Vibrio salmonicida pathogenesis analyzed by experimental challenge of Atlantic salmon (Salmo salar)

Microbial Pathogenesis 52 (2012) 77e84

Contents lists available at SciVerse ScienceDirect

Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath

Vibrio salmonicida pathogenesis analyzed by experimental challenge of Atlantic salmon (Salmo salar) Ane Mohn Bjelland a, *, Renate Johansen b, Espen Brudal a, Hilde Hansen c, Hanne C. Winther-Larsen d, Henning Sørum a a

Section for Microbiology, Immunology and Parasitology, Department of Food Safety and Infection Biology, Norwegian School of Veterinary Science, PO Box 8146 Dep, 0033 Oslo, Norway Section for Pathology, Department of Laboratory Services, Norwegian Veterinary Institute, PO Box 750 Sentrum, 0106 Oslo, Norway c The Molecular Biosystems Research Group, Institute of Chemistry, Faculty of Sciences, University of Tromsø, N-9037 Tromsø, Norway d Laboratory for Microbial Dynamics (LaMDa) and Department of Pharmaceutical Biosciences, University of Oslo, PO Box 1068, Blindern, 0316 Oslo, Norway b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 8 July 2011 Received in revised form 21 October 2011 Accepted 27 October 2011 Available online 4 November 2011

Cold-water vibriosis (CV) is a bacterial septicemia of farmed salmonid fish and cod caused by the Gramnegative bacterium Vibrio (Aliivibrio) salmonicida. To study the pathogenesis of this marine pathogen, Atlantic salmon was experimentally infected by immersion challenge with wild type V. salmonicida and the bacterial distribution in different organs was investigated at different time points. V. salmonicida was identified in the blood as early as 2 h after challenge demonstrating a rapid establishment of bacteremia without an initial period of colonization of the host. Two days after immersion challenge, only a few V. salmonicida were identified in the intestines, but the amount increased with time. In prolonged CV cases, V. salmonicida was the dominating bacterium of the gut microbiota causing a release of the pathogen to the water. We hypothesize that V. salmonicida uses the blood volume for proliferation during the infection of the fish and the salmonid intestine as a reservoir that favors survival and transmission. In addition, a motility-deficient V. salmonicida strain led us to investigate the impact of motility in the CV pathogenesis by comparing the virulence properties of the mutant with the wild type LFI1238 strain in both i.p. and immersion challenge experiments. V. salmonicida was shown to be highly dependent on motility to gain access to the fish host. After invasion, motility was no longer required for virulence, but the absence of normal flagellation delayed the disease development. Ó 2011 Elsevier Ltd. All rights reserved.

Keywords: Vibrio salmonicida Cold-water vibriosis Pathogenesis Virulence Motility

1. Introduction Cold-water vibriosis (CV) is a bacterial septicemia of farmed salmonid fish [1e4] characterized by anemia and extended petechial hemorrhages, especially in the integument surrounding the internal organs of the fish, in the vent region and at the base of the pectoral, pelvic and anal fins. As its name indicates, the disease occurs mainly in late autumn, winter and early spring when the seawater temperature is below 10
C [1]. Although affecting mainly farmed Atlantic salmon (Salmo salar), CV is identified in both farmed rainbow trout (Oncorhynchus mykiss) and wild caught captive and farmed Atlantic cod (Gadus morhua) [2,4].

Abbreviations: AFM, Atomic force microscopy; BA2.5, Blood agar with 5% ox blood and 2.5% NaCl; CFU, Colony forming units; CV, Cold-water vibriosis; LB1, Luria Bertani broth with 1% NaCl; LB3, Luria Bertani broth with 3% NaCl; OMVs, Outer membrane vesicles. * Corresponding author. Tel.: þ47 22597416; fax: þ47 22964818. E-mail address: [email protected] (A.M. Bjelland). 0882-4010/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.micpath.2011.10.007

The causal agent of CV is the cold- (psychrophilic) and saltadapted (halophilic) bacterium Vibrio (Aliivibrio) salmonicida. This marine bacterium is a Gram-negative curved and motile rod which carries up to nine polar flagella [1]. V. salmonicida and its three closely related species Vibrio fischeri, Vibrio logei and Vibrio wodanis were recently proposed reclassified into a new genus, Aliivibrio gen. nov., resulting in the new name A. salmonicida [5]. The species designation A. salmonicida is, however, already occupied by the well-established abbreviation of A. salmonicida, the etiological agent of furunculosis in salmonids. To avoid possible nomenclature confusion, the name V. salmonicida will be used throughout this paper. V. salmonicida shows a high potential for starvation and survival in the ocean environment and the numbers of V. salmonicida in fish farm seawater ranges from 12 to 43 bacteria/ml with concentrations being highest during the winter period when the total bacterial count in seawater generally is at the lowest [6e8]. The pathogen is suggested to be transmitted through seawater between salmonids either as bacterioplankton or on the surface of particles

78

A.M. Bjelland et al. / Microbial Pathogenesis 52 (2012) 77e84

[3,9,10]. V. salmonicida is detected in fish farms and fish farm sediments without a foregoing CV history, and in feces from fish that survived an experimental infection [6,8,11]. Based on these observations, an asymptomatic carrier state of the disease has been proposed, indicating that healthy salmon release bacteria into the environment. Additionally, a former study described nonpathogenic intestinal strains of V. salmonicida isolated in various amounts as parts of the ubiquitous intestinal microflora in Atlantic salmon, Atlantic cod, saithe (Pollachius virens), and Atlantic herring (Clupea harengus) [12]. Several studies have tried to uncover the pathogenicity of V. salmonicida [13e17]. The gills, skin and GI tractus have previously been suggested as the portal of entrance in V. salmonicida infections, but no clear conclusion has been made [11,12,18e20]. After challenge, but before the fish shows clinical signs of disease, V. salmonicida are only detected in the lumen of the capillaries. The first targets of V. salmonicida are reported to be the endothelial cells of the capillaries and leukocytes of the blood in which the bacteria are internalized. In the later stages of infection endothelial cells are completely disintegrated and actively proliferating bacteria can be detected in the extravascular space and in the surrounding tissue [16]. Flagellar motility helps the bacteria to reach the most favorable environments and to successfully compete with other microbes. These complex organelles also play an important role in adhesion to substrates and biofilm formation. Thus, motility is linked to colonization and virulence in several bacteria including species in the Vibrio group and attenuated virulence due to loss of motility have been thoroughly described [21e26]. Previous studies have shown that V. salmonicida motility is regulated by environmental factors such as osmolarity and temperature [27]. Although motility is suggested as a virulence factor of V. salmonicida [27], the direct impact of motility in the V. salmonicida pathogenesis has never been studied. In this work, we attempt to further elucidate the pathogenesis of V. salmonicida by including the contribution of motility to the bacterial virulence. 2. Material and methods 2.1. Bacterial strains and culture conditions Strains used in this study are listed in Table 1. The V. salmonicida wild type strains NCMB2262 (type strain) and LFI1238 (genomic sequenced strain) were originally isolated from the head kidney of a CV diseased Atlantic salmon and Atlantic cod, respectively [1,28]. The intestinal strains of V. salmonicida were originally isolated from Atlantic salmon (2A4h, T3B1, T3B2, TA22, TA30), Atlantic cod (PT2T, T6) and Atlantic herring (T2S1) [12]. Bacteria were grown on blood agar base No. 2 (Oxoid, Cambridge, UK) supplemented with 5% ox blood and 2.5% NaCl (BA2.5) or in Luria Bertani broth with 3% NaCl (LB3) with agitation (200 rpm) at 8
C for 2e4 days unless otherwise stated. Escherichia coli S17-1 cells were cultivated in Luria Bertani broth or agar at 37
C [29,30]. For selection of E. coli transformants or V. salmonicida transconjugants a final concentration of 25 mg/ml or 2 mg/ml chloramphenicol were added to the medium, respectively. 2.2. DNA isolation, PCR and 16S rDNA sequencing For 16S rDNA analysis, total nucleic acids were extracted either by using the Qiagen DNAeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) or the MoleStrips DNA Blood Kit (Mole Genetics AS, Lysaker, Norway) according to the manufacturer’s instructions. When using the MoleStrips DNA Blood Kit and before the samples were processed by the GeneMoleÒ automatic nucleic acid extractor,

Table 1 Bacterial strains, plasmids and primers used in this study. Strain or primer Strains V. salmonicida LFI1238 NCMB2262 Δqrr MOT2A4h T2S1 T3B1 T3B2 TA22 TA30 PT2T T6 E. coli S17-1 Plasmids pDM4 pNQ705 pDM4Δqrr pNQ705qrr

Description or sequence

Source or reference

Wild type; isolated from Atlantic cod, sequenced strain Wild type; isolated from Atlantic salmon, type strain LFI1238 containing an in-frame deletion in qrr Dqrr complemented with the LFI1238 qrr gene; Cmr Isolated from head kidney of CV diseased Atlantic salmon Intestinal isolate from Atlantic herring Intestinal isolate from Atlantic salmon Intestinal isolate from Atlantic salmon Intestinal isolate from Atlantic salmon Intestinal isolate from Atlantic salmon Intestinal isolate from Atlantic cod Intestinal isolate from Atlantic cod

[28]

[12] [12] [12] [12] [12] [12] [12]

Donor strain for conjugation, l-pir

[30]

r

Cm ; suicide vector with an R6K origin (l-pir requiring) and sacBR Cmr; suicide vector with an R6K origin (l-pir requiring) pDM4 containing a fragment of qrr harboring an internal deletion pNQ705 containing wild type qrr and flanking sequences

[1] This study This study [12]

[22] [22] This study This study

Primers (50 e30 ) 16S rDNA sequencing primers for identification of intestinal strains and verification of V. salmonicida B27F AGAGTTTGATCATGGCTCAGA [32] U1492R GGTTACCTTGTTACGACTTC [31] Primers used for construction and verification of Dqrr and MOT-: Qrr A-F TAACTCGAGCGATAAAGCGCAGCAACA Qrr B-R AACCGTAATATACCGCCTTTGGCTTAAAGGGTC Qrr C-F CGGTATATTACGGTTGGCTTC Qrr D-R CGAACTAGTAAGAAGGAGCGAGTTATCAATC Qrr E-F GGCAACATCAATAGAACCAT Qrr F-R GGCTGATATTCTTGAATTGG Pnq-F TAACGGCAAAAGCACCGCCGGACATCA Pnq-R TGTACACCTTAACACTCGCCTATTGTT

This This This This This This * *

study study study study study study

* Kindly provided by Professor Debra Milton, Umeå University, Sweden.

the samples were first incubated with 180 ml lysis buffer (20 mM Tris HCl pH 8.0, 2 mM sodium EDTA, 1.2% TritonÒ X-100 and 20 mg/ ml lysozym) at 37
C for 30 min, following the addition of 100 ml of the solution from well 2 of the MoleStrips and 20 ml Proteinase K (Qiagen) with further incubation at 56
C for 30 min. Amplification of 16S rDNA was performed using a bacterium-specific forward primer B27F and a universal reverse primer 1492R DNA obtained from Medprobe (Eurogentec, Liege, Belgium) [31,32]. The PCR reagents were obtained from Fermentas (Thermo Fischer Scientific, Waltham, MA, USA) and the PCR reactions were performed using standard protocols [33]. The primers used for sequencing are listed in Table 1.

2.3. Construction of a motility-deficient strain of V. salmonicida LFI1238 During mutant construction experiments in V. salmonicida LFI1238, a motility-deficient Dqrr mutant was observed. The qrr mutation was complemented by the insertion of a functional qrr gene into the original locus. This rescue mutant (MOT-) maintained the motility-deficient phenotype. The protocols for mutant

A.M. Bjelland et al. / Microbial Pathogenesis 52 (2012) 77e84

construction, complementation and conjugation are described elsewhere [22,34,35]. In brief, the Dqrr allele was made by allelic exchange, fusing together two PCR amplified products flanking the sequence to be deleted. The fused PCR product was cloned into pDM4 and transformed into E. coli S17-1 cells before conjugation with V. salmonicida. Similarly, MOT- was made by amplifying the complete ORF of qrr from the wild type genome of V. salmonicida LFI1238. The PCR product was cloned into pNQ705, transformed into E. coli S17-1 and finally introduced into the Dqrr mutant by conjugation. DNA extraction, general recombinant DNA techniques and transformations were performed using standard protocols [33]. Restriction enzyme digestion, ligation and plasmid purification were performed as recommended by the manufacturers (NEB Biolabs, OMEGA Bio-Tek, Ipswich, MA, USA). PCR (Phusion, FinnZyme, Espoo, Finland) and Big Dye sequencing (Applied Biosystems, Carlsbad, CA, USA) were performed with custom made primers synthesized by Sigma (St.Louis, MS, USA) and Operon (Leeds, UK). Bacterial strains, plasmids and primers used are listed in Table 1. 2.4. Motility assay The bacterial swimming motility was studied by phase contrast microscopy and assayed using LB soft agar plates (0.25% agar) supplemented with 3% NaCl. Single colonies of LFI1238 and MOTwere used to initiate cultures that after overnight incubation were diluted 1:40 in LB3 and grown until an OD600 equal 0.4. Then, 3 ml of the cultures were spotted into the center of the soft agar plates and incubated at 8
C for 5 days. The diameter of the migration zone was measured every 24 h and compared between the LFI1238 and MOT-. The experiment was performed with biological triplicates and repeated twice. 2.5. Atomic force microscopy (AFM) Atomic force microscopy (AFM) was performed on the V. salmonicida LFI1238 and MOT- strains grown on BA2.5 for 72 h at 8
C and from the motility assay plates. For AFM bacterial colony material were scraped from plates with sterile loops and resuspended in 10 mM Tris/MgCl2 buffer. 10 ml cell suspensions were applied on freshly cleaved mica surfaces and allowed to adhere for 10 min before being washed with deionized water. Excess water was removed, and the slides gently dried using nitrogen gas. Images were recorded in intermittent-contact mode at room temperature using a NanoWizard Microscope (JPK Instruments AG, Berlin, Germany) with a scan frequency of 1.0 Hz using ultrasharp silicon cantilevers with silicon etched probe tips, NSC35/AlBS (MikroMasch, Madrid, Spain). AFM images were analyzed using The NanoWizardÒ IP Image Processing Software (JPK Instruments AG). 2.6. Trial 1: distribution of V. salmonicida in infected salmon 2.6.1. Trial 1A e freshwater Forty Atlantic salmon (fry) of 40 g were kept in a 200 l tank supplied with oxygenized and carbon filtered freshwater at a temperature of z7
C. The V. salmonicida LFI1238 strain that was recently passaged through fish to verify and prepare virulence, was cultured in LB3 at 8
C for 3 days. The salmon were challenged by immersion in a separate tank containing seawater (7
C, 35 ppm) with V. salmonicida LFI1238 added to a final concentration of 106 CFU/ml. The challenge doses used in all experiments (Trial 1A, 1B, 2A and 2B) were established based on pre-challenge experiments as well as previous studies [9,35e37]. A control group consisting of 10 fish was immersed in seawater with 1% LB3 added. After 30 min of immersion, the test and control groups were returned to a common freshwater holding tank. The fish fins were

79

differentially clipped to distinguish between groups. Every second day from day 1e15, two fish from the test group were removed from the tank and euthanized in a water bath containing 0.01% benzocaine (BenzoakÒ VET, Euro-Pharma). Samples were taken from the head kidney, liver, anterior and posterior intestines by using a sterile metal loop, plated on BA2.5 and incubated at 8
C to identify the presence of V. salmonicida. Samples from the control fish were taken on day 1 (2 fish), 7 (2 fish) and 17 (6 fish) after challenge. At the end of the trial on day 17, all survivors were euthanized for sampling. The presence of V. salmonicida and other bacteria from each sample were graded as “no growth”, “sparse”, “moderate”, “rich” and “very rich” amounts of bacteria. 2.6.2. Trial 1B e seawater Seventy Atlantic salmon (smolt) of 40 g were kept in a 1400 l tank supplied with well aerated seawater (8
C, 35 ppm). Recently passaged V. salmonicida LFI1238 was cultured in LB3 at 8
C for 3 days. Two weeks after smoltification, the fish were challenged by immersion for 45 min in seawater with V. salmonicida LFI1238 added to a final concentration of 3  105 CFU/ml. A control group consisting of 70 fish was immersed in seawater with 1% LB3 added. Every 1e2 days starting from 2 h to day 15 after challenge, five fish were removed from the test tank and euthanized in a water bath containing 0.01% benzocaine. Samples were taken from the blood, skin, mouth, gills, anterior and posterior intestines, liver and head kidney by using a sterile metal loop, plated on BA2.5 and incubated at 8
C to identify the presence of V. salmonicida. Sampling of control fish were performed after 2 h (3 fish) and on day 7 (3 fish) and 15 (6 fish) after challenge. For further identification of V. salmonicida and other bacterial strains from mixed cultures (skin, gills, mouth, intestine), 16S rDNA sequencing was performed. On day 3 and 8, water samples of 100 ml were taken from the fish tank, before 100 ml was directly plated out onto BA2.5 plates and incubated at 8
C. The presence of V. salmonicida and other bacteria from each sample were graded as “no growth”, “sparse”, “moderate”, “large” and “very large” amounts of bacteria. 2.7. Trial 2: challenge experiments with the wild type LFI1238 and MOT- strain 2.7.1. Trial 2A e freshwater Thirty Atlantic salmon (fry) of 25 g were kept together in a 200 l tank supplied with oxygenized and carbon filtered freshwater with a temperature of 5e7
C. Recently passaged V. salmonicida LFI1238 and MOT- were cultured in LB1 at 8
C for 1 day. After anesthesia in a water bath containing 0.0035% benzocaine, 10 fish were injected intraperitoneally (i.p.) with 0.08 ml of wild type LFI1238 (5  106 CFU) and 10 fish with MOT- strain (4  106 CFU). Ten control fish were injected i.p. with 0.08 ml LB1. The fish fins were differentially clipped to distinguish between groups. Mortality was monitored daily for a period of three weeks. Samples from the head kidney were plated on BA2.5 by using a sterile metal loop and incubated at 8
C to verify the presence of V. salmonicida. 2.7.2. Trial 2B e seawater Two weeks after smoltification, 136 Atlantic salmon (smolt) of 40 g were divided into three groups which were kept in separate tanks (1400 l) supplied with well aerated seawater (8
C, 35 ppm). Recently passaged V. salmonicida LFI1238 and MOT- were cultured in LB3 at 8
C for 3 days., the fish were immersion challenged for 45 min in seawater with bacteria added to a final concentration of 7  105 CFU/ml for wild type strain LFI1238 (52 fish) and 2  105 CFU/ml for MOT- (44 fish). The control group was immersed in seawater with 1% LB3 added (40 fish). Mortality was monitored daily for a period of three weeks. Samples from the head kidney

80

A.M. Bjelland et al. / Microbial Pathogenesis 52 (2012) 77e84

were plated on BA2.5 by using a sterile metal loop and incubated at 8
C to verify the presence of V. salmonicida. 3. Results 3.1. V. salmonicida in the salmon intestinal microflora To investigate the impact of V. salmonicida on the intestinal microflora of Atlantic salmon, eight intestinal strains of V. salmonicida which originally were isolated from Atlantic salmon, Atlantic cod and Atlantic herring were chosen for further characterization [12]. Surprisingly, 16S rDNA sequencing results revealed that all strains previously classified as the intestinal group of V. salmonicida belong to the V. logei species. The strains LFI1238 and NVMB2262 were, however, identified as V. salmonicida as expected. To further investigate the intestinal microflora of Atlantic salmon, bacterial strains of the gut flora were isolated during Trial 1B and 16S rDNA sequenced. The most dominant strains isolated during the first days of the experiment were Brevundimonas sp. and V. logei. At this time, only sparse amounts of V. salmonicida were identified, but the amount increased with time. In fish with V. salmonicida identified in liver and head kidney during Trial 1B, the bacteria were also identified in the intestines of 81% of the smolts. In prolonged CV cases, V. salmonicida was found in large or very large amounts as the dominating bacteria of the intestinal flora. 3.2. The distribution of V. salmonicida in Atlantic salmon after immersion challenge The immersion challenges in Trial 1 were conducted to investigate the distribution of V. salmonicida in the fish during a CV infection. V. salmonicida requires at least 0.5% NaCl to survive [1]. Seawater was therefore used during the challenge in Trial 1A before returning the fish back into freshwater. This method excludes the possibility of cross infection between the salmon because V. salmonicida does not survive in freshwater. V. salmonicida was identified in the anterior gut from day 5, in the posterior gut from day 11, and in the liver and head kidney from day 13. The salmons showed mortality from day 11. On day 17, V. salmonicida was identified in sparse amounts in mixed cultures from the posterior gut from 55% of the surviving fish as a minor contributor to the intestinal flora. To further investigate the development of CV, Trial 1B was performed. In this study, we increased the number of salmon, organ samples, and the frequency of sampling. The number of V. salmonicida positive fish per sampling is illustrated in Fig. 1. Interestingly, as early as 2 h after challenge and throughout the

experiment, V. salmonicida was identified in all blood samples taken with the exception of two fish. Two hours after challenge, the bacteria were also isolated in sparse amounts from mixed cultures of the intestines, mouth and gills, but not from the skin surface. On day 2, sparse amounts of V. salmonicida were grown from mixed cultures of the intestines and not from any other organs. On day 3, pure cultures of V. salmonicida in moderate amounts were identified in the liver and head kidney. V. salmonicida was not identified in skin samples before day 3 and from gills on day 4. All fish with V. salmonicida detected in skin and gills had symptoms of CV. Of the 25 salmons investigated during the experiment’s first six days, only two fish were not infected with V. salmonicida. A few fish died sporadically during the first days of challenge and the main mortality started at day 8. At this time, the concentration of V. salmonicida in the water tank was z103 CFU/ml. 3.3. Motility studies of LFI1238 and MOTDuring the construction of a V. salmonicida Dqrr mutant, we observed a motility-deficient phenotype. A complementation restored the function of the targeted knocked out gene. However, this did not restore the motility suggesting that the deficient motility was due to mutation(s) elsewhere in the genome and not due to deletion of qrr. Indeed, another Dqrr mutant was made that showed wild type motility supporting the assumption that qrr is not involved in the motility of V. salmonicida (unpublished results). Phase contrast microscopy of single MOT- colonies from agar plates showed non-motile bacteria. In the soft agar motility assay, a weak zone of migrating MOT- bacteria was observed after five days incubation demonstrating that a minority of the MOT- population were able to move through the soft agar. The diameter of the MOT- migration zone was approximately 65% less than compared to LFI1238 (Fig. 2A and data not shown). Using AFM, the lack of motility was correlated to bacteria carrying few and abnormal looking flagella or complete lack of flagellation (Fig. 3B). However, bacteria visualized from the MOT- migration zone on soft agar plates had a wild type phenotype with respect to flagellation (Fig. 2C and D). These results demonstrate that the MOTpopulation consists of non-motile bacteria without functional flagella in addition to a small fraction of motile bacteria. The MOTstrain did not express other observed phenotypes different from the wild type strain such as growth rate, morphology and survival that could have an obvious effect on the bacterial pathogenicity (data not shown). Interestingly, by AFM the presence of outer membrane vesicles (OMVs) of approximately 200 nm in diameter budding out from the cell wall of V. salmonicida were also identified (Fig. 2E and F).

Fig. 1. Identification of V. salmonicida during Trial 1B. The identification of V. salmonicida in infected salmon after cultivation from different organs and at different time points during the first six days of Trial 1B.

A.M. Bjelland et al. / Microbial Pathogenesis 52 (2012) 77e84

81

Fig. 2. Motility studies of LFI1238 and MOT-. A: Soft agar motility assay demonstrating the motility zones of LFI1238 and MOT- after five days incubation at 8
C. A weak zone of migrating MOT- bacteria is observed showing that only a small fraction of the MOT- population is motile. In addition, the diameter of the MOT- migration zone is 65% less than compared to LFI1238. BeD: Visualization of flagellation of non-motile (B) and motile (C) MOT-, and LFI1238 (D) by atomic force microscopy (AFM). EeF: AFM of LFI1238 demonstrating outer membrane vesicle (open arrow head), polar (open arrow) and lateral flagella (filled arrow). The small vesicle-like structures in the surroundings are artifacts from the preparation probably due to salt precipitation. Scale bar all photos: 250 nm.

3.4. The impact of bacterial motility in V. salmonicida infections Motility is linked to colonization and virulence in several bacterial species, thus the MOT- strain was used as a tool to investigate the impact of this feature during CV disease development. In Trial 2A, salmon infected by i.p-injection with LFI1238 showed mortality from day 3. At day 16 all fish in this group were dead. The disease development was delayed in fish challenged with MOT- compared to the wild type LFI1238; salmon infected with the MOT- strain showed mortality from day 5 and all fish were dead at day 22. A typically outbreak of CV with increased mortality was registered from day 6 and 9 in the LFI1238 and MOT- group, respectively. The difference between the mortality rates of the two groups was statistically significant (Log Rank Test, P < 0.0262; Wilcoxon Test, P < 0.0593) (Fig. 3A). The presence of both motile and non-motile types of MOT- bacteria were identified from the head kidney of dead salmon by phase contrast microscopy.

In Trial 2B, fish infected by immersion with wild type LFI1238 showed mortality from day 1 and a typical outbreak started at day 8. At the end of the trial at day 18, all fish in this group had died. Fish infected with the MOT- strain showed mortality from day 2 and interestingly, only 6 fish (13.6%) died during the experiment after a small outbreak from day 14. The difference between LFI1238 and MOT- mortality rates was statistically significant (Log Rank Test, P < 0.0001; Wilcoxon Test, P < 0.0001) (Fig. 3B). In both challenge experiments, V. salmonicida was grown from the head kidney from all diseased and dead fish. No control fish showed symptoms of infection or mortality. At the end of the experiments, neither V. salmonicida nor any other bacterial species were identified after cultivation from the head kidney of survivors or control fish. Additionally, blood samples from five of the survivors from each of the MOT- and control groups in the immersion challenge experiment were taken to identify a possible early colonization phase. V. salmonicida was not identified in any of these samples.

Fig. 3. Virulence properties of LFI1238 and MOT-. Survival plot after challenge of Atlantic salmon (S. salar) by i.p.-injection (A) and immersion (B) with V. salmonicida LFI1238 (blue line) and MOT- (red line). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

82

A.M. Bjelland et al. / Microbial Pathogenesis 52 (2012) 77e84

4. Discussion 4.1. V. salmonicida in the salmon intestine This study was initiated with a hypothesis that V. salmonicida uses the salmon intestine as a natural habitat. A previous report by Onarheim et al. (1994) described ubiquitous, non-virulent intestinal V. salmonicida strains as the dominating gut flora in several fish species. In our study, however, these strains were identified as V. logei. Nevertheless, V. salmonicida is identified in feces from salmon that survived CV after challenge and from sediments below fish farms both with and without CV outbreaks [11,18]. This could point to a healthy carrier state with V. salmonicida in fish intestines without the bacteria dominating the ubiquitous gut microbiota. We found the bacteria to be able to colonize the gut, even under freshwater holding conditions. The salinity of the intestine, however, is reported to be physiological both in fresh and seawater since the osmoregulation occurs in the fish’s esophagus explaining the occurrence of V. salmonicida in the intestines of the freshwater living fry [38]. In Trial 1A, the salmon showed mortality from day 11, which was somewhat later than expected compared to previously reported [9] and unpublished results. The delayed outbreak of disease implies that the freshwater provided an inhibitory effect on the disease development possibly due to the absence of co-habitant infection as V. salmonicida requires at least 0.5% NaCl to grow and survive [1]. However, to minimize the saltwater exposure time for the non-smoltified freshwater living fish in Trial 1A, the fry were challenged for a shorter period than the smolts in Trial 1B. This reduced exposure time could have influenced the onset of the disease outbreak. In the first days after immersion challenge in Trial 1, only few V. salmonicida were identified in the fish gut, but the amount increased with time and in prolonged CV cases, V. salmonicida was the dominating bacterium in the gut flora. This suggests that the V. salmonicida dominance of the intestinal flora is a result of the septicemia and in this way CV diseased fish excrete the bacteria by feces to the water. Additionally, as V. salmonicida were identified in the gut of 55% of the surviving fish in Trial 1A, a potential carrier role is indicated. This suggests that the colonization of V. salmonicida in the salmon intestine may play an important secondary role in the CV pathogenesis where both healthy carriers and CV diseased salmon could excrete the bacteria to the water causing increased infection pressure toward co-habitants of the salmon population. 4.2. The port of entry in V. salmonicida infections In fish, the three major routes of infection are through the skin, the gills and the gastrointestinal tract [39,40]. Our results suggest that the immune system of the skin manage to eradicate V. salmonicida in the initial phase of the infection. This effect is probably due to antimicrobial substances in mucus and/or cells of the innate immune system [41e44]. The causative agent of winter ulcer disease in Atlantic salmon Moritella viscosa, is described to possess virulence properties which inhibit phagocytizing keratocytes, thus making the fish more susceptible for winter ulcer infections through the skin [43e45]. Our results suggest that V. salmonicida does not hold similar mechanisms to escape the salmon skin’s antimicrobial properties hence implying that the skin is not the port of entry in V. salmonicida infections. It has previously been shown that cultivation from tissue samples possesses similar low detection limits of bacteria as with RT-PCR [46]. However, the bacteria may infect the salmon directly through the skin without an initial adhering phase and/or from areas of the skin not included in the sampling. Thus, the detection

method used may have failed to identify V. salmonicida bacteria invading the fish host through the skin. Several previous studies have more or less rejected the gastrointestinal tract as a possible port of entry mainly because of the absence of intestinal epithelial cell injuries [3,13,16,47]. Our observation of V. salmonicida’s ability to colonize the intestine in addition to the supposedly absence of extracellular toxin activity in the pathogenesis of CV makes it tempting to hypothesize that the bacteria are transported through specialized cells without causing cell-damage [3,28,47]. Specialized antigen-presenting cells in the posterior gut segment of Atlantic salmon are reported to rapidly transport intact proteins and bacteria through the intestinal barrier [48e51] and selective endocytosis of V. salmonicida by epithelial cells in the posterior intestine of Atlantic cod and Atlantic herring larvae has been demonstrated [52]. Nevertheless, we should not decline the possibility that there is more than one port of entry for V. salmonicida into the host. The gills have by several occasions been postulated as the port of entry for V. salmonicida [19,20]. 4.3. The tissue distribution of V. salmonicida in salmon during CV infection Interestingly, as early as 2 h after challenge in Trial 1B, V. salmonicida was identified in the blood and during the first two days of infection, the bacteria were not identified in any other organ. This demonstrates that V. salmonicida successfully invades the host’s blood stream without requiring a primary general colonization of the host’s outer surfaces. Previous studies have mostly been performed on moribund or dead fish, which makes this the first study that demonstrates the ability of V. salmonicida to rapidly establish a bacteremia. To do this, V. salmonicida must have developed a proper strategy to resist the bactericidal effect of serum and avoid the immune cells of the blood stream. Little is known, however, about this mechanism in V. salmonicida, although Totland et al. (1988) described numerous small membrane blebs that seemed to emerge from the OM adhering to intra- and intercellular material. Our AFM studies suggest that the blebs observed are outer membrane vesicles (OMVs). OMVs are described to directly bind and even destroy host bactericidal factors [53,54]. The time span from the establishment of bacteremia until the bacteria were identified in other organs and symptoms of CV were registered implies a latency period. This, in addition to earlier reports [16], indicates that the bacteria use the blood volume to proliferate to ensure a total infection. In Trial 2A and 2B, a few fish died very early in the experiment even before mortalities were expected. Such early mortalities have also been observed in previous challenge experiments, performed both by i.p. and immersion [35]. Perhaps a few individuals with low activity in the unspecific immune system are more susceptible to infection and rapidly develop a septicemia where the tissues are directly infected. In most salmon, however, a latency period is needed for bacterial proliferation to overcome the host’s immune defense. 4.4. The impact of motility in the V. salmonicida pathogenesis The motility-deficient V. salmonicida strain MOT- was used to investigate the impact of motility as a virulence factor of V. salmonicida. The MOT- population was shown to mainly consist of nonmotile bacteria without functional flagella in addition to a small proportion of motile bacteria. Single colonies used as origin in the assays performed demonstrate that the two types of MOT- are of the same population. We hypothesize that the motility defect may spontaneously be repaired in a small proportion of the population resulting in bacteria showing normal flagellation and motility. All bacteria visualized from the MOT- migration zone on soft agar

A.M. Bjelland et al. / Microbial Pathogenesis 52 (2012) 77e84

plates had a wild type phenotype with regards to flagellation suggesting that the functional repair of the flagellar activity is stable. The genotype of this mutant is not clear, thus the changes in virulence could be related to other factors in addition to the loss of normal flagellation and motility. Trial 2A, however, indicates that the virulence capacity of MOT- is well-functional and not affected by other factors due to the mutant construction. By challenging salmon along different routes (i.p. and immersion) we have shown that V. salmonicida is highly dependent on motility to gain access to the fish host. The small proportion of motile bacteria of the MOT- population may explain the mortality of 13.6% in the group challenged by immersion with MOT-. In contrast, 100% of the MOT- infected salmon died during the i.p. experiment. This suggests that motility is required for virulence before, but not after invasion of the salmon. However, absence of normal flagellation and motility was shown to delay the disease development in the i.p. challenge. Although the bacteria are introduced directly into the host when i.p. challenged, the bacteria still need to overcome epithelial barriers before entering the blood stream. These barriers could be the reason for the delayed mortality observed, thus suggesting i. v. cannulation challenge as an interesting future experiment. In addition, flagellation of V. salmonicida in vivo are reported by several authors also after establishing an infection [16,55]. This is in contrast to the situation in Vibrio cholerae, V. fischeri and Vibrio anguillarum where the flagella are lost during host colonization [22,56,57]. Thus, V. salmonicida may in some way benefit from its constitutively expressed flagella. Perhaps the bacteria including the flagella and OMVs display factors that trigger the host’s inflammatory responses as described with other pathogens [58,59]. Because an inflammatory response is to a minor or major degree destructive to the host, the observed latency period could be related to the time required for the salmon’s immune system to respond to the bacterial invasion and eventually damage its own cells and tissue. Hence, lack of flagellation or abnormal flagella could delay the disease development additionally. 5. Conclusion Novel fish pathogens are frequently discovered in the aquaculture industry, increasing the need for new knowledge about bacterial pathogenesis to better improve treatment and prophylactic strategies. In this work we have demonstrated that V. salmonicida rapidly establishes a bacteremia in salmon and probably uses the blood to proliferate. V. salmonicida colonize the salmon intestine which creates healthy carriers and release of the pathogen to the environment, thus increasing the infection pressure in the salmon population. In addition, we have shown that V. salmonicida is highly dependent on motility to gain access to the fish host. Although this study has elucidated parts of the V. salmonicida pathogenesis, its mechanisms to avoid and/or stimulate the host’s immune system are still unsolved. By continuing to investigate the pathogenesis of V. salmonicida, new and more sophisticated treatment and vaccine strategies can be developed giving rise to increased fish welfare in the aquaculture industry. Acknowledgments The authors would like to acknowledge Debra Milton (Umeå University, Sweden) for kindly providing the suicide plasmids pDM4 and pNQ701. Also thanks to Stein Helge Skjelde (SørSmolt AS) for providing Atlantic salmon fry and smolts for the in vivo experiments, Tove Hansen (Fellesakvariet, Norwegian School of Veterinary Science (NSVS)) and Oddbjørn Pettersen and co-workers (NIVA, Solbergstrand) for fish experiment facility management and

83

technical assistance, and Ida Kristin Hegna (Department of Pharmaceutical Biosciences and Laboratory of Microbial Dynamics, University of Oslo,) for technical assistance with AFM. All challenge experiments in this study were approved by The Norwegian Animal Research Authority, approval no. ID3297, ID2926, ID1728 and ID3925. This work was supported by The Norwegian Research Council, Grant no. 174968/S10 and by NSVS to Espen Brudal. References [1] Egidius E, Wiik R, Andersen K, Hoff KA, Hjeltnes B. Vibrio salmonicida sp. nov., a new fish pathogen. Int J Syst Bacteriol 1986;36:518e20. [2] Jørgensen TØ. Microbiological and immunological aspects of "Hitra disease" of coldwater vibriosis (a summary). In: Stenmark A, Malmberg G, editors. Parasites and diseases in natural waters and aquaculture in Nordic countries. Stockholm, Sweden: Naturhistoriska Riksmuseet; 1987. p. 113e9. [3] Holm KO, Strøm E, Stensvaag K, Raa J, Jørgensen TØ. Characteristics of a Vibrio sp. associated with the "Hitra disease" of Atlantic salmon in Norwegian fish farms. Fish Pathol 1985;20:125e9. [4] Egidius E, Andersen K, Clausen E, Raa J. Cold-water vibriosis or "Hitra disease" in Norwegian salmonid farming. J Fish Dis 1981;4:353e4. [5] Urbanczyk H, Ast JC, Higgins MJ, Carson J, Dunlap PV. Reclassification of Vibrio fischeri, Vibrio logei, Vibrio salmonicida and Vibrio wodanis as Aliivibrio fischeri gen. nov., comb. nov., Aliivibrio logei comb. nov., Aliivibrio salmonicida comb. nov. and Aliivibrio wodanis comb. nov. Int J Syst Evol Microbiol 2007;57:2823e9. [6] Enger Ø, Hoff KA, Schei GH, Dundas I. Starvation survival of the fish pathogenic bacteria Vibrio anguillarum and Vibrio salmonicida in marine environments. FEMS Microbiol Lett 1990;74:215e20. [7] Hoff KA. Survival of Vibrio anguillarum and Vibrio salmonicida at different salinities. Appl Environ Microbiol 1989;55:1775e86. [8] Enger Ø, Husevag B, Goksøyr J. Seasonal variation in presence of Vibrio salmonicida and total bacterial counts in Norwegian fish-farm water. Can J Microbiol 1991;37:618e23. [9] Nordmo R, Sevatdal S, Ramstad A. Experimental infection with Vibrio salmonicida in Atlantic salmon (Salmo salar L.): an evaluation of three different challenge methods. Aquaculture 1997;158:23e32. [10] Sørum H, Hvaal AB, Heum M, Daae FL, Wiik R. Plasmid profiling of Vibrio salmonicida for epidemiological studies of cold-water vibriosis in Atlantic salmon (Salmo salar) and cod (Gadus morhua). Appl Environ Microbiol 1990; 56:1033e7. [11] Hoff KA. Occurrence of the fish pathogen Vibrio salmonicida in faeces from Atlantic salmon, Salmo salar L., after experimental infection. J Fish Dis 1989; 12:595e7. [12] Onarheim AM, Wiik R, Burghardt J, Stackebrandt E. Characterization and identification of two vibrio species indigenous to the intestine of fish in cold sea water: description of Vibrio iliopiscarius sp. nov. Syst Appl Microbiol 1994; 17:370e9. [13] Evensen Ø, Espelid S, Håstein T. Immunohistochemical identification of Vibrio salmonicida in stored tissues of Atlantic salmon Salmo salar from the first known outbreak of coldwater vibriosis ("Hitra disease. Dis Aquat Organ 1991; 10:185e9. [14] Bøgwald J, Stensvaag K, Hoffman J, Espelid S, Holm KO, Jørgensen TØ. Electrophoretic and immunochemical analysis of surface antigens of the fish pathogens Vibrio salmonicida and Vibrio anguillarum. J Fish Dis 1990;13: 293e301. [15] Espelid S, Holm KO, Hjelmeland K, Jørgensen TØ. Monoclonal antibodies against Vibrio salmonicida: the causative agent of coldwater vibriosis (‘Hitra disease’) in Atlantic salmon, Salmo salar L. J Fish Dis 1988;11:207e14. [16] Totland GK, Nylund A, Holm KO. An ultrastructural study of morphological changes in Atlantic salmon, Salmo salar L., during the development of cold water vibriosis. J Fish Dis 1987;11:1e13. [17] Brattgjerd S, Evensen Ø. A sequential light microscopic and ultrastructural study on the uptake and handling of Vibrio salmonicida in phagocytes of the head kidney in experimentally infected Atlantic salmon (Salmo salar L.). Vet Pathol 1996;33:55e65. [18] Enger Ø, Husevåg B, Goksøyr J. Presence of the fish pathogen Vibrio salmonicida in fish farm sediments. Appl Environ Microbiol 1989;55:2815e8. [19] Larsen JL, Pedersen K. Bakteriesykdommer; infeksjoner med vibrio-bakterier. In: Poppe TT, editor. Fiskehelse og fiskesykdommer. 2nd ed. Oslo: Universitetsforlaget; 2002. p. 74e7. Chapter 5. [20] Hjeltnes B, Andersen K, Ellingsen HM, Egidius E. Experimental studies on the pathogenicity of a Vibrio sp. isolated from Atlantic salmon, Salmo salar L., suffering from Hitra Disease. J Fish Dis 1987;10:21e7. [21] O’Toole R, Milton DL, Horstedt P, Wolf-Watz H. RpoN of the fish pathogen Vibrio (Listonella) anguillarum is essential for flagellum production and virulence by the water-borne but not intraperitoneal route of inoculation. Microbiology 1997;143:3849e59. [22] Milton DL, O’Toole R, Horstedt P, Wolf-Watz H. Flagellin A is essential for the virulence of Vibrio anguillarum. J Bacteriol 1996;178:1310e9. [23] Richardson K. Roles of motility and flagellar structure in pathogenicity of Vibrio cholerae: analysis of motility mutants in three animal models. Infect Immun 1991;59:2727e36.

84

A.M. Bjelland et al. / Microbial Pathogenesis 52 (2012) 77e84

[24] Graf J, Dunlap PV, Ruby EG. Effect of transposon-induced motility mutations on colonization of the host light organ by Vibrio fischeri. J Bacteriol 1994;176: 6986e91. [25] Ormonde P, Horstedt P, O’Toole R, Milton DL. Role of motility in adherence to and invasion of a fish cell line by Vibrio anguillarum. J Bacteriol 2000;182: 2326e8. [26] Lee JH, Rho JB, Park KJ, Kim CB, Han YS, Choi SH, et al. Role of flagellum and motility in pathogenesis of Vibrio vulnificus. Infect Immun 2004;72: 4905e10. [27] Karlsen C, Paulsen SM, Tunsjø HS, Krinner S, Sørum H, Haugen P, et al. Motility and flagellin gene expression in the fish pathogen Vibrio salmonicida: effects of salinity and temperature. Microb Pathog 2008;45:258e64. [28] Hjerde E, Lorentzen MS, Holden MT, Seeger K, Paulsen S, Bason N, et al. The genome sequence of the fish pathogen Aliivibrio salmonicida strain LFI1238 shows extensive evidence of gene decay. BMC Genomics 2008;9:616. [29] Kolter R, Helinski DR. Construction of plasmid R6K derivatives in vitro: characterization of the R6K replication region. Plasmid 1978;1:571e80. [30] Simon R, Priefer U, Puhler A. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Nat Biotech 1983;1:784e91. [31] Dojka MA, Hugenholtz P, Haack SK, Pace NR. Microbial diversity in a hydrocarbon- and chlorinated-solvent-contaminated aquifer undergoing intrinsic bioremediation. Appl Environ Microbiol 1998;64:3869e77. [32] Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 1991;173:697e703. [33] Sambrook JE, Fritsch F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1989. [34] Valla S, Frydenlund K, Coucheron DH, Haugan K, Johansen B, Jørgensen TØ, et al. Development of a gene transfer system for curing of plasmids in the marine fish pathogen Vibrio salmonicida. Appl Environ Microbiol 1992;58: 1980e5. [35] Nelson EJ, Tunsjø HS, Fidopiastis PM, Sørum H, Ruby EG. A novel lux operon in the cryptically bioluminescent fish pathogen Vibrio salmonicida is associated with virulence. Appl Environ Microbiol 2007;73:1825e33. [36] Colquhoun DJ, Alvheim K, Dommarsnes K, Syvertsen C, Sørum H. Relevance of incubation temperature for Vibrio salmonicida vaccine production. J Appl Microbiol 2002;92:1087e96. [37] Eggset G, Mikkelsen H, Killie JE. Immunocompetence and duration of immunity against Vibrio salmonicida and Aeromonas salmonicida after vaccination of Atlantic salmon (Salmo salar L.) at low and high temperatures. Fish Shellfish Immunol 1997;7:247e60. [38] Grosell M. Intestinal anion exchange in marine fish osmoregulation. J Exp Biol 2006;209:2813e27. [39] Birkbeck TH, Ringø E. Pathogenesis and the gastrointestinal tract of growing fish. In: Holzapfel W, Naughton P, editors. Microbial ecology in growing animals. Edinburgh: Elsevier; 2005. p. 208e34. [40] Ringø E, Jutfelt F, Kanapathippillai P, Bakken Y, Sundell K, Glette J, et al. Damaging effect of the fish pathogen Aeromonas salmonicida ssp. salmonicida on intestinal enterocytes of Atlantic salmon (Salmo salar L. Cell Tissue Res 2004;318:305e11. [41] Shephard KL. Functions for fish mucus. Rev Fish Biol Fisheries 1994;4:401e29. [42] Harris JE, Hunt S. The fine structure of the epidermis of two species of salmonid fish, the Atlantic salmon (Salmo salar L.). and the brown trout (Salmo trutta L.). Cell Tissue Res 1975;163:535e43. [43] Åsbakk K. Elimination of foreign material by epidermal malpighian cells during wound healing in fish skin. J Fish Biol 2001;58:953e66.

[44] Åsbakk K, Dalmo RA. Atlantic salmon (Salmo salar L.) epidermal Malpighian cells - motile cells clearing away latex beads in vitro. J Mar Biotechnol 1998;6: 30e4. [45] Karlsen C. Marine cold water vibrio-like Atlantic salmon pathogens - adaptation, virulence and interactions. A dissertation for the degree of Philosophiae Doctor. University of Tromsø, Norway; 2011. [46] Løvoll M, Wiik-Nielsen CR, Tunsjø HS, Colquhoun D, Lunder T, Sørum H, et al. Atlantic salmon bath challenged with Moritella viscosa - pathogen invasion and host response. Fish Shellfish Immunol 2009;26:877e84. [47] Hjelmeland K, Stensvaag K, Jørgensen T, Espelid S. Isolation and characterization of a surface layer antigen from Vibrio salmonicida. J Fish Dis 1988;11: 197e205. [48] Fuglem B, Jirillo E, Bjerkås I, Kiyono H, Nochi T, Yuki Y, et al. Antigen-sampling cells in the salmonid intestinal epithelium. Dev Comp Immunol 2010;34:768e74. [49] Jang MH, Kweon MN, Iwatani K, Yamamoto M, Terahara K, Sasakawa C, et al. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proc Natl Acad Sci USA 2004;101:6110e5. [50] Rombout JHWM, Bot HE, Taverne-Thiele JJ. Immunological importance of the second gut segment of carp. J Fish Biol 1989;35:167e78. [51] Owen RL. Uptake and transport of intestinal macromolecules and microorganisms by M cells in Peyer’s patches - a personal and historical perspective. Semin Immunol 1999;11:157e63. [52] Olafsen JA, Hansen GH. Intact antigen uptake in intestinal epithelial cells of marine fish larvae. J Fish Biol 1992;40:141e56. [53] Kuehn MJ, Kesty NC. Bacterial outer membrane vesicles and the hostpathogen interaction. Genes Dev 2005;19:2645e55. [54] Pettit RK, Judd RC. The interaction of naturally elaborated blebs from serumsusceptible and serum-resistant strains of Neisseria gonorrhoeae with normal human serum. Mol Microbiol 1992;6:729e34. [55] Colquhoun DJ, Sørum H. Outer membrane protein expression during in vivo cultivation of Vibrio salmonicida. Fish Shellfish Immunol 1998;8:367e77. [56] Ruby EG, Asato LM. Growth and flagellation of Vibrio fischeri during initiation of the sepiolid squid light organ symbiosis. Arch Microbiol 1993;159:160e7. [57] Krukonis ES, DiRita VJ. From motility to virulence: sensing and responding to environmental signals in Vibrio cholerae. Curr Opin Microbiol 2003;6:186e90. [58] Ellis TN, Kuehn MJ. Virulence and immunomodulatory roles of bacterial outer membrane vesicles. Microbiol Mol Biol Rev 2010;74:81e94. [59] Hong GE, Kim DG, Park EM, Nam BH, Kim YO, Kong IS. Identification of Vibrio anguillarum outer membrane vesicles related to immuno stimulation in the Japanese flounder, Paralichthys olivaceus. Biosci Biotechnol Biochem 2009;73: 437e9.

Glossary Bacteremia: The presence of bacteria in the blood Fry: Freshwater stage of the Atlantic salmon life cycle before the fish migrates to the ocean Head kidney: Anterior (frontal) part of the kidney in teleost fish Latency period: Interval between exposure to an infectious organism and the clinical appearance of disease Salmonid: Fish belonging to, or characteristic of the family Salmonidae, which includes the salmon, trout, and whitefish Smolt: Stage of the Atlantic salmon life cycle adapted for sea water Quorum sensing: Cell density dependant regulation of bacterial gene expression coordinated through the production of signaling molecules called autoinducers