- Email: [email protected]
Vibrio vulnificus cytolysin induces inflammatory responses in RAW264.7 macrophages through calcium signaling and causes inflammation in vivo
Journal Pre-proof Vibrio vulnificus cytolysin induces inflammatory responses in RAW264.7 macrophages through calcium signaling and causes inflammation in vivo Kewei Qin, Kaifei Fu, Jianfei Liu, Chenglin Wu, Yuxiao Wang, Lijun Zhou PII:
S0882-4010(19)30436-X
DOI:
https://doi.org/10.1016/j.micpath.2019.103789
Reference:
YMPAT 103789
To appear in:
Microbial Pathogenesis
Received Date: 11 March 2019 Revised Date:
12 July 2019
Accepted Date: 8 October 2019
Please cite this article as: Qin K, Fu K, Liu J, Wu C, Wang Y, Zhou L, Vibrio vulnificus cytolysin induces inflammatory responses in RAW264.7 macrophages through calcium signaling and causes inflammation in vivo, Microbial Pathogenesis (2019), doi: https://doi.org/10.1016/j.micpath.2019.103789. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Ltd.
Vibrio vulnificus cytolysin induces inflammatory responses in RAW264.7 macrophages through calcium signaling and causes inflammation in vivo Kewei Qin1, Kaifei Fu1, Jianfei Liu1, Chenglin Wu1, Yuxiao Wang1, Lijun Zhou1,* 1
Central Laboratory, The Sixth Medical Center of Chinese PLA General Hospital,
Beijing, 100048, China
Footnotes: *
Address correspondence and reprint requests to: Dr. Lijun Zhou. Central Laboratory,
The Sixth Medical Center of Chinese PLA General Hospital, Beijing, 100048, China; E-mail: [email protected]
Abstract Vibrio vulnificus is a food-borne marine pathogen that causes both life-threatening primary septicemia and necrotizing wound infections which accompany severe inflammation. Cytolysin is a very powerful virulence factor of V. vulnificus and is one of the likely candidates in the pathogenesis of V. vulnificus infections. However, the pathogenetic roles of cytolysin in V. vulnificus-induced inflammation are not well understood. In this study, we used the recombinant protein Vibrio vulnificus cytolysin (VVC) to demonstrate that VVC can induce inflammatory responses in RAW264.7 macrophages. Low dose (< 5 µg/ml) VVC had no impact on cell viability and induced pro-inflammatory cytokines production in RAW264.7 macrophages such as IL-6 and TNF-α. Moreover, VVC induced p65, p38, ERK1/2, and AKT phosphorylation in RAW264.7 macrophages. We further demonstrated that BAPTA, a specific intracellular calcium chelator, inhibited VVC-induced inflammatory response including pro-inflammatory cytokines production and inflammatory signaling activation in RAW264.7 macrophages. In addition, VVC primed rather than actived NLRP3 inflammasome in RAW264.7 macrophages. To determine whether VVC have a direct inflammatory effect on the host, we examined the effects of VVC injected
into the skin of mice. VVC stimulated a significant induction of mRNAs for the pro-inflammatory cytokine IL-6 and inflammatory chemokines such as MCP-1 and IP-10. Histology data also showed that VVC caused inflammatory responses in the skin of mice. Collectively, our findings indicated that VVC induced inflammatory responses in RAW264.7 macrophages and in vivo and suggested the possibility of targeting VVC as a strategy for the clinical management of V. vulnificus-induced inflammatory responses.
Keywords: Vibrio vulnificus; Cytolysin; Macrophage; Calcium; Inflammation; Pro-inflammatory cytokine
1. Introduction V. vulnificus is a halophilic Gram-negative bacterium widely distributed in tropical and subtropical seawaters. This opportunistic pathogen has been isolated from a range of different seafood produce such as eels, shrimp, oysters and clams[1]. Patients with V. vulnificus infections have been reported every year in locations all over the world. The earliest case was described in 1970, when Roland reported that V. vulnificus infection led to calf gangrene and endotoxic shock[2]. Since then, the number of reported infections has increased because of greater disease activity due to global warming and improved recognition by clinicians. V. vulnificus is known for its high virulence and high mortality rate. For example, it is reported that this pathogen is responsible for over 95% of seafood-related deaths in the United States[3], which is the highest fatality rate of all food-borne pathogens[4]. V. vulnificus infection can cause rapidly progressive fatal septicemia and necrotizing wound infection which are always accompanied by septic shock or multiple organ dysfunction[5]. Despite the fact that previous studies have significantly advanced our understanding of the pathogenesis of V. vulnificus infection, many aspects related to its virulence remain elusive. V. vulnificus possesses a range of virulence or toxic factors that play roles in its pathogenicity, including capsular polysaccharides, flagella, siderophores, pili,
cytolytic toxin, proteolytic enzymes, phospholipase A, and repeats-in-toxin toxin[6, 7]. Among the virulence factors, V. vulnificus cytolysin (VVC, also known as V. vulnificus hemolysin) is of significant importance during human infection. VVC is a 51 kDa water-soluble pore-forming toxin which oligomerizes at cholesterol-enriched membrane domains known as lipid rafts[8]. It is reported that VVC may contribute to bacterial invasion from the intestine to the blood stream[9] or trigger vasodilation to enhance the development of hypotensive septic shock[10]. V. vulnificus infections may cause a serious inflammatory process characterised by the upregulation of pro-inflammatory cytokines. Previous studies on V. vulnificus have investigated the association between pro-inflammatory cytokines production and virulence factors such as lipopolysaccharide (LPS), iron-overloading[11] , and capsular polysaccharides [12]. However, the role of VVC in inflammation during V. vulnificus infection is not fully understood. A previous study shows that VVC induces NF-κB-dependent mitochondria-mediated cell death via lipid raft-mediated reactive oxygen species (ROS) production in intestinal epithelial cells[13]. Hemolysin from other pathogens such as Group B Streptococcus[14] and Penicillium chrysogenum[15] have been reported to enhance host inflammation. These studies indicate that VVC may play a role in the inflammatory response during V. vulnificus infection. It is well established that infection of macrophages with bacterial pathogens results in cytokines production. However, whether VVC is involved in inflammatory responses to V. vulnificus in macrophages and the potential mechanism behind its involvement remains elusive. In this report, we demonstrated that a low dose (< 5 µg/ml) of VVC induced pro-inflammatory cytokines production in RAW264.7 macrophages. Moreover, VVC could activate NF-κB, MAPK, and AKT in RAW264.7 macrophages. In addition, inhibition of calcium influx regulated VVC-induced inflammatory response including pro-inflammatory cytokine production and inflammatory signaling activation in RAW264.7 macrophages. VVC also acted as a priming signal rather than an activating signal of NLRP3 inflammasome in RAW264.7 macrophages. And in the dermal inflammation model we employed, VVC induced inflammation in vivo.
2. Materials and methods 2.1. Reagents LPS (O111:B4) was purchased from Sigma-Aldrich (St. Louis, MO, USA) and used as previously described[16]. N-acetylcysteine[13] and BAPTA-AM[17] were from Selleck Chemicals (Houston, TX, USA) and used as previously described. Antibodies specific for GAPDH, actin, NLPR3, procaspase-1, cleaved caspase-1, p38, AKT, p65, and ERK1/2, phospho-specific Abs against p65 (Ser536), p38 (Thr180/Tyr182), ERK1/2 (Thr202/Tyr204), and AKT (Ser473) were from Cell Signaling
Technology
(Beverly,
MA,
USA).
Horseradish
peroxidase
(HRP)-conjugated secondary antibodies were from eBioscience (San Diego, CA, USA). Antibodies specific for F4/80 and IL-6 were from Servicebio (Beijing, China). 2.2. Cell culture RAW264.7 cell lines were obtained from the American Type Culture Collection. The cells were cultured with endotoxin-free RPMI 1640 (HyClone, Logan, UT, USA) with 10% fetal bovine serum which from Thermo Fisher Scientific (Waltham, MA, USA). 2.3. RNA quantification Total cellular RNA was extracted from cells using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. RNA concentrations were quantified using a spectrophotometer (Nanodrop 8000, Thermo Fisher Scientific) at 260 nm. Preparation of cDNA was performed using PrimeScriptTM reverse transcription reagent kit (TaKaRa, Japan) and PCR was performed using a thermal cycler (GeneAmp PCR system 2400, PerkinElmer, Waltham, MA, USA). Quantitative real-time RT-PCR analysis was performed using a LightCycler instrument (Thermal Cycler 2720, Applied Biosystems, Carlsbad, CA, USA) with SYBR RT-PCR kit (TaKaRa, Japan). Based on PrimerBank (https://pga.mgh.harvard.edu/primerbank/), we used the oligonucleotide primers listed in Table 1 (supplementary Tab. 1). β-actin served as the normalizer and relative gene expression was expressed as the “fold change” using the 2-∆∆Ct method. 2.4. Immunoblot
Cells were washed in PBS and lysed with RIPA buffer (Cell Signaling Technology, Beverly, MA, USA) supplemented with protease inhibitor cocktail on ice. Protein concentrations of the extracts were measured with BCA assay (Pierce, Waltham, MA, USA). The lysates were then cleared by centrifugation (20,000g at 4 °C for 20 min). Equal amounts of protein (20 µg) were resolved by 10% SDS-PAGE and transferred to polyvinylidene fluoride membranes. The membranes were washed with Tris-buffer solution-Tween 20 (10 mM Tris-HCl, pH 7.6, 150 mM NaCl, and 0.05% Tween-20), blocked with 5% skim milk for 1 h, and incubated with the appropriate primary antibody at 4 °C overnight. The membrane was then washed and incubated with a HRP-conjugated secondary antibody. Blots were developed using the enhanced chemiluminescence detection method. (ImageQuant LAS 4000, General Electric Company, MA, USA). 2.5. CCK8 (Cell Counting Kit-8) Assay Cells were treated with VVC for various lengths of time. CCK8 (Dojindo, Japan) solution was then added to each well and the plates were incubated at 37 °C for another 2 h. After incubation, the absorbance was measured at 450 nm using iMarker Microplate Reader (Bio-Rad, Hercules, CA, USA). Cell viability was calculated as a percentage of the untreated sample. 2.6. Enzyme-linked immunosorbent assays (ELISA) After cells were stimulated (100 ng/ml LPS, 1-20 µg/ml VVC), the culture supernatants were collected for analysis at designated times using enzyme-linked immunosorbent assays for cytokine concentration. ELISA kits including IL-6 (DKW12-2060, Dakewe, Beijing, China)，TNF-α (DKW12-2720, Dakewe, Beijing, China)， IL-1β (DKW12-10122, Dakewe, Beijing, China) and IL-18 (ml063131, Mlbio, Shanghai, China) were used according to the manufacturer’s instructions. 2.7. Purification of the recombinant VVC protein To find the functional role of VVC in RAW264.7 cells, we prepared a recombinant version of the VVC protein. The oligonucleotide sequence was designed using the V. vulnificus YJ016 genomic sequence (www.ncbi.nlm.nih.gov, NCBI Reference Sequence: NC_005140.1). Briefly, the open reading frame of VVC was amplified by
PCR using a pair of primers (Pvvf1: gcggatccatgaaaaaaatgactctgttt (BamH1); Pvvr2: ccctcgaggagtttgacttgttgtaatgt (Xho1)) and cloned into pET28a, a His-tag expression vector, resulting in pET28a-vvc. E. coli BL21 (DE3) harboring the pET28a-vvc was grown in LB-kanamycin media at 37 °C until OD600 reached 0.6 and protein expression was induced using 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) for 6 h. The cells were harvested by centrifugation, resuspended in buffer A (50 mM Tris， 300 mM NaCl，pH 8.5), and the cell suspensions were ultrasonicated. The crude cell extracts were centrifuged at 12,000 rpm for 20 min at 4 °C, and the supernatant containing His-tagged VVC protein was purified using nickel agarose affinity chromatography. Wash buffer (8M urea, 50 mM Tris, 300 mM NaCl, 20 mM imidazole, pH 8.5) and elution buffer (8M urea, 50 mM Tris, 300 mM NaCl, 500 mM imidazole, pH 8.5) were used during the process. Purified proteins were dialyzed against 25 mM Tris, 150 mM NaCl, 0.1% SKL, pH 9.0 and concentrated to 0.4 mg/ml and stored at − 80 °C until use. The purified VVC was assessed using SDS-PAGE (supplementary Fig. 3). Before experiments were performed, the VVC protein was dissolved in PBS (phosphate buffer saline), the solution was purified using EtEraser Endotoxin Removal Kit (BIOENDOTM, Xiameng, China), and any residual endotoxin in the purified VVC protein solution was measured using the Endotoxin Test Kit (BIOENDOTM, Xiameng, China) according to the manufacturer’s instructions. 2.8. Dermal inflammation mice model Female BALB/c mice (8-10 weeks old, Vitalriver, Beijing, China) were used in the experiments. Mice were bred in pathogen free conditions and randomly grouped (n = 4 mice each group). Hair was shaved to expose the skin, and 50µl of PBS or VVC dissolved in PBS was injected intradermally. Groups 1 to 3 were administered PBS, VVC 2 µg and VVC 20 µg, respectively. After 12 h, the mice were sacrificed by cervical dislocation after anesthesia. Skin tissues at the site of injection were removed and kept immersed in fixative for 24 hours before stained with H&E or antibodies for immunohistochemistry test. In addition, the other skin tissues were lysed in TRIzol reagent for RNA extraction. 2.9. Statistical analysis
Results are given as mean plus or minus standard deviation (SD). Comparisons between two groups were performed using Student’s t test. Statistical significance was determined as P values less than 0.05. 3. Results 3.1. Low dose VVC does not affect RAW264.7 macrophages viability VVC has been reported to be cytotoxic toward mammalian cells in culture and can induce the superoxide anion-initiated apoptotic signaling pathway in ECV304 cells [18]. Therefore, we investigated the effect of VVC on RAW264.7 cells viability as our initial step, using recombinant VVC protein. Cell viability was measured using the CCK-8 assay to evaluate whether VVC can injure RAW264.7 cells. VVC showed no cytotoxicity on RAW264.7 cells at 0.5 µg/ml or 5 µg/ml, but cytotoxicity was observed in cells treated with 10 µg/ml and 20 µg/ml VVC. The cytotoxicity of VVC increased in a concentration-dependent manner (Fig. 1A). No visible cell loss was observed by microscope until the VVC dose was increased to more than 5 µg/ml, consistent with the CCK-8 results (Fig. 1B). These results indicate that low dose (< 5 µg/ml) VVC does not affect RAW264.7 cell viability.
Fig. 1. Viability of RAW264.7 macrophages incubated with different concentrations of recombinant VVC protein. (A) Viability of RAW264.7 macrophages following incubation with VVC （0 – 20 µg/ml）for 24 h. (B) Microscopic pictures of RAW264.7 macrophages incubated for 24 h in medium containing 0 – 20 µg/ml VVC. Data are representative of three independent experiments with similar results and presented as mean ± SD. ＊P < 0.05 indicates a significant difference from the control group.
3.2. Low dose VVC induces pro-inflammatory cytokines production in RAW264.7 macrophages
We next examined the effect of low dose VVC on the production of pro-inflammatory cytokines in RAW264.7 macrophages. In order to exclude endotoxin residues in the recombinant VVC protein used in the experiment, the protein was further purified using an efficient endotoxin removal resin and residual endotoxin was tested. Residual endotoxin in purified 1 µg/ml VVC was present only at a very low level (0.02 EU/ml), which is less than 0.02 ng/ml LPS (Supplementary Fig. 1), which we demonstrate to be unable to induce pro-inflammatory cytokine (IL-6 and TNF-α) production in RAW264.7 cells (Supplementary Fig. 2). RAW264.7 cells were treated with purified VVC and mRNA expression of pro-inflammatory cytokines was tested by quantitative real-time PCR (Q-PCR). The results show that in response to VVC, RAW264.7 macrophages produced pro-inflammatory cytokines (IL-6 and TNF-α) in a dose-dependent manner (Fig. 2A). 3.3. VVC enhances LPS-induced pro-inflammatory cytokines production in RAW264.7 macrophages Given that VVC is one of the virulence factors of V. vulnificus and LPS from the pathogen also contributes significantly to activating Toll-like receptors (TLRs) signaling and to inducing the inflammatory response, it is important to understand whether VVC has an additive effect on LPS induced pro-inflammatory cytokines production. To do this, RAW264.7 cells were collected at 0 h, 1 h, 4 h, 8 h, 12 h, and 24 h after stimulation by VVC and LPS. The production of pro-inflammatory cytokines was tested by Q-PCR. Both VVC and LPS could induce pro-inflammatory cytokines (IL- 6 and TNF-α) mRNA expression, but the VVC and LPS co-treatment group produced more IL-6 and TNF-α mRNA than the LPS alone treatment group (Fig. 2B). We also confirmed that VVC could induce pro-inflammatory cytokines production (IL-6 and TNF-α) and enhance LPS-induced IL-6 and TNF-α secretion in RAW264.7 macrophages by ELISA (Fig. 2C). Taken together, these results show that VVC induces the production of pro-inflammatory cytokines and that this effect is additive with LPS treatment in RAW264.7 macrophages.
Fig. 2. VVC induces pro-inflammatory cytokine production in RAW264.7 macrophages. (A) Q-PCR of IL-6 and TNF-α in RAW264.7 macrophages (8 × 105 cells per well) incubated in medium containing 0 – 4 µg/ml of VVC for certain time. IL-6 mRNA in RAW264.7 macrophages was measured after 8 h VVC treatment and TNF-α mRNA in RAW264.7 was measured after 2 h VVC treatment. (B) Q-PCR of IL-6 and TNF-α in RAW264.7 macrophages (8 × 105 cells per well) incubated in medium containing VVC (1 µg/ml) and/or LPS (100 ng/ml) for the indicated length of time. (C) ELISA of IL-6 and TNF-α in supernatants from RAW264.7 macrophages (8 × 105 cells per well) incubated in medium containing VVC (1 µg/ml) and/or LPS (100 ng/ml) for 12 h. Data are representative of three independent experiments with similar results and presented as mean ± SD. ＊P < 0.05 indicates significant differences from the control group (0 h or untreated by VVC). ＃P < 0.05 indicates significant differences from the LPS treatment group in the certain time.
3.4. VVC induces p65, p38, ERK1/2 and AKT phosphorylation in RAW264.7 macrophages
To understand how VVC mediates pro-inflammatory cytokines production in RAW264.7 cells, we determined the effect of VVC on several cell signaling pathways related to inflammatory responses, including NF-κB, MAPK, and AKT signaling pathways. RAW264.7 were treated with VVC (1 µg/ml) for 0 min, 30 min, 60 min, and 90 min, then the extracted proteins were subjected to immunoblotting using anti-phospho-p65, -phospho-p38, -phospho-ERK1/2, and -phospho-AKT antibodies. We found that p65, p38, ERK1/2, and AKT were phosphorylated in cells treated with VVC, in comparison to the untreated control cells, where the above proteins were either non-phosphorylated or only weakly phosphorylated (Fig. 3A). VVC increased the ratio of phosphorylated protein to total protein in the analysis of p65, p38, ERK1/2, and AKT, and the strongest activation was observed at the 30 min time point (Fig. 3B). These results indicate that VVC may induce pro-inflammatory cytokines production through activating inflammation-related signaling pathways.
Fig. 3. The effect of VVC on p65, p38, ERK1/2, and AKT phosphorylation in RAW264.7 macrophages. (A) Immunoblot of RAW264.7 macrophages (8×105 cells per well) cell lysates using the indicated antibodies. Cells were stimulated with VVC (1 µg/ml). GAPDH protein was used as an internal control. Data are representative of three independent experiments with similar results. (B) Quantification of p65, p38, ERK1/2, and AKT phosphorylation. The intensities of bands were analyzed and quantified using the Tanon Gel Image System. Results are expressed as the ratio of phosphorylated
protein to total protein and are expressed as a fold difference compared to levels in untreated RAW264.7 cells. Results indicate mean ± standard error of the mean of three independent experiments. ＊P < 0.05 indicates significant differences from the control group (0 min).
3.5. BAPTA inhibits VVC induced pro-inflammatory cytokines production in RAW264.7 macrophages To further explore how VVC activates inflammation-related signaling pathways, we investigated the potential mechanisms that under this activation. It is well established that VVC, as a kind of hemolysin, can induce an increase in calcium influx[19]. Calcium ions are central to multiple signal transduction pathways that ultimately control a variety of biological functions, including the inflammatory response. Under some circumstances, elevations of cellular Ca2+ can directly or indirectly influence cellular signaling, including activation of MAPKs[20-22] and of the PI3K/Akt signal pathway[23], which may activate the downstream NF-κB signal pathway. Meanwhile, we also noted a previous publication that describes the ability of VVC to increase the interaction of NADPH oxidase 2 with a cytosolic protein NCF1 to facilitate the production of ROS[13]. It has been reported that ROS can mediate activation of the MAPK signaling pathway by inducing JNK, p38, and ERK1/2 phosphorylation [24-26]. ROS can also mediate activation of the PI3K/AKT signaling pathway [27]. These reports indicate that VVC may activate inflammation-related signaling pathways through increasing calcium influx or cellular ROS levels. RAW264.7 macrophages were pre-treated with the ROS inhibitor NAC (N-acetylcysteine) or BAPTA-AM, a specific intracellular calcium chelator that prevents the increase of calcium levels, before being stimulated by VVC. The production of IL-6 and TNF-α was measured by Q-PCR. Data revealed that 20 µM BAPTA can significantly decrease IL-6 and TNF-α mRNA expression induced by VVC treatment, while NAC didn’t affect IL-6 and TNF-α mRNA production induced by VVC within the recommended concentrations (Fig. 4A). In accordance with Q-PCR results, data obtained by ELSIA confirmed that BAPTA inhibits VVC-induced IL-6 and TNF-α production in RAW264.7 macrophages, while NAC does not (Fig. 4B).
Fig. 4. The effect of BAPTA and NAC on VVC-induced pro-inflammatory cytokines production in RAW264.7 macrophages. (A) Q-PCR of IL-6 and TNF-α in RAW264.7 macrophages (8 × 105 cells per well) pretreated with NAC (0 – 100 µM) or BAPTA-AM (0 – 20 µM) for 30 mins and then stimulated with VVC (1 µg/ml) for 6 h. (B) ELISA of IL-6 and TNF-α in supernatants from RAW264.7 macrophages (8 × 105 cells per well) pretreated with NAC (100 µM) or BAPTA-AM (20 µM) for 30 mins and then stimulated with VVC (1 µg/ml) for 12 h. Data are representative of three independent experiments with similar results and presented as mean ± SD. ＊ P < 0.05 indicates significant differences from the DMSO-treated group.
3.6. BAPTA inhibits VVC-induced p65, p38, ERK1/2, and AKT phosphorylation in RAW264.7 macrophages We continued to examine whether VVC treatment affects NF-κB, MAPK, and
PI3K/Akt activation through calcium influx. RAW264.7 cells were treated with VVC (1 µg/ml) for 0 min or 30 min, with or without BAPTA-AM pre-treatment. Then, the extracted proteins were subjected to immunoblotting with anti-phosphorylation antibodies. Western blots demonstrated that in the group treated with VVC and BAPTA, VVC-induced p65, p38, ERK1/2, and AKT phosphorylation were significantly impaired compare to the group simply treated with VVC (Fig. 5A). In accordance with the western blot results, statistical results prove that BAPTA decreased the ratio of phosphorylated to total protein in p65, p38, ERK1/2, and AKT in RAW264.7 cells treated using VVC (Fig. 5B). The above data indicate that VVC may induce pro-inflammatory cytokine production through calcium influx-mediated activation of inflammation-related signaling through NF-κB, MAPK, and PI3K/Akt pathways.
Fig. 5. The effect of BAPTA on VVC-induced p65, p38, ERK1/2, and AKT phosphorylation in RAW264.7 macrophages. (A) Immunoblot of cell lysates from RAW264.7 macrophages (8×105 cells per well) stimulated with VVC (1 µg/ml) using the indicated antibodies. GAPDH protein was used as an internal control. Data are representative of three independent experiments with similar results. (B) Quantification of p65, p38, ERK1/2, and AKT phosphorylation. The intensities of bands were analyzed and quantified using the Tanon Gel Image System. Results are expressed as the ratio of phosphorylated protein to total protein and as fold differences as compared to untreated RAW264.7 cells. Results
indicate mean ± standard error of the mean of three independent experiments. ＊P < 0.05 indicates significant differences from the “VVC+ and BAPTA-” group.
3.7. VVC primes rather than activates NLRP3 inflammasome in RAW264.7 macrophages. Considering that previous reports show that BAPTA inhibits inflammation in macrophage through inflammasome[28] and V. vulnificus can activate NLRP3 inflammasome[29],
we
continued
to
clarify
the
involvement
of
NLRP3
inflammasome in VVC induced inflammation in RAW264.7 macrophages. Activated NLRP3 inflammasome stimulates caspase-1 activation that triggers maturation and secretion of pro-inflammatory cytokines, including IL-1β and IL-18. The activation of NLRP3 inflammasome requires signal 1 (priming signal such as LPS, upregulating the expression of proIL-1β, proIL-18 and NLRP3) and signal 2 (activating inflammasome)[30]. We first tested whether VVC can act as signal 1 just like LPS in RAW264.7 macrophages. The results show that VVC induced IL-1β, IL-18 and NLRP3 mRNA expression in RAW264.7 macrophages in a time and dose-dependent manner (Fig. 6A&B). Western blots demonstrated that VVC induced NLRP3 and proIL-1β protein expression (Fig. 6C, Supplementary Fig. 4&Supplementary Fig. 5), however only VVC treatment could not active procaspase-1 and produce cleaved caspase-1 (data not shown) in RAW264.7 cells. We next examined whether VVC can act as signal 2 to activate inflammasome. IL-1β and IL-18 in supernatants from RAW264.7 macrophages primed with and without LPS, and exposed with VVC were tested by ELISA. The results show that VVC had no influence on IL-1β and IL-18 secretion (Fig. 6D&E) and western blots didn’t detect cleaved caspase-1 in the RAW264.7 cells (data not shown). Our result is consistent with a previous study which shows that infection with V. vulnificus lacking VVC induced caspase-1 activation and IL-1β secretion were comparable to that induced by infection with the isogenic WT strain in macropahges[29]. These data and report indicate that VVC may act as signal 1 to prime NLRP3 inflammasome like LPS while can’t act as signal 2 to active NLRP3 inflammasome alone.
Fig. 6. VVC primes rather than activates NLRP3 inflammasome in RAW264.7 macrophages. (A) Q-PCR of IL-1β, IL-18 and NLRP3 in RAW264.7 macrophages (8 × 105 cells per well) incubated in medium containing VVC (1 µg/ml) or LPS (100 ng/ml) for the indicated length of time. (B) Q-PCR of IL-1β, IL-18 and NLRP3 in RAW264.7 macrophages (8 × 105 cells per well) incubated in medium containing 0 – 4 µg/ml VVC for certain time. IL-1β mRNA in RAW264.7 macrophages was measured after 12 h VVC treatment, IL-18 mRNA was measured after 8 h VVC treatment and NLRP3 was measured after 2 h VVC treatment. (C) Immunoblot of RAW264.7 macrophages (8×105 cells per well) cell lysates using the indicated antibodies. Cells were stimulated with VVC (1 µg/ml). (D&E) ELISA of IL-1β (D) and IL-18 (E) in supernatants from RAW264.7 macrophages (8 × 105 cells per well) primed with and without LPS (100 ng/ml) for 12 h and then exposed with VVC for 3 h. Data are representative of three independent experiments with similar results and presented as mean ± SD. ＊ P < 0.05 indicates significant differences from the control group (0 h or untreated by VVC).
3.8. VVC induces inflammation in the skin of mice. Above data indicated the inflammatory role of VVC in vitro, we further explored the effects of VVC in vivo. Considering that a previous report had already studied the role of VVC with orally infected mice model[31] and V. vulnificus from seawater and
marine organisms could also infect people through fresh wound in skin[5], we employed another dermal inflammation model[32] to examine the effects of VVC in vivo. In this model, PBS or VVC was injected intradermally in mice and tissue samples from injection sites were stained by H&E (Hematoxylin and eosin). Control group injected with PBS showed no signs of inflammation while samples from mice injected with 2 μg VVC showed a significant infiltration of inflammatory cells in the dermal and fatty layers of the skin. In the samples from mice injected with 20 μg VVC, there was a more extensive infiltration of inflammatory cells, combined with edema of the dermal and epidermal layer (Fig. 7A). We further used immunohistochemistry to examine the tissue samples, the results showed that F4/80 positive macrophages are present in the fatty layers of the skin injected with VVC and pro-inflammatory cytokine IL-6 is secreted and found distributed near the inflammatory cells (Fig. 7B). We also examined the tissue samples for the presence of IL-6 by Q-PCR and a ten to twenty fold induction in the mRNA level of IL-6 was found with VVC stimulation in vivo (Fig. 7C). The samples were also examined for the presence of inflammatory chemokines to determine how VVC was inducing infiltration of inflammatory cells in the skin of mice. The result correlates with the histology data, which show that VVC induces the production of inflammatory chemokines such as MCP-1 and IP-10 in a dose-dependent manner in vivo (Fig. 7C). Taken together, these data demonstrate that VVC can induce both pro-inflammatory cytokine and inflammatory chemokine genes expression in vivo and cause inflammatory responses in the skin of mice.
Fig. 7. VVC induces cellular infiltration and production of inflammatory chemokines and cytokine in mouse skin. (A) Hematoxylin and eosin staining of skin sections from mice 12 h after dermal
injection
of
PBS
or
VVC
as
indicated.
Magnification,
200×
or
800×.
(B)
Immunohistochemistry analysis of F4/80 and IL-6 expression in the skin sections from mice 12 h after dermal injection as indicated. Magnification, 200×. (C) Q-PCR analysis of IL-6, MCP-1 and IP-10 mRNA expression from mice 12 h after dermal injection as indicated. ＊P < 0.05 indicates significant differences from the control group (PBS treatment). Each bar is the mean from samples from 4 separate mice and error bars indicate standard deviations.
4. Discussion V. vulnificus can cause serious sepsis in the host and induce inflammation via recruiting and activating innate immune cells such as monocytes, NK cells and macrophages upon infection. For example, a previous report shows that V. vulnificus infection triggered strong inflammatory responses in vivo and V. vulnificus treatment induced the production of multiple cytokines in macrophages[33]. High serum levels of pro-inflammatory cytokine such as IL-6 in patients with early-phase Gram-negative sepsis often predict poor clinical outcomes[34]. Thus, the role and specific
mechanism of V. vulnificus and its toxic factors in the inflammatory responses and inflammatory resolution during infection is an important issue to address. Previous research on VVC had focused on its role in intestinal epithelial cells, as V. vulnificus was believed to produce sufficient VVC in the small intestine to result in an acceleration of the bacterial invasion of the blood stream[1]. However, once V. vulnificus invades the blood stream, the VVC may be diluted and be spread to other tissues by the blood. Besides, V. vulnificus could also infect people through fresh wound in skin. Macrophages are large phagocytes found in essentially all tissues and play a critical role in increasing inflammation and stimulating the immune system[35]. Thus, it is important to delineate the effects of VVC on macrophage which is significant on the production of pro-inflammatory cytokines. However, until now, this issue remains unclear. In the present study, the role and mechanism of VVC on the inflammatory responses in RAW264.7 macrophage cells was investigated. We demonstrate that VVC can induce inflammatory responses in RAW264.7 macrophages through calcium signaling. A previous study showed that endothelial cell damage induced by VVC was medicated by the increase of free cytosolic Ca2+[36]. It has been known that excessive accumulation of Ca2+ in cells leads to cytotoxicity due to the activation of Ca2+-dependent enzyme systems including endonuclease[37]. However, in RAW264.7 macrophages, it seems that only high dose treatments of VVC can induce cell damage while the increase in free cytosolic Ca2+ caused by low dose treatments of VVC was not enough to lead to cytotoxicity, but was adequate to activate inflammation-related signaling pathways and induce pro-inflammatory cytokines production. In the dermal inflammation model we employed, VVC itself could induce inflammatory responses in vivo. And it seems that the tissues and cells in vivo have a higher tolerance to VVC from RAW264.7 macrophages in vitro. Because even in the tissue samples from mice injected with 20 µg VVC, there wasn’t much lysed tissue cells or inflammatory cells and a more extensive infiltration of inflammatory cells presented. Considering that the VVC may be produced in a low level during the early phage of the inflammatory responses or the inflammatory resolution phage which the
V. vulnificus has not massive proliferated or has been suppressed by immune system, a certain concentration of VVC may activate nearby monocytes/macrophages or other cells and induce inflammatory responses to affect the pathological process of bacterial infection. Due to V. vulnificus is an opportunistic pathogen and the patients often have deficiencies in their normal immune functions. Inflammation induced by VVC may be nonproductive in its ability to clear the infection and would instead lead to poor clinical outcomes[38]. Therefore, VVC of V. vulnificus can contribute to its’ pathogenesis by inducing inflammation. In this report, we show that VVC induces an influx of Ca2+ to activate NF-κB, MAPKs, and AKT signaling pathways. Previous research shows that mobilization of Ca2+ leads to JNK, p38, ERK1/2, and AKT phosphorylation[20-23] , and that p65 can be activated by p-ERK1/2[39] and p-AKT[40]. The NF-κB and p38 MAPK signal transduction pathways play important roles in stress responses such as inflammation, and may be the main cause of pro-inflammatory cytokines production induced by VVC. Meanwhile, the ERK1/2 signal transduction pathway regulates cell growth and differentiation, and the Akt pathway promotes survival and growth in response to extracellular signals. Thus, VVC may not only induce inflammatory responses in macrophage, but may also regulate other cellular activities which will be important topics to address in the future. Interestingly, we found that VVC can enhance LPS-induced pro-inflammatory cytokines production in RAW264.7 macrophages. These results suggest that VVC has additive effects with LPS in the inflammatory responses during V. vulnificus infection. And the phenomena may partially explain the rapidly progress, high virulence, and high mortality in V. vulnificus-induced septicemia and necrotizing wound infection. In the blood and tissues, certain doses of VVC from V. vulnificus may be a constant threat that leads monocytes/macrophages to continuously secrete pro-inflammatory cytokines such as IL-6 that can lead to poor sepsis outcomes[34]. Thus, the inflammatory role of VVC in macrophages outlines a new direction for the clinical management of V. vulnificus infection. 5. Conclusion
We have shown that VVC can trigger inflammatory response in RAW264.7 macrophages through induction an influx of Ca2+ and activating inflammatory signaling pathways. And VVC induces inflammatory responses in the dermal inflammation mice model. These data may help in the development a strategy targeting VVC for the clinical management of V. vulnificus induced inflammatory responses. Conflict-of-interest disclosure The authors declare that they have no financial conflicts of interest. Acknowledgements This work was supported by Medical and Health Key Project Foundations (Grant No：BHJ14J004 and CHJ12J025) and Innovation Cultivating Foundation of Sixth Medical Center of Chinese People's Liberation Army General Hospital（Grant No： CXPY201824） Authorship L.Z. and K.Q. designed the experiments; K.Q., K.F., J.L., C.W. and Y.W. did the experiments; L.Z. and K.Q. analyzed data and wrote the manuscript. Appendix A. Supplementary data Supplemental data include supplemental Table 1 and Figures 1-5. Reference [1] Elgaml A, Miyoshi SI. Regulation systems of protease and hemolysin production in Vibrio vulnificus. Microbiol Immunol 2017;61:1-11. http://dx.doi.org/10.1111/1348-0421.12465. PMID: 28111826. [2] Wickboldt LG, Sanders CV. Vibrio vulnificus infection. Case report and update since 1970. J Am Acad Dermatol 1983;9:243-51. PMID: 6886115. [3] Jones MK, Oliver JD. Vibrio vulnificus: disease and pathogenesis. Infect Immun 2009;77:1723-33. http://dx.doi.org/110.1128/IAI.01046-08. PMID: 19255188. [4] Rippey SR. Infectious diseases associated with molluscan shellfish consumption. Clin Microbiol Rev 1994;7:419-25. PMID: 7834599. [5] Baker-Austin C, Oliver JD. Vibrio vulnificus: new insights into a deadly opportunistic pathogen. Environ Microbiol 2018;20:423-430. http://dx.doi.org/10.1111/1462-2920.13955. PMID: 29027375. [6] Oliver JD. Vibrio vulnificus: death on the half shell. A personal journey with the pathogen and its ecology. Microb Ecol 2013;65:793-9. http://dx.doi.org/10.1007/s00248-012-0140-9. PMID: 23263234. [7] Horseman MA, Surani S. A comprehensive review of Vibrio vulnificus: an important cause of severe sepsis
and skin and soft-tissue infection. Int J Infect Dis 2011;15:e157-66.
http://dx.doi.org/10.1016/j.ijid.2010.11.003. PMID: 21177133. [8] Park JW, Jahng TA, Rho HW, Park BH, Kim NH, Kim HR. Inhibitory mechanism of Ca2+ on the hemolysis caused by Vibrio vulnificus cytolysin. Biochim Biophys Acta 1994;1194:166-70. PMID: 8075131. [9] Senoh M, Miyoshi S, Okamoto K, Fouz B, Amaro C, Shinoda S. The cytotoxin-hemolysin genes of human and eel pathogenic Vibrio vulnificus strains: comparison of nucleotide sequences and application to the genetic grouping. Microbiol Immunol 2005;49:513-9. PMID: 15965298. [10] Kook H, Lee SE, Baik YH, Chung SS, Rhee JH. Vibrio vulnificus hemolysin dilates rat thoracic aorta by activating guanylate cyclase. Life Sci 1996;59:PL41-7. PMID: 8699927. [11] Hor LI, Chang YK, Chang CC, Lei HY, Ou JT. Mechanism of high susceptibility of iron-overloaded mouse to Vibrio vulnificus infection. Microbiol Immunol 2000;44:871-8. PMID: 11145266. [12] Powell JL, Wright AC, Wasserman SS, Hone DM, Morris JJ. Release of tumor necrosis factor alpha in response to Vibrio vulnificus capsular
polysaccharide in in vivo and in vitro models. Infect
Immun 1997;65:3713-8. PMID: 9284142. [13] Lee SJ, Jung YH, Oh SY, Song EJ, Choi SH, Han HJ. Vibrio vulnificus VvhA induces NF-kappaB-dependent mitochondrial cell death via lipid raft-mediated ROS production in intestinal epithelial cells. Cell Death Dis 2015;6:1655. http://dx.doi.org/10.1038/cddis.2015.19. PMID: 25695598. [14] Kulkarni R, Randis TM, Antala S, Wang A, Amaral FE, Ratner AJ. beta-Hemolysin/cytolysin of Group B Streptococcus enhances host inflammation but
is dispensable for establishment of urinary
tract infection. Plos One 2013;8:e59091. http://dx.doi.org/10.1371/journal.pone.0059091. PMID: 23505569. [15] Donohue M, Chung Y, Magnuson ML, Ward M, Selgrade MJ, Vesper S. Hemolysin chrysolysin from Penicillium chrysogenum promotes inflammatory response. Int J Hyg Environ Health 2005;208:279-85. PMID: 16078642 [16] Chen W, Han C, Xie B, Hu X, Yu Q, Shi L, et al. Induction of Siglec-G by RNA viruses inhibits the
innate
immune
response
by
promoting
RIG-I
degradation.
Cell
2013;152:467-78.
http://dx.doi.org/10.1016/j.cell.2013.01.011. PMID: 23374343. [17] Jiang JH, Ge G, Gao K, Pang Y, Chai RC, Jia XH, et al. Calcium Signaling Involvement in Cadmium-Induced Astrocyte Cytotoxicity and Cell PI3K/Akt
Signaling
Pathways.
Death Through Activation of MAPK and
Neurochem
Res
2015;40:1929-44.
http://dx.doi.org/10.1007/s11064-015-1686-y. PMID: 26248512. [18] Kwon KB, Yang JY, Ryu DG, Rho HW, Kim JS, Park JW, et al. Vibrio vulnificus cytolysin induces superoxide anion-initiated apoptotic signaling pathway in human ECV304 cells. J Biol Chem 2001;276:47518-23. http://dx.doi.org/10.1074/jbc.M108645200. PMID: 11591724 [19] Rho HW, Choi MJ, Lee JN, Park JW, Kim JS, Park BH, et al. Cytotoxic mechanism of Vibrio vulnificus cytolysin in CPAE cells. Life Sci 2002;70:1923-34. PMID: 12005177. [20] Stringaris AK, Geisenhainer J, Bergmann F, Balshusemann C, Lee U, Zysk G, et al. Neurotoxicity of pneumolysin, a major pneumococcal virulence factor, involves calcium influx and depends on activation of p38 mitogen-activated protein kinase. Neurobiol Dis 2002;11:355-68. PMID: 12586546. [21] Crow T, Xue-Bian JJ, Siddiqi V, Neary JT. Serotonin activation of the ERK pathway in Hermissenda: contribution of calcium-dependent protein kinase C. J Neurochem 2001;78:358-64. PMID: 11461971.
[22] Matsuoka M, Igisu H. Activation of c-Jun NH2-terminal kinase (JNK/SAPK) in LLC-PK1 cells by
cadmium.
Biochem
Biophys
Res
Commun
1998;251:527-32.
http://dx.doi.org/10.1006/bbrc.1998.9487. PMID: 9792807. [23] Yano S, Tokumitsu H, Soderling TR. Calcium promotes cell survival through CaM-K kinase activation of the protein-kinase-B pathway. Nature 1998;396:584-7. http://dx.doi.org/10.1038/25147. PMID: 9859994. [24] Day AM, Veal EA. Hydrogen peroxide-sensitive cysteines in the Sty1 MAPK regulate the transcriptional
response
to
oxidative
stress.
J
Biol
Chem
2010;285:7505-16.
http://dx.doi.org/10.1074/jbc.M109.040840. PMID: 20061379. [25] Meng D, Shi X, Jiang BH, Fang J. Insulin-like growth factor-I (IGF-I) induces epidermal growth factor receptor transactivation and cell proliferation through reactive oxygen species. Free Radic Biol Med 2007;42:1651-60. http://dx.doi.org/10.1016/j.freeradbiomed.2007.01.037. PMID: 17462533. [26] Kamata H, Honda S, Maeda S, Chang L, Hirata H, Karin M. Reactive oxygen species promote TNFalpha-induced death and sustained JNK activation by inhibiting MAP kinase phosphatases. Cell 2005;120:649-61. http://dx.doi.org/10.1016/j.cell.2004.12.041. PMID: 15766528. [27] Okoh VO, Felty Q, Parkash J, Poppiti R, Roy D. Reactive oxygen species via redox signaling to PI3K/AKT pathway contribute to the malignant growth of 4-hydroxy estradiol-transformed mammary epithelial cells. Plos One 2013;8:e54206. http://dx.doi.org/10.1371/journal.pone.0054206. PMID: 23437041. [28] Yaron JR, Gangaraju S, Rao MY, Kong X, Zhang L, Su F, et al. K(+) regulates Ca(2+) to drive inflammasome signaling: dynamic visualization of ion flux in live cells. Cell Death Dis 2015;6:e1954. http://dx.doi.org/10.1038/cddis.2015.277. PMID: 26512962. [29] Toma C, Higa N, Koizumi Y, Nakasone N, Ogura Y, McCoy AJ, et al. Pathogenic Vibrio activate NLRP3 inflammasome via cytotoxins and TLR/nucleotide-binding oligomerization domain-mediated NF-kappa B signaling. J Immunol 2010;184:5287-97. http://dx.doi.org/10.4049/jimmunol.0903536. PMID: 20348425. [30] Sutterwala FS, Haasken S, Cassel SL. Mechanism of NLRP3 inflammasome activation. Ann N Y Acad Sci 2014;1319:82-95. http://dx.doi.org/10.1111/nyas.12458. PMID: 24840700. [31] Jeong HG, Satchell KJ. Additive function of Vibrio vulnificus MARTX(Vv) and VvhA cytolysins promotes rapid growth and epithelial tissue necrosis during intestinal infection. Plos Pathog 2012;8:e1002581. http://dx.doi.org/10.1371/journal.ppat.1002581. PMID: 22457618. [32] Smith RS, Harris SG, Phipps R, Iglewski B. The Pseudomonas aeruginosa quorum-sensing molecule N-(3-oxododecanoyl)homoserine
lactone contributes to virulence and induces inflammation
in vivo. J Bacteriol 2002;184:1132-9. http://dx.doi.org/10.1128/jb.184.4.1132-1139.2002. PMID: 11807074. [33] Xie DL, Zheng MM, Zheng Y, Gao H, Zhang J, Zhang T, et al. Vibrio vulnificus induces mTOR activation
and
inflammatory
responses
in
macrophages.
Plos
One
2017;12:e0181454.
http://dx.doi.org/10.1371/journal.pone.0181454. PMID: 28719654. [34] Damas P, Ledoux D, Nys M, Vrindts Y, De Groote D, Franchimont P, et al. Cytokine serum level during severe sepsis in human IL-6 as a marker of severity. Ann Surg 1992;215:356-62. PMID: 1558416. [35] Ovchinnikov DA. Macrophages in the embryo and beyond: much more than just giant phagocytes. Genesis 2008;46:447-62. http://dx.doi.org/10.1002/dvg.20417. PMID: 18781633. [36] Park KH, Lee YR, Hur H, Yu HN, Rah SY, Kim UH, et al. Role of calcium/calmodulin signaling
pathway in Vibrio vulnificus cytolysin-induced hyperpermeability. Microb Pathog 2009;47:47-51. http://dx.doi.org/10.1016/j.micpath.2009.04.014. PMID: 19447166. [37] McCabe MJ, Nicotera P, Orrenius S. Calcium-dependent cell death. Role of the endonuclease, protein kinase C, and chromatin conformation. Ann N Y Acad Sci 1992;663:269-78. PMID: 1336329. [38] Baldovino S, Montin D, Martino S, Sciascia S, Menegatti E, Roccatello D. Common variable immunodeficiency: crossroads between infections, inflammation and autoimmunity. Autoimmun Rev 2013;12:796-801. http://dx.doi.org/10.1016/j.autrev.2012.11.003. PMID: 23219764. [39] Chen BC, Lin WW. PKC- and ERK-dependent activation of I kappa B kinase by lipopolysaccharide in macrophages: enhancement by P2Y receptor-mediated CaMK activation. Br J Pharmacol 2001;134:1055-65. http://dx.doi.org/10.1038/sj.bjp.0704334. PMID: 11682454. [40] Taniguchi R, Fukushima H, Osawa K, Maruyama T, Yasuda H, Weih F, et al. RelB-induced expression of Cot, an MAP3K family member, rescues RANKL-induced osteoclastogenesis in alymphoplasia mice by promoting NF-kappaB2 processing by IKKalpha. J Biol Chem 2014;289:7349-61. http://dx.doi.org/10.1074/jbc.M113.538314. PMID: 24488495.
Highlights: 1.
Low dose VVC induces inflammatory response in RAW264.7 macrophages.
2.
BAPTA inhibits macrophages.
3.
VVC primes rather than activates NLRP3 inflammasome in RAW264.7 macrophages.
4.
VVC induces inflammation in the skin of mice.
VVC
induced
inflammatory
response
in
RAW264.7
S0882-4010(19)30436-X
DOI:
https://doi.org/10.1016/j.micpath.2019.103789
Reference:
YMPAT 103789
To appear in:
Microbial Pathogenesis
Received Date: 11 March 2019 Revised Date:
12 July 2019
Accepted Date: 8 October 2019
Please cite this article as: Qin K, Fu K, Liu J, Wu C, Wang Y, Zhou L, Vibrio vulnificus cytolysin induces inflammatory responses in RAW264.7 macrophages through calcium signaling and causes inflammation in vivo, Microbial Pathogenesis (2019), doi: https://doi.org/10.1016/j.micpath.2019.103789. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Ltd.
Vibrio vulnificus cytolysin induces inflammatory responses in RAW264.7 macrophages through calcium signaling and causes inflammation in vivo Kewei Qin1, Kaifei Fu1, Jianfei Liu1, Chenglin Wu1, Yuxiao Wang1, Lijun Zhou1,* 1
Central Laboratory, The Sixth Medical Center of Chinese PLA General Hospital,
Beijing, 100048, China
Footnotes: *
Address correspondence and reprint requests to: Dr. Lijun Zhou. Central Laboratory,
The Sixth Medical Center of Chinese PLA General Hospital, Beijing, 100048, China; E-mail: [email protected]
Abstract Vibrio vulnificus is a food-borne marine pathogen that causes both life-threatening primary septicemia and necrotizing wound infections which accompany severe inflammation. Cytolysin is a very powerful virulence factor of V. vulnificus and is one of the likely candidates in the pathogenesis of V. vulnificus infections. However, the pathogenetic roles of cytolysin in V. vulnificus-induced inflammation are not well understood. In this study, we used the recombinant protein Vibrio vulnificus cytolysin (VVC) to demonstrate that VVC can induce inflammatory responses in RAW264.7 macrophages. Low dose (< 5 µg/ml) VVC had no impact on cell viability and induced pro-inflammatory cytokines production in RAW264.7 macrophages such as IL-6 and TNF-α. Moreover, VVC induced p65, p38, ERK1/2, and AKT phosphorylation in RAW264.7 macrophages. We further demonstrated that BAPTA, a specific intracellular calcium chelator, inhibited VVC-induced inflammatory response including pro-inflammatory cytokines production and inflammatory signaling activation in RAW264.7 macrophages. In addition, VVC primed rather than actived NLRP3 inflammasome in RAW264.7 macrophages. To determine whether VVC have a direct inflammatory effect on the host, we examined the effects of VVC injected
into the skin of mice. VVC stimulated a significant induction of mRNAs for the pro-inflammatory cytokine IL-6 and inflammatory chemokines such as MCP-1 and IP-10. Histology data also showed that VVC caused inflammatory responses in the skin of mice. Collectively, our findings indicated that VVC induced inflammatory responses in RAW264.7 macrophages and in vivo and suggested the possibility of targeting VVC as a strategy for the clinical management of V. vulnificus-induced inflammatory responses.
Keywords: Vibrio vulnificus; Cytolysin; Macrophage; Calcium; Inflammation; Pro-inflammatory cytokine
1. Introduction V. vulnificus is a halophilic Gram-negative bacterium widely distributed in tropical and subtropical seawaters. This opportunistic pathogen has been isolated from a range of different seafood produce such as eels, shrimp, oysters and clams[1]. Patients with V. vulnificus infections have been reported every year in locations all over the world. The earliest case was described in 1970, when Roland reported that V. vulnificus infection led to calf gangrene and endotoxic shock[2]. Since then, the number of reported infections has increased because of greater disease activity due to global warming and improved recognition by clinicians. V. vulnificus is known for its high virulence and high mortality rate. For example, it is reported that this pathogen is responsible for over 95% of seafood-related deaths in the United States[3], which is the highest fatality rate of all food-borne pathogens[4]. V. vulnificus infection can cause rapidly progressive fatal septicemia and necrotizing wound infection which are always accompanied by septic shock or multiple organ dysfunction[5]. Despite the fact that previous studies have significantly advanced our understanding of the pathogenesis of V. vulnificus infection, many aspects related to its virulence remain elusive. V. vulnificus possesses a range of virulence or toxic factors that play roles in its pathogenicity, including capsular polysaccharides, flagella, siderophores, pili,
cytolytic toxin, proteolytic enzymes, phospholipase A, and repeats-in-toxin toxin[6, 7]. Among the virulence factors, V. vulnificus cytolysin (VVC, also known as V. vulnificus hemolysin) is of significant importance during human infection. VVC is a 51 kDa water-soluble pore-forming toxin which oligomerizes at cholesterol-enriched membrane domains known as lipid rafts[8]. It is reported that VVC may contribute to bacterial invasion from the intestine to the blood stream[9] or trigger vasodilation to enhance the development of hypotensive septic shock[10]. V. vulnificus infections may cause a serious inflammatory process characterised by the upregulation of pro-inflammatory cytokines. Previous studies on V. vulnificus have investigated the association between pro-inflammatory cytokines production and virulence factors such as lipopolysaccharide (LPS), iron-overloading[11] , and capsular polysaccharides [12]. However, the role of VVC in inflammation during V. vulnificus infection is not fully understood. A previous study shows that VVC induces NF-κB-dependent mitochondria-mediated cell death via lipid raft-mediated reactive oxygen species (ROS) production in intestinal epithelial cells[13]. Hemolysin from other pathogens such as Group B Streptococcus[14] and Penicillium chrysogenum[15] have been reported to enhance host inflammation. These studies indicate that VVC may play a role in the inflammatory response during V. vulnificus infection. It is well established that infection of macrophages with bacterial pathogens results in cytokines production. However, whether VVC is involved in inflammatory responses to V. vulnificus in macrophages and the potential mechanism behind its involvement remains elusive. In this report, we demonstrated that a low dose (< 5 µg/ml) of VVC induced pro-inflammatory cytokines production in RAW264.7 macrophages. Moreover, VVC could activate NF-κB, MAPK, and AKT in RAW264.7 macrophages. In addition, inhibition of calcium influx regulated VVC-induced inflammatory response including pro-inflammatory cytokine production and inflammatory signaling activation in RAW264.7 macrophages. VVC also acted as a priming signal rather than an activating signal of NLRP3 inflammasome in RAW264.7 macrophages. And in the dermal inflammation model we employed, VVC induced inflammation in vivo.
2. Materials and methods 2.1. Reagents LPS (O111:B4) was purchased from Sigma-Aldrich (St. Louis, MO, USA) and used as previously described[16]. N-acetylcysteine[13] and BAPTA-AM[17] were from Selleck Chemicals (Houston, TX, USA) and used as previously described. Antibodies specific for GAPDH, actin, NLPR3, procaspase-1, cleaved caspase-1, p38, AKT, p65, and ERK1/2, phospho-specific Abs against p65 (Ser536), p38 (Thr180/Tyr182), ERK1/2 (Thr202/Tyr204), and AKT (Ser473) were from Cell Signaling
Technology
(Beverly,
MA,
USA).
Horseradish
peroxidase
(HRP)-conjugated secondary antibodies were from eBioscience (San Diego, CA, USA). Antibodies specific for F4/80 and IL-6 were from Servicebio (Beijing, China). 2.2. Cell culture RAW264.7 cell lines were obtained from the American Type Culture Collection. The cells were cultured with endotoxin-free RPMI 1640 (HyClone, Logan, UT, USA) with 10% fetal bovine serum which from Thermo Fisher Scientific (Waltham, MA, USA). 2.3. RNA quantification Total cellular RNA was extracted from cells using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. RNA concentrations were quantified using a spectrophotometer (Nanodrop 8000, Thermo Fisher Scientific) at 260 nm. Preparation of cDNA was performed using PrimeScriptTM reverse transcription reagent kit (TaKaRa, Japan) and PCR was performed using a thermal cycler (GeneAmp PCR system 2400, PerkinElmer, Waltham, MA, USA). Quantitative real-time RT-PCR analysis was performed using a LightCycler instrument (Thermal Cycler 2720, Applied Biosystems, Carlsbad, CA, USA) with SYBR RT-PCR kit (TaKaRa, Japan). Based on PrimerBank (https://pga.mgh.harvard.edu/primerbank/), we used the oligonucleotide primers listed in Table 1 (supplementary Tab. 1). β-actin served as the normalizer and relative gene expression was expressed as the “fold change” using the 2-∆∆Ct method. 2.4. Immunoblot
Cells were washed in PBS and lysed with RIPA buffer (Cell Signaling Technology, Beverly, MA, USA) supplemented with protease inhibitor cocktail on ice. Protein concentrations of the extracts were measured with BCA assay (Pierce, Waltham, MA, USA). The lysates were then cleared by centrifugation (20,000g at 4 °C for 20 min). Equal amounts of protein (20 µg) were resolved by 10% SDS-PAGE and transferred to polyvinylidene fluoride membranes. The membranes were washed with Tris-buffer solution-Tween 20 (10 mM Tris-HCl, pH 7.6, 150 mM NaCl, and 0.05% Tween-20), blocked with 5% skim milk for 1 h, and incubated with the appropriate primary antibody at 4 °C overnight. The membrane was then washed and incubated with a HRP-conjugated secondary antibody. Blots were developed using the enhanced chemiluminescence detection method. (ImageQuant LAS 4000, General Electric Company, MA, USA). 2.5. CCK8 (Cell Counting Kit-8) Assay Cells were treated with VVC for various lengths of time. CCK8 (Dojindo, Japan) solution was then added to each well and the plates were incubated at 37 °C for another 2 h. After incubation, the absorbance was measured at 450 nm using iMarker Microplate Reader (Bio-Rad, Hercules, CA, USA). Cell viability was calculated as a percentage of the untreated sample. 2.6. Enzyme-linked immunosorbent assays (ELISA) After cells were stimulated (100 ng/ml LPS, 1-20 µg/ml VVC), the culture supernatants were collected for analysis at designated times using enzyme-linked immunosorbent assays for cytokine concentration. ELISA kits including IL-6 (DKW12-2060, Dakewe, Beijing, China)，TNF-α (DKW12-2720, Dakewe, Beijing, China)， IL-1β (DKW12-10122, Dakewe, Beijing, China) and IL-18 (ml063131, Mlbio, Shanghai, China) were used according to the manufacturer’s instructions. 2.7. Purification of the recombinant VVC protein To find the functional role of VVC in RAW264.7 cells, we prepared a recombinant version of the VVC protein. The oligonucleotide sequence was designed using the V. vulnificus YJ016 genomic sequence (www.ncbi.nlm.nih.gov, NCBI Reference Sequence: NC_005140.1). Briefly, the open reading frame of VVC was amplified by
PCR using a pair of primers (Pvvf1: gcggatccatgaaaaaaatgactctgttt (BamH1); Pvvr2: ccctcgaggagtttgacttgttgtaatgt (Xho1)) and cloned into pET28a, a His-tag expression vector, resulting in pET28a-vvc. E. coli BL21 (DE3) harboring the pET28a-vvc was grown in LB-kanamycin media at 37 °C until OD600 reached 0.6 and protein expression was induced using 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) for 6 h. The cells were harvested by centrifugation, resuspended in buffer A (50 mM Tris， 300 mM NaCl，pH 8.5), and the cell suspensions were ultrasonicated. The crude cell extracts were centrifuged at 12,000 rpm for 20 min at 4 °C, and the supernatant containing His-tagged VVC protein was purified using nickel agarose affinity chromatography. Wash buffer (8M urea, 50 mM Tris, 300 mM NaCl, 20 mM imidazole, pH 8.5) and elution buffer (8M urea, 50 mM Tris, 300 mM NaCl, 500 mM imidazole, pH 8.5) were used during the process. Purified proteins were dialyzed against 25 mM Tris, 150 mM NaCl, 0.1% SKL, pH 9.0 and concentrated to 0.4 mg/ml and stored at − 80 °C until use. The purified VVC was assessed using SDS-PAGE (supplementary Fig. 3). Before experiments were performed, the VVC protein was dissolved in PBS (phosphate buffer saline), the solution was purified using EtEraser Endotoxin Removal Kit (BIOENDOTM, Xiameng, China), and any residual endotoxin in the purified VVC protein solution was measured using the Endotoxin Test Kit (BIOENDOTM, Xiameng, China) according to the manufacturer’s instructions. 2.8. Dermal inflammation mice model Female BALB/c mice (8-10 weeks old, Vitalriver, Beijing, China) were used in the experiments. Mice were bred in pathogen free conditions and randomly grouped (n = 4 mice each group). Hair was shaved to expose the skin, and 50µl of PBS or VVC dissolved in PBS was injected intradermally. Groups 1 to 3 were administered PBS, VVC 2 µg and VVC 20 µg, respectively. After 12 h, the mice were sacrificed by cervical dislocation after anesthesia. Skin tissues at the site of injection were removed and kept immersed in fixative for 24 hours before stained with H&E or antibodies for immunohistochemistry test. In addition, the other skin tissues were lysed in TRIzol reagent for RNA extraction. 2.9. Statistical analysis
Results are given as mean plus or minus standard deviation (SD). Comparisons between two groups were performed using Student’s t test. Statistical significance was determined as P values less than 0.05. 3. Results 3.1. Low dose VVC does not affect RAW264.7 macrophages viability VVC has been reported to be cytotoxic toward mammalian cells in culture and can induce the superoxide anion-initiated apoptotic signaling pathway in ECV304 cells [18]. Therefore, we investigated the effect of VVC on RAW264.7 cells viability as our initial step, using recombinant VVC protein. Cell viability was measured using the CCK-8 assay to evaluate whether VVC can injure RAW264.7 cells. VVC showed no cytotoxicity on RAW264.7 cells at 0.5 µg/ml or 5 µg/ml, but cytotoxicity was observed in cells treated with 10 µg/ml and 20 µg/ml VVC. The cytotoxicity of VVC increased in a concentration-dependent manner (Fig. 1A). No visible cell loss was observed by microscope until the VVC dose was increased to more than 5 µg/ml, consistent with the CCK-8 results (Fig. 1B). These results indicate that low dose (< 5 µg/ml) VVC does not affect RAW264.7 cell viability.
Fig. 1. Viability of RAW264.7 macrophages incubated with different concentrations of recombinant VVC protein. (A) Viability of RAW264.7 macrophages following incubation with VVC （0 – 20 µg/ml）for 24 h. (B) Microscopic pictures of RAW264.7 macrophages incubated for 24 h in medium containing 0 – 20 µg/ml VVC. Data are representative of three independent experiments with similar results and presented as mean ± SD. ＊P < 0.05 indicates a significant difference from the control group.
3.2. Low dose VVC induces pro-inflammatory cytokines production in RAW264.7 macrophages
We next examined the effect of low dose VVC on the production of pro-inflammatory cytokines in RAW264.7 macrophages. In order to exclude endotoxin residues in the recombinant VVC protein used in the experiment, the protein was further purified using an efficient endotoxin removal resin and residual endotoxin was tested. Residual endotoxin in purified 1 µg/ml VVC was present only at a very low level (0.02 EU/ml), which is less than 0.02 ng/ml LPS (Supplementary Fig. 1), which we demonstrate to be unable to induce pro-inflammatory cytokine (IL-6 and TNF-α) production in RAW264.7 cells (Supplementary Fig. 2). RAW264.7 cells were treated with purified VVC and mRNA expression of pro-inflammatory cytokines was tested by quantitative real-time PCR (Q-PCR). The results show that in response to VVC, RAW264.7 macrophages produced pro-inflammatory cytokines (IL-6 and TNF-α) in a dose-dependent manner (Fig. 2A). 3.3. VVC enhances LPS-induced pro-inflammatory cytokines production in RAW264.7 macrophages Given that VVC is one of the virulence factors of V. vulnificus and LPS from the pathogen also contributes significantly to activating Toll-like receptors (TLRs) signaling and to inducing the inflammatory response, it is important to understand whether VVC has an additive effect on LPS induced pro-inflammatory cytokines production. To do this, RAW264.7 cells were collected at 0 h, 1 h, 4 h, 8 h, 12 h, and 24 h after stimulation by VVC and LPS. The production of pro-inflammatory cytokines was tested by Q-PCR. Both VVC and LPS could induce pro-inflammatory cytokines (IL- 6 and TNF-α) mRNA expression, but the VVC and LPS co-treatment group produced more IL-6 and TNF-α mRNA than the LPS alone treatment group (Fig. 2B). We also confirmed that VVC could induce pro-inflammatory cytokines production (IL-6 and TNF-α) and enhance LPS-induced IL-6 and TNF-α secretion in RAW264.7 macrophages by ELISA (Fig. 2C). Taken together, these results show that VVC induces the production of pro-inflammatory cytokines and that this effect is additive with LPS treatment in RAW264.7 macrophages.
Fig. 2. VVC induces pro-inflammatory cytokine production in RAW264.7 macrophages. (A) Q-PCR of IL-6 and TNF-α in RAW264.7 macrophages (8 × 105 cells per well) incubated in medium containing 0 – 4 µg/ml of VVC for certain time. IL-6 mRNA in RAW264.7 macrophages was measured after 8 h VVC treatment and TNF-α mRNA in RAW264.7 was measured after 2 h VVC treatment. (B) Q-PCR of IL-6 and TNF-α in RAW264.7 macrophages (8 × 105 cells per well) incubated in medium containing VVC (1 µg/ml) and/or LPS (100 ng/ml) for the indicated length of time. (C) ELISA of IL-6 and TNF-α in supernatants from RAW264.7 macrophages (8 × 105 cells per well) incubated in medium containing VVC (1 µg/ml) and/or LPS (100 ng/ml) for 12 h. Data are representative of three independent experiments with similar results and presented as mean ± SD. ＊P < 0.05 indicates significant differences from the control group (0 h or untreated by VVC). ＃P < 0.05 indicates significant differences from the LPS treatment group in the certain time.
3.4. VVC induces p65, p38, ERK1/2 and AKT phosphorylation in RAW264.7 macrophages
To understand how VVC mediates pro-inflammatory cytokines production in RAW264.7 cells, we determined the effect of VVC on several cell signaling pathways related to inflammatory responses, including NF-κB, MAPK, and AKT signaling pathways. RAW264.7 were treated with VVC (1 µg/ml) for 0 min, 30 min, 60 min, and 90 min, then the extracted proteins were subjected to immunoblotting using anti-phospho-p65, -phospho-p38, -phospho-ERK1/2, and -phospho-AKT antibodies. We found that p65, p38, ERK1/2, and AKT were phosphorylated in cells treated with VVC, in comparison to the untreated control cells, where the above proteins were either non-phosphorylated or only weakly phosphorylated (Fig. 3A). VVC increased the ratio of phosphorylated protein to total protein in the analysis of p65, p38, ERK1/2, and AKT, and the strongest activation was observed at the 30 min time point (Fig. 3B). These results indicate that VVC may induce pro-inflammatory cytokines production through activating inflammation-related signaling pathways.
Fig. 3. The effect of VVC on p65, p38, ERK1/2, and AKT phosphorylation in RAW264.7 macrophages. (A) Immunoblot of RAW264.7 macrophages (8×105 cells per well) cell lysates using the indicated antibodies. Cells were stimulated with VVC (1 µg/ml). GAPDH protein was used as an internal control. Data are representative of three independent experiments with similar results. (B) Quantification of p65, p38, ERK1/2, and AKT phosphorylation. The intensities of bands were analyzed and quantified using the Tanon Gel Image System. Results are expressed as the ratio of phosphorylated
protein to total protein and are expressed as a fold difference compared to levels in untreated RAW264.7 cells. Results indicate mean ± standard error of the mean of three independent experiments. ＊P < 0.05 indicates significant differences from the control group (0 min).
3.5. BAPTA inhibits VVC induced pro-inflammatory cytokines production in RAW264.7 macrophages To further explore how VVC activates inflammation-related signaling pathways, we investigated the potential mechanisms that under this activation. It is well established that VVC, as a kind of hemolysin, can induce an increase in calcium influx[19]. Calcium ions are central to multiple signal transduction pathways that ultimately control a variety of biological functions, including the inflammatory response. Under some circumstances, elevations of cellular Ca2+ can directly or indirectly influence cellular signaling, including activation of MAPKs[20-22] and of the PI3K/Akt signal pathway[23], which may activate the downstream NF-κB signal pathway. Meanwhile, we also noted a previous publication that describes the ability of VVC to increase the interaction of NADPH oxidase 2 with a cytosolic protein NCF1 to facilitate the production of ROS[13]. It has been reported that ROS can mediate activation of the MAPK signaling pathway by inducing JNK, p38, and ERK1/2 phosphorylation [24-26]. ROS can also mediate activation of the PI3K/AKT signaling pathway [27]. These reports indicate that VVC may activate inflammation-related signaling pathways through increasing calcium influx or cellular ROS levels. RAW264.7 macrophages were pre-treated with the ROS inhibitor NAC (N-acetylcysteine) or BAPTA-AM, a specific intracellular calcium chelator that prevents the increase of calcium levels, before being stimulated by VVC. The production of IL-6 and TNF-α was measured by Q-PCR. Data revealed that 20 µM BAPTA can significantly decrease IL-6 and TNF-α mRNA expression induced by VVC treatment, while NAC didn’t affect IL-6 and TNF-α mRNA production induced by VVC within the recommended concentrations (Fig. 4A). In accordance with Q-PCR results, data obtained by ELSIA confirmed that BAPTA inhibits VVC-induced IL-6 and TNF-α production in RAW264.7 macrophages, while NAC does not (Fig. 4B).
Fig. 4. The effect of BAPTA and NAC on VVC-induced pro-inflammatory cytokines production in RAW264.7 macrophages. (A) Q-PCR of IL-6 and TNF-α in RAW264.7 macrophages (8 × 105 cells per well) pretreated with NAC (0 – 100 µM) or BAPTA-AM (0 – 20 µM) for 30 mins and then stimulated with VVC (1 µg/ml) for 6 h. (B) ELISA of IL-6 and TNF-α in supernatants from RAW264.7 macrophages (8 × 105 cells per well) pretreated with NAC (100 µM) or BAPTA-AM (20 µM) for 30 mins and then stimulated with VVC (1 µg/ml) for 12 h. Data are representative of three independent experiments with similar results and presented as mean ± SD. ＊ P < 0.05 indicates significant differences from the DMSO-treated group.
3.6. BAPTA inhibits VVC-induced p65, p38, ERK1/2, and AKT phosphorylation in RAW264.7 macrophages We continued to examine whether VVC treatment affects NF-κB, MAPK, and
PI3K/Akt activation through calcium influx. RAW264.7 cells were treated with VVC (1 µg/ml) for 0 min or 30 min, with or without BAPTA-AM pre-treatment. Then, the extracted proteins were subjected to immunoblotting with anti-phosphorylation antibodies. Western blots demonstrated that in the group treated with VVC and BAPTA, VVC-induced p65, p38, ERK1/2, and AKT phosphorylation were significantly impaired compare to the group simply treated with VVC (Fig. 5A). In accordance with the western blot results, statistical results prove that BAPTA decreased the ratio of phosphorylated to total protein in p65, p38, ERK1/2, and AKT in RAW264.7 cells treated using VVC (Fig. 5B). The above data indicate that VVC may induce pro-inflammatory cytokine production through calcium influx-mediated activation of inflammation-related signaling through NF-κB, MAPK, and PI3K/Akt pathways.
Fig. 5. The effect of BAPTA on VVC-induced p65, p38, ERK1/2, and AKT phosphorylation in RAW264.7 macrophages. (A) Immunoblot of cell lysates from RAW264.7 macrophages (8×105 cells per well) stimulated with VVC (1 µg/ml) using the indicated antibodies. GAPDH protein was used as an internal control. Data are representative of three independent experiments with similar results. (B) Quantification of p65, p38, ERK1/2, and AKT phosphorylation. The intensities of bands were analyzed and quantified using the Tanon Gel Image System. Results are expressed as the ratio of phosphorylated protein to total protein and as fold differences as compared to untreated RAW264.7 cells. Results
indicate mean ± standard error of the mean of three independent experiments. ＊P < 0.05 indicates significant differences from the “VVC+ and BAPTA-” group.
3.7. VVC primes rather than activates NLRP3 inflammasome in RAW264.7 macrophages. Considering that previous reports show that BAPTA inhibits inflammation in macrophage through inflammasome[28] and V. vulnificus can activate NLRP3 inflammasome[29],
we
continued
to
clarify
the
involvement
of
NLRP3
inflammasome in VVC induced inflammation in RAW264.7 macrophages. Activated NLRP3 inflammasome stimulates caspase-1 activation that triggers maturation and secretion of pro-inflammatory cytokines, including IL-1β and IL-18. The activation of NLRP3 inflammasome requires signal 1 (priming signal such as LPS, upregulating the expression of proIL-1β, proIL-18 and NLRP3) and signal 2 (activating inflammasome)[30]. We first tested whether VVC can act as signal 1 just like LPS in RAW264.7 macrophages. The results show that VVC induced IL-1β, IL-18 and NLRP3 mRNA expression in RAW264.7 macrophages in a time and dose-dependent manner (Fig. 6A&B). Western blots demonstrated that VVC induced NLRP3 and proIL-1β protein expression (Fig. 6C, Supplementary Fig. 4&Supplementary Fig. 5), however only VVC treatment could not active procaspase-1 and produce cleaved caspase-1 (data not shown) in RAW264.7 cells. We next examined whether VVC can act as signal 2 to activate inflammasome. IL-1β and IL-18 in supernatants from RAW264.7 macrophages primed with and without LPS, and exposed with VVC were tested by ELISA. The results show that VVC had no influence on IL-1β and IL-18 secretion (Fig. 6D&E) and western blots didn’t detect cleaved caspase-1 in the RAW264.7 cells (data not shown). Our result is consistent with a previous study which shows that infection with V. vulnificus lacking VVC induced caspase-1 activation and IL-1β secretion were comparable to that induced by infection with the isogenic WT strain in macropahges[29]. These data and report indicate that VVC may act as signal 1 to prime NLRP3 inflammasome like LPS while can’t act as signal 2 to active NLRP3 inflammasome alone.
Fig. 6. VVC primes rather than activates NLRP3 inflammasome in RAW264.7 macrophages. (A) Q-PCR of IL-1β, IL-18 and NLRP3 in RAW264.7 macrophages (8 × 105 cells per well) incubated in medium containing VVC (1 µg/ml) or LPS (100 ng/ml) for the indicated length of time. (B) Q-PCR of IL-1β, IL-18 and NLRP3 in RAW264.7 macrophages (8 × 105 cells per well) incubated in medium containing 0 – 4 µg/ml VVC for certain time. IL-1β mRNA in RAW264.7 macrophages was measured after 12 h VVC treatment, IL-18 mRNA was measured after 8 h VVC treatment and NLRP3 was measured after 2 h VVC treatment. (C) Immunoblot of RAW264.7 macrophages (8×105 cells per well) cell lysates using the indicated antibodies. Cells were stimulated with VVC (1 µg/ml). (D&E) ELISA of IL-1β (D) and IL-18 (E) in supernatants from RAW264.7 macrophages (8 × 105 cells per well) primed with and without LPS (100 ng/ml) for 12 h and then exposed with VVC for 3 h. Data are representative of three independent experiments with similar results and presented as mean ± SD. ＊ P < 0.05 indicates significant differences from the control group (0 h or untreated by VVC).
3.8. VVC induces inflammation in the skin of mice. Above data indicated the inflammatory role of VVC in vitro, we further explored the effects of VVC in vivo. Considering that a previous report had already studied the role of VVC with orally infected mice model[31] and V. vulnificus from seawater and
marine organisms could also infect people through fresh wound in skin[5], we employed another dermal inflammation model[32] to examine the effects of VVC in vivo. In this model, PBS or VVC was injected intradermally in mice and tissue samples from injection sites were stained by H&E (Hematoxylin and eosin). Control group injected with PBS showed no signs of inflammation while samples from mice injected with 2 μg VVC showed a significant infiltration of inflammatory cells in the dermal and fatty layers of the skin. In the samples from mice injected with 20 μg VVC, there was a more extensive infiltration of inflammatory cells, combined with edema of the dermal and epidermal layer (Fig. 7A). We further used immunohistochemistry to examine the tissue samples, the results showed that F4/80 positive macrophages are present in the fatty layers of the skin injected with VVC and pro-inflammatory cytokine IL-6 is secreted and found distributed near the inflammatory cells (Fig. 7B). We also examined the tissue samples for the presence of IL-6 by Q-PCR and a ten to twenty fold induction in the mRNA level of IL-6 was found with VVC stimulation in vivo (Fig. 7C). The samples were also examined for the presence of inflammatory chemokines to determine how VVC was inducing infiltration of inflammatory cells in the skin of mice. The result correlates with the histology data, which show that VVC induces the production of inflammatory chemokines such as MCP-1 and IP-10 in a dose-dependent manner in vivo (Fig. 7C). Taken together, these data demonstrate that VVC can induce both pro-inflammatory cytokine and inflammatory chemokine genes expression in vivo and cause inflammatory responses in the skin of mice.
Fig. 7. VVC induces cellular infiltration and production of inflammatory chemokines and cytokine in mouse skin. (A) Hematoxylin and eosin staining of skin sections from mice 12 h after dermal
injection
of
PBS
or
VVC
as
indicated.
Magnification,
200×
or
800×.
(B)
Immunohistochemistry analysis of F4/80 and IL-6 expression in the skin sections from mice 12 h after dermal injection as indicated. Magnification, 200×. (C) Q-PCR analysis of IL-6, MCP-1 and IP-10 mRNA expression from mice 12 h after dermal injection as indicated. ＊P < 0.05 indicates significant differences from the control group (PBS treatment). Each bar is the mean from samples from 4 separate mice and error bars indicate standard deviations.
4. Discussion V. vulnificus can cause serious sepsis in the host and induce inflammation via recruiting and activating innate immune cells such as monocytes, NK cells and macrophages upon infection. For example, a previous report shows that V. vulnificus infection triggered strong inflammatory responses in vivo and V. vulnificus treatment induced the production of multiple cytokines in macrophages[33]. High serum levels of pro-inflammatory cytokine such as IL-6 in patients with early-phase Gram-negative sepsis often predict poor clinical outcomes[34]. Thus, the role and specific
mechanism of V. vulnificus and its toxic factors in the inflammatory responses and inflammatory resolution during infection is an important issue to address. Previous research on VVC had focused on its role in intestinal epithelial cells, as V. vulnificus was believed to produce sufficient VVC in the small intestine to result in an acceleration of the bacterial invasion of the blood stream[1]. However, once V. vulnificus invades the blood stream, the VVC may be diluted and be spread to other tissues by the blood. Besides, V. vulnificus could also infect people through fresh wound in skin. Macrophages are large phagocytes found in essentially all tissues and play a critical role in increasing inflammation and stimulating the immune system[35]. Thus, it is important to delineate the effects of VVC on macrophage which is significant on the production of pro-inflammatory cytokines. However, until now, this issue remains unclear. In the present study, the role and mechanism of VVC on the inflammatory responses in RAW264.7 macrophage cells was investigated. We demonstrate that VVC can induce inflammatory responses in RAW264.7 macrophages through calcium signaling. A previous study showed that endothelial cell damage induced by VVC was medicated by the increase of free cytosolic Ca2+[36]. It has been known that excessive accumulation of Ca2+ in cells leads to cytotoxicity due to the activation of Ca2+-dependent enzyme systems including endonuclease[37]. However, in RAW264.7 macrophages, it seems that only high dose treatments of VVC can induce cell damage while the increase in free cytosolic Ca2+ caused by low dose treatments of VVC was not enough to lead to cytotoxicity, but was adequate to activate inflammation-related signaling pathways and induce pro-inflammatory cytokines production. In the dermal inflammation model we employed, VVC itself could induce inflammatory responses in vivo. And it seems that the tissues and cells in vivo have a higher tolerance to VVC from RAW264.7 macrophages in vitro. Because even in the tissue samples from mice injected with 20 µg VVC, there wasn’t much lysed tissue cells or inflammatory cells and a more extensive infiltration of inflammatory cells presented. Considering that the VVC may be produced in a low level during the early phage of the inflammatory responses or the inflammatory resolution phage which the
V. vulnificus has not massive proliferated or has been suppressed by immune system, a certain concentration of VVC may activate nearby monocytes/macrophages or other cells and induce inflammatory responses to affect the pathological process of bacterial infection. Due to V. vulnificus is an opportunistic pathogen and the patients often have deficiencies in their normal immune functions. Inflammation induced by VVC may be nonproductive in its ability to clear the infection and would instead lead to poor clinical outcomes[38]. Therefore, VVC of V. vulnificus can contribute to its’ pathogenesis by inducing inflammation. In this report, we show that VVC induces an influx of Ca2+ to activate NF-κB, MAPKs, and AKT signaling pathways. Previous research shows that mobilization of Ca2+ leads to JNK, p38, ERK1/2, and AKT phosphorylation[20-23] , and that p65 can be activated by p-ERK1/2[39] and p-AKT[40]. The NF-κB and p38 MAPK signal transduction pathways play important roles in stress responses such as inflammation, and may be the main cause of pro-inflammatory cytokines production induced by VVC. Meanwhile, the ERK1/2 signal transduction pathway regulates cell growth and differentiation, and the Akt pathway promotes survival and growth in response to extracellular signals. Thus, VVC may not only induce inflammatory responses in macrophage, but may also regulate other cellular activities which will be important topics to address in the future. Interestingly, we found that VVC can enhance LPS-induced pro-inflammatory cytokines production in RAW264.7 macrophages. These results suggest that VVC has additive effects with LPS in the inflammatory responses during V. vulnificus infection. And the phenomena may partially explain the rapidly progress, high virulence, and high mortality in V. vulnificus-induced septicemia and necrotizing wound infection. In the blood and tissues, certain doses of VVC from V. vulnificus may be a constant threat that leads monocytes/macrophages to continuously secrete pro-inflammatory cytokines such as IL-6 that can lead to poor sepsis outcomes[34]. Thus, the inflammatory role of VVC in macrophages outlines a new direction for the clinical management of V. vulnificus infection. 5. Conclusion
We have shown that VVC can trigger inflammatory response in RAW264.7 macrophages through induction an influx of Ca2+ and activating inflammatory signaling pathways. And VVC induces inflammatory responses in the dermal inflammation mice model. These data may help in the development a strategy targeting VVC for the clinical management of V. vulnificus induced inflammatory responses. Conflict-of-interest disclosure The authors declare that they have no financial conflicts of interest. Acknowledgements This work was supported by Medical and Health Key Project Foundations (Grant No：BHJ14J004 and CHJ12J025) and Innovation Cultivating Foundation of Sixth Medical Center of Chinese People's Liberation Army General Hospital（Grant No： CXPY201824） Authorship L.Z. and K.Q. designed the experiments; K.Q., K.F., J.L., C.W. and Y.W. did the experiments; L.Z. and K.Q. analyzed data and wrote the manuscript. Appendix A. Supplementary data Supplemental data include supplemental Table 1 and Figures 1-5. Reference [1] Elgaml A, Miyoshi SI. Regulation systems of protease and hemolysin production in Vibrio vulnificus. Microbiol Immunol 2017;61:1-11. http://dx.doi.org/10.1111/1348-0421.12465. PMID: 28111826. [2] Wickboldt LG, Sanders CV. Vibrio vulnificus infection. Case report and update since 1970. J Am Acad Dermatol 1983;9:243-51. PMID: 6886115. [3] Jones MK, Oliver JD. Vibrio vulnificus: disease and pathogenesis. Infect Immun 2009;77:1723-33. http://dx.doi.org/110.1128/IAI.01046-08. PMID: 19255188. [4] Rippey SR. Infectious diseases associated with molluscan shellfish consumption. Clin Microbiol Rev 1994;7:419-25. PMID: 7834599. [5] Baker-Austin C, Oliver JD. Vibrio vulnificus: new insights into a deadly opportunistic pathogen. Environ Microbiol 2018;20:423-430. http://dx.doi.org/10.1111/1462-2920.13955. PMID: 29027375. [6] Oliver JD. Vibrio vulnificus: death on the half shell. A personal journey with the pathogen and its ecology. Microb Ecol 2013;65:793-9. http://dx.doi.org/10.1007/s00248-012-0140-9. PMID: 23263234. [7] Horseman MA, Surani S. A comprehensive review of Vibrio vulnificus: an important cause of severe sepsis
and skin and soft-tissue infection. Int J Infect Dis 2011;15:e157-66.
http://dx.doi.org/10.1016/j.ijid.2010.11.003. PMID: 21177133. [8] Park JW, Jahng TA, Rho HW, Park BH, Kim NH, Kim HR. Inhibitory mechanism of Ca2+ on the hemolysis caused by Vibrio vulnificus cytolysin. Biochim Biophys Acta 1994;1194:166-70. PMID: 8075131. [9] Senoh M, Miyoshi S, Okamoto K, Fouz B, Amaro C, Shinoda S. The cytotoxin-hemolysin genes of human and eel pathogenic Vibrio vulnificus strains: comparison of nucleotide sequences and application to the genetic grouping. Microbiol Immunol 2005;49:513-9. PMID: 15965298. [10] Kook H, Lee SE, Baik YH, Chung SS, Rhee JH. Vibrio vulnificus hemolysin dilates rat thoracic aorta by activating guanylate cyclase. Life Sci 1996;59:PL41-7. PMID: 8699927. [11] Hor LI, Chang YK, Chang CC, Lei HY, Ou JT. Mechanism of high susceptibility of iron-overloaded mouse to Vibrio vulnificus infection. Microbiol Immunol 2000;44:871-8. PMID: 11145266. [12] Powell JL, Wright AC, Wasserman SS, Hone DM, Morris JJ. Release of tumor necrosis factor alpha in response to Vibrio vulnificus capsular
polysaccharide in in vivo and in vitro models. Infect
Immun 1997;65:3713-8. PMID: 9284142. [13] Lee SJ, Jung YH, Oh SY, Song EJ, Choi SH, Han HJ. Vibrio vulnificus VvhA induces NF-kappaB-dependent mitochondrial cell death via lipid raft-mediated ROS production in intestinal epithelial cells. Cell Death Dis 2015;6:1655. http://dx.doi.org/10.1038/cddis.2015.19. PMID: 25695598. [14] Kulkarni R, Randis TM, Antala S, Wang A, Amaral FE, Ratner AJ. beta-Hemolysin/cytolysin of Group B Streptococcus enhances host inflammation but
is dispensable for establishment of urinary
tract infection. Plos One 2013;8:e59091. http://dx.doi.org/10.1371/journal.pone.0059091. PMID: 23505569. [15] Donohue M, Chung Y, Magnuson ML, Ward M, Selgrade MJ, Vesper S. Hemolysin chrysolysin from Penicillium chrysogenum promotes inflammatory response. Int J Hyg Environ Health 2005;208:279-85. PMID: 16078642 [16] Chen W, Han C, Xie B, Hu X, Yu Q, Shi L, et al. Induction of Siglec-G by RNA viruses inhibits the
innate
immune
response
by
promoting
RIG-I
degradation.
Cell
2013;152:467-78.
http://dx.doi.org/10.1016/j.cell.2013.01.011. PMID: 23374343. [17] Jiang JH, Ge G, Gao K, Pang Y, Chai RC, Jia XH, et al. Calcium Signaling Involvement in Cadmium-Induced Astrocyte Cytotoxicity and Cell PI3K/Akt
Signaling
Pathways.
Death Through Activation of MAPK and
Neurochem
Res
2015;40:1929-44.
http://dx.doi.org/10.1007/s11064-015-1686-y. PMID: 26248512. [18] Kwon KB, Yang JY, Ryu DG, Rho HW, Kim JS, Park JW, et al. Vibrio vulnificus cytolysin induces superoxide anion-initiated apoptotic signaling pathway in human ECV304 cells. J Biol Chem 2001;276:47518-23. http://dx.doi.org/10.1074/jbc.M108645200. PMID: 11591724 [19] Rho HW, Choi MJ, Lee JN, Park JW, Kim JS, Park BH, et al. Cytotoxic mechanism of Vibrio vulnificus cytolysin in CPAE cells. Life Sci 2002;70:1923-34. PMID: 12005177. [20] Stringaris AK, Geisenhainer J, Bergmann F, Balshusemann C, Lee U, Zysk G, et al. Neurotoxicity of pneumolysin, a major pneumococcal virulence factor, involves calcium influx and depends on activation of p38 mitogen-activated protein kinase. Neurobiol Dis 2002;11:355-68. PMID: 12586546. [21] Crow T, Xue-Bian JJ, Siddiqi V, Neary JT. Serotonin activation of the ERK pathway in Hermissenda: contribution of calcium-dependent protein kinase C. J Neurochem 2001;78:358-64. PMID: 11461971.
[22] Matsuoka M, Igisu H. Activation of c-Jun NH2-terminal kinase (JNK/SAPK) in LLC-PK1 cells by
cadmium.
Biochem
Biophys
Res
Commun
1998;251:527-32.
http://dx.doi.org/10.1006/bbrc.1998.9487. PMID: 9792807. [23] Yano S, Tokumitsu H, Soderling TR. Calcium promotes cell survival through CaM-K kinase activation of the protein-kinase-B pathway. Nature 1998;396:584-7. http://dx.doi.org/10.1038/25147. PMID: 9859994. [24] Day AM, Veal EA. Hydrogen peroxide-sensitive cysteines in the Sty1 MAPK regulate the transcriptional
response
to
oxidative
stress.
J
Biol
Chem
2010;285:7505-16.
http://dx.doi.org/10.1074/jbc.M109.040840. PMID: 20061379. [25] Meng D, Shi X, Jiang BH, Fang J. Insulin-like growth factor-I (IGF-I) induces epidermal growth factor receptor transactivation and cell proliferation through reactive oxygen species. Free Radic Biol Med 2007;42:1651-60. http://dx.doi.org/10.1016/j.freeradbiomed.2007.01.037. PMID: 17462533. [26] Kamata H, Honda S, Maeda S, Chang L, Hirata H, Karin M. Reactive oxygen species promote TNFalpha-induced death and sustained JNK activation by inhibiting MAP kinase phosphatases. Cell 2005;120:649-61. http://dx.doi.org/10.1016/j.cell.2004.12.041. PMID: 15766528. [27] Okoh VO, Felty Q, Parkash J, Poppiti R, Roy D. Reactive oxygen species via redox signaling to PI3K/AKT pathway contribute to the malignant growth of 4-hydroxy estradiol-transformed mammary epithelial cells. Plos One 2013;8:e54206. http://dx.doi.org/10.1371/journal.pone.0054206. PMID: 23437041. [28] Yaron JR, Gangaraju S, Rao MY, Kong X, Zhang L, Su F, et al. K(+) regulates Ca(2+) to drive inflammasome signaling: dynamic visualization of ion flux in live cells. Cell Death Dis 2015;6:e1954. http://dx.doi.org/10.1038/cddis.2015.277. PMID: 26512962. [29] Toma C, Higa N, Koizumi Y, Nakasone N, Ogura Y, McCoy AJ, et al. Pathogenic Vibrio activate NLRP3 inflammasome via cytotoxins and TLR/nucleotide-binding oligomerization domain-mediated NF-kappa B signaling. J Immunol 2010;184:5287-97. http://dx.doi.org/10.4049/jimmunol.0903536. PMID: 20348425. [30] Sutterwala FS, Haasken S, Cassel SL. Mechanism of NLRP3 inflammasome activation. Ann N Y Acad Sci 2014;1319:82-95. http://dx.doi.org/10.1111/nyas.12458. PMID: 24840700. [31] Jeong HG, Satchell KJ. Additive function of Vibrio vulnificus MARTX(Vv) and VvhA cytolysins promotes rapid growth and epithelial tissue necrosis during intestinal infection. Plos Pathog 2012;8:e1002581. http://dx.doi.org/10.1371/journal.ppat.1002581. PMID: 22457618. [32] Smith RS, Harris SG, Phipps R, Iglewski B. The Pseudomonas aeruginosa quorum-sensing molecule N-(3-oxododecanoyl)homoserine
lactone contributes to virulence and induces inflammation
in vivo. J Bacteriol 2002;184:1132-9. http://dx.doi.org/10.1128/jb.184.4.1132-1139.2002. PMID: 11807074. [33] Xie DL, Zheng MM, Zheng Y, Gao H, Zhang J, Zhang T, et al. Vibrio vulnificus induces mTOR activation
and
inflammatory
responses
in
macrophages.
Plos
One
2017;12:e0181454.
http://dx.doi.org/10.1371/journal.pone.0181454. PMID: 28719654. [34] Damas P, Ledoux D, Nys M, Vrindts Y, De Groote D, Franchimont P, et al. Cytokine serum level during severe sepsis in human IL-6 as a marker of severity. Ann Surg 1992;215:356-62. PMID: 1558416. [35] Ovchinnikov DA. Macrophages in the embryo and beyond: much more than just giant phagocytes. Genesis 2008;46:447-62. http://dx.doi.org/10.1002/dvg.20417. PMID: 18781633. [36] Park KH, Lee YR, Hur H, Yu HN, Rah SY, Kim UH, et al. Role of calcium/calmodulin signaling
pathway in Vibrio vulnificus cytolysin-induced hyperpermeability. Microb Pathog 2009;47:47-51. http://dx.doi.org/10.1016/j.micpath.2009.04.014. PMID: 19447166. [37] McCabe MJ, Nicotera P, Orrenius S. Calcium-dependent cell death. Role of the endonuclease, protein kinase C, and chromatin conformation. Ann N Y Acad Sci 1992;663:269-78. PMID: 1336329. [38] Baldovino S, Montin D, Martino S, Sciascia S, Menegatti E, Roccatello D. Common variable immunodeficiency: crossroads between infections, inflammation and autoimmunity. Autoimmun Rev 2013;12:796-801. http://dx.doi.org/10.1016/j.autrev.2012.11.003. PMID: 23219764. [39] Chen BC, Lin WW. PKC- and ERK-dependent activation of I kappa B kinase by lipopolysaccharide in macrophages: enhancement by P2Y receptor-mediated CaMK activation. Br J Pharmacol 2001;134:1055-65. http://dx.doi.org/10.1038/sj.bjp.0704334. PMID: 11682454. [40] Taniguchi R, Fukushima H, Osawa K, Maruyama T, Yasuda H, Weih F, et al. RelB-induced expression of Cot, an MAP3K family member, rescues RANKL-induced osteoclastogenesis in alymphoplasia mice by promoting NF-kappaB2 processing by IKKalpha. J Biol Chem 2014;289:7349-61. http://dx.doi.org/10.1074/jbc.M113.538314. PMID: 24488495.
Highlights: 1.
Low dose VVC induces inflammatory response in RAW264.7 macrophages.
2.
BAPTA inhibits macrophages.
3.
VVC primes rather than activates NLRP3 inflammasome in RAW264.7 macrophages.
4.
VVC induces inflammation in the skin of mice.
VVC
induced
inflammatory
response
in
RAW264.7