- Email: [email protected]
Verification on the Function of Geldanamycin Biosynthetic Genes in Streptomyces hygroscopicus 17997
CHINESE JOURNAL OF BIOTECHNOLOGY Volume 24, Issue 7, July 2008 Online English edition of the Chinese language journal RESEARCH PAPER
Cite this article as: Chin J Biotech, 2008, 24(7), 1133í1139.
Verification on the Function of Geldanamycin Biosynthetic Genes in Streptomyces hygroscopicus 17997 Weiqing He, Yuying Liu, Guizhi Sun, and Yiguang Wang Key Lab of Biotechnology of Antibiotics of Ministry of Health, Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100050, China
Abstract: Geldanamycin (Gdm), as inhibitor of heat shock protein 90 (Hsp90), shows antitumor and antivirus bioactivity. Most of Gdm biosynthetic genes have been cloned from the genome library of S. hygroscopicus 17997. In this report, polyketide synthase (pks) gene, monooxygenase (gdmM) gene, and carbamoyltransferase gene (gdmN) were subjected to inactivation, respectively. Three gene disrupted mutants (Ƹpks, ƸgdmM, and ƸgdmN) were obtained by double crossover. No Gdm production was detected in three mutant strains cultured in fermentation broth. Gene complementation experiments excluded the possible polar effect of gene disruption on other genes. These results confirmed that pks, gdmM, and gdmN genes were essential for Gdm biosynthesis. Keywords: Streptomyces hygroscopicus 17997; geldanamycin (Gdm); gene disruption; gene complementation
Introduction Geldanamycin (Gdm), as specific inhibitor of heat shock protein 90 (Hsp90)[1], shows many bioactivities such as antiprotozoan, antitumor, antivirus, and immunomodulation [2–4] . However, due to poor aqueous solubility and hepatotoxicity, GA has not moved forward in clinical trials. In order to create novel Gdm analogs through biotechnology, its biosynthetic gene cluster has been cloned from the S. hygroscopicus 17997 genomic library[5,6]. Three deduced Gdm biosynthetic genes in the gene cluster were inactivated to detect whether the mutants can produce the Gdm following gene complementation experiments excluding the polar effect. These studies will help to deeply understand the function of Gdm biosynthetic genes.
1
Materials and methods
1.1 Materials 1.1.1 Bacterial strains and plasmids:
S. hygroscopicus
17997, a Gdm producing strain, was isolated by Institute of Medicinal Biotechnology from Chinese soil. E. coli ET12567/pUZ8002 was used as donor strain for conjugation transfer to S. hygroscopicus 17997. The genomic library of S. hygroscopicus 17997 was constructed by Dr. Qunjie Gao[5]. pGH112 vector was kindly provided by Prof. Ke-qian Yang. pUC18-AmR (aac(3) IV, apramycin resistant gene, AmR) plasmid used in gene disruption was constructed in our lab. pKC1139-Km is a pKC1139-based plasmid having the aphII gene of Tn5. This plasmid was used in gene complementation of mutant as described below. 1.1.2 Main reagents and equipments: Thiostrepton (Tsr) is a product obtained from Squibb & Sons, INC. Ampicillin (Amp) is a product of Huamei Corporation. Apramycin (Am) was provided by Prof. Huanzhang Xia. Nalidixic acid was purchased from Amresco Corporation. Restriction enzymes, T4 DNA ligase, and LA-Taq polymerase were purchased from TaKaRa Corporation. DIG DNA Labeling & Detection Kit I was purchased from ROCHE (B.M.) Corporation. Southern blotting nylon membrane was purchased from
Received: October 22, 2007; Accepted: December 15, 2007 Supported by: the National Dept. of Sciences and Technology under Preliminary Basic Research 973 project (No. 2001CCA00500). Corresponding author: Yiguang Wang. Tel: +86-10-63038137, Fax: +86-10-63176489; E-mail: [email protected] Copyright © 2008, Institute of Microbiology, Chinese Academy of Sciences and Chinese Society for Microbiology. Published by Elsevier BV. All rights reserved.
Weiqing He et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1133–1139
Amersham Corporation. HPLC (Shimadzu ODS-C18, 150 × 20 mm) was CLASS-VP stop. 1.1.3 Media: R2YE medium, MS medium for ET12567/ pUZ8002 and S. hygroscopicus 17997 conjugation, and fermentation medium for S. hygroscopicus 17997 and mutants are described in the reference [8, 9]. 1.2 Methods 1.2.1 Gene cloning protocol is described in reference [7]. 1.2.2 PCR amplification conditions: GC buffer I PCR reaction system, 1 min, 45°C for preheat, 95°C, 2 min for predenaturation, then 95°C, 30 s, 60°C, 30 s, 72°C, 1 min, 30 cycles, followed by 72°C, 10 min. 1.2.3 Conjugation between S. hygroscopicus 17997 and E. coli ET12567/pUZ8002 described in references[8]. 1.2.4 Gene complementation of mutants: intact gdmN (Bgl II fragment) and gdmM (Sac I fragment) gene were cloned into the pKC1139-Km vector, and then the recombinant plasmid was introduced into the relevant mutants. The positive clones were identified by PCR, and Gdm assay was carried out by the HPLC. 1.2.6 Fermentation, extraction, and analysis of broth are described in reference [9].
2
Results and discussion
2.1 Screening and identification of the pks, gdmM, and gdmN gene disruptants 2.1.1 Construction of disruption plasmids of pks, gdmM, and gdmN genes: Three target genes, the sixth module of pks gene, monooxygenase gene (gdmM), and carbamoyltransferase gene (gdmN) (GenBank Accession No. DQ914285), were inactivated by homologous genes recombination. The homologous fragments of the recombinant plasmids for gdmM gene and gdmN gene disruption were obtained by the P1-P4 primers and P5-P8 primers, respectively, and are shown in Tab. 1. The 1.5 kb apramycin resistant gene marker was inserted between two homologous fragments and then ligated into pGH112 vector to construct the gene disruption plasmids pGEX-pks and pGEX-gdmN (shown in Fig. 1). The construction of recombinant plasmid for gdmM gene inactivation was different to that of pks and gdmN. The fragment containing the gdmM gene was first cloned into pGH112 vector, and the BamH I-Pst I Apramycin resistant gene (semiblunt ended) was then inserted into the Bgl II site of gdmM gene to generate the pGEX-gdmM plasmid (shown in Fig. 2). The recombinant plasmids pGEX-pks, pGEX-gdmM, and pGEX-gdmN were introduced into S. hygroscopicus 17997 by conjugation using E. coli ET12567/pUZ8002 as donor. According to antibiotics resistant results, the desired double crossover mutants (TsrS and AmR), 16 pks gene disruptant (ǻpks), 20 gdmM gene disruptants (ǻgdmM), and 8 gdmN
gene disruptants (ǻgdmN) were obtained. The target genes inserted into AmR gene were primarily verified by the expected resistant phenotype. 2.1.2 Identification of pks, gdmM, and gdmN gene disruptants: The identification primers were designed by the flanking sequence of the two homologous fragments of recombinant plasmids (shown in Tab. 1). The PCR products from the parent strain and three mutants genomic DNAs were obtained by the PCR (shown in Fig. 3 and Tab. 2). Just as expected, the PCR products from the mutants were longer, about 1.5 kb, than that of S. hygroscopicus 17997, and the apramycin resistant phenotype of the mutants remains stable even after they were cultured for many generations. These results demonstrated that pks, gdmM, and gdmN genes were inactivated by insertion of apramycin resistant gene through homologous double-cross recombination. 2.1.3 Identification of mutants’ fermentation products by HPLC: The assay of fermentation products extracted from the parent strain and mutants were carried out by HPLC (Fig. 4). According to the results of Fig. 4a, the retention time of Gdm absorption peak was 24.863 min. However, the two main products, ǻgdmN-1 and ǻgdmN-2, of ǻgdmN mutant were detected. The retention time of ǻgdmN-1 and ǻgdmN-2 was 12.925 min and 25.866 min, respectively. The retention time and ultraviolet absorption type of ǻgdmN-2 were different to that of Gdm(Tab. 3, Fig. 5), although its retention time was near with the Gdm’s. ǻgdmN-2 was likely the progeldanamycin absent of the C7-carbamoyl group because of the inactivation of the carbamoyltransferase gene in the ǻgdmN mutant. However, it was unclear how to produce Tab. 1 Primers used in construction of the gene disruption vector and identification of the mutants Primers P1
Primer sequence (5ƍ–3ƍ) CCGGAATTCCTGAGGCGTCGGGTGGTC(EcoR I)
P2
CGCGGATCCTGTTCTCCGGCTCGTTCG(BamH I)
P3
AAAACTGCAGATGCCACGACCGCTGCTC (Pst I)
P4
CTAGTCTAGACCTCGACGGTGTCCGCAC (Xba I)
P5
CCGGAATTCACGGCCTTGGCCAGATCC(EcoR I)
P6
CGCGGATCCATCCACCCCGCCTCGCAC (BamH I)
P7 P8
AAAACTGCAGGCCGTTGAGGCTGGAGTT (Pst I) CTAGTCTAGACCGACTGGTTTGGGTGAT (Xba I)
Ƹpks (F)
CGCGGATCCGGACTTCTACCGTTCGCTCGTGGAC (BamH I)
Ƹpks (R)
CTAGTCTAGACAGGGACCAGCCGATGT (Xba I)
ƸgdmM (F)
CGCGGATCCCCGAGAAGCGGCGGAAGACGAC (BamH I)
ƸgdmM (R)
CTAGTCTAGA CGGTCGGGGTGAGTTGTT (Xba I)
ƸgdmN (F)
CCCAAGCTT CTCGTGGACGGGTTGCT(Hind III)
ƸgdmN (R)
CTAGTCTAGA TCGAACGCCTCCACCTC (Xba I)
Weiqing He et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1133–1139
Fig. 1
Construction of the pks and gdmN gene disruption plasmids
Tab. 2
Amplification products from the genomes of parent strain and gene disruptants
Strains
Fig. 2
Construction of the gdmM gene disruption plasmid
Fig. 3 Electrophoresis of PCR products M1: O/Hind III; M2: marker III 1, 3, 5: parent strain; 2: ǻgdmN; 4: ǻgdmM; 6: ǻpks
ǻgdmN-1 in this mutant, and investigations are being carried out for the identification of its chemical structure. There was only one main product (Rt 14.732) but no Gdm to be detected in the ǻgdmM mutant, which suggested that
ƸgdmN (F-R)
ƸgdmM (F-R)
Ƹpks (F-R)
S. hygroscopicus 17997
3.1 kb
2.5 kb
4.4 kb
Gene disruptants
4.5 kb
4.0 kb
6.0 kb
the mutant cannot produce the Gdm as the gdmM gene disruption. According to the work of Andreas Rascher [10], gdmM gene coding for the monooxygenase was possibly involved in the oxidation of C21 and C17. Inactivation of gdmM gene would lead to produce a progeldanamycin in which C18 was hydroxyl group and C21 or C17 were no substituent group. The characteristic absorption peak of Gdm was not detected from the ǻpks mutant and the production of secondary metabolites was fewer, which demonstrated that this pks gene was responsible for the geldanamycin polyketides chain biosynthesis. 2.2 Gene complementation of the mutant It should be proved that the loss of Gdm production in three mutants was due to inactivation of pks, gdmM, and gdmN but not due to the polar effect resulting in the inactivation of other genes. The Sac I fragment (containing the intact gdmM gene) and Bgl II fragment (containing the intact gdmN gene) obtained from S. hygroscopicus 17997 genomic DNA were cloned into the pKC1139-Km plasmid, and then the recombinant plasmids were introduced into the ǻgdmM and ǻgdmN mutants, respectively, by gene conjugation transfer system. The intact gdmM and gdmN genes were confirmed by PCR in the resultant complementation strains. The complementation strains were fermented in medium
Weiqing He et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1133–1139
Fig. 4
HPLC result of the disruptants fermentation broth
A: S. hygroscopicus 17997; B: ǻgdmN; C: ǻgdmM; D: ǻpks
Fig. 5
with 50 ȝg/mL apramycin and kanamycin, and the broth of fermentation were assayed by HPLC. Geldanamycin production were all restored in the two complementation strains, although Gdm production only gets to 1/3 or 1/9 of the parent strains’ normal level (Fig. 6 and Tab. 4). The complementation experiments excluded the polar effect and confirmed that the gdmM and gdmN gene were necessary for the Gdm biosynthesis. 2.3 coculturing between the mutants The ǻpks and ǻgdmN mutants can complement their gene defects to produce Gdm, ǻgdmN-1, and ǻgdmN-2 when cocultured in the fermentation medium (Fig. 7). Similarly, ǻgdmM and ǻgdmN mutants cocultured in the fermentation medium can produce a little Gdm with some of Rt 14.7 min compound of ǻgdmM mutant. Furthermore, the intact gdmN gene coding for the carbamoyltransferase of the ǻpks and ǻgdmM mutant can catalyze ǻgdmN-2 to form Gdm when ǻgdmN-2 was added into the two mutant fermentation broths.
UV spectrum of main products of mutants
A: Gdm; B: ǻgdmN-1; C: ǻgdmN-2; D: ǻgdmM
These results can demonstrate that ǻgdmN-2 is a progeldanamycin absent of the C7-carbamoyl, maybe similar to the 4,5-dihydro-7-O-descarbamoyl-7-hydroxy Gdm[11]. Simultaneously, the intact pks gene of ǻgdmM mutant and ǻgdmN mutant can also complement the disrupted pks gene of ǻpks mutant to produce Gdm. This study demonstrated that pks, gdmM, and gdmN genes were involved in the Gdm biosynthesis by the gene disruption and complementation experiments. ǻpks mutant can be applied to modification of the Gdm polyketide. The gdmM gene and gdmN gene were likely involved in the post-PKS modification steps at C7, C17, and C21 sites, and these pro-geldanamycin compound produced by the mutant can be used in reforming the structure of Gdm. This work will form the basis for modifying the structure of Gdm to generate new derivatives by combinatorial biosynthesis.
Weiqing He et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1133–1139
Tab. 3 Retention time and peak area of the main products in the mutants Product
Retention time
Peak area
geldanamycin
24.863
6944101
ǻgdmN-1
12.925
10271416
ǻgdmN-2
25.866
4027986
ǻgdmM
14.732
9874614
Tab. 4 Retention time and peak area of geldanamycin of mutant complementation strains
Fig. 6
Identification the fermentation broth of ǻgdmN and ǻgdmM complementation strains by HPLC
A: S. hygroscopicus 17997, B: ǻgdmN complementation, C: ǻgdmN complementation
Strains
Retention time
Peak area
S. hygroscopicus 17997
24.873
7614330
ǻgdmN-complementation
24.575
2386700
ǻgdmM-complementation
24.917
831014
REFERENCES [1]
Prodromou C, Roe SM, O’Brien R, et al. Identification and structural characterization of the ATP/ADP-binding site in the Hsp90 molecular chaperone. Cell, 1997, 90: 65–75.
[2]
Sasaki K, Yasuda H, Onodera K. Growth inhibition of virus transformed cells in vitro and antitumor activity in vivo of geldanamycin and its derivatives. J Antibiot (Tokyo), 1979, 32: 849–851.
[3]
Tao PJ, Lou ZX, Yao TJ, et al. Antiviral study on the broad spectrum antiviral antibiotic 17997 in vitro and in vivo. Chinese J Antibiot, 1997, 22: 368–372.
[4]
Murphy P, Sharp A, Shin J, et al. Suppressive effects of ansamycin on inducible nitric oxide synthase expression and the
development
of
experimental
autoimmune
encephalomyelitis. J Neurosci Res, 2002, 67: 461–470. [5]
Gao QJ, Shang GD, Yang Y, et al. Cloning and molecular analysis
of
geldanamycin
biosynthetic
genes
from
Streptomyces hygroscopicus. Chin J Antibiot, 2002, 27: 13–27. [6]
He WQ, Wang YG. Cloning and analysis of geldanamycin partial
biosynthetic
gene
cluster
of
Streptomyces
hygroscopicus 17997. Chin J Biotech, 2006, 22: 902–906. [7]
Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed, New York: Cold Spring Harbor Laboratory Press 1989.
[8]
Kieser T, Bibb MJ, Buttner MJ, et al. Practical Streptomyces genetics, the John Innes Foundation, Norwich 2000.
[9] Fig. 7
Identification the broth of the disruptants co-culture by HPLC
A: S. hygroscopicus 17997; B: ǻpks and ǻgdmN; C: ǻpks and ǻgdmM; D: add ǻgdmN-2 to ǻpks; E: add ǻgdmN-2 to ǻgdmM
He WQ, Li JY, Sun GZ, et al. Application of RP-HPLC pattern analysis to detect new products of Streptomyces hygroscopicus 17997 mutants. Chin J Antibiot, 2006, 31: 168–171.
Weiqing He et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1133–1139
[10] Rascher A, Hu Z, Buchanan GO, et al. Insights into the
[11] Hong YS, Lee D, Kim W, et al. Inactivation of the
biosynthesis of the benzoquinone ansamycins geldanamycin
carbamoyltransferase gene refines post-polyketide synthase
and herbimycin, obtained by gene sequencing and disruption.
modification steps in the biosynthesis of the antitumor agent
Appl Environ Microbiol, 2005, 71: 4862–4871.
geldanamycin. J Am Chem Soc, 2004, 126: 11142–11143.
Cite this article as: Chin J Biotech, 2008, 24(7), 1133í1139.
Verification on the Function of Geldanamycin Biosynthetic Genes in Streptomyces hygroscopicus 17997 Weiqing He, Yuying Liu, Guizhi Sun, and Yiguang Wang Key Lab of Biotechnology of Antibiotics of Ministry of Health, Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100050, China
Abstract: Geldanamycin (Gdm), as inhibitor of heat shock protein 90 (Hsp90), shows antitumor and antivirus bioactivity. Most of Gdm biosynthetic genes have been cloned from the genome library of S. hygroscopicus 17997. In this report, polyketide synthase (pks) gene, monooxygenase (gdmM) gene, and carbamoyltransferase gene (gdmN) were subjected to inactivation, respectively. Three gene disrupted mutants (Ƹpks, ƸgdmM, and ƸgdmN) were obtained by double crossover. No Gdm production was detected in three mutant strains cultured in fermentation broth. Gene complementation experiments excluded the possible polar effect of gene disruption on other genes. These results confirmed that pks, gdmM, and gdmN genes were essential for Gdm biosynthesis. Keywords: Streptomyces hygroscopicus 17997; geldanamycin (Gdm); gene disruption; gene complementation
Introduction Geldanamycin (Gdm), as specific inhibitor of heat shock protein 90 (Hsp90)[1], shows many bioactivities such as antiprotozoan, antitumor, antivirus, and immunomodulation [2–4] . However, due to poor aqueous solubility and hepatotoxicity, GA has not moved forward in clinical trials. In order to create novel Gdm analogs through biotechnology, its biosynthetic gene cluster has been cloned from the S. hygroscopicus 17997 genomic library[5,6]. Three deduced Gdm biosynthetic genes in the gene cluster were inactivated to detect whether the mutants can produce the Gdm following gene complementation experiments excluding the polar effect. These studies will help to deeply understand the function of Gdm biosynthetic genes.
1
Materials and methods
1.1 Materials 1.1.1 Bacterial strains and plasmids:
S. hygroscopicus
17997, a Gdm producing strain, was isolated by Institute of Medicinal Biotechnology from Chinese soil. E. coli ET12567/pUZ8002 was used as donor strain for conjugation transfer to S. hygroscopicus 17997. The genomic library of S. hygroscopicus 17997 was constructed by Dr. Qunjie Gao[5]. pGH112 vector was kindly provided by Prof. Ke-qian Yang. pUC18-AmR (aac(3) IV, apramycin resistant gene, AmR) plasmid used in gene disruption was constructed in our lab. pKC1139-Km is a pKC1139-based plasmid having the aphII gene of Tn5. This plasmid was used in gene complementation of mutant as described below. 1.1.2 Main reagents and equipments: Thiostrepton (Tsr) is a product obtained from Squibb & Sons, INC. Ampicillin (Amp) is a product of Huamei Corporation. Apramycin (Am) was provided by Prof. Huanzhang Xia. Nalidixic acid was purchased from Amresco Corporation. Restriction enzymes, T4 DNA ligase, and LA-Taq polymerase were purchased from TaKaRa Corporation. DIG DNA Labeling & Detection Kit I was purchased from ROCHE (B.M.) Corporation. Southern blotting nylon membrane was purchased from
Received: October 22, 2007; Accepted: December 15, 2007 Supported by: the National Dept. of Sciences and Technology under Preliminary Basic Research 973 project (No. 2001CCA00500). Corresponding author: Yiguang Wang. Tel: +86-10-63038137, Fax: +86-10-63176489; E-mail: [email protected] Copyright © 2008, Institute of Microbiology, Chinese Academy of Sciences and Chinese Society for Microbiology. Published by Elsevier BV. All rights reserved.
Weiqing He et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1133–1139
Amersham Corporation. HPLC (Shimadzu ODS-C18, 150 × 20 mm) was CLASS-VP stop. 1.1.3 Media: R2YE medium, MS medium for ET12567/ pUZ8002 and S. hygroscopicus 17997 conjugation, and fermentation medium for S. hygroscopicus 17997 and mutants are described in the reference [8, 9]. 1.2 Methods 1.2.1 Gene cloning protocol is described in reference [7]. 1.2.2 PCR amplification conditions: GC buffer I PCR reaction system, 1 min, 45°C for preheat, 95°C, 2 min for predenaturation, then 95°C, 30 s, 60°C, 30 s, 72°C, 1 min, 30 cycles, followed by 72°C, 10 min. 1.2.3 Conjugation between S. hygroscopicus 17997 and E. coli ET12567/pUZ8002 described in references[8]. 1.2.4 Gene complementation of mutants: intact gdmN (Bgl II fragment) and gdmM (Sac I fragment) gene were cloned into the pKC1139-Km vector, and then the recombinant plasmid was introduced into the relevant mutants. The positive clones were identified by PCR, and Gdm assay was carried out by the HPLC. 1.2.6 Fermentation, extraction, and analysis of broth are described in reference [9].
2
Results and discussion
2.1 Screening and identification of the pks, gdmM, and gdmN gene disruptants 2.1.1 Construction of disruption plasmids of pks, gdmM, and gdmN genes: Three target genes, the sixth module of pks gene, monooxygenase gene (gdmM), and carbamoyltransferase gene (gdmN) (GenBank Accession No. DQ914285), were inactivated by homologous genes recombination. The homologous fragments of the recombinant plasmids for gdmM gene and gdmN gene disruption were obtained by the P1-P4 primers and P5-P8 primers, respectively, and are shown in Tab. 1. The 1.5 kb apramycin resistant gene marker was inserted between two homologous fragments and then ligated into pGH112 vector to construct the gene disruption plasmids pGEX-pks and pGEX-gdmN (shown in Fig. 1). The construction of recombinant plasmid for gdmM gene inactivation was different to that of pks and gdmN. The fragment containing the gdmM gene was first cloned into pGH112 vector, and the BamH I-Pst I Apramycin resistant gene (semiblunt ended) was then inserted into the Bgl II site of gdmM gene to generate the pGEX-gdmM plasmid (shown in Fig. 2). The recombinant plasmids pGEX-pks, pGEX-gdmM, and pGEX-gdmN were introduced into S. hygroscopicus 17997 by conjugation using E. coli ET12567/pUZ8002 as donor. According to antibiotics resistant results, the desired double crossover mutants (TsrS and AmR), 16 pks gene disruptant (ǻpks), 20 gdmM gene disruptants (ǻgdmM), and 8 gdmN
gene disruptants (ǻgdmN) were obtained. The target genes inserted into AmR gene were primarily verified by the expected resistant phenotype. 2.1.2 Identification of pks, gdmM, and gdmN gene disruptants: The identification primers were designed by the flanking sequence of the two homologous fragments of recombinant plasmids (shown in Tab. 1). The PCR products from the parent strain and three mutants genomic DNAs were obtained by the PCR (shown in Fig. 3 and Tab. 2). Just as expected, the PCR products from the mutants were longer, about 1.5 kb, than that of S. hygroscopicus 17997, and the apramycin resistant phenotype of the mutants remains stable even after they were cultured for many generations. These results demonstrated that pks, gdmM, and gdmN genes were inactivated by insertion of apramycin resistant gene through homologous double-cross recombination. 2.1.3 Identification of mutants’ fermentation products by HPLC: The assay of fermentation products extracted from the parent strain and mutants were carried out by HPLC (Fig. 4). According to the results of Fig. 4a, the retention time of Gdm absorption peak was 24.863 min. However, the two main products, ǻgdmN-1 and ǻgdmN-2, of ǻgdmN mutant were detected. The retention time of ǻgdmN-1 and ǻgdmN-2 was 12.925 min and 25.866 min, respectively. The retention time and ultraviolet absorption type of ǻgdmN-2 were different to that of Gdm(Tab. 3, Fig. 5), although its retention time was near with the Gdm’s. ǻgdmN-2 was likely the progeldanamycin absent of the C7-carbamoyl group because of the inactivation of the carbamoyltransferase gene in the ǻgdmN mutant. However, it was unclear how to produce Tab. 1 Primers used in construction of the gene disruption vector and identification of the mutants Primers P1
Primer sequence (5ƍ–3ƍ) CCGGAATTCCTGAGGCGTCGGGTGGTC(EcoR I)
P2
CGCGGATCCTGTTCTCCGGCTCGTTCG(BamH I)
P3
AAAACTGCAGATGCCACGACCGCTGCTC (Pst I)
P4
CTAGTCTAGACCTCGACGGTGTCCGCAC (Xba I)
P5
CCGGAATTCACGGCCTTGGCCAGATCC(EcoR I)
P6
CGCGGATCCATCCACCCCGCCTCGCAC (BamH I)
P7 P8
AAAACTGCAGGCCGTTGAGGCTGGAGTT (Pst I) CTAGTCTAGACCGACTGGTTTGGGTGAT (Xba I)
Ƹpks (F)
CGCGGATCCGGACTTCTACCGTTCGCTCGTGGAC (BamH I)
Ƹpks (R)
CTAGTCTAGACAGGGACCAGCCGATGT (Xba I)
ƸgdmM (F)
CGCGGATCCCCGAGAAGCGGCGGAAGACGAC (BamH I)
ƸgdmM (R)
CTAGTCTAGA CGGTCGGGGTGAGTTGTT (Xba I)
ƸgdmN (F)
CCCAAGCTT CTCGTGGACGGGTTGCT(Hind III)
ƸgdmN (R)
CTAGTCTAGA TCGAACGCCTCCACCTC (Xba I)
Weiqing He et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1133–1139
Fig. 1
Construction of the pks and gdmN gene disruption plasmids
Tab. 2
Amplification products from the genomes of parent strain and gene disruptants
Strains
Fig. 2
Construction of the gdmM gene disruption plasmid
Fig. 3 Electrophoresis of PCR products M1: O/Hind III; M2: marker III 1, 3, 5: parent strain; 2: ǻgdmN; 4: ǻgdmM; 6: ǻpks
ǻgdmN-1 in this mutant, and investigations are being carried out for the identification of its chemical structure. There was only one main product (Rt 14.732) but no Gdm to be detected in the ǻgdmM mutant, which suggested that
ƸgdmN (F-R)
ƸgdmM (F-R)
Ƹpks (F-R)
S. hygroscopicus 17997
3.1 kb
2.5 kb
4.4 kb
Gene disruptants
4.5 kb
4.0 kb
6.0 kb
the mutant cannot produce the Gdm as the gdmM gene disruption. According to the work of Andreas Rascher [10], gdmM gene coding for the monooxygenase was possibly involved in the oxidation of C21 and C17. Inactivation of gdmM gene would lead to produce a progeldanamycin in which C18 was hydroxyl group and C21 or C17 were no substituent group. The characteristic absorption peak of Gdm was not detected from the ǻpks mutant and the production of secondary metabolites was fewer, which demonstrated that this pks gene was responsible for the geldanamycin polyketides chain biosynthesis. 2.2 Gene complementation of the mutant It should be proved that the loss of Gdm production in three mutants was due to inactivation of pks, gdmM, and gdmN but not due to the polar effect resulting in the inactivation of other genes. The Sac I fragment (containing the intact gdmM gene) and Bgl II fragment (containing the intact gdmN gene) obtained from S. hygroscopicus 17997 genomic DNA were cloned into the pKC1139-Km plasmid, and then the recombinant plasmids were introduced into the ǻgdmM and ǻgdmN mutants, respectively, by gene conjugation transfer system. The intact gdmM and gdmN genes were confirmed by PCR in the resultant complementation strains. The complementation strains were fermented in medium
Weiqing He et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1133–1139
Fig. 4
HPLC result of the disruptants fermentation broth
A: S. hygroscopicus 17997; B: ǻgdmN; C: ǻgdmM; D: ǻpks
Fig. 5
with 50 ȝg/mL apramycin and kanamycin, and the broth of fermentation were assayed by HPLC. Geldanamycin production were all restored in the two complementation strains, although Gdm production only gets to 1/3 or 1/9 of the parent strains’ normal level (Fig. 6 and Tab. 4). The complementation experiments excluded the polar effect and confirmed that the gdmM and gdmN gene were necessary for the Gdm biosynthesis. 2.3 coculturing between the mutants The ǻpks and ǻgdmN mutants can complement their gene defects to produce Gdm, ǻgdmN-1, and ǻgdmN-2 when cocultured in the fermentation medium (Fig. 7). Similarly, ǻgdmM and ǻgdmN mutants cocultured in the fermentation medium can produce a little Gdm with some of Rt 14.7 min compound of ǻgdmM mutant. Furthermore, the intact gdmN gene coding for the carbamoyltransferase of the ǻpks and ǻgdmM mutant can catalyze ǻgdmN-2 to form Gdm when ǻgdmN-2 was added into the two mutant fermentation broths.
UV spectrum of main products of mutants
A: Gdm; B: ǻgdmN-1; C: ǻgdmN-2; D: ǻgdmM
These results can demonstrate that ǻgdmN-2 is a progeldanamycin absent of the C7-carbamoyl, maybe similar to the 4,5-dihydro-7-O-descarbamoyl-7-hydroxy Gdm[11]. Simultaneously, the intact pks gene of ǻgdmM mutant and ǻgdmN mutant can also complement the disrupted pks gene of ǻpks mutant to produce Gdm. This study demonstrated that pks, gdmM, and gdmN genes were involved in the Gdm biosynthesis by the gene disruption and complementation experiments. ǻpks mutant can be applied to modification of the Gdm polyketide. The gdmM gene and gdmN gene were likely involved in the post-PKS modification steps at C7, C17, and C21 sites, and these pro-geldanamycin compound produced by the mutant can be used in reforming the structure of Gdm. This work will form the basis for modifying the structure of Gdm to generate new derivatives by combinatorial biosynthesis.
Weiqing He et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1133–1139
Tab. 3 Retention time and peak area of the main products in the mutants Product
Retention time
Peak area
geldanamycin
24.863
6944101
ǻgdmN-1
12.925
10271416
ǻgdmN-2
25.866
4027986
ǻgdmM
14.732
9874614
Tab. 4 Retention time and peak area of geldanamycin of mutant complementation strains
Fig. 6
Identification the fermentation broth of ǻgdmN and ǻgdmM complementation strains by HPLC
A: S. hygroscopicus 17997, B: ǻgdmN complementation, C: ǻgdmN complementation
Strains
Retention time
Peak area
S. hygroscopicus 17997
24.873
7614330
ǻgdmN-complementation
24.575
2386700
ǻgdmM-complementation
24.917
831014
REFERENCES [1]
Prodromou C, Roe SM, O’Brien R, et al. Identification and structural characterization of the ATP/ADP-binding site in the Hsp90 molecular chaperone. Cell, 1997, 90: 65–75.
[2]
Sasaki K, Yasuda H, Onodera K. Growth inhibition of virus transformed cells in vitro and antitumor activity in vivo of geldanamycin and its derivatives. J Antibiot (Tokyo), 1979, 32: 849–851.
[3]
Tao PJ, Lou ZX, Yao TJ, et al. Antiviral study on the broad spectrum antiviral antibiotic 17997 in vitro and in vivo. Chinese J Antibiot, 1997, 22: 368–372.
[4]
Murphy P, Sharp A, Shin J, et al. Suppressive effects of ansamycin on inducible nitric oxide synthase expression and the
development
of
experimental
autoimmune
encephalomyelitis. J Neurosci Res, 2002, 67: 461–470. [5]
Gao QJ, Shang GD, Yang Y, et al. Cloning and molecular analysis
of
geldanamycin
biosynthetic
genes
from
Streptomyces hygroscopicus. Chin J Antibiot, 2002, 27: 13–27. [6]
He WQ, Wang YG. Cloning and analysis of geldanamycin partial
biosynthetic
gene
cluster
of
Streptomyces
hygroscopicus 17997. Chin J Biotech, 2006, 22: 902–906. [7]
Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed, New York: Cold Spring Harbor Laboratory Press 1989.
[8]
Kieser T, Bibb MJ, Buttner MJ, et al. Practical Streptomyces genetics, the John Innes Foundation, Norwich 2000.
[9] Fig. 7
Identification the broth of the disruptants co-culture by HPLC
A: S. hygroscopicus 17997; B: ǻpks and ǻgdmN; C: ǻpks and ǻgdmM; D: add ǻgdmN-2 to ǻpks; E: add ǻgdmN-2 to ǻgdmM
He WQ, Li JY, Sun GZ, et al. Application of RP-HPLC pattern analysis to detect new products of Streptomyces hygroscopicus 17997 mutants. Chin J Antibiot, 2006, 31: 168–171.
Weiqing He et al. / Chinese Journal of Biotechnology, 2008, 24(7): 1133–1139
[10] Rascher A, Hu Z, Buchanan GO, et al. Insights into the
[11] Hong YS, Lee D, Kim W, et al. Inactivation of the
biosynthesis of the benzoquinone ansamycins geldanamycin
carbamoyltransferase gene refines post-polyketide synthase
and herbimycin, obtained by gene sequencing and disruption.
modification steps in the biosynthesis of the antitumor agent
Appl Environ Microbiol, 2005, 71: 4862–4871.
geldanamycin. J Am Chem Soc, 2004, 126: 11142–11143.