Versatile vectors for direct cloning and ligation-independent cloning of PCR-amplified fragments for surface display on filamentous bacteriophages

GENE Gene 190 (1997) 5-10

Versatile vectors for direct cloning and ligation-independent cloning of PCR-amplified fragments for surface display on filamentous bacteriophages’ Aruna Sampath, Smita Abrol, Vijay K. Chaudhary * Department of Biochemistry, University of Delhi South Campus, Benito Juarez Road, New Delhi 110021, India

Received 22 February 1996; revised 18 June 1996; accepted 9 July 1996; Received by S.E. Hasnain

Abstract We have constructed phagemid and phage-based vectors which can be used for both direct (T/A) and ligation-independent cloning (LIC) of PCR products for surface display of encoded peptides/proteins fused with the gII1 protein of the filamentous bacteriophages Ml3 and fd-tet. The vectors harbour a DNA cassette consisting of the 1acZocfragment inserted between the +2 and +3 codons of gIIIp. The 1ucZcl fragment is flanked by several restriction enzyme recognition sites which can be used for conventional blunt- and cohesive-end cloning in addition to T/A cloning and LIC. The cloning strategies lead to the loss of the /ucZz fragment facilitating the selection of the recombinants in XGal plates. The efficiency of direct (T/A) cloning and LIC for surface display in both vectors was evaluated using PCR-amplified fragments encoding a variety of different proteins which included the Fc-binding domain of protein A, the ADP-ribosylation domain of Pseudomonas exotoxin A and a single-chain antibody fragment. The cloning efficiency obtained was 75-85% using the two strategies as monitored by restriction enzyme analysis of the recombinant white colonies on XGal plates. The expression of encoded proteins in recombinants, which were displayed as gIIIp fusions, was found to be 10% in case of T/A cloning but more than 90% in case of LIC. Keywords: Expression vector; Phage display; Phagemid; T/A cloning

1. Introduction Phage display system has emerged as a powerful technique for selecting high-affinity variants of several proteins (Clackson and Wells, 1994) including antibodies (Ab) (Winter et al., 1994). For this, two types of vectors, namely, phagemid and phage vectors, have been developed for monovalent and multivalent display of proteins, respectively. Polymerase chain reaction (PCR)-

* Corresponding author. Tel. +91 11 678876/601955; Fax +91 11 6885270/6886427; e-mail: [email protected] 1 Presented at the International Conference on ‘Eukaryotic Expression Vector Systems: Biology and Applications’, National Institute of Immunology, New Delhi, India, 4-8 February 1996. Abbreviations: Ab, antibody(ies); ABTS, 2,2’-azino-bis(3’-ethylbenzthiazoline-6-sulfonic acid); blu, gene encoding j3-lactamase (Bla); bp, base pair(s); dNTPs, deoxyribonucleoside triphosphates; ELISA, enzyme-linked immunosorbent assay; Fc, crystallizable fragment of an antibody; gIIIp, gene III encoded minor coat protein of bacteriophage M 13; gIZIP, gZIZ promoter; glllss, gZIZ signal sequence; 0378-1119/97/$17.000 1997 El sevier Science B.V. All rights reserved PII SO378-1119( 96)00709-3

based amplification methods are routinely used for cloning various DNA fragments. This technique is also being used for cloning and mutagenizing Ab-encoding genes in combination with phage display vectors (Deng et al., 1994). One of the commonly practised techniques is to create unique restriction enzyme recognition sites at both ends of the PCR product using specific primers. However, PCR products are often difficult to be digested by restriction enzymes (Kaufman and Evans, 1990;

HRP, horseradish peroxidase; IgG, immunoglobulin G; IPTG, isopropyl-8-n-thiogalactopyranoside; lacZp0, lac promoteroperator; LB, Luria-Bertani (medium); LIC, ligation-independent cloning; moi, multiplicity of infection; nt, nucleotide(s); ori, origin of DNA replication; PBS, phosphate-buffered saline (20 mM Na phosphate buffer/l 50 mM NaCl pH 7.4); PCR, polymerase chain reaction; PE, see Table 1, footnote b; pelBss, pelB signal sequence: PolIk, Klenow fragment of E. coli DNA polymerase I; RBS, ribosomebinding site; scFv, single chain variable domain of an antibody; T/A, see section 2.1; Tat, p55 peptide of the IL2 receptor ([Junghans et al., 5-bromo-4-chloro-3-indolyl-B-n-galactopyranoside; 19901); XGal, 2 x YT, 16 g Bacto-tryptone/lO g yeast extract/5 g NaCl per litre pH 7.2.

6

A. Sampath et al. / Gene I90 (1997) 5-10

Abrol and Chaudhary, 1993). Several methods for direct cloning of PCR products have been described earlier (Kovalic et al., 1991; Mead et al., 1991; Cha et al., 1993, 1994). In these methods, the PCR fragments carrying a single dAMP residue at the 3’termini added in a template-independent manner by Taq polymerase (Clark, 1988) are cloned into vectors carrying T-overhangs. Alternatively, the ends of the PCR-amplified fragments can be made blunt using PolIk and cloned into blunt-end vectors (Lohff and Cease, 1991). However, in these systems the orientation of the insert cannot be controlled. Other methods include ligationindependent cloning (LIC) (Aslandis and De Jong, 1990; Haun et al., 1992) in which the PCR primers are so designed that after amplification, the inserts upon exonucleolytic treatment with T4 polymerase in the presence of one of the dNTPs produce lo-12 nucleotide (nt) specific overhangs which can be annealed with the specific complementary ends created in the vector. The circularized DNA can then be introduced directly into the bacteria where the nicks are covalently joined and the recombinant plasmid is replicated, thus, obviating the need for an in vitro ligation reaction. In this paper, we describe phage and phagemid vectors which can be used to clone PCR-amplified fragments either by direct (T/A) cloning or by LIC in-frame with gI11 of filamentous bacteriophage (Ml 3 and fd-tet) for surface display of the encoded foreign peptides.

2. Experimental and discussion The vectors described here are derived from our phagemid-based vector pVCCD43426 (Abrol et al., 1994; Kushwaha et al., 1994) and previously described phage display vector, fd-tet (Zacher et al., 1980). The phage display vector, fdtetTA74, carries the gene encoding the gIIIp signal sequence (Fig. 1A), while the phagemid-based display vector, pVC3TA726, carries the gene encoding the PelB signal sequence (Fig. 1B). A DNA cassette has been inserted between the + 2 and +3 codons of gIIIp as a NheI-MluI fragment in both the vectors. The DNA cassette consists of the sequence encoding the u-fragment of E. coli IacZ gene comprising of the laczpo, RBS and the first 58 codons of 1acZ (Fig. 1C). The a-fragment is flanked by several restriction sites; NheI, EcoRV, XcmI and BssHII at the 5’end and BssHII, Xc&, EcoRV and MluI at the 3’end. For LIC, a set of two specific primers has been designed for the amplification of the insert in which the 5’ half of each PCR primer carries a unique 14 nt sequence while the 3’half depends upon the desired gene to be amplified (Fig. 1D).

2.1. Direct (T/A) cloning of the PCRproducts For direct cloning of PCR-amplified products, the vector is digested with XcmI and the large fragment carrying T-overhangs is ligated with the PCR-amplified insert followed by transformation in a suitable host expressing the w-fragment of ZacZ (Fig. 2A). The recombinants should produce white colonies in XGal plates due to the loss of a-fragment. This method was adopted for cloning the Fc-binding B domain of protein A (Kushwaha et al., 1994) in the phagemid vector, pVC3TA726. It was observed that more than 90% colonies were white in XGal plates (Table 1). However, restriction analysis showed that only 75% of the white clones contained the plasmid with the insert which were present in both orientations with equal frequency. The clones carrying the insert in the right orientation were used to produce phage particles after superinfection with the helper phage VCSM13. These phages were analysed by affinity capture phage ELISA for their ability to bind human IgG (Kushwaha et al., 1994). It was found that phages produced by only 10% of the clones with insert could bind human IgG. The cloning strategy had been so designed that proper cloning of the dA-tailed PCR product in XcmI-cut vector with T-overhangs would restore both the EcoRV sites and the reading frame of gIIIp. It was observed that only the clones with the PCR product inserted in the right orientation with intact EcoRV sites expressed the B-domain-gIIIp fusion protein and produced phage particles which could bind human IgG (data not shown). These results indicate that although the cloning efficiency using this protocol is high, only a small percentage of the clones with the insert in correct orientation have the proper reading frame restored with respect to gIIIp. This could be due to the loss of nt at either of the junctions as observed earlier (Mead et al., 1991) that would result in an improper reading frame. Thus, direct cloning of PCR products proves to be efficient but may not be suitable for the expression of the inserts as fusion proteins. A vector designed with HphI sites (Mead et al., 1991) could perhaps reduce the frequency of mis-ligation of non-compatible ends. 2.2. Ligation-independent cloning (LIC) of the PCRamph$ed fragments In this strategy, the vector is digested with &HI1 followed by isolation of the large fragment; this fragment is treated with T4 DNA polymerase in the presence of dATP which produces specifically designed overhangs of 13 and 12 nt at the two ends of the linearized vector. In a separate reaction, the desired insert is amplified using a specific set of primers (Figs. lD, 2Ba and 2Bb). The amplified product is also treated with T4 DNA polymerase in the presence of TTP which produces 12

A. Sampath et al. 1 Gene 190 (1997) 5-10

(4

(6)

03 Primers used for PCR amplification of the inserts. (a) 5’primfir S~CTGGTGGGCGCGAT 15-18 nt specific to the inseft w 3

(b)

3’ primer

5’a

15-18 CCClTGGCGCGACC

nt specific

to the insert )3

Fig. 1. Phage (fdtetTA74) and phagemid (pVC3TA726) display vectors. (A) fdtetTA74 consists of the iacZ-cc fragment cassette as a NheI-MuI insert between the + 2 and + 3 codons of gIIIp of fd-tet. A decapeptide tag (c-my) has been inserted between the lucZ-a cassette and codons 3-406 of gII1. The vector also contains the tet gene (tetracycline resistance) and all other phage genes. Only the relevant genes have been shown. (B) pVC3TA726 consists of a gene fusion cassette under IacZpo between Hind111 and EcoRI sites of pUCl19. The cassette comprises of the DNA encoding the peZB signal sequence (pelBss), lacZ-a fragment cassette, c-myc tag and codons 3-406 of gZII as in A. The vector also contains f 1 ori (MI3 IG), ColEl ori (ori) and b/a. (C) 1acZa fragment cassette in fdtetTA74 and pVC3TA726 comprises of the IacZpo, RBS, codons 1-58 of E. coli IacZ followed by two translational stop codons. The cassette is flanked by the sites for NheI, EcoRV, XcmI and BssHII at the 5’end and BssHII, XcmI, EcoRV and MluI at the 3’end. In both the vectors, the IacZ cassette was preceded by a stop codon after the first BssHII site in order to terminate the translation product initiating from an upstream AUG. Amino acids (aa) shown in circles are in-frame with the start codon and the aa in boxes are in-frame with gIIIp. (D) Sequence of the PCR primers used for amplification of the insert. The ‘T’shown in the box can be added to each primer if the inserts were to be cloned only by LIC. Methods: pVC3TA726 was constructed by inserting a PCR-amplified fragment of the E. coli IacZ gene (accession No. 501636, 1162-1460 bp) comprising of IacZpo, RBS and the nt sequence encoding codons l-58 of E. coli IacZa (kzcZ-a) and two translational stop codons into pVCCD43426 (Abrol et al., 1994) as a NheI-MluI insert. fdtetTA74 was constructed by inserting the IucZa fragment cassette along with c-my from pVC3TA726 into NheI +KpnI-digested fdtetTA4. The latter is a derivative of fd-tet (Zacher et al., 1980) in which MluI and EcoRV sites were deleted from the tet’ gene and NheI and KpnI restricton recognition sites were inserted between codons + 2 and + 3 of gIIIp by site-directed mutagenesis.

and 11 nt long specific overhangs which are different in sequence from each other (Fig. 2Bc) but complementary to that produced in the vector (Fig. 2Be). Mixing of the insert and the vector results in the annealing of the compatible ends and the formation of a gapped circular DNA (Fig. 2Bf ), which upon transformation in a host producing the w-fragment of ZacZ yields white colonies on XGal plates. This strategy was employed for cloning and surface display of several ligands such as Fc-binding B domain of protein A, the ADP-ribosylating domain of Pseudomonas exotoxin A (Chaudhary et al., 1988) and anti-Tat (scFv), a single chain Fv fragment of the anti-Tat Ab which binds to the ~55 subunit of interleukin-2 receptor (Chaudhary et al., 1989) in the phagemid-based vector, pVC3TA726. Analysis of the

plasmid DNA isolated from these white colonies revealed that 90-100% of the clones contained the desired insert (Table 1) in the right orientation. Further restriction analysis showed that the recombinants contained the EcoRV sites flanking the insert thereby indicating that the inserts should be in frame with gIIIp. The recombinants were used to produce phage particles by superinfection with the helper phage, VCSM13. All the recombinants with the phagemid carrying the insert produced phage particles, which specifically bound to their respective counterparts and could be detected in affinity capture phage ELISA as in the case of anti-Tat phages (Fig. 3). Similar results were obtained using phages displaying B domain of protein A and ADPribosylating domain of Pseudomonas exotoxin A, which

A. Sampath et al. 1 Gene 190 (1997) 5-10

8 xcd

BssHIl

GCTAGCCAGATA&msGTGGdCGCGCCTXA CGATCGGTCTATAGACCACCCGCGCGGATT

BssHII Xcml T~T~AcG~GCGCCAnGGc~T*TCTGGACGCGT ATTATTCCGCGCGGTTCCCTATAGACCTGCGCA

(4 DIRECT

(T/A) CLONING

UoATloN

INDEPENDENT

CLONING

(LtC)

GCTAGCCAGATM

EcoRV

EcoRV

Fig. 2. Strategies for cloning of PCR products by (A) T/A cloning and (B) ligation-independent cloning. The ‘T’and ‘A shown in boxes are the T-overhangs produced in the vector after XcmI digestion and the A-overhangs in the PCR products; ‘*’indicates a stop codon and ‘- ’indicates a gap. Methods: The vector was cut to completion with Xc& (A) or BssHII (B) and the 4.5kb fragment was purified from the IacZ-cc fragment in a 1.2% low melting point gel (FMC BioProducts) and further extracted by QIA-quick gel extraction kit (Qiagen). The insert was PCR amplified (Bab) using primers shown in Fig. 1D and processed further by QIA-quick PCR purification kit (Qiagen) to remove residual dNTPs and oligodeoxynucleotides. For T/A cloning (A), 100 ng of the _&&cut vector and 100 ng of the PCR product were used for the ligation reaction using 600 units of T4 ligase (New England Biolabs). For LIC (B), 100 ng of the linearized vector (Bd) and 100 ng of the PCR product (Bb) were treated with 3 units of T4 DNA polymerase (New England Biolabs) in separate reactions in the presence of 0.5 mM dATP (Be) or TTP (Bc), respectively. The reaction was carried out in a 100~ulmixture containing 20 mM Tris acetate/l0 mM Mg acetate/50 mM K. acetate/l mM dithiothreitol, pH 7.9 at 37°C for 30 min. The enzyme was then heat inactivated at 70°C for 10 min. For the annealing reaction, the vector and the PCR product were mixed and heated at 55°C for 3 min and allowed to come to room temperature slowly (Bf). The mixture was then precipitated with Na acetate/ethanol, centrifuged, dried and suspended in 20 ul of 1 mM Tris HCl/O.l mM EDTA, pH 8.0, and allowed to stand at room temperature for 2 h and transformed into E. coli XL-1 Blue cells.

could be selectively captured on microtitre plates coated with human IgG and with anti-PE Ab, respectively (data not shown). This strategy introduces an additional nine codons both at the N and C termini of the insert, but these may not affect the binding as shown in the case of anti-Tat phages (Fig. 3). Thus, the overall efficiency of cloning and expression of foreign proteins as fusion with gIIIp by this method was more than 85% (Table 1). Similar results were obtained using the phage vector fdtetTA74 (data not shown). The efficiency of cloning and expression would also depend on the purity of the PCR products. This is because the non-specifically amplified DNA can also undergo LIC. We found this to be true in the case of anti-Tat phages (Table 1) where

the PCR-amplified product contained minor contamination thereby 10% of the recombinants contained inserts of different sizes. In the LIC strategy described here, the annealed product generates a single nt gap on both ends of the insert which get filled after transformation in the host. This gap is due to the fact that these vectors and the primers used for amplification of the insert have also been designed to be used for direct cloning of the PCR products by taking advantage of the single 3’ dA-overhangs in the insert and the single 5’T-overhangs in the vector. If the inserts were to be cloned only by LIC, primers could be synthesized with an additional T-residue at their 5’ends to avoid the gap produced on vector-insert annealing (Fig. 1D) .

9

A. Sampath et al. / Gene 190 (1997) 5-10 Table 1 Comparison

of the efficiency PCR productb

T/A cloning LIC

B domain B domain anti-Tat PE

of cloning

and expression

in direct (T/A) cloning

and ligation-independent

cloning

(LIC)” Clones expressing

(%)

White transfonnants with insertsd (%)

White transformants in-frame with gIIIp” (%)

(%)

90 89 81 95

15 100 100 100

10 100 100 100

100 (7) 100 (89) 90 (73) 100 (95)

White transformantsC

fusion protein’

“In each experiment 24448 clones were analysed. bB domain, Fc-binding domain of Staphylococcal protein A; anti-Tat, single-chain variable domain of anti-Tat monoclonal Ab; PE. ADPribosylation domain of Pseudomonas exotoxin. “Transformants using E. coli XL-l Blue cells and XGal plates. The efficiency of the competent cells averaged (l-6) x 10s colony forming units/ug supercoiled pUCll9-based plasmid DNA. dTransformants with inserts as analysed by restriction enzyme digestion. The values are number of clones in percent with respect to ‘. “Transformants with EcoRV sites restored at both junctions. The values are number of clones in percent with respect to d. ‘Transformants with inserts flanked by EcoRV sites expressing the fusion protein with gIIIp as detected by affinity capture phage ELISA on microtitre plates coated with the respective counterpart. The values are number of clones in percent with respect to e. The numbers in parentheses indicate the actual percentage of white transformants’ displaying the desired foreign proteins.

0.0~ 107

109 108 Phage number

10’0

Fig. 3. Affinity capture phage ELISA of anti-Tat phages produced by clones resulting from LIC. The filled circle (0) represents anti-Tat phages produced from pVC73426 (Bhardwaj et al., 1995); the open triangle (a) open square (0) and open circle (0) represent anti-Tat phages produced from the phagemid recombinants which resulted from LIC. Methods: The phage particles were produced from 2.5 ml culture of XL-l Blue cells harbouring the desired phagemid in LB medium containing ampicillin (100 kg/ml), tetracycline (10 ug/ml) and kanamycin (50 ug/ml), infected with the helper phage VCSM13, at a moi of 20 as described earlier (Kushwaha et al., 1994). The anti-Tat phages in the culture supernatant were captured on biotinylated ~55 immobilized on streptavidin. The bound phages were then probed with mouse anti-gVIII-HRP (Bhardwaj et al., 1995).

3. Conclusions

We have described versatile phage and phagemidbased vectors for the cloning and display of foreign peptides as fusions with gIIIp on the surface of filamentous phages, Ml3 and fd-tet. These vectors can be used for (I) direct cloning of PCR products by generating 3’ T-overhangs in the vector, (2) LIC by virtue of annealing

of insert and vector carrying 11-13 nt complementary and specific overhangs which are generated upon exonucleolytic treatment with T4 polymerase in the presence of one of the dNTPs, (3) blunt-end cloning in the EcoRV-cut vector and (4) cohesive-end cloning in the NheI+MluI-cut vector. These vectors also provide a direct selection of the recombinants in XGal plates due to the loss of lucZ-cc fragment. In case of T/A cloning, the cloning efficiency of PCR products was low due to the loss of nt at either of the junctions. However, the T/A cloning with this vector could be useful for cloning and surface display of dA-tailed DNA fragments of random sizes generated after DNase I treatment under limiting conditions in the presence of Mn’+ (Melgar and Goldthwait, 1968). The dA tailing can be done by treating the DNA fragments with Tuq or Tth polymerase in the presence of dATP (Clark, 1988). Since DNase I does not have any site preference and the dA-tailed fragment can get inserted in two orientations, one of every 18 clones should have both the insert and the gIIIp in the right reading frame so that the encoded peptide/protein is displayed on the phage surface.

Acknowledgement

The authors are thankful to Dr. George Smith for providing fd-tet and to Dr. Ira Pastan for providing ~55. A.S. and S.A. are recipients of research fellowships from the Council of Scientific and Industrial Research, India. The authors are also thankful to Mr. Devesh Bhardwaj, Mr. Sanjay Gupta, Ms. Ashima Kushwaha and Dr. P.K. Ghosh for carefully reading the manuscript. This work was supported by the Department of Science and Technology, Government of India.

10

A. Sampath et al. 1 Gene 190 (1997) 5-10

References Abrol, S. and Chaudhary, V.K. (1993) Excess primers inhibit DNA cleavage by some restriction endonucleases. Biotechniques 15, 630-632. Abrol, S., Sampath, A., Arora, K. and Chaudhary, V.K. ( 1994) Construction and characterization of Ml3 bacteriophage displaying gpl20 binding domains of human CD4. Indian J. Biochem. Biophys. 31, 302-309. Aslandis, C. and De Jong, P.J. (1990) Ligation independent cloning of PCR products (LIC-PCR). Nucleic Acids Res. 18, 6069-6074. Bhardwaj, D., Singh, S.S., Abrol, S. and Chaudhary, V.K. (1995) Monoclonal antibodies against a minor and the major coat proteins of filamentous phage M13: their application in phage display. J. Immunol. Methods 179, 165-175. Cha, J., Bishai, W. and Chandrasegaran, S. (1993) New vectors for direct cloning of PCR products. Gene 136, 369-370. Cha, J., Bishai, W. and Chandrasegaran, S. (1994) Corrigendum: New vectors for direct cloning of PCR products. Gene 141, 149. Chaudhary, V.K., Mizukami, T., Fuerst, T.R., FitzGerald, D.J., Moss, B., Pastan, I. and Berger, E.A. (1988) Selective killing of HIV infected cells by recombinant human CD4-Pseudomonas exotoxin hybrid protein. Nature 335, 369-372. Chaudhary, V.K., Queen, C., Junghans, R.P., Waldmann, T.A., FitzGerald, D.J. and Pastan, I. (1989) A recombinant immunotoxin consisting of two antibody variable domains fused to Pseudomonas exotoxin. Nature 339, 394-397. Clackson, T. and Wells, J.A. (1994) In vitro selection from protein and peptide libraries. Trends Biotechnol. 12, 173-184. Clark, J.M. (1988) Novel non-ternplated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 16, 9677-9686. Deng, Su-jun., MacKenczie, C.R., Sadowska, J., Michniewicz, J., Young, N.M., Bundle, D.R. and Narang, S.A. (1994) Selection of

antibody single-chain variable fragments with improved carbohydrate binding by phage display. J. Biol. Chem. 269, 9533-9538. Haun, R.S., Serventi, I.M. and Moss, J. (1992) Rapid reliable ligation independent cloning of PCR products using modified plasmid vectors. Biotechniques 13, 5155518. Junghans, R.P., Waldmann, T.A., Landolfi, N.F., Avdalovic, N.M., Schneider, W.P. and Queen, C. (1990) Anti-Tat-H, a humanized antibody to the interleukin 2 receptor with new features for immunotherapy in malignant and immune disorders. Cancer Res., 50, 1495-1502. Kaufman, D.L. and Evans, G.A. (1990) Restriction endonuclease cleavage at the termini of PCR products. Biotechniques 9, 304-306. Kovalic, D., Kwak, J.-H. and Weisblum, B. (1991) General method for direct cloning of DNA fragments generated by the polymerase chain reaction. Nucleic Acids Res. 19, 4560. Kushwaha, A., Chowdhury, P.S., Arora, K., Abrol, S. and Chaudhary, V.K. (1994) Construction and characterization of Ml3 bacteriophage displaying functional IgG-binding domains of Staphylococcal protein A. Gene 151, 45-51. Lohff, C.J. and Cease, K.B. (1991) PCR using a thermostable polymerase with 3’to 5’exonuclease activity generates blunt end products suitable for direct cloning. Nucleic Acids Res. 20, 144. Mead, D.A., Pey, N.K., Herrnstadt, C., Marcil, R.A. and Smith, L.M. (1991) A universal method for the direct cloning of PCR amplified nucleic acid. Biotechnology 9, 657-663. Melgar, E. and Goldthwait, D.A. (1968) Deoxyribonucleases II. The effects of metals on the mechanism of action of deoxyribonucleases I. J. Biol. Chem. 243, 4409-4416. Winter, G., Griffiths, A.D., Hawkins, R.E. and Hoogenboom, H.R. (1994) Making antibodies by phage display technology. Annu. Rev. Immunol. 12,4333455. Zacher III, A.N., Stock, CA., Golden II, J.W. and Smith, G.P. (1980) A new filamentous phage cloning vector: fd-tet. Gene 9, 127-140.