Variation of the Acceptor–Anticodon Interstem Angles Among Mitochondrial and Non-mitochondrial tRNAs

doi:10.1016/j.jmb.2004.07.087

J. Mol. Biol. (2004) 343, 313–325

Variation of the Acceptor–Anticodon Interstem Angles Among Mitochondrial and Non-mitochondrial tRNAs Ashley A. Frazer-Abel1 and Paul J. Hagerman2* 1

Center for Cancer Causation and Prevention AMC Cancer Research Center, Denver CO 802014, USA 2 Hagerman Laboratory Department of Biochemistry and Molecular Medicine University of California, Davis School of Medicine, Davis CA 95616, USA

A cloverleaf secondary structure and the concomitant “L”-shaped tertiary conformation are considered the paradigm for tRNA structure, since there appears to be very little deviation from either secondary or tertiary structural forms among the more than one dozen canonical (cloverleaf) tRNAs that have yielded to crystallographic structure determination. However, many metazoan mitochondrial tRNAs deviate markedly from the canonical secondary structure, and are often highly truncated (i.e. missing either a dihydrouridine or a TJC arm). These departures from the secondary cloverleaf form call into question the universality of the tertiary (L-shaped) conformation, suggesting that other structural constraints may be at play for the truncated tRNAs. To examine this issue, a set of 11 tRNAs, comprising mitochondrial and non-mitochondrial, and canonical and noncanonical species, has been examined in solution using the method of transient electric birefringence. Apparent interstem angles have been determined for each member of the set, represented as transcripts in which the anticodon and acceptor stems have each been extended by w70 bp of duplex RNA helix. The measurements demonstrate much more variation in global structure than had been supposed on the basis of crystallographic analysis of canonical tRNAs. In particular, the apparent acceptor–anticodon interstem angles are more obtuse for the metazoan mitochondrial tRNAs that are truncated (missing either a dihydrouridine or a TJC arm) than for the canonical (cloverleaf) tRNAs. Furthermore, the magnesium dependence of this interstem angle differs for the set of truncated tRNAs compared to the canonical species. q 2004 Elsevier Ltd. All rights reserved.

*Corresponding author

Keywords: RNA structure; translation; phylogeny; birefringence; evolution

Introduction The crystallization and refinement of the Saccharomyces cerevisiae cytoplasmic tRNAPhe structure1–3 revealed a tertiary structure of the canonical tRNA in which the acceptor-TJC (T)-stem domain is Abbreviations used: DhU (or D), dihydrouridine (conserved stem/loop of canonical tRNAs); TJC (or T), ribothymidine-pseudouridine-cytidine (conserved stem– loop of canonical tRNAs); EF-TU, elongation factor-Tu; TEB, transient electric birefringence; mtRNA, mitochondrial tRNA; ctRNA, cytoplasmic tRNA; sctRNAPhe, S. cerevisiae ctRNAPhe; hctRNALys, Homo sapiens ctRNALys; bmtRNASer(AGY), B. taurus mtRNASer(AGY); hmtRNALys, Homo sapiens mtRNALys(AAA); mrel, relative mobility; thtx, decay time of heteroduplex extended tRNA construct; tdplx, decay time of linear duplex. E-mail address of the corresponding author: [email protected]

arranged at nearly a right-angle (w808) with respect to the anticodon-dihydrouridine (DhU,D)-stem domain. The subsequent crystallization of 17 other canonical tRNAs, free or complexed with their cognate synthetases, has revealed only minimal variations from the global “L” shaped tertiary structure.4–14 An exception to the “L” paradigm has been noted for a metazoan mitochondrial tRNA (mtRNA);15 however, it is unclear whether this exception is an isolated instance, or whether departures from the L paradigm are more widespread among the non-canonical tRNAs (e.g. tRNAs lacking conserved T or D arms; truncated tRNAs).16 Non-canonical tRNAs include the family of serine mitochondrial tRNAs, which recognize the AGY codon, all having an abbreviated D arm. Moreover, the majority of mitochondrial tRNAs of Caenorhabditis elegans and Ascaris suum have an abbreviated T-arm.17,18 Even among these groups,

0022-2836/$ - see front matter q 2004 Elsevier Ltd. All rights reserved.

314 the sizes of replacement loops or short (1–3 bp) stems are highly variable. Thus, these variant classes of tRNAs present an excellent opportunity for assessing the extent to which non-canonical secondary structures give rise to variations in global tertiary structure. A governing principle for the global conformations of both canonical and noncanonical tRNAs has been proposed by Steinberg & Cedergren.19 Those authors argued that the distance between the 3 0 end and anticodon loop (primary axis length) must be preserved among all tRNAs for a given organism; this structural constraint reflects the need to span a fixed distance between the peptidyl transfer center and the codon. The smaller, truncated tRNAs would necessarily be more open (larger interstem angle) to maintain the same primary axis length. To assess the variability of the interstem angle among both canonical and non-canonical tRNAs, we determined the apparent angle between the anticodon and acceptor stems of six metazoan mitochondrial tRNAs, one metazoan cytoplasmic tRNA, one pre-metazoan mitochondrial tRNA, one pre-metazoan cytoplasmic tRNA, and two eubacterial tRNAs. Utilizing the technique of transient electric birefringence (TEB), we quantified the interstem angles, both in the presence and absence of magnesium ions, for this set of 11 tRNAs, five of which are highly truncated. The TEB approach has been used successfully in a number of investigations,20–22 including investigations of tRNA structure, that have proven to be quantitatively consistent with corresponding crystal structures.15,23–25 We note that the angles are apparent, in that they undoubtedly reflect varying contributions from added interstem

Interstem Angles of tRNAs

flexibility, with the net effect of fixed and dynamic components incorporated into the measured angle. Here, the central result is that the tRNAs demonstrate a much broader range of interstem angles than is appreciated from crystallographic studies of the canonical tRNAs alone. All of the metazoan mitochondrial tRNAs used in the current investigation have more open anticodon–acceptor interstem angles than their canonical counterparts. Furthermore, the mtRNAs demonstrate very little structural dependence on magnesium; in marked contrast to the profound reduction in interstem angle found for S. cerevisiae cytoplasmic tRNAPhe (ctRNAPhe).

Results Formation of extended tRNA constructs Here, the method used to construct the extended tRNAs is essentially identical with the approach used by our lab for studies of two canonical tRNAs, S. cerevisiae ctRNAPhe and human cytoplasmic tRNA Lys (AAA),23,25,26 and two non-canonical mitochondrial tRNAs, Bos taurus mitochondrial tRNA Ser (AGY) and human mitochondrial tRNALys.15,26 In brief, core sequence elements for the tRNA of interest are placed at the center of an otherwise duplex RNA molecule, with the anticodon and acceptor stems each extended by approximately 70 bp of duplex helix (Figure 1). Fully duplex (reference) RNA molecules are also constructed with the same duplex arms, differing from the tRNA heteroduplex molecules only by the

Figure 1. Representation of the extended tRNA species used here, using bovine mitochondrial (m) tRNASer(AGY) (left) as an example. The tRNA and core sequence elements are depicted in black; helix extensions (w70 bp) are indicated in gray (center, right). For each extended tRNA construct, pairs of expression plasmids are transcribed to yield the two single-stranded RNA species (center). These single-stranded RNAs are annealed and purified to yield the extended heteroduplex (right).

Interstem Angles of tRNAs

315

Figure 2. Proposed secondary structure of the tRNAs examined here.16 The broken lines indicate helix extensions. (R), tRNAs sequenced at the RNA level, with the number of post-transcriptional modifications indicated in square brackets. The specific residues modified are boxed (see the work done by Sprinzl et al.16 for modification type). The extended constructs are unmodified.

presence of a central duplex segment corresponding to the span of the tRNA core.15,23 The core tRNA sequences used here are depicted in Figure 2; the oligonucleotides, used for cloning to create these core elements, and the duplex controls are presented in Table 1A–C. Electrophoretic mobility analysis reveals that the apparent anticodon–acceptor angles vary among the extended tRNA species, as do their responses to magnesium ions Relative mobility (mrel) measurements afford a sensitive, albeit qualitative, comparison of

interstem angles for the various extended tRNA constructs. Constructs with more acute angles between the anticodon and acceptor arms will have reduced mobilities in the polyacrylamide matrix.20,22,23,25 Since the absolute mobilities for each of the extended tRNA constructs will depend on the overall contour length of the heteroduplex as well as the interstem angle per se, the electrophoretic mobility of each extended tRNA species is first divided by the mobility of the equivalent length, full-duplex (linear) control RNA to yield the mrel values in Table 2. The approach for determining the lengths of the equivalent duplex species is described in Materials and Methods, and is the

316

Interstem Angles of tRNAs

Table 1. Sequences of oligonucleotides used for the plasmids and to create controls tRNA species Plasmid designationsa

Oligomer sequencesb

A. Sequences used for cytoplasmic and prokaryotic tRNA expression plasmid Escherichia coli ctRNASer(AGN) pDecAGN (D half) 5 0 -AGCT GGTGAGGTGGCCGAGAGGCTGAAGGCGCTCCCc CCACTCCACCGGCTCTCCGACTTCCGCGAGGG TCGA-5 0 pTecAGN (T half) 5 0 -AGCT GGGAGTATGCGGTCAAAAGCTGCATCCGGGGTTCGAATCCCCGCCTCACC CCCTCATACGCCAGTTTTCGACGTAGGCCCCAAGCTTAGGGGCGGAGTGG TCGA-5 0 Ser Mycoplasma capricolum ctRNA (AGN) pDmcAGN (D half) 5 0 -AGCT GGGTTAATACTCAAGTTGGTGAAGAGGACACC CCCAATTATGAGTTCAACCACTTCTCCTGTGG TCGA-5 0 pTmcAGN (T half) 5 0 -AGCT GGTGTTAGGTCGGTCTCCGGCGCGAGGGTTCGAGTCCCTCTTAACCC CCACAATCCAGCCAGAGGCCGCGCTCCCAAGCTCAGGGAGAATTGGG TCGA-5 0 Phe d Saccharomyces cerevisiae ctRNA pGJ122A9 (D half) 5 0 -AGCTGGT GCGGATTTAGCTCAGTTGGGAGAGCGCCAGA GCT CCA CGCCTAAATCGAGTCAACCCTCTCGCGGTCT CGATCGA-5 0 pGJ122B10 (T half) 5 0 -AGCTAGC TCTGGAGGTCCTGTGTTCGATCCACAGAATTCGC ACC TCG AGACCTCCAGGACACAAGCTAGGTGTCTTAAGCG TGGTCGA-5 0 Ser Bos taurus ctRNA (UCN) pDbcUCN (D half) 5 0 -AGCT GCAGCGATGGCCGAGTGGTTAAGGCGTTGG CGTCGCTACCGGCTCACCAATTCCGCAACC TCGA-5 0 pTbcUCN (T half) 5 0 -AGCT CCAATGGGGTCTCCCCGCGCAGGTTCGAACCCTGCTCGCTGC GGTTACCCCAGAGGGGCGCGTCCAAGCTTGGGACGAGCGACG TCGA-5 0 B. Sequences used for the mitochondrial tRNA expression plasmids S. cerevisiae mtRNASer(AGY) pDsmAGY (D half) 5 0 -AGCT GGAAAATTAACTATAGGTAAAGTGGATTATc CCTTTTAATTGATATCCATTTCACCTAATA TCGA-5 0 pTsmAGY (T half) 5 0 -AGCT GTAATTGAATTGTAAATTCTTATGAGTTCGAATCTCATATTTTCC CATTAACTTAACATTTAAGAATACTCAAGCTTAGAGTATAAAAGG TCGA-5 0 B. taurus mtRNASer(UCN) pDbmUCN (D half) 5 0 -AGCT GAGAGAGACATAGAGGTTATGATGTTGG CTCTCTCTGTATCTCCAATACTACAACC TCGA-5 0 pTbmUCN (T half) 5 0 -AGCT CCAATAGTAGGGGGTTCGATTCCTTCCTTTCTT GGTTATCATCCCCCAAGCTAAGGAAGGAAAGAA TCGA-5 0 B. taurus mtRNASer(AGY)e pDbmAGY (D half) 5 0 -AGCTGGC GAAAAAGTATGCAAG CCG CTTTTTCATACGTTC TCGA-5 0 pTbmAGY (T half) 5 0 -AGCT CTATGCTCCCATATCTAATAGTATGGCTTTTTC GCC GATACGCGGGTATAGATTATCATACCGAAAAAG CGGTCGA-5 0 Fasciola hepatica mtRNASer(AGY) pDfmAGY (D half) 5 0 -AGCT GAGGATTGTTAGGTTGTCG CTCCTAACAATCCAACAGC TCGA-5 0 pTfmAGY (T half) 5 0 -AGCT CGATGATTTGGGCTTTGGTTGCTCGGTTCTC GCTACTAAACCCGAAACCAACGAGCCAAGAG TCGA-5 0 Ascaris suum mtRNASer(AGY) pDamAGY (D half) 5 0 -AGCT GACAAATGTTTTCAGGT GCT CTGTTTACAAAAGTCCA CGATCGA-5 0 pTamAGY (T half) 5 0 -AGCTAGC ATCTGTTTTGGAGAAATCCGTTTGTT TCG TAGACAAAACCTCTTTAGGCAAACAA TCGA-5 0 Ser Caenorhabditis elegans mtRNA (AGY) pDcmAGY (D half) 5 0 -AGCT AACGAGTTCATAAAGCAAGT TTGCTCAAGTATTTCGTTCA TCGA-5 0 pTcmAGY (T half) 5 0 -AGCT ATTTGTTCTAGGTTAAATCCTGCTCGTT TAAACAAGATCCAATTTAGGACGAGCAA TCGA-5 0 Phe C. elegans mtRNA pDcmPhe (D half) 5 0 -AGCT CTCTTTTAGTTTATAATTAAAATATGGCC GCT GAGAAAATCAAATATTAATTTTATACCGG CGATCGA-5 0 pTcmPhe (T half) 5 0 -AGCTAGC GGCTAAGAATATTAGGAG TCG CCGATTCTTATAATCCTC TCGA-5 0 C. Sequences used to create linear (duplex) controlsf 158 bp linear pDL158 pTL158

5 0 -AGCT GGCGAAAAAGTATGCAAG CCGCTTTTTCATACGTTCTCGA-5 0

317

Interstem Angles of tRNAs

Table 1 (continued) tRNA species Plasmid designationsa 170 bp linear pDL170 pTL170 174 bp linearg pGJ122A38C pGJ122B38K 182 bp linear pDL182 pTL182

Oligomer sequencesb 5 0 -AGCT AGCGCGCTAGCTCTTGCATACTTTTTCGCC TCGCGCGATCGAGAACGTATGAAAAAGCGGTCGA-5 0 5 0 -AGCT GGTGCGGATAGTCTGCAGCATCATGACCAGAGCT CCACGCCTATCAGACGTCGTAGTACTGGTCTCGATCGA-5 0 5 0 -AGCT AGCTAGCAGCTGAGCGCGCTAGCTCTTGCATACTTTTTCGCC TCGATCGTCGACTCGCGCGATCGAGAACGTATGAAAAAGCGGTCGA-5 0

a

Plasmid naming convention: p, plasmid; (D or T), dhU or TyC; n, first letter of parent species; (c or m), cytoplasmic or mitochondrial; (AGN, AGY or UCN), codon designation (YZU or C; N, any nucleotide). b Oligonucleotides used to create each species by annealing and insertion into the HindIII site of plasmids pGJ122A or pGJ122B. c Roman text corresponds to the sequence of the tRNA core. Italics indicate the nucleotides associated with the helix extensions. d Sequences and plasmid designations from the work done by Friederich et al.23 e Sequence from the work done by Frazer-Abel & Hagerman.15 f Pairs of plasmids are created with the same insert, with opposite orientations in the two plasmids. g See the work done by Friederich et al.23

same for both electrophoresis and birefringence decay experiments. The electrophoretic mobility data (Table 2; Figure 3) demonstrate that the tRNA species represented in Figure 2 possess a range of relative mobilities, reflective of a range of apparent interstem angles. These data do not allow one to distinguish between fixed-angle bends and regions of increased torsional and/or lateral flexibility. Nevertheless, it is clear that the nearly perpendicular interstem angle of the S. cerevisiae ctRNAPhe is not universal. Moreover, it is clear from the data in Table 2, and in Figure 3, that there is a range of responses of the relative mobilities to the presence of Mg2C. In particular, as discussed,25 S. cerevisiae ctRNAPhe experiences a dramatic reduction in mobility upon the introduction of magnesium, other extended tRNAs demonTable 2. Relative electrophoretic mobilities of the mitochondrial and non-mitochondrial tRNA constructs Relative mobility (mrel)a,b tRNA speciesc Ser

E. coli ctRNA (AGN) M. capricolum ctRNASer(AGN) S. cerevisiae ctRNAPhe S. cerevisiae mtRNASer(AGY) B. taurus ctRNASer(UCN) B. taurus mtRNASer(UCN) B. taurus mtRNASer(AGY) F. hepatica mtRNASer(AGY) A. suum mtRNASer(AGY) C. elegans mtRNASer(AGY) C. elegans mtRNAPhe

No magnesium d

0.70G0.01 0.83G0.01 0.88G0.01 0.75G0.01 0.75G0.02 0.78G0.01 0.71G0.01 0.78G0.01 0.84G0.01 0.71G0.02 0.89G0.02

2 mM MgCl2 0.57G0.01 0.59G0.01 0.49G0.01 0.52G0.01 0.62G0.01 0.62G0.01 0.70G0.01 0.70G0.01 0.80G0.01 0.80G0.02 0.86G0.01

a Gel running conditions are described in Materials and Methods. b mrel is the ratio of the absolute mobility of the tRNA construct to the mobility of the appropriate linear control. c c, cytoplasmic; m, mitochondrial. d Data represent the average and standard error of three electrophoretic measurements performed with two independent RNA preparations. Standard errors %0.01 are reported as 0.01.

strate smaller changes in relative mobility, some even shifting in the opposite direction (from S. cerevisiae ctRNAPhe) for the differential effect of Mg2C. When mrel in the absence of magnesium is plotted versus the mrel in the presence of magnesium no overall correlation is seen, suggesting that the observed shifts depend on specific core-Mg2C associations, not a general polyelectrolyte effect (Figure 4) Birefringence measurements provide further evidence for a broad range of anticodon– acceptor interstem angles Representative birefringence decay curves for two extended tRNA species are presented in Figure 5(a) and (b), along with the plots of the decay times for the linear controls (Figure 5(c)). The birefringence decay times and relative amplitudes for all tRNAs examined are presented in Table 3 (absence of Mg2C) and Table 4 (presence of Mg2C). Values for the apparent interstem angles (Table 5) were obtained from the data in Tables 3 and 4 by use of the t-ratio method.15,23,27 The t-ratio is defined as the ratio of the terminal decay time of the heteroduplex (extended) tRNA construct (thtx) to the terminal decay time of a linear duplex, (tdplx), of the same contour length. t-ratios are quite insensitive to the uncertainties in the default values for the helix ˚ ), hydrodynamic radius (13 A ˚ ), and rise (2.8 A ˚ persistence length (700 A), since such uncertainties are largely canceled through the use of linear control helices of the same sequence as the arms of the extended heteroduplex species.27 However, the t-ratio approach requires knowledge of the contour length of the heteroduplex molecule being tested. The contour length for each control (duplex) RNA species is chosen to have the same contour length as the heteroduplex (extended) tRNA molecule, as described in Materials and Methods. This

318

Interstem Angles of tRNAs

approach is discussed in the work done by FrazerAbel & Hagerman.15 The need to estimate the contour length of the tRNAs introduces additional uncertainty to the angle measurements (see Discussion); we estimate that this uncertainty would be no more than 2–4 bp for the current constructs, which would introduce a corresponding uncertainty (over the experimental error) of w4–88 in the apparent interstem angle.27 As indicated in Tables 3 and 4, four linear (duplex) control RNAs were utilized for the purpose of obtaining the tdplx values by interpolation (Figure 5(c)), using the relationship yZaxb, where y is the slow decay time, x is the contour length (in bp), b is held between 2.3 and 2.7, and a is a variable determined by the data. For discussion of this interpolation function, see the work done by Hagerman & Zimm.28

Discussion The anticodon–acceptor interstem angle is not universally conserved among tRNA molecules

Figure 3. Analysis of relative electrophoretic mobilities of the extended tRNA constructs. (a) No magnesium; (b) 2 mM free Mg2C. Lane designations: (1) 158 bp linear; (2) S. cerevisiae ctRNAPhe ; (3) E. coli ctRNASer(AGN); (4) M. capricolum ctRNASer (AGN); (5) S. cerevisiae mtRNA Ser (AGY); (6) B. taurus ctRNASer(UCN); (7) B. taurus mtRNASer(UCN); (8) B. taurus mtRNASer(AGY); (AGY); (9) F. hepatica mtRNASer(AGY); (10) A. suum mtRNASer(AGY); (11) C. elegans mtRNASer(AGY); (12) C. elegans mtRNAPhe; (13) 174 bp linear. Gels were 8% (w/v) acrylamide (monomer to bis-acrylamide, 29 : 1, w/w) with 10 mM NaPi (pH 7.2), 1 mM EDTA as the running buffer.

Figure 4. Relative mobilities (mrel) for each sample plotted for 2 mM Mg2C (ordinate) versus no magnesium (abscissa). A linear regression (continuous line) indicates a lack of significant correlation between the two data sets.

Here, we extend our earlier measurements of the B. taurus mtRNASer(AGY),15 to a larger class of metazoan and pre-metazoan tRNAs. In the presence of divalent (Mg2C) cations, we observe a nearly twofold (w658) range of apparent interstem angles (Table 5), with the canonical (S. cerevisiae) cytoplasmic tRNAPhe having by far the most acute interstem angle. For the limited set of tRNAs examined here (Figure 2), the t-ratio data suggest that the non-canonical tRNAs tend to have larger (non-paired t-test, pZ0.018; Table 5, 2 mM Mg2C), and perhaps more flexible, interstem angles than do their more canonical (non-truncated) counterparts under magnesium conditions approximating those in mitochondria.29–31 In this regard, in the presence of magnesium, there is a complete partitioning of the relative (gel) mobility data (Figure 3(b)) between non-truncated (lanes 2–7) versus truncated (lanes 8– 12) tRNA cores (pZ0.0004). The correlation between the t-ratio and mobility data (Figure 7) suggests that additional surveys may be accomplished using the gel-based methods. Interpretation of the data in the absence of magnesium is more problematic, since the core interactions may not be fully native in the absence of divalent cations.25 Studies of the flexibility of S. cerevisiae ctRNAPhe 24 revealed that this tRNA possesses no more flexibility about its central bend than a standard RNA helix of the same axial contour length. Despite the presence of non-helical elements within the core of this canonical tRNA, there are sufficient intramolecular and RNA–magnesium interactions to impart substantial rigidity. For the truncated mtRNAs, however, the potential for such stabilizing interactions is substantially reduced. In particular, the four metazoan mitochondrial members of the Ser(AGY) family are all missing the entire D arm, possessing only replacement loops of

319

Interstem Angles of tRNAs

Figure 5. Representative birefringence decay curves for two of the species tested: (a) canonical S. cerevisiae ctRNAPhe (C) and the 174 bp linear (duplex) RNA control (B), in the presence of 2 mM magnesium ions. (b) Non-canonical C. elegans mtRNAPhe , measurements were performed in the absence of magnesium (B) and in the presence of 2 mM Mg2C (C). (c) Plots of the slow decay times (ms) of the linear duplex controls; each data set was fit to the function, where y is slow decay time, x is contour length (see Table 5) and b is held between 2.3 and 2.7.

varying sizes. The C. elegans mtRNAPhe is almost a mirror reflection, having a D arm, but not a T arm. Thus, the interactions between the D and T arms,1–3 thought to be highly stabilizing in the canonical tRNAs, are not possible in the truncated tRNAs. Absence of these important tertiary interactions is likely to permit much greater conformational freedom to the tRNA core for the truncated tRNAs. Although increased interstem flexibility may well contribute to the apparent angles measured by TEB, it would not alter the central conclusion of this work; namely, that there is a broad range of interstem angles among tRNAs. TEB measurements yield an apparent (or mean) angle of the ensemble

of tRNA molecules. For obtuse angle measurements in the range of the current study, a more flexible bend would bias the apparent angle toward 908.27 This bias is due to the greater configurational space (sector volume) as angles approach 908. For a more complete discussion of this phenomena see the work done by Vacano & Hagerman.27 Although the current solution measurements do not permit us to draw any detailed structural conclusions, they do allow us to address the previous model described by Steinberg & Cedergren.19 Those investigators had predicted that the truncated tRNAs would not conform to a universal L-shaped structure, but would have a more open interstem

Table 3. Birefringence decay times and fractional amplitudes for the extended tRNA species and linear controls in the absence of magnesium E[tRNA] Ser

E. coli ctRNA (AGN) M. capricolum ctRNASer(AGN) S. cerevisiae ctRNAPhe S. cerevisiae mtRNASer(AGY) B. taurus ctRNASer(UCN) B. taurus mtRNASer(UCN) B. taurus mtRNASer(AGY)a F. hepatica mtRNASer(AGY) A. suum mtRNASer(AGY) C. elegans mtRNASer(AGY) C. elegans mtRNAPhe 158 bp linear 170 bp linear 174 bp linear 182 bp linear

Fraction fast decay

Fast decay time (ms)

Fraction slow decay

Slow decay time (ms)

0.67G0.02 0.63G0.01 0.60G0.01 0.70G0.01 0.74G0.01 0.68G0.03 0.67G0.01 0.59G0.02 0.57G0.01 0.50G0.03 0.75G0.01 0.16G0.03 0.18G0.01 0.12G0.01 0.22G0.01

0.60G0.01 0.58G0.01 0.60G0.01 0.60G0.02 0.58G0.02 0.51G0.05 0.49G0.01 0.49G0.01 0.47G0.01 0.43G0.02 0.52G0.01 0.25G0.01 0.32G0.02 0.25G0.02 0.39G0.02

0.31G0.01 0.40G0.01 0.38G0.01 0.29G0.01 0.25G0.01 0.31G0.03 0.32G0.01 0.40G0.02 0.42G0.01 0.49G0.03 0.24G0.01 0.82G0.04 0.81G0.01 0.87G0.01 0.76G0.01

2.48G0.04 2.73G0.04 3.14G0.04 2.64G0.05 2.28G0.10 2.39G0.08 2.10G0.02 2.28G0.04 2.41G0.04 2.48G0.04 2.13G0.02 2.86G0.05 3.33G0.03 3.57G0.07 3.95G0.03

Birefringence measurements were performed as described in Materials and Methods. Each value represents the average and standard error for at least ten TEB measurements on two independent RNA preparations. All standard errors %0.01 are reported as 0.01. a Data from the work done by Frazer-Abel & Hagerman.15

320

Interstem Angles of tRNAs

Table 4. Birefringence decay times and fractional amplitudes for the extended tRNA species and linear controls in the presence of MgCl2 E[tRNA] Ser

E. coli ctRNA (AGN) M. capricolum ctRNASer(AGN) S. cerevisiae ctRNAPhe S. cerevisiae mtRNASer(AGY) B. taurus ctRNASer(UCN) B. taurus mtRNASer(UCN) B. taurus mtRNASer(AGY)a F. hepatica mtRNASer(AGY) A. suum mtRNASer(AGY) C. elegans mtRNASer(AGY) C. elegans mtRNAPhe 158 bp linear 170 bp linear 174 bp linear 182 bp linear

Fraction fast decay

Fast decay time (ms)

Fraction slow decay

Slow decay time (ms)

0.68G0.01 0.75G0.05 0.73G0.02 0.82G0.04 0.77G0.02 0.75G0.02 0.51G0.01 0.78G0.01 0.68G0.02 0.55G0.02 0.57G0.01 0.16G0.03 0.13G0.01 0.10G0.01 0.20G0.01

0.47G0.01 0.47G0.02 0.54G0.01 0.48G0.02 0.46G0.02 0.47G0.01 0.44G0.01 0.52G0.01 0.50G0.01 0.41G0.01 0.46G0.01 0.29G0.06 0.28G0.02 0.25G0.02 0.37G0.01

0.29G0.01 0.23G0.06 0.27G0.02 0.16G0.05 0.21G0.02 0.23G0.02 0.48G0.01 0.20G0.01 0.31G0.02 0.44G0.02 0.42G0.01 0.82G0.04 0.86G0.01 0.91G0.03 0.79G0.01

2.26G0.05 1.91G0.11 1.33G0.04 1.85G0.11 2.02G0.05 2.00G0.05 1.97G0.01 2.26G0.04 2.21G0.04 2.03G0.08 2.32G0.04 2.69G0.08 2.87G0.03 3.14G0.08 3.51G0.03

Birefringence measurements were performed as described in Materials and Methods. Each value represents the average and standard error for at least ten TEB measurements on two independent RNA preparations. All standard errors %0.01 are reported as 0.01. a Data from work done by Frazer-Abel & Hagerman.15

angle. They argued that the critical variable for tRNA function is not the angle between the anticodon and acceptor stems, per se; rather, it is the distance between the anticodon and the 3 0 end of the tRNA, termed the primary axis length. In effect, this distance reflects the separation between the codon and the peptidyl transfer center, which must be spanned by both canonical and (smaller) truncated tRNAs. The current results are consistent with the primary axis length model. Structural modulation by magnesium presents a clear distinction between the metazoan and nonmetazoan tRNAs Here, another striking observation is the varied influence of magnesium on the interstem angles of the truncated and non-truncated tRNAs. It is evident from both crystallographic1–3 and more recent solution studies23,25 that magnesium ions play a critical role in defining the tertiary structure

of S. cerevisiae ctRNAPhe and, in particular, its interstem angle. As discussed in the work done by Friederich & Hagerman25 for the canonical S. cerevisiae ctRNA Phe , the presence of magnesium decreases the interstem angle by w808, from an apparent angle of 1548 without magnesium to w758 with magnesium present.24,25 As shown in Figure 6, both the Mycoplasma capricolum cytoplasmic tRNA and S. cerevisiae mitochondrial tRNA exhibit reductions (albeit of smaller magnitude) in interstem angle upon addition of magnesium, consistent with magnesium playing important structural roles for these non-metazoan tRNAs. However, magnesium appears to play a much smaller role in the structure of the truncated mtRNAs. These tRNAs exhibit either no appreciable change in interstem angle, or even small increases in interstem angle upon introduction of magnesium ions. It is interesting to speculate that magnesium ions might be used to alter the interstem angle during the translation cycle.32

Table 5. Acceptor–anticodon interstem angles for extended mtRNA constructs Apparent interstem angle (deg.)a Extended tRNA species E. coli ctRNASer(AGN) M. capricolum ctRNASer(AGN) S. cerevisiae ctRNAPhe c S. cerevisiae mtRNASer(AGY) B. taurus ctRNASer(UCN) B. taurus mtRNASer(UCN) B. taurus mtRNASer(AGY)d F. hepatica mtRNASer(AGY) A. suum mtRNASer(AGY) C. elegans mtRNASer(AGY) C. elegans mtRNAPhe

No magnesium

2 mm MgCl2

bp equivb

119G1 129G1 154G3 125G3 112G3 118G3 110G5 120G2 128G2 114G2 128G1

124G2 109G5 75G4 107G7 115G6 116G10 120G5 139G8 138G9 125G4 140G3

169 169 174 168 168 167 163 162 161 162 163

a The designation “apparent” reflects possible contributions from any added flexibility of the tRNA cores.24,27 Standard errors reflect only measurement error. Angle between the anticodon and acceptor stems for the extended tRNA species. b The estimated contour length, in base-pair equivalents (bp equiv), of the tRNA constructs; the tRNA core element (Figure 2) plus the w70 bp helix extensions. c Data from the work done by Friederich et al.23 d Data from the work done by Frazer-Abel & Hagerman.15

Interstem Angles of tRNAs

321

Figure 6. Change in the angle between the anticodon and acceptor stems of the tRNA species upon the addition of 2 mM MgCl2 (Dq8hq(Mg)Kq(no Mg)). c, Cytoplasmic tRNA; m, mitochondrial tRNA.

Potential caveats Absence of post-transcriptional modifications There are several potential limitations of the current investigation. First, our studies utilized bacteriophage T7 transcripts for all of the TEB and

Figure 7. Correlation between interstem angles (q8) determined by TEB and relative electrophoretic mobilities (mrel) for the tRNA constructs. (,) 2 mM MgCl2; (C) no magnesium. Continuous line, linear regression, presence of 2 mM MgCl2; broken line, linear regression, absence of magnesium.

gel mobility measurements. Therefore, the extended tRNAs did not possess any post-transcriptional modifications. Although such modifications have been shown to be important for specificity in protein interactions,33,34 to affect thermostability,35,36 and in recent work to be necessary to preclude abnormal structure formation of at least one mtRNA,37 we have reason to believe that this does not present a substantial shortcoming here. Studies on S. cerevisiae ctRNAPhe, which of all of the tRNAs presented here has the largest number of modifications in the native tRNA, demonstrated remarkable consistency between the crystal structures of the fully modified tRNA and the TEB measurements of the in vitro transcript.1–3,23 Moreover, a number of studies have found the unmodified transcripts structurally consistent with the fully modified in vivo isolates,38–44 although Helm et al.45 did note a structural transition controlled by an m 1A9 modification at the base of the acceptor stem of human mtRNALys. Finally, in their analysis of the crystal structures of glutaminyl-tRNA synthetase complexed with either the native (modified) or unmodified forms of tRNA(Gln), Arnez & Stietz44 observed no differences in the electron density maps for the modified and unmodified tRNAs, except for some small, local shifts due to the absence of the modifications. Those authors suggested that the absence of pseudouridine may alter tRNA stability (although not conformation), a suggestion that has also been made by Hall and coworkers for ctRNAPhe. In addition, examination of the type and location of post-translational modifications in the metazoan

322

Interstem Angles of tRNAs

mitochondrial tRNAs used here suggests that the absence of these modifications would not cause systematic alterations in structures measured. The modification patterns are known for three of the metazoan mitochondrial tRNA tested, two highly abbreviated tRNAs, and an additional canonical tRNA (Figure 2). Of the highly abbreviated tRNAs, the B. taurus tRNASer(AGY) has only a single modification outside of the anticodon loop, a m5C at position 35. This modification was detected in only 0.43 molar ratio in tRNA isolated from bovine liver,46 and was not detected in heart mitochondria, indicating that the functionality and presumed structural integrity of this tRNA is not dependent on this post-translational modification.47 Another abbreviated tRNA that has been sequenced at the RNA level is the A. suum mtRNASer(AGY). The modifications of this tRNA consist exclusively of pseudouridine, and are therefore not expected to have a major impact on tertiary structure. The final mtRNA, the more canonical B. taurus mtRNASer (UCN), possess six modifications outside the anticodon loop: the dihydrouridine in the D arm, three pseudouridine residues in the acceptor stem, and a pseudouridine and a m1A in the T loop. The m1A in the T loop is the only one of these modifications that could be expected to have the potential to impact tertiary structure.

range of the angles measured here. The most acute bend measured was for S. cerevisiae ctRNAPhe with an interstem angle of w808, which is also the tRNA with most additional verification. The angle for this tRNA, measured by TEB,23 is in close agreement with the measurements for the crystal structure tRNAPhe.1–3 Furthermore, TEB measurements of a tmRNA49 are also in close agreement with the crystal structure determined for the same species.50

Estimation of contour length

Preparation of expression plasmids

A second potential limitation here involves the necessity of estimating the (axial) contour length of the extended tRNA species. Errors associated with this approach are discussed at length in the work done by Vacano & Hagerman,27 and in the work done by Hagerman & Hagerman.48 Here, we estimate that the overall uncertainty associated with our contour length estimates will not exceed 2–4 bp equivalents. As discussed in the work done by Vacano & Hagerman,27 such an uncertainty in the length of a central non-helical element introduces only a modest error in the interstem angle measurement. Over the entire length of the construct, in the range of R160 bp, an uncertainty of 2– 4 bp in the contour length results in only 4–88 uncertainty in the interstem angle. With a w608 difference between the interstem angle measurements of the canonical and non-canonical tRNA, a 4–88 uncertainty does not change the fundamental conclusion that the L-shaped tertiary structure is not universal, and that mtRNAs tend to possess larger angles between their anticodon and acceptor arms than do their canonical counterparts.

Plasmids were constructed essentially as described.15,23 Synthetic oligonucleotides were designed to correspond to the 5 0 (dihyrouridine, “D”) and 3 0 (TJC, “T”) halves of the tRNAs, or to fully duplex linear controls, as delineated in Figure 2 and Table 1C. tRNA sequences used here are as represented by Sprinzl et al.;16 in each instance, the tRNA core elements are terminated at the ends of the anticodon and acceptor stems, as indicated in Figure 1 and its legend. The stem sequences were then modified by inclusion of HindIII overhangs to facilitate cloning. These overhangs became part of the helix extensions of the stems. Duplex DNA sequences used to construct expression vectors are presented in Table 1A and B. When tRNA sequence information was available at the RNA level, the following replacements were made at the DNA (template) level: J to T, dhU to T, m1A to A, m5A to A, (for definition of modifications see the work done by Sprinzl et al.16). The complementary oligonucleotides (Table 1A–C) cloned into parent plasmids pGJ122A for the 5 0 halves, and pGJ122B for the 3 0 halves. The parent plasmids are described in detail elsewhere.23 Plasmids pGJ122A,B were constructed to provide complementary template sequences for the w70 bp duplex extensions to the anticodon and acceptor stems of the tRNA cores. Plasmid DNA was linearized with SmaI at a site at the 3 0 end of the template extension.

Influence of the helix extensions

RNA production and purification

Finally, it might be argued that the helical extensions themselves would present a limitation here. That is, that the extended RNA helix would alter the interstem angles. However, there is substantial data to support the contention that the extensions do not alter the angle, particularly in the

Transcription reactions were performed essentially as described.15 One milliliter reactions contained 180 mg of linearized plasmid, bacteriophage T7 RNA polymerase (2–6 mg/ml prepared as described51), and 4 mM each rNTP, all in 40 mM Tris–HCl (pH 8.1), 2 mM spermine– HCl, 1 mM DTT, 0.01% (w/v) Triton X-100, and 20 mM

Conclusions Here, we present the first measurement of global structure for a group of metazoan mitochondrial tRNAs. The unusual secondary structure of the mtRNAs presents a unique opportunity to examine the interplay of secondary and tertiary structure in these molecules. Our results establish that the L-shaped structure found in many of the canonical tRNAs is not universally conserved; and that other factors, such as the distance between the 3 0 end of the acceptor stem and the anticodon loop (the primary axis length)19 may be an important guiding principle of tRNA global conformation.

Materials and Methods

323

Interstem Angles of tRNAs

MgCl2. Once transcribed and annealed, the extended tRNAs were run on 6% (w/v) polyacrylamide gels (acrylamide to N,N 0 -methylene-bisacrylamide 29 : 1, w/ w; TBE buffer: 45 mM Tris base, 0.1 M boric acid, and 1 mM Na2EDTA). Bands were cut from the gel, triturated using fine-mesh screen, and eluted overnight at 4 8C in buffer containing 0.5 M sodium acetate, 10 mM EDTA, and 50 mM Tris (pH 8.1). Gel slurry was subsequently removed by passage through glass-fiber filters and the RNA precipitated with isopropanol. Electrophoretic mobility analysis Analysis of the relative electrophoretic mobilities was performed as described.15,23 For the current studies, analytical 8% (w/v) polyacrylamide gels (acrylamide to N,N 0 -methylene-bisacrylamide, 29 : 1, w/w ) were run with 10 mM sodium phosphate (NaPi) (pH 7.2), with buffer recirculation, at room temperature. For gels containing Mg2C, the buffer was supplemented with 1 mM Na2EDTA, and MgCl2 sufficient to yield the indicated free magnesium concentrations.25 The relative mobility (mrel) is defined as the ratio of the absolute mobility of the extended tRNA to the mobility for a fully duplex linear control of the same contour length. Two linear controls were run on the gel and the mobilities of species of intermediate length were determined by interpolation. Transient electric birefringence measurements TEB experiments were conducted essentially as described,15 and were interpreted using the analytical framework provided by Vacano & Hagerman.27 Here, we involve the following pulse configurations: pulse-width, 1.0 ms; pulse repetition frequency, 1 Hz; orientation field strength, 10 kV/cm. Except where indicated, measurement conditions used were: 9 mg of RNA in 35 ml of 5 mM NaPi (pH 7.2) 1 mM Na2EDTA and MgCl2 sufficient to yield the indicated free magnesium concentration. For each RNA construct tested, at least two independent RNA preparations were used, and five independent sets of measurements were made per preparation (for Rten measurement sets per extended tRNA construct). Each measurement set (signal-averaged decay curve) represents the average of 128 transients, digitized and averaged on a LeCroy 9310 oscilloscope. Decay curves were analyzed by fitting to a double-exponential function using the Levenberg–Marquart method.52 As for all of our previous studies of RNA structure, we confirmed that the decay times were independent of either the field strength or the width of the orienting pulse. Further analysis of the t-ratio technique and discussion of error can be found in the work done by Vacano & Hagerman27 and Hagerman & Hagerman.48 Determination of the interstem angle from transient electric birefringence measurements The t-ratio approach was utilized for the determination of interstem angles. The t-ratio is defined as the ratio of the terminal decay time of the heteroduplex (extended) tRNA construct (thtx) to the terminal decay time of a linear duplex, (tdplx), of the same contour length. This approach requires knowledge of the contour length of the heteroduplex molecule being tested; details of contour length estimation are presented elsewhere.15,23 For the case of the S. cerevisiae ctRNAPhe, this distance was measured from the crystal structure;23 for the B. taurus

mtRNASer(AGY) the contour length was estimated to be 163 bp. 15 These two tRNAs were used as standards from which the remaining secondary structures were compared to estimate the contour length. For the more canonical tRNAs: Escherichia coli ctRNASer(AGY), M. capricolum ctRNASer(AGY), S. cerevisiae mtRNASer(AGY), B. taurus ctRNASer(UCN) and B. taurus mtRNASer(UCN), comparisons were made to S. cerevisiae tRNAPhe. For every additional base-pair in a stem region or for every two bases in loop regions an additional base-pair was added to the 174 value for yeast tRNAPhe.23 Similarly, base-pairs were subtracted for the loss of base-pairs or loop bases. For the abbreviated tRNAs; Fasciola hepatica mtRNA Ser (AGY), A. suum mtRNASer(AGY), C. elegans mtRNASer (AGY), and C. elegans mtRNAPhe, equivalent lengths were determined in a similar manner, except that comparisons were made to B. taurus mtRNASer(AGY) (163 bp equivalence;15). The resulting (equivalent length) values are shown in Table 5.

Acknowledgements The authors thank Elsi Vacano for her help with data analysis, and Janine Mills for her assistance in the construction of the extended tRNAs. This work was supported by a grant from the National Institutes of Health (GM35305 to P.J.H.)

References 1. Hingerty, B., Brown, R. S. & Jack, A. (1978). Further refinement of the structure of yeast tRNAPhe. J. Mol. Biol. 124, 523–534. 2. Holbrook, S. R., Sussman, J. L., Warrant, R. W. & Kim, S. H. (1978). Crystal structure of yeast phenylalanine transfer RNA. II. Structural features and functional implications. J. Mol. Biol. 123, 631–660. 3. Sussman, J. L., Holbrook, S. R., Warrant, R. W., Church, G. M. & Kim, S. H. (1978). Crystal structure of yeast phenylalanine transfer RNA. I. Crystallographic refinement. J. Mol. Biol. 123, 607–630. 4. Moras, D., Comarmond, M. B., Fischer, J., Weiss, R., Thierry, J. C., Ebel, J. P. & Giege, R. (1980). Crystal structure of yeast tRNAAsp. Nature, 288, 669–674. 5. Woo, N. H., Roe, B. A. & Rich, A. (1980). Threedimensional structure of Escherichia coli initiator tRNAfMet. Nature, 286, 346–351. 6. Rould, M. A., Perona, J. J., Soll, D. & Steitz, T. A. (1989). Structure of E. coli glutaminyl-tRNA synthe˚ tase complexed with tRNA(Gln) and ATP at 2.8 A resolution. Science, 246, 1135–1142. ˚ crystal 7. Basavappa, R. & Sigler, P. B. (1991). The 3 A structure of yeast initiator tRNA: functional implications in initiator/elongator discrimination. EMBO J. 10, 3105–3111. 8. Ruff, M., Krishnaswamy, S., Boeglin, M., Poterszman, A., Mitschler, A., Podjarny, A. et al. (1991). Class II aminoacyl transfer RNA synthetases: crystal structure of yeast aspartyl-tRNA synthetase complexed with tRNA(Asp). Science, 252, 1682–1689. 9. Price, S., Cusack, S., Borel, F., Berthet-Colominas, C. & Leberman, R. (1993). Crystallization of the seryl-tRNA synthetase:tRNAS(Ser) complex of Escherichia coli. FEBS Letters, 324, 167–170. 10. Biou, V., Yaremchuk, A., Tukalo, M. & Cusack, S.

324

11.

12. 13.

14.

15.

16.

17.

18.

19. 20. 21. 22. 23.

24.

25.

26.

27.

˚ crystal structure of T. thermophilus (1994). The 2.9 A seryl-tRNA synthetase complexed with tRNA(Ser). Science, 263, 1404–1410. Eriani, G. & Gangloff, J. (1999). Yeast aspartyl-tRNA synthetase residues interacting with tRNA(Asp) identity bases connectively contribute to tRNA(Asp) binding in the ground and transition-state complex and discriminate against non-cognate tRNAs. J. Mol. Biol. 291, 761–773. Shi, H. & Moore, P. B. (2000). The crystal structure of ˚ resolution: a yeast phenylalanine tRNA at 1.93 A classic structure revisited. RNA, 6, 1091–1105. Yaremchuk, A., Cusack, S. & Tukalo, M. (2000). Crystal structure of a eukaryote/archaeon-like protyl-tRNA synthetase and its complex with tRNAPro(CGG). EMBO J. 19, 4745–4758. Sekine, S., Nureki, O., Dubois, D. Y., Bernier, S., Chenevert, R., Lapointe, J. et al. (2003). ATP binding by glutamyl-tRNA synthetase is switched to the productive mode by tRNA binding. EMBO J. 22, 676–688. Frazer-Abel, A. A. & Hagerman, P. J. (1999). Determination of the angle between the acceptor and anticodon stems of a truncated mitochondrial tRNA. J. Mol. Biol. 285, 581–593. Sprinzl, M., Horn, C., Brown, M., Ioudovitch, A. & Steinberg, S. (1998). Compilation of tRNA sequences and sequences of tRNA genes. Nucl. Acids Res. 26, 148–153. Anderson, S., de Bruijn, M. H., Coulson, A. R., Eperon, I. C., Sanger, F. & Young, I. G. (1982). Complete sequence of bovine mitochondrial DNA. Conserved features of the mammalian mitochondrial genome. J. Mol. Biol. 156, 683–717. Okimoto, R., Macfarlane, J. L., Clary, D. O. & Wolstenholme, D. R. (1992). The mitochondrial genomes of two nematodes. Caenorhabditis elegans and Ascaris suum. Genetics, 130, 471–498. Steinberg, S. & Cedergren, R. (1994). Structural compensation in atypical mitochondrial tRNAs. Nature Struct. Biol. 1, 507–510. Cooper, J. P. & Hagerman, P. J. (1989). Geometry of a branched DNA structure in solution. Proc. Natl Acad. Sci. USA, 86, 7336–7340. Amiri, K. M. & Hagerman, P. J. (1994). Global conformation of a self-cleaving hammerhead RNA. Biochemistry, 33, 13172–13177. Zacharias, M. & Hagerman, P. J. (1995). Bulgeinduced bends in RNA: quantification by transient electric birefringence. J. Mol. Biol. 247, 486–500. Friederich, M. W., Gast, F. U., Vacano, E. & Hagerman, P. J. (1995). Determination of the angle between the anticodon and aminoacyl acceptor stems of yeast phenylalanyl tRNA in solution. Proc. Natl Acad. Sci. USA, 92, 4803–4807. Friederich, M. W., Vacano, E. & Hagerman, P. J. (1998). Global flexibility of tertiary structure in RNA: yeast tRNAPhe as a model system. Proc. Natl Acad. Sci. USA, 95, 3572–3577. Friederich, M. W. & Hagerman, P. J. (1997). The angle between the anticodon and aminoacyl acceptor stems of yeast tRNA(Phe) is strongly modulated by magnesium ions. Biochemistry, 36, 6090–6099. Leehey, M. A., Squassoni, C. A., Friederich, M. W., Mills, J. B. & Hagerman, P. J. (1995). A noncanonical tertiary conformation of a human mitochondrial transfer RNA. Biochemistry, 34, 16235–16239. Vacano, E. & Hagerman, P. J. (1997). Analysis of

Interstem Angles of tRNAs

28. 29. 30. 31.

32.

33.

34.

35.

36.

37.

38.

39. 40.

41.

42.

43.

birefringence decay profiles for nucleic acid helices possessing bends: the tau-ratio approach. Biophys. J. 73, 306–317. Hagerman, P. J. & Zimm, B. H. (1981). Monte Carlo approach to the analysis of the rotational diffusion of wormlike chains. Biopolymers, 20, 1481–1502. Jung, D. W., Apel, L. & Brierley, G. P. (1990). Matrix free Mg2C changes with metabolic state in isolated heart mitochondria. Biochemistry, 29, 4121–4128. Jung, D. W. & Brierley, G. P. (1991). Determination of free Mg2C in isolated heart mitochondria using fluorescent probes. Magnes. Trace Elem. 10, 151–164. Jung, D. W., Chapman, C. J., Baysal, K., Pfeiffer, D. R. & Brierley, G. P. (1996). On the use of fluorescent probes to estimate free Mg2C in the matrix of heart mitochondria. Arch. Biochem. Biophys. 332, 19–29. Valle, M., Zavialov, A., Li, W., Stagg, S. M., Sengupta, J., Nielsen, R. C. et al. (2003). Incorporation of aminoacyl-tRNA into the ribosome as seen by cryoelectron microscopy. Nature Struct. Biol. 10, 899–906. Oct 2019. Degoul, F., Brule, H., Cepanec, C., Helm, M., Marsac, C., Leroux, J. et al. (1998). Isoleucylation properties of native human mitochondrial tRNAIle and tRNAIle transcripts. Implications for cardiomyopathy-related point mutations (4269, 4317) in the tRNAIle gene. Hum. Mol. Genet. 7, 347–354. Harrington, K. M., Nazarenko, I. A., Dix, D. B., Thompson, R. C. & Uhlenbeck, O. C. (1993). In vitro analysis of translational rate and accuracy with an unmodified tRNA. Biochemistry, 32, 7617–7622. Hayashi, I., Yokogawa, T., Kawai, G., Ueda, T., Nishikawa, K. & Watanabe, K. (1997). Assignment of imino proton signals of G-C base pairs and magnesium ion binding: an NMR study of bovine mitochondrial tRNA(SerGCU) lacking the entire D arm. J. Biochem. (Tokyo), 121, 1115–1122. Kowalak, J. A., Dalluge, J. J., McCloskey, J. A. & Stetter, K. O. (1994). The role of posttranscriptional modification in stabilization of transfer RNA from hyperthermophiles. Biochemistry, 33, 7869–7876. Helm, M., Brule, H., Degoul, F., Cepanec, C., Leroux, J. P., Giege, R. & Florentz, C. (1998). The presence of modified nucleotides is required for cloverleaf folding of a human mitochondrial tRNA. Nucl. Acids Res. 26, 1636–1643. Sampson, J. R. & Uhlenbeck, O. C. (1988). Biochemical and physical characterization of an unmodified yeast phenylalanine transfer RNA transcribed in vitro. Proc. Natl Acad. Sci. USA, 85, 1033–1037. Hall, K. B., Sampson, J. R., Uhlenbeck, O. C. & Redfield, A. G. (1989). Structure of an unmodified tRNA molecule. Biochemistry, 28, 5794–5801. Perret, V., Garcia, A., Puglisi, J., Grosjean, H., Ebel, J. P., Florentz, C. & Giege, R. (1990). Conformation in solution of yeast tRNA(Asp) transcripts deprived of modified nucleotides. Biochimie, 72, 735–743. Dao, V., Guenther, R., Malkiewicz, A., Nawrot, B., Sochacka, E., Kraszewski, A. et al. (1994). Ribosome binding of DNA analogs of tRNA requires base modifications and supports the “extended anticodon”. Proc. Natl Acad. Sci. USA, 91, 2125–2129. Grosjean, H., Edqvist, J., Straby, K. B. & Giege, R. (1996). Enzymatic formation of modified nucleosides in tRNA: dependence on tRNA architecture. J. Mol. Biol. 255, 67–85. Hayashi, I., Kawai, G. & Watanabe, K. (1997).

325

Interstem Angles of tRNAs

44.

45.

46.

47.

Expression of bovine mitochondrial tRNASer GCU derivatives in Escherichia coli. Nucl. Acids Res. 25, 3503–3507. Arnez, J. G. & Steitz, T. A. (1994). Crystal structure of unmodified tRNA(Gln) complexed with glutaminyltRNA synthetase and ATP suggests a possible role for pseudo-uridines in stabilization of RNA structure. Biochemistry, 33, 7560–7567. Helm, M., Giege, R. & Florentz, C. (1999). A Watson– Crick base-pair-disrupting methyl group (m1A9) is sufficient for cloverleaf folding of human mitochondrial tRNALys. Biochemistry, 38, 13338–13346. de Bruijn, M. H., Schreier, P. H., Eperon, I. C., Barrell, B. G., Chen, E. Y., Armstrong, P. W. et al. (1980). A mammalian mitochondrial serine transfer RNA lacking the “dihydrouridine” loop and stem. Nucl. Acids Res. 8, 5213–5222. Arcari, P. & Brownlee, G. G. (1980). The nucleotide sequence of a small (3S) seryl-tRNA (anticodon GCU) from beef heart mitochondria. Nucl. Acids Res. 8, 5207–5212.

48. Hagerman, K. R. & Hagerman, P. J. (1996). Helix rigidity of DNA: the meroduplex as an experimental paradigm. J. Mol. Biol. 260, 207–223. 49. Stagg, S. M., Frazer-Abel, A. A., Hagerman, P. J. & Harvey, S. C. (2001). Structural studies of the tRNA domain of tmRNA. J. Mol. Biol. 309, 727–735. 50. Gutmann, S., Haebel, P. W., Metzinger, L., Sutter, M., Felden, B. & Ban, N. (2003). Crystal structure of the transfer-RNA domain of transfer-messenger RNA in complex with SmpB. Nature, 424, 699–703. 51. Shen, Z. & Hagerman, P. J. (1994). Conformation of the central, three-helix junction of the 5 S ribosomal RNA of Sulfolobus acidocaldarius. J. Mol. Biol. 241, 415–430. 52. Press, W. H., Vetterling, W. T., Teukolsky, S. A. & Flannery, B. P. (1992). Numerical Recipes in Fortran: The Art of Scientific Computation, Cambridge University Press, Cambridge.

Edited by D. E. Draper (Received 16 April 2004; received in revised form 13 July 2004; accepted 22 July 2004)