- Email: [email protected]
Vinclozolin affects the interrenal system of the rare minnow (Gobiocypris rarus)
Aquatic Toxicology 104 (2011) 153–159
Contents lists available at ScienceDirect
Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox
Vinclozolin affects the interrenal system of the rare minnow (Gobiocypris rarus) Lihua Yang, Jinmiao Zha, Wei Li, Zhaoli Li, Zijian Wang ∗ State Key Laboratory of Environmental Aquatic Chemistry, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, P.O. Box 2871, Beijing 100085, China
a r t i c l e
i n f o
Article history: Received 25 October 2010 Received in revised form 2 April 2011 Accepted 9 April 2011 Key words: Vinclozolin Rare minnow (Gobiocypris rarus) Interrenal system
a b s t r a c t Vinclozolin, a widely used fungicide, has been characterized as a potent androgen antagonist. In this study, the effects of vinclozolin on the interrenal system of the rare minnow (Gobiocypris rarus) were evaluated. The results revealed a decline of the renal somatic index (RSI) and the presence of histopathological effects, including shrinkage of the glomerulus and expansion of the Bowman’s space in the kidneys, in rare minnows exposed to vinclozolin. Elevated plasma cortisol concentrations in females exposed to ≥2 g/L vinclozolin and males exposed to ≥10 g/L vinclozolin (p < 0.05) suggested that endocrine stress was evoked by vinclozolin exposure. Significant decreases in mRNA levels of interrenal crf, pomc, gr, and nka in females and gr and nka in males were observed after exposure to ≥0.5 g/L and 2 g/L vinclozolin (p < 0.05), respectively; however, no changes in expression of these genes were observed in the brain of males (p ≥ 0.159) or females (p ≥ 0.053) compared with the control. The results indicated that female rare minnows were more sensitive than males to vinclozolin exposure. In conclusion, vinclozolin exposure evoked endocrine stress on the hypothalamic–pituitary–interrenal axis in the rare minnow, and the interrenal tissue was more sensitive than the brain tissue to stress caused by vinclozolin exposure. These results provide additional data about the modes of toxicological action of vinclozolin. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Vinclozolin [3-(3,5-dichlorophenyl)-5-methyl-5-vinyloxazolidine 2,4-dione], is a fungicide widely used on fruits and vegetables (Papadopoulou-Mourkidou, 1991). It can be transported to surface water via spray drift from aerial and ground applications and may be available for runoff for several weeks to months after application (U.S. EPA, 2000). Steeger and Garber (2009) assessed acute and chronic exposure of aquatic organisms using the Pesticide Root Zone Model coupled with the Exposure Analysis Model System (PRZM/EXAMS) and reported the one-inten-year peak and 60-d mean aquatic estimated environmental concentrations of vinclozolin and its residues to be 52.0 and 49.9 g/L, respectively. Along the Rhine River in Dusseldorf the presence of vinclozolin has been detected at a concentration of 2.4 g/L (Oskam et al., 1993). Vinclozolin has been listed under the EU priority list of endocrine disrupters (European Commission, 2001) and in the final Contaminant Candidate List 3 for products that may be assessed for contamination levels in drinking water (U.S. EPA, 2009). Therefore, extensive information on its environmental occurrence and impacts on aquatic organisms are crucial to support decision making.
∗ Corresponding author. Tel.: +86 10 62849140; fax: +86 10 62929140. E-mail address: [email protected] (Z. Wang). 0166-445X/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.aquatox.2011.04.005
Although vinclozolin exhibits low acute toxicity to wildlife (U.S. EPA, 2000), it can result in reproductive defects such as retained nipples, atrophic testes, reduced prostate weight, and vaginal pouching in rats (Gray et al., 2001). Numerous studies have shown that such effects occur mainly via interference with the androgen signaling pathway (Kelce et al., 1994). For example, in the fathead minnow (Pimephales promelas), Martinovic et al. (2008) found changes in testosterone levels and the expression of the androgen receptor after exposure to vinclozolin. However, the effects of vinclozolin on the adrenal system in animals, which is homologous with the interrenal system in fish, have rarely been studied. The hypothalamic–pituitary–interrenal (HPI) axis is affected by many endocrine disruptors (Bisson and Hontela, 2002; Waring and Moore, 2004). Disruptions of the adrenal system could result in abnormalities in the communication between immune and neuroendocrine systems (Volkoff and Peter, 2004), in behavior such as locomotion and foraging (Crespi and Denver, 2004), and in food intake (Bernier et al., 2004). Corticotropin-releasing factor (CRF) is the principle hypothalamic initiator of the stress response, and it induces the secretion of proopiomelanocortin (POMC) peptides from the pituitary. Recently, the presence of CRF system was confirmed in the adrenal gland of mammals (Ehrhart-Bornstein et al., 1998) and the interrenal tissue of teleost fish (Huising et al., 2007). The objective of this study was to evaluate the potential effects of vinclozolin on the interrenal system in the rare minnow. The presence of histopathological effects in the kidney, level of plasma cortisol, and relative mRNA expression of corticotrophin-releasing
154
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159
factor (crf), proopiomelanocortin (pomc), glucocorticoid receptor (gr), and Na+ /K+ -ATPase (nka) in the brain and kidney were evaluated.
remaining male and female rare minnow were flash-frozen in liquid nitrogen and stored at −80 ◦ C. 2.4. Water concentration of vinclozolin
2. Materials and methods 2.1. Chemicals Vinclozolin (purity > 99.5%) was purchased from Supelco Chemical Company (St. Louis, MO, USA), and high-performance liquid chromatography-grade dimethylsulfoxide (DMSO) was purchased from Sigma Chemical Co. (St. Louis, MO, USA). 2.2. Test fish and culture conditions The rare minnow has been maintained in our laboratory for >6 years. The brood stock was kept in a flow-through system filled with dechlorinated tap water (pH 7.2–7.6; hardness 44.0–61.0 mg CaCO3 /L) and subjected to a 16:8 h light:dark cycle at 25 ± 1 ◦ C. The brood stock was fed newly hatched brine shrimp (Artemia nauplii) twice a day and granule food (TetraMin, Tetra Werke, Melle, Germany) once a day. Wastes and residues were removed daily, and the test equipment and chambers were cleaned once a week. 2.3. Experimental design The sexually mature fish (∼8 months old) used in this experiment were the offspring from one male–female pair of the brood stock. The offspring (n = 210) were randomly divided into seven groups of 30 fish (sex ratio 1:1). After acclimating for 2 weeks, the fish were exposed to various concentrations of vinclozolin (0.1, 0.5, 2, 10, 50 g/L; nominal concentrations). The solvent control aquaria received a combination of DMSO and water (1:100,000, v/v), whereas the water control aquaria received dechlorinated tap water only. The stock solutions were prepared every day in distilled water with DMSO as the co-solvent, and they were added to the aquarium water via polytetrafluorethylene and isoversinic tubes (Abimed, Langenfeld, Germany) to obtain the appropriate concentrations; the final concentrations of DMSO in all vinclozolin aquaria were lower than that in the solvent control. After 28 d of exposure, fish were sacrificed by the flow process as follows: body length and weight were quickly determined, and then blood was collected in heparinized microcapillary tubes and transferred to the sampling buffer (20 mM Tris (pH 7.5) containing 1 mM EDTA, 150 mM NaCl, and 25 KIU/mL approtinin). Capture and blood sampling of all fish in each group were completed within 20 min to avoid cortisol secretion due to physical stress. Blood was immediately centrifuged (8000 × g, 10 min, 4 ◦ C), and the plasma was collected and kept frozen at −80 ◦ C. In succession, the abdomen of each fish was dissected on the left side, the digestive system and gonad were removed, and the kidney (characterized as the dark red parenchymatous organ appressed against the vertebrae) was carefully isolated and weighed. The brain was separated from the skull. The dissection of each fish was carried out simultaneously by two skilled experimenters to improve efficiency and prevent the degradation of total RNA. The reproducibility of the operations was verified by comparing relevant data (weight of isolated kidney and renal somatic index (RSI)) obtained by each experimenter from 10 female fish and approximate size (44.8 ± 5.0 mm, 1.07 ± 0.49 g); these fish were from the brood stock but were not part of the experiment. Kidneys from the first four males and first four females dissected (randomly selected) in each group were fixed in Bouin’s solution (71% saturated picric acid, 24% formaldehyde, 5% glacial acetic acid; Sigma–Aldrich, St. Louis, MO, USA). The kidney and brain from each
The actual concentrations of vinclozolin in the test solutions were measured once a week during the exposure period. Filtered water samples (2 L) from the vinclozolin treatments were acidified and concentrated on solid-phase extraction cartridges. The cartridges were eluted with 10 mL dichloromethane. All of the extracts were evaporated under a gentle stream of nitrogen. Next, 5 mL of hexane was added to the solvents, and then the samples were dried. The residue was dissolved in 0.2 mL of the hexane solution. The samples were analyzed using an Agilent 6890 gas chromatograph ([GC], Agilent, Santa Clara, CA, USA) equipped with an electron capture detector (63Ni). The capillary column for GC determination was a fused-silica HP1701 MS column (30 m × 0.25 mm i.d., 0.25 m film thickness, J&W Scientific, Folsom, CA, USA). The GC oven temperature program used was as follows: 60 ◦ C held for 2 min, 20 ◦ C/min to 200 ◦ C, 10 ◦ C/min to 220 ◦ C, 20 ◦ C/min to 260 ◦ C, held for 5 min. The injector and detector temperatures were 260 ◦ C and 300 ◦ C, respectively. The carrier gas was ECD-grade nitrogen, which was maintained at a flow rate of 1 mL/min. A 1 L volume was injected in the splitless mode with the split closed for 2 min. 2.5. Renal somatic index and histopathology of the kidney The renal somatic index (RSI) of each female and male rare minnow was calculated as follows: RSI =
kidney weight (g) × 100 body weight (g)
After 24 h, the kidney samples fixed in Bouin’s solution were transferred to 70% ethanol, processed routinely according to standard histological methods, and embedded in paraffin wax as described by Wolf et al. (2004). The sections were cut into 3–4 m slices and stained with hematoxylin and eosin, and the sections were analyzed using an Axioskop 2 mot plus optical microscope (Zeiss, Oberkochen, Germany). The diameters of epithelial cells and the lumen in different segments of renal tubules and the Bowman’s space were measured as described by Kokolakis et al. (2008). 2.6. Plasma cortisol radioimmunoassay Plasma cortisol concentration was measured using a cortisol radioimmunoassay (RIA) kit (Sunbio, Beijing, China). All samples were analyzed simultaneously to avoid interassay variability. The observation that the dilution curves of immunoreactive cortisol of rare minnow plasma were parallel to the standard curves validated the use of RIA for measuring cortisol in rare minnow plasma. The assay sensitivity was 2 ng/mL, and the intra-assay coefficients of variation were <10%. 2.7. Quantification of the crf, pomc, gr, and nka mRNA Total RNA was extracted from kidney and brain samples using the SV Total RNA Isolation System (with DNase I, Promega, Madison, WI, USA) so that mRNA expression of four genes could be measured. The integrity of total RNA was examined using 1.2% agarose gel electrophoresis (0.5× TBE buffer, 150 V, 15 min), and the purity was evaluated by OD260 /OD280 using a UV-2000 spectrophotometer (United Products and Instruments Inc., Dayton, NJ, USA). The RNA samples were dissolved in ribonuclease-free water and stored at −80 ◦ C. The reverse transcription reaction and real-time PCR were performed as described previously (Yang et al., 2010). Table 1
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159
155
Table 1 Sequences of primers used for PCR. Genes
Accession no.
Primer sequences (from 5 to 3 )
Product size (bp)
crf
FJ394553
112
pomc
FJ410932
gr
FJ410931
nka
FJ527618
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
lists the primer pairs used for real-time PCR. The cycling conditions used were: an initial denaturation step of 95 ◦ C for 10 min; 40 cycles of 95 ◦ C for 30 s, 57 ◦ C for 40 s, and 72 ◦ C for 30 s; and the last cycle of 95 ◦ C for 30 s, 57 ◦ C for 30 s, and 72 ◦ C for 60 s to generate the dissociation curve. An exclusive peak was observed for each amplification, which indicated that there was no amplification of untargeted genes. The control, which contained all of the reaction components except for the template, was included in all experiments. All of the cDNA samples were analyzed twice and each reaction was performed in triplicate. The mean values were used for calculations of mRNA expression using the delta–delta Ct method. The crf, pomc, gr, and nka mRNA expressions were normalized for ˇ-actin mRNA expression. The validity of using ˇ-actin as an internal standard was evaluated using poly (A)+ RNA-A (Takara, Tokyo, Japan) as an external standard (Ojima et al., 2005). The results showed no statistical difference in the amounts of ˇ-actin mRNA in control and vinclozolin-exposed groups (p ≥ 0.561). 2.8. Statistical analysis All quantitative data are expressed as mean ± SEM. Statistical analysis of variance (ANOVA) was performed using SPSS (version 17.0), and the Levene test of homogeneity of variance and Dunnett’s test were used to compare data between treatments. A probability of p < 0.05 was considered to be statistically significant. 3. Results 3.1. Water concentration of vinclozolin Recovery of vinclozolin from fortified water standards ranged from 89 to 112%. The detection limit was 20 ng/L. The analyzed concentrations (n = 4, presented as mean ± SD and % analyzed/nominal) of vinclozolin in the test solutions (0.1, 0.5, 2, 10, 50 g/L) during the exposure period were 0.09 ± 0.01 (92%), 0.44 ± 0.03 (95%), 1.75 ± 0.18 (88%), 9.16 ± 0.5 (92%), and 47.16 ± 745 (94%) g/L, respectively. Nominal vinclozolin concentrations are used in the following text. 3.2. Body length, weight, and RSI As verification of the reproducibility of tissue separation, kidney weight and RSI of rare minnows of the same sex and approximate size (n = 10) obtained by two experimenters were compared; the data showed no statistical difference for either parameter (p = 0.762 and 0.902, respectively). Table 2 shows the body length, body weight, and RSI data for the rare minnows evaluated in this study. There was no statistical difference in these indices between the solvent control (data not shown) and the water control for both males and females (p ≥ 0.138). Statistical analysis revealed no difference among groups in body length and weight for both males (p = 0.292, 0.336) and females (p = 0.089, 0.086). The RSI was not affected in
CTGACCTTTCATCTGCTACG CTTGTGGTTACTTCCCGAA CTACGGCGGTTTCATGACCT CCCTCACTCGCCCTTCTTG GAGAACTCCAGCCAGAACTG CCACGCTCAGAGATTTATTCAC ACATTGGTGTGGCTATGGG TTGAGGCAAAGTTGTCGTC
118 126 87
male fish exposed to vinclozolin at 0.1 g/L, but the RSI significantly decreased in males exposed to ≥0.5 g/L vinclozolin and in females at all concentrations of vinclozolin compared with the control (p < 0.05). 3.3. Histopathology of the kidney Normal renal tissue is composed of numerous renal corpuscles with well-developed renal capsules and an intricate system of tubules (Fig. 1A and B). The glomerulus (G) encloses a cluster of capillaries, and the Bowman’s space (BS) lies between the parietal and visceral epithelium of the glomerulus. The renal tubules are segmented into the first and second proximal convoluted tubule (PI, PII), distal convoluted tubule (D), and collecting tubes (not shown). The diameters of epithelial cells and the lumen of renal tubules of fish exposed to vinclozolin did not differ from those of the control (p ≥ 0.126, data not shown). However, the renal capsule, which encloses a cluster of capillaries, showed visible shrinkage in females and males exposed to ≥2 g/L and ≥10 g/L vinclozolin, respectively, and the most severe lesions occurred at the highest concentration of vinclozolin (50 g/L) (Fig. 1C and D). Correspondingly, the Bowman’s space increased from 0.29 ± 0.12 m (control) to 1.94 ± 0.68 m (50 g/L) in females and from 0.37 ± 0.09 m (control) to 1.81 ± 0.65 m (50 g/L) in males (p < 0.05). 3.4. Plasma cortisol concentration Plasma cortisol concentrations are shown in Table 3. Statistical analysis revealed no difference in this parameter between the solvent control (data not shown) and the water control for both male (p = 0.561) and female (p = 0.478) fish. Plasma cortisol levels of male rare minnows were not affected by exposure to vinclozolin at ≤2 g/L (p ≥ 0.079), but the levels were remarkably elevated compared with the control (p < 0.05) at vinclozolin concentrations of 10 and 50 g/L. In females, significantly elevated cortisol levels were observed after exposure to vinclozolin at ≥0.5 g/L (p < 0.05). 3.5. Real-time PCR No statistical differences in mRNA levels of any of the four genes were detected between the solvent control (data not shown) and the water control for both males and females (p ≥ 0. 381). Compared with the control, mRNA levels of crf, pomc, gr, and nka in the brain did not differ for male (p ≥ 0.159) and female (p ≥ 0.053) rare minnows after vinclozolin exposure (Fig. 2). However, statistical differences between vinclozolin-treated groups and the control were observed in mRNA levels of brain crf (Fig. 2A), pomc (Fig. 2B), and nka (Fig. 2D) in female fish (p < 0.05). Vinclozolin exposure at ≥0.5 g/L resulted in a significant decrease in the transcript level of renal crf, pomc, gr, and nka in female fish and renal gr and nka in male fish (p < 0.05) (Fig. 3). In addition, statistical analysis revealed no changes in male renal crf and pomc mRNA levels in any vinclozolin-treated group compared with the control (Fig. 3A and B), but significant differences
156
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159
Table 2 Length, weight and renal somatic index (RSI) of rare minnow (Gobiocypris rarus). Concentration (g/L)
Length (mm) Female
Control 0.1 0.5 2 10 50
47.5 46.2 45.4 45.3 45.7 44.1
± ± ± ± ± ±
Weight (g) Male
5.2 4.1 4.0 4.4 3.5 2.8
44.1 42.6 43.5 44.1 43.5 43.6
RSI (%)
Female ± ± ± ± ± ±
2.8 3.5 2.6 2.9 3.3 3.7
1.35 1.19 1.13 1.04 1.01 1.01
± ± ± ± ± ±
Male 0.55 0.39 0.38 0.36 0.35 0.23
0.88 0.84 0.89 0.87 0.84 0.85
Female ± ± ± ± ± ±
0.14 0.21 0.23 0.16 0.22 0.21
0.50 0.34 0.33 0.33 0.24 0.25
± ± ± ± ± ±
Male 0.14a 0.10b 0.14b 0.11b 0.12c 0.10c
0.46 0.42 0.35 0.37 0.34 0.28
± ± ± ± ± ±
0.12a 0.11a 0.14b 0.12b 0.15bc 0.18c
Data are expressed as mean ± SEM (n = 15). Within each series, a, b, c denote statistically significant differences among groups (Dunnett’s test; p < 0.05).
Fig. 1. Microphotographs of the kidney from rare minnow (Gobiocypris rarus). (A) Kidney from female control. (B) Kidney from male control. (C) Kidney from female fish exposed to 50 g/L vinclozolin. (D) Kidney from male fish exposed to 50 g/L vinclozolin. G: glomerulus; bs: Bowman’s space; PI: the first proximal convoluted tubule; PII: the second proximal convoluted tubule; D: distal convoluted tubule. Table 3 Plasma cortisol concentrations (ng/mL) in rare minnow (Gobiocypris rarus). Concentration (g/L)
Control
0.1
Female Male
103.8 ± 7.2 66.6 ± 5.5a a
0.5
100.4 ± 5.8 68.9 ± 4.2a a
2
111.2 ± 8.0 76.8 ± 7.6a
ab
10
124.3 ± 8.5 74.3 ± 6.5a
b
50
117.1 ± 9.0 85.5 ± 6.1b b
176.5 ± 11.4c 97.5 ± 7.3c
Data are expressed as mean ± SEM (n = 15). Within each series, a, b, c denote statistically significant differences among groups (Dunnett’s test; p < 0.05).
were found between treatments with different concentrations of vinclozolin (p < 0.05). 4. Discussion Most studies of the effects of vinclozolin in mammals and fish have focused on the gonadal system (Kiparissis et al., 2003), and its effects on other systems (i.e., the adrenal and thyroid systems) remain largely unknown. Overall, the data generated in this study suggest that subchronic exposure to vinclozolin at environmentally relevant concentrations could have adverse effects on the interrenal system of the rare minnow. Such effects could include a decreased RSI, elevated plasma cortisol concentrations, histopathological changes, and altered transcription levels of crf, pomc, gr, and nka in the kidney. These results indicate that the effects of vinclozolin on aquatic organisms are not limited to the reproduc-
tive system and that multiple systems should be considered when assessing the toxicological effects of vinclozolin. Body length, weight, and tissue somatic indices are commonly used to evaluate the general conditions of fish or a specific tissue because they can be determined easily (West, 1990; Zha et al., 2007). In this study, body length and weight of rare minnows did not change significantly after exposure to vinclozolin. In contrast, Kiparissis et al. (2003) reported significantly decreased body length and weight in newly hatched Japanese medaka (Oryzias latipes) after exposure to vinclozolin (2500 g/L) for 100 d. The RSI was significantly decreased in both males and females, indicating dysfunctions in the kidney caused by exposure to vinclozolin. These results suggest that the RSI was more sensitive than body length and weight to vinclozolin. Histopathological investigations are useful for assessing direct effects of chemical compounds within target organs of fish
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159
157
Fig. 2. Effects of vinclozolin on the expression of crf (A), pomc (B), gr (C) and nka (D) in the brain of rare minnow (Gobiocypris rarus). Horizontal axis represents vinclozolin concentrations (g/L); and vertical axis represents relative expression of target genes (fold). Data are expressed as mean ± SEM (n = 6). Within series the letters (a, b, c, d) denote statistically significant differences among groups in the relative expression of target genes (Dunnett’s test; p < 0.05).
(Schwaiger et al., 2000; Zha et al., 2007). In this study, the glomerulus, which encloses a cluster of capillaries, exhibited shrinkage in both male and female rare minnows exposed to vinclozolin, and this shrinkage resulted in an increase in the Bowman’s space. Contraction of the glomerulus and expansion of the Bowman’s space have also been reported in the carps (Cyprinus carpio) exposed to deltamethrin (Cengiz, 2006) and Cirrhinus mrigala exposed to fenvalerate (Velmurugan et al., 2007). According to Roy and Bhattacharya (2006), who made similar observations in spotted murrel (Channa punctatus) exposed to arsenic, the expansion in the Bowman’s space indicated an increase in the filtration rate, and
the shrinkage of the glomerulus suggested that treated fish adopt some other routes of nitrogen excretion. These alterations might be a mechanism to overcome the toxic effects of exposure to chemical pollutants. Plasma cortisol concentration has been used as a good indicator of the stress response of fish to various environmental factors (Vijayan et al., 2003). The basal levels of plasma cortisol in male and female rare minnows found in this study were similar to those of adult sockeye salmon (Oncorhynchus nerka) (Kubokawa et al., 1999) and Coho salmon (Oncorhynchus kisutch) (Stratholt et al., 1997). In addition, the plasma cortisol concentrations in female rare
Fig. 3. Effects of vinclozolin on the expression of crf (A), pomc (B), gr (C) and nka (D) in the kidney of rare minnow (Gobiocypris rarus). Horizontal axis represents vinclozolin concentrations (g/L); and vertical axis represents relative expression of target genes (fold). Data are expressed as mean ± SEM (n = 6). Within series the letters (a, b, c, d) denote statistically significant differences among groups in the relative expression of target genes (Dunnett’s test; p < 0.05).
158
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159
minnows were much higher than those in males within both control and treated groups, which agrees with earlier observations in sockeye salmon (Kubokawa et al., 1999). In general, exposure to vinclozolin resulted in significantly elevated plasma cortisol levels in both female and male rare minnows compared to the control, indicating that physical stress was evoked. Many environmental pollutants, including benzo(a)pyrene (BaP) and atrazine, result in elevation of plasma cortisol in rainbow trout (Oncorhynchus mykiss) (Tintos et al., 2008) and Atlantic salmon (Salmo salar) smolts (Waring and Moore, 2004). Previous studies have reported that chronic elevation of circulating cortisol caused by exogenous stress may be primarily responsible for suppression of growth (Barton et al., 1987). However, body length and weight of rare minnows were not affected in this study, which may be because the exposure duration (28 d) was short. Real-time PCR assays were used to evaluate the relative mRNA expression of relevant genes in the HPI axis (crf, pomc, gr, and nka) in the brain and kidney of rare minnow. The activation of the HPI axis by various stressors normally begins in the brain and is followed by a series of biochemical reactions (Wendelaar Bonga, 1997). The observed differences among vinclozolin treatments in brain crf, pomc, and nka mRNA levels in female fish might be attributable to different response mechanisms, but this issue is very complicated and will not be further discussed here. In general, no significant differences in the mRNA levels of the four genes were observed in the brains of vinclozolin-treated fish compared to the controls. Doyon et al. (2005) found that preoptic area CRF1 mRNA levels in rainbow trout were up-regulated 4 h after physical stress (isolation) and then returned to control values 72 h later. Considering that one important function of the HPI axis is to adapt to environmental challenges, a restoring process might occur in the brain and/or compensatory mechanism(s) at other levels might develop to negate the influence of vinclozolin during exposure. Time course effects on gene expression specifically in the hypothalamus should be addressed in future experiments. In contrast to the brain, profound changes in mRNA levels of the crf, pomc, gr, and nka genes were found in the kidney of rare minnows. This finding corroborates earlier results showing that changes in the kidney were more severe than in other tissues in the white seabass (Lates calcarifer) after subchronic exposure to cadmium (Thophona et al., 2003). Moreover, Sierra-Santoyo et al. (2008) found that the bioaccumulation of vinclozolin in the kidney of rats was three-fold higher than that in the brain. This may explain why the kidney was more sensitive than the brain in our study. Keller-Wood and Dallman (1984) suggested that the activation of a negative feedback mechanism is a consistent effect of chronic elevation of circulating glucocorticoids in mammals. Down-regulated crf mRNA expression accompanied by elevated plasma cortisol was also reported in goldfish (Capito auratus) (Bernier et al., 2004). In our study of rare minnows, the expression of renal crf and pomc mRNA was suppressed only in females, which may be relevant to the higher basal cortisol levels in female fish. The glucocorticoid receptor (GR) plays an important role in cortisol-mediated responses such as water electrolyte imbalance, abnormal growth, and development in mammalians (Kleiman and Tuckermann, 2007) and fish (Bernier et al., 2004). Down-regulated GR protein levels have been reported in Coho salmon (Maule and Schreck, 1991) and rainbow trout (Shrimpton and McCormick, 1999) treated with exogenous cortisol. In this study, the transcripts of interrenal gr decreased remarkably in fish exposed to vinclozolin compared to control fish. These decreases may have resulted in the decreased RSI and the presence of histopathological changes, as gr signaling is mainly responsible for energy metabolism in teleosts (Mommsen et al., 1999; Vijayan et al., 2003).
nka is involved in osmoregulation and is commonly used as an indication of adaptive responses (Richards et al., 2003). In our study, the expression of nka mRNA was significantly suppressed in the kidney of both female and male fish, which indicates that exposure to vinclozolin may impair the fish’s ability to acclimatize to the environment. Decreased NKA activity caused by endocrine disruptors has been reported in Atlantic salmon (Waring and Moore, 2004). We previously found that the effects of pollutant exposure on the nka transcripts were more profound in the kidney than in the gill of rare minnows (Yang et al., 2010). These results support the theory that the interrenal tissue is more sensitive than other tissues in its response to environmental stressors. 5. Conclusions In conclusion, exposure to vinclozolin evoked stress on the HPI axis of the rare minnow, and interrenal tissue was more sensitive than brain tissue in its response to vinclozolin exposure. These results provide additional data about modes of action of vinclozolin and about assessing toxicological effects of vinclozolin on fish. Acknowledgements This work was supported by the Chinese Academy of Science (KZCX2-YW-Q02-05), the National Basic Research Program (2007CB407304), and the National Natural Science Foundation of China (20737003). We would like to thank Dr. Qingwei Bu from the State Key Laboratory of Environmental Aquatic Chemistry, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences for his assistance with chemical analysis and Dr. Satyanarayanan Senthil Kumaran from Unit of Toxicology, Bharathiar University for revising an earlier version of this manuscript. References Barton, B.A., Schreck, C.B., Barton, L.D., 1987. Effects of chronic cortisol administration and daily acute stress on growth, physiological conditions, and stress responses in juvenile rainbow trout. Dis. Aquat. Org. 2, 173–185. Bernier, N.J., Bedard, N., Peter, R.E., 2004. Effects of cortisol on food intake, growth and forebrain neuropeptide Y and corticotropin releasing factor gene expression in goldfish. Gen. Comp. Endocrinol. 135, 230–240. Bisson, M., Hontela, A., 2002. Cytotoxic and endocrine-disrupting potential of atrazine, diazinon, endosulfan, and mancozeb in adrenocortical steroidogenic cells of rainbow trout exposed in vitro. Toxicol. Appl. Pharmacol. 180, 110–117. Cengiz, E.I., 2006. Gill and kidney histopathology in the freshwater fish Cyprinus carpio after acute exposure to deltamethrin. Environ. Toxicol. Pharmacol. 22, 200–204. Crespi, E.J., Denver, R.J., 2004. Ontogeny of corticotropin-releasing factor effects on locomotion and foraging in the Western spadefoot toad (Spea hammondii). Horm. Behav. 46, 399–410. Doyon, C., Trudeau, V.L., Moon, T.W., 2005. Stress elevates corticotropinreleasing factor and CRF-binding protein mRNA levels in rainbow trout (Oncorhynchus mykiss). J. Endocrinol. 186, 123–130. Ehrhart-Bornstein, M., Hinson, J.P., Bornstein, S.R., Scherbaum, W.A., Vinson, G.P., 1998. Intraadrenal interactions in the regulation of adrenocortical steroidogenesis. Endocr. Rev. 19, 101–143. European Commission, 2001. Communication to the Council and the European Parliament on the Implementation of the Community Strategy for Endocrine Disrupters—A Range of Substances Suspected of Interfering with the Hormone Systems of Humans and Wildlife. Commission of the European Communities, Brussels, Belgium. Gray, L.E., Ostby, J., Furr, J., Wolf, C.J., Lambright, C., Parks, L., Veeramachaneni, D.N., Wilson, V., Price, M., Hotchkiss, A., Orlando, E., Guillette, L., 2001. Effects of environmental antiandrogens on reproductive development in experimental animals. Hum. Reprod. Update 7, 248–264. Huising, M.O., van der Aa, L.M., Metz, J.R., Mazon, A.F., Verburg-van Kemenade, B.M.L., Flik, G., 2007. Corticotropin-releasing factor (CRF) and CRF-binding protein expression in and release from the head kidney of common carp: evolutionary conservation of the adrenal CRF system. J. Endocrinol. 193, 349–357. Kelce, W.R., Monosson, E., Gamcsik, M.P., Laws, S.C., Gray Jr., L.E., 1994. Environmental hormone disrupters: evidence that vinclozolin developmental toxicity is mediated by antiandrogenic metabolites. Toxicol. Appl. Pharmacol. 126, 276–285. Keller-Wood, M.E., Dallman, M.F., 1984. Corticosteroid inhibition of ACTH secretion. Endocr. Rev. 5, 1–24.
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159 Kiparissis, Y., Metcalfe, T.L., Balch, G.C., Metcalfe, C.D., 2003. Effects of the antiandrogens, vinclozolin and cyproterone acetate on gonadal development in the Japanese medaka (Oryzias latipes). Aquat. Toxicol. 63, 391–403. Kleiman, A., Tuckermann, J.P., 2007. Glucocorticoid receptor action in beneficial and side effects of steroid therapy: lessons from conditional knockout mice. Mol. Cell. Endocrinol. 275, 98–108. Kokolakis, G., Panagis, L., Stathopoulos, E., Giannikaki, E., Tosca, A., KrügerKrasagakis, S., 2008. From the protein to the graph: how to quantify immunohistochemistry staining of the skin using digital imaging. J. Immunol. Methods 331, 140–146. Kubokawa, K., Watanabe, T., Yoshioka, M., Iwata, M., 1999. Effects of acute stress on plasma cortisol, sex steroid hormone and glucose levels in male and female sockeye salmon during the breeding season. Aquaculture 172, 335–349. Martinovic, D., Blake, L.S., Durhan, E.J., Greene, K.J., Kahl, M.D., Jensen, K.M., Makynen, E.A., Villeneuve, D.L., Ankley, G.T., 2008. Reproductive toxicity of vinclozolin in the fathead minnow: confirming an anti-androgenic mode of action. Environ. Toxicol. Chem. 27, 478–488. Maule, A.G., Schreck, C.B., 1991. Stress and cortisol treatment changed affinity and number of glucocorticoid receptors in leukocytes and gill of coho salmon. Gen. Comp. Endocrinol. 84, 83–93. Mommsen, T.P., Vijayan, M.M., Moon, T.W., 1999. Cortisol in teleosts: dynamics, mechanisms of action, and metabolic regulation. Rev. Fish Boil. Fish. 9, 211–268. Ojima, N., Yamashita, M., Watabe, S., 2005. Quantitative mRNA expression profiling of heat-shock protein families in rainbow trout cells. Biochem. Biophys. Res. Commun. 329, 51–57. Oskam, G., Van, Genderen, J., Hopman, R., Noij, T.H.M., Noordsij, A., Puijker, L.M., 1993. General view of the problem, with special reference to the Dutch situation. Water Supply 11, 1–17. Papadopoulou-Mourkidou, E., 1991. Postharvest-applied agrochemicals and their residues in fresh fruits and vegetables. J. Assoc. Off. Anal. Chem. 74, 745–765. Richards, J.G., Semple, J.W., Bystriansky, J.S., Schulte, P.M., 2003. Na+/K+-ATPaseisoform switching in gill of rainbow trout (Oncorhynchus mykiss) during salinity transfer. J. Exp. Biol. 206, 4475–4486. Roy, S., Bhattacharya, S., 2006. Arsenic-induced histopathology and synthesis of stress proteins in liver and kidney of Channa punctatus. Ecotoxicol. Environ. Saf. 65, 218–229. Schwaiger, J., Spieser, O.H., Bauer, C., 2000. Chronic toxicity of nonylphenol and ethinylestradiol: haematological and histopathological effects in juvenile Common carp (Cyprinus carpio). Aquat. Toxicol. 51, 69–78. Shrimpton, J.M., McCormick, S.D., 1999. Responsiveness of gill Na+/K+-ATPase to cortisol is related to gill corticosteroid receptor concentration in juvenile rainbow trout. J. Exp. Biol. 202, 987–995.
159
Sierra-Santoyo, A., Castaneda-Hernández, G., Harrison, R.A., Barton, H.A., Hughes, M.F., 2008. Pharmacokinetics and dosimetry of the antiandrogen vinclozolin after oral administration in the rat. Toxicol. Sci. 106, 55–63. Steeger, T., Garber, K., 2009. Risks of Vinclozolin Use to Federally Threatened California Red-legged Frog (Rana aurora draytonii). Environmental Fate and Effects Division. Office of Pesticide Programs, Washington, DC, 20460. Stratholt, M.L., Donaldson, E.M., Liley, N.R., 1997. Stress-induced elevation of plasma cortisol in adult female coho salmon (Oncorhynchus kisutch), is reflected in egg cortisol content, but does not appear to affect early development. Aquaculture 158, 141–153. Thophona, S., Kruatrachuea, M., Upathama, E.S., Pokethitiyooka, P., Sahaphongb, S., Jaritkhuanc, S., 2003. Histopathological alterations of white seabass Lates calcarifer, in acute and subchronic cadmium exposure. Environ. Pollut. 121, 307–320. Tintos, A., Gesto, M., Mıguez, J.M., Soengas, J.L., 2008. -Naphthoflavone and benzo(a)pyrene treatment affect liver intermediary metabolism and plasma cortisol levels in rainbow trout Oncorhynchus mykiss. Ecotoxicol. Environ. Saf. 69, 180–186. U.S. EPA, 2000. Reregistration Eligibility Decision for Vinclozolin. Office of Prevention, Pesticides and Toxic Substances, Washington, DC, USA. U.S. EPA, 2009. Contaminant Candidate List 3. Washington, DC, USA. Velmurugan, B., Selvanayagam, M., Cengiz, E.I., Unlu, E., 2007. The effects of fenvalerate on different tissues of freshwater fish Cirrhinus mrigala. J. Environ. Sci. Health B 42, 157–163. Vijayan, M.M., Raptis, S., Sathiyaa, R., 2003. Cortisol treatment affects glucocorticoid receptor and glucocorticoid-responsive genes in the liver of rainbow trout. Gen. Comp. Endocrinol. 132, 256–263. Volkoff, H., Peter, R.E., 2004. Effects of lipopolysaccharide treatment on feeding of goldfish: role of appetite-regulating peptides. Brain Res. 998, 139–147. Waring, C.P., Moore, A., 2004. The effect of atrazine on Atlantic salmon (Salmo salar) smolts in fresh water and after sea water transfer. Aquat. Toxicol. 66, 93–104. Wendelaar Bonga, S.E., 1997. The stress response in fish. Physiol. Rev. 77, 591–625. West, G., 1990. Methods of assessing ovarian development in fishes—a review. Aust. J. Mar. Freshwater Res. 41, 199–222. Wolf, J.C., Dietrich, D.R., Friederich, U., Caunter, J., Brown, A.R., 2004. Qualitative and quantitative histomorphologic assessment of fathead minnow (Pimephales promelas) gonads as an endpoint for evaluating endocrine-active compounds: a pilot methodology study. Toxicol. Pathol. 32, 600–612. Yang, L., Zha, J., Li, W., Li, Z., Wang, Z., 2010. Atrazine affects kidney and adrenal hormones (AHs) related genes expressions of rare minnow (Gobiocypris rarus). Aquat. Toxicol. 97, 204–211. Zha, J., Wang, Z., Wang, N., Ingersoll, C., 2007. Histological alternation and vitellogenin induction in adult rare minnow (Gobiocypris rarus) after exposure to ethynylestradiol and nonylphenol. Chemosphere 66, 488–495.
Contents lists available at ScienceDirect
Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox
Vinclozolin affects the interrenal system of the rare minnow (Gobiocypris rarus) Lihua Yang, Jinmiao Zha, Wei Li, Zhaoli Li, Zijian Wang ∗ State Key Laboratory of Environmental Aquatic Chemistry, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, P.O. Box 2871, Beijing 100085, China
a r t i c l e
i n f o
Article history: Received 25 October 2010 Received in revised form 2 April 2011 Accepted 9 April 2011 Key words: Vinclozolin Rare minnow (Gobiocypris rarus) Interrenal system
a b s t r a c t Vinclozolin, a widely used fungicide, has been characterized as a potent androgen antagonist. In this study, the effects of vinclozolin on the interrenal system of the rare minnow (Gobiocypris rarus) were evaluated. The results revealed a decline of the renal somatic index (RSI) and the presence of histopathological effects, including shrinkage of the glomerulus and expansion of the Bowman’s space in the kidneys, in rare minnows exposed to vinclozolin. Elevated plasma cortisol concentrations in females exposed to ≥2 g/L vinclozolin and males exposed to ≥10 g/L vinclozolin (p < 0.05) suggested that endocrine stress was evoked by vinclozolin exposure. Significant decreases in mRNA levels of interrenal crf, pomc, gr, and nka in females and gr and nka in males were observed after exposure to ≥0.5 g/L and 2 g/L vinclozolin (p < 0.05), respectively; however, no changes in expression of these genes were observed in the brain of males (p ≥ 0.159) or females (p ≥ 0.053) compared with the control. The results indicated that female rare minnows were more sensitive than males to vinclozolin exposure. In conclusion, vinclozolin exposure evoked endocrine stress on the hypothalamic–pituitary–interrenal axis in the rare minnow, and the interrenal tissue was more sensitive than the brain tissue to stress caused by vinclozolin exposure. These results provide additional data about the modes of toxicological action of vinclozolin. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Vinclozolin [3-(3,5-dichlorophenyl)-5-methyl-5-vinyloxazolidine 2,4-dione], is a fungicide widely used on fruits and vegetables (Papadopoulou-Mourkidou, 1991). It can be transported to surface water via spray drift from aerial and ground applications and may be available for runoff for several weeks to months after application (U.S. EPA, 2000). Steeger and Garber (2009) assessed acute and chronic exposure of aquatic organisms using the Pesticide Root Zone Model coupled with the Exposure Analysis Model System (PRZM/EXAMS) and reported the one-inten-year peak and 60-d mean aquatic estimated environmental concentrations of vinclozolin and its residues to be 52.0 and 49.9 g/L, respectively. Along the Rhine River in Dusseldorf the presence of vinclozolin has been detected at a concentration of 2.4 g/L (Oskam et al., 1993). Vinclozolin has been listed under the EU priority list of endocrine disrupters (European Commission, 2001) and in the final Contaminant Candidate List 3 for products that may be assessed for contamination levels in drinking water (U.S. EPA, 2009). Therefore, extensive information on its environmental occurrence and impacts on aquatic organisms are crucial to support decision making.
∗ Corresponding author. Tel.: +86 10 62849140; fax: +86 10 62929140. E-mail address: [email protected] (Z. Wang). 0166-445X/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.aquatox.2011.04.005
Although vinclozolin exhibits low acute toxicity to wildlife (U.S. EPA, 2000), it can result in reproductive defects such as retained nipples, atrophic testes, reduced prostate weight, and vaginal pouching in rats (Gray et al., 2001). Numerous studies have shown that such effects occur mainly via interference with the androgen signaling pathway (Kelce et al., 1994). For example, in the fathead minnow (Pimephales promelas), Martinovic et al. (2008) found changes in testosterone levels and the expression of the androgen receptor after exposure to vinclozolin. However, the effects of vinclozolin on the adrenal system in animals, which is homologous with the interrenal system in fish, have rarely been studied. The hypothalamic–pituitary–interrenal (HPI) axis is affected by many endocrine disruptors (Bisson and Hontela, 2002; Waring and Moore, 2004). Disruptions of the adrenal system could result in abnormalities in the communication between immune and neuroendocrine systems (Volkoff and Peter, 2004), in behavior such as locomotion and foraging (Crespi and Denver, 2004), and in food intake (Bernier et al., 2004). Corticotropin-releasing factor (CRF) is the principle hypothalamic initiator of the stress response, and it induces the secretion of proopiomelanocortin (POMC) peptides from the pituitary. Recently, the presence of CRF system was confirmed in the adrenal gland of mammals (Ehrhart-Bornstein et al., 1998) and the interrenal tissue of teleost fish (Huising et al., 2007). The objective of this study was to evaluate the potential effects of vinclozolin on the interrenal system in the rare minnow. The presence of histopathological effects in the kidney, level of plasma cortisol, and relative mRNA expression of corticotrophin-releasing
154
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159
factor (crf), proopiomelanocortin (pomc), glucocorticoid receptor (gr), and Na+ /K+ -ATPase (nka) in the brain and kidney were evaluated.
remaining male and female rare minnow were flash-frozen in liquid nitrogen and stored at −80 ◦ C. 2.4. Water concentration of vinclozolin
2. Materials and methods 2.1. Chemicals Vinclozolin (purity > 99.5%) was purchased from Supelco Chemical Company (St. Louis, MO, USA), and high-performance liquid chromatography-grade dimethylsulfoxide (DMSO) was purchased from Sigma Chemical Co. (St. Louis, MO, USA). 2.2. Test fish and culture conditions The rare minnow has been maintained in our laboratory for >6 years. The brood stock was kept in a flow-through system filled with dechlorinated tap water (pH 7.2–7.6; hardness 44.0–61.0 mg CaCO3 /L) and subjected to a 16:8 h light:dark cycle at 25 ± 1 ◦ C. The brood stock was fed newly hatched brine shrimp (Artemia nauplii) twice a day and granule food (TetraMin, Tetra Werke, Melle, Germany) once a day. Wastes and residues were removed daily, and the test equipment and chambers were cleaned once a week. 2.3. Experimental design The sexually mature fish (∼8 months old) used in this experiment were the offspring from one male–female pair of the brood stock. The offspring (n = 210) were randomly divided into seven groups of 30 fish (sex ratio 1:1). After acclimating for 2 weeks, the fish were exposed to various concentrations of vinclozolin (0.1, 0.5, 2, 10, 50 g/L; nominal concentrations). The solvent control aquaria received a combination of DMSO and water (1:100,000, v/v), whereas the water control aquaria received dechlorinated tap water only. The stock solutions were prepared every day in distilled water with DMSO as the co-solvent, and they were added to the aquarium water via polytetrafluorethylene and isoversinic tubes (Abimed, Langenfeld, Germany) to obtain the appropriate concentrations; the final concentrations of DMSO in all vinclozolin aquaria were lower than that in the solvent control. After 28 d of exposure, fish were sacrificed by the flow process as follows: body length and weight were quickly determined, and then blood was collected in heparinized microcapillary tubes and transferred to the sampling buffer (20 mM Tris (pH 7.5) containing 1 mM EDTA, 150 mM NaCl, and 25 KIU/mL approtinin). Capture and blood sampling of all fish in each group were completed within 20 min to avoid cortisol secretion due to physical stress. Blood was immediately centrifuged (8000 × g, 10 min, 4 ◦ C), and the plasma was collected and kept frozen at −80 ◦ C. In succession, the abdomen of each fish was dissected on the left side, the digestive system and gonad were removed, and the kidney (characterized as the dark red parenchymatous organ appressed against the vertebrae) was carefully isolated and weighed. The brain was separated from the skull. The dissection of each fish was carried out simultaneously by two skilled experimenters to improve efficiency and prevent the degradation of total RNA. The reproducibility of the operations was verified by comparing relevant data (weight of isolated kidney and renal somatic index (RSI)) obtained by each experimenter from 10 female fish and approximate size (44.8 ± 5.0 mm, 1.07 ± 0.49 g); these fish were from the brood stock but were not part of the experiment. Kidneys from the first four males and first four females dissected (randomly selected) in each group were fixed in Bouin’s solution (71% saturated picric acid, 24% formaldehyde, 5% glacial acetic acid; Sigma–Aldrich, St. Louis, MO, USA). The kidney and brain from each
The actual concentrations of vinclozolin in the test solutions were measured once a week during the exposure period. Filtered water samples (2 L) from the vinclozolin treatments were acidified and concentrated on solid-phase extraction cartridges. The cartridges were eluted with 10 mL dichloromethane. All of the extracts were evaporated under a gentle stream of nitrogen. Next, 5 mL of hexane was added to the solvents, and then the samples were dried. The residue was dissolved in 0.2 mL of the hexane solution. The samples were analyzed using an Agilent 6890 gas chromatograph ([GC], Agilent, Santa Clara, CA, USA) equipped with an electron capture detector (63Ni). The capillary column for GC determination was a fused-silica HP1701 MS column (30 m × 0.25 mm i.d., 0.25 m film thickness, J&W Scientific, Folsom, CA, USA). The GC oven temperature program used was as follows: 60 ◦ C held for 2 min, 20 ◦ C/min to 200 ◦ C, 10 ◦ C/min to 220 ◦ C, 20 ◦ C/min to 260 ◦ C, held for 5 min. The injector and detector temperatures were 260 ◦ C and 300 ◦ C, respectively. The carrier gas was ECD-grade nitrogen, which was maintained at a flow rate of 1 mL/min. A 1 L volume was injected in the splitless mode with the split closed for 2 min. 2.5. Renal somatic index and histopathology of the kidney The renal somatic index (RSI) of each female and male rare minnow was calculated as follows: RSI =
kidney weight (g) × 100 body weight (g)
After 24 h, the kidney samples fixed in Bouin’s solution were transferred to 70% ethanol, processed routinely according to standard histological methods, and embedded in paraffin wax as described by Wolf et al. (2004). The sections were cut into 3–4 m slices and stained with hematoxylin and eosin, and the sections were analyzed using an Axioskop 2 mot plus optical microscope (Zeiss, Oberkochen, Germany). The diameters of epithelial cells and the lumen in different segments of renal tubules and the Bowman’s space were measured as described by Kokolakis et al. (2008). 2.6. Plasma cortisol radioimmunoassay Plasma cortisol concentration was measured using a cortisol radioimmunoassay (RIA) kit (Sunbio, Beijing, China). All samples were analyzed simultaneously to avoid interassay variability. The observation that the dilution curves of immunoreactive cortisol of rare minnow plasma were parallel to the standard curves validated the use of RIA for measuring cortisol in rare minnow plasma. The assay sensitivity was 2 ng/mL, and the intra-assay coefficients of variation were <10%. 2.7. Quantification of the crf, pomc, gr, and nka mRNA Total RNA was extracted from kidney and brain samples using the SV Total RNA Isolation System (with DNase I, Promega, Madison, WI, USA) so that mRNA expression of four genes could be measured. The integrity of total RNA was examined using 1.2% agarose gel electrophoresis (0.5× TBE buffer, 150 V, 15 min), and the purity was evaluated by OD260 /OD280 using a UV-2000 spectrophotometer (United Products and Instruments Inc., Dayton, NJ, USA). The RNA samples were dissolved in ribonuclease-free water and stored at −80 ◦ C. The reverse transcription reaction and real-time PCR were performed as described previously (Yang et al., 2010). Table 1
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159
155
Table 1 Sequences of primers used for PCR. Genes
Accession no.
Primer sequences (from 5 to 3 )
Product size (bp)
crf
FJ394553
112
pomc
FJ410932
gr
FJ410931
nka
FJ527618
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
lists the primer pairs used for real-time PCR. The cycling conditions used were: an initial denaturation step of 95 ◦ C for 10 min; 40 cycles of 95 ◦ C for 30 s, 57 ◦ C for 40 s, and 72 ◦ C for 30 s; and the last cycle of 95 ◦ C for 30 s, 57 ◦ C for 30 s, and 72 ◦ C for 60 s to generate the dissociation curve. An exclusive peak was observed for each amplification, which indicated that there was no amplification of untargeted genes. The control, which contained all of the reaction components except for the template, was included in all experiments. All of the cDNA samples were analyzed twice and each reaction was performed in triplicate. The mean values were used for calculations of mRNA expression using the delta–delta Ct method. The crf, pomc, gr, and nka mRNA expressions were normalized for ˇ-actin mRNA expression. The validity of using ˇ-actin as an internal standard was evaluated using poly (A)+ RNA-A (Takara, Tokyo, Japan) as an external standard (Ojima et al., 2005). The results showed no statistical difference in the amounts of ˇ-actin mRNA in control and vinclozolin-exposed groups (p ≥ 0.561). 2.8. Statistical analysis All quantitative data are expressed as mean ± SEM. Statistical analysis of variance (ANOVA) was performed using SPSS (version 17.0), and the Levene test of homogeneity of variance and Dunnett’s test were used to compare data between treatments. A probability of p < 0.05 was considered to be statistically significant. 3. Results 3.1. Water concentration of vinclozolin Recovery of vinclozolin from fortified water standards ranged from 89 to 112%. The detection limit was 20 ng/L. The analyzed concentrations (n = 4, presented as mean ± SD and % analyzed/nominal) of vinclozolin in the test solutions (0.1, 0.5, 2, 10, 50 g/L) during the exposure period were 0.09 ± 0.01 (92%), 0.44 ± 0.03 (95%), 1.75 ± 0.18 (88%), 9.16 ± 0.5 (92%), and 47.16 ± 745 (94%) g/L, respectively. Nominal vinclozolin concentrations are used in the following text. 3.2. Body length, weight, and RSI As verification of the reproducibility of tissue separation, kidney weight and RSI of rare minnows of the same sex and approximate size (n = 10) obtained by two experimenters were compared; the data showed no statistical difference for either parameter (p = 0.762 and 0.902, respectively). Table 2 shows the body length, body weight, and RSI data for the rare minnows evaluated in this study. There was no statistical difference in these indices between the solvent control (data not shown) and the water control for both males and females (p ≥ 0.138). Statistical analysis revealed no difference among groups in body length and weight for both males (p = 0.292, 0.336) and females (p = 0.089, 0.086). The RSI was not affected in
CTGACCTTTCATCTGCTACG CTTGTGGTTACTTCCCGAA CTACGGCGGTTTCATGACCT CCCTCACTCGCCCTTCTTG GAGAACTCCAGCCAGAACTG CCACGCTCAGAGATTTATTCAC ACATTGGTGTGGCTATGGG TTGAGGCAAAGTTGTCGTC
118 126 87
male fish exposed to vinclozolin at 0.1 g/L, but the RSI significantly decreased in males exposed to ≥0.5 g/L vinclozolin and in females at all concentrations of vinclozolin compared with the control (p < 0.05). 3.3. Histopathology of the kidney Normal renal tissue is composed of numerous renal corpuscles with well-developed renal capsules and an intricate system of tubules (Fig. 1A and B). The glomerulus (G) encloses a cluster of capillaries, and the Bowman’s space (BS) lies between the parietal and visceral epithelium of the glomerulus. The renal tubules are segmented into the first and second proximal convoluted tubule (PI, PII), distal convoluted tubule (D), and collecting tubes (not shown). The diameters of epithelial cells and the lumen of renal tubules of fish exposed to vinclozolin did not differ from those of the control (p ≥ 0.126, data not shown). However, the renal capsule, which encloses a cluster of capillaries, showed visible shrinkage in females and males exposed to ≥2 g/L and ≥10 g/L vinclozolin, respectively, and the most severe lesions occurred at the highest concentration of vinclozolin (50 g/L) (Fig. 1C and D). Correspondingly, the Bowman’s space increased from 0.29 ± 0.12 m (control) to 1.94 ± 0.68 m (50 g/L) in females and from 0.37 ± 0.09 m (control) to 1.81 ± 0.65 m (50 g/L) in males (p < 0.05). 3.4. Plasma cortisol concentration Plasma cortisol concentrations are shown in Table 3. Statistical analysis revealed no difference in this parameter between the solvent control (data not shown) and the water control for both male (p = 0.561) and female (p = 0.478) fish. Plasma cortisol levels of male rare minnows were not affected by exposure to vinclozolin at ≤2 g/L (p ≥ 0.079), but the levels were remarkably elevated compared with the control (p < 0.05) at vinclozolin concentrations of 10 and 50 g/L. In females, significantly elevated cortisol levels were observed after exposure to vinclozolin at ≥0.5 g/L (p < 0.05). 3.5. Real-time PCR No statistical differences in mRNA levels of any of the four genes were detected between the solvent control (data not shown) and the water control for both males and females (p ≥ 0. 381). Compared with the control, mRNA levels of crf, pomc, gr, and nka in the brain did not differ for male (p ≥ 0.159) and female (p ≥ 0.053) rare minnows after vinclozolin exposure (Fig. 2). However, statistical differences between vinclozolin-treated groups and the control were observed in mRNA levels of brain crf (Fig. 2A), pomc (Fig. 2B), and nka (Fig. 2D) in female fish (p < 0.05). Vinclozolin exposure at ≥0.5 g/L resulted in a significant decrease in the transcript level of renal crf, pomc, gr, and nka in female fish and renal gr and nka in male fish (p < 0.05) (Fig. 3). In addition, statistical analysis revealed no changes in male renal crf and pomc mRNA levels in any vinclozolin-treated group compared with the control (Fig. 3A and B), but significant differences
156
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159
Table 2 Length, weight and renal somatic index (RSI) of rare minnow (Gobiocypris rarus). Concentration (g/L)
Length (mm) Female
Control 0.1 0.5 2 10 50
47.5 46.2 45.4 45.3 45.7 44.1
± ± ± ± ± ±
Weight (g) Male
5.2 4.1 4.0 4.4 3.5 2.8
44.1 42.6 43.5 44.1 43.5 43.6
RSI (%)
Female ± ± ± ± ± ±
2.8 3.5 2.6 2.9 3.3 3.7
1.35 1.19 1.13 1.04 1.01 1.01
± ± ± ± ± ±
Male 0.55 0.39 0.38 0.36 0.35 0.23
0.88 0.84 0.89 0.87 0.84 0.85
Female ± ± ± ± ± ±
0.14 0.21 0.23 0.16 0.22 0.21
0.50 0.34 0.33 0.33 0.24 0.25
± ± ± ± ± ±
Male 0.14a 0.10b 0.14b 0.11b 0.12c 0.10c
0.46 0.42 0.35 0.37 0.34 0.28
± ± ± ± ± ±
0.12a 0.11a 0.14b 0.12b 0.15bc 0.18c
Data are expressed as mean ± SEM (n = 15). Within each series, a, b, c denote statistically significant differences among groups (Dunnett’s test; p < 0.05).
Fig. 1. Microphotographs of the kidney from rare minnow (Gobiocypris rarus). (A) Kidney from female control. (B) Kidney from male control. (C) Kidney from female fish exposed to 50 g/L vinclozolin. (D) Kidney from male fish exposed to 50 g/L vinclozolin. G: glomerulus; bs: Bowman’s space; PI: the first proximal convoluted tubule; PII: the second proximal convoluted tubule; D: distal convoluted tubule. Table 3 Plasma cortisol concentrations (ng/mL) in rare minnow (Gobiocypris rarus). Concentration (g/L)
Control
0.1
Female Male
103.8 ± 7.2 66.6 ± 5.5a a
0.5
100.4 ± 5.8 68.9 ± 4.2a a
2
111.2 ± 8.0 76.8 ± 7.6a
ab
10
124.3 ± 8.5 74.3 ± 6.5a
b
50
117.1 ± 9.0 85.5 ± 6.1b b
176.5 ± 11.4c 97.5 ± 7.3c
Data are expressed as mean ± SEM (n = 15). Within each series, a, b, c denote statistically significant differences among groups (Dunnett’s test; p < 0.05).
were found between treatments with different concentrations of vinclozolin (p < 0.05). 4. Discussion Most studies of the effects of vinclozolin in mammals and fish have focused on the gonadal system (Kiparissis et al., 2003), and its effects on other systems (i.e., the adrenal and thyroid systems) remain largely unknown. Overall, the data generated in this study suggest that subchronic exposure to vinclozolin at environmentally relevant concentrations could have adverse effects on the interrenal system of the rare minnow. Such effects could include a decreased RSI, elevated plasma cortisol concentrations, histopathological changes, and altered transcription levels of crf, pomc, gr, and nka in the kidney. These results indicate that the effects of vinclozolin on aquatic organisms are not limited to the reproduc-
tive system and that multiple systems should be considered when assessing the toxicological effects of vinclozolin. Body length, weight, and tissue somatic indices are commonly used to evaluate the general conditions of fish or a specific tissue because they can be determined easily (West, 1990; Zha et al., 2007). In this study, body length and weight of rare minnows did not change significantly after exposure to vinclozolin. In contrast, Kiparissis et al. (2003) reported significantly decreased body length and weight in newly hatched Japanese medaka (Oryzias latipes) after exposure to vinclozolin (2500 g/L) for 100 d. The RSI was significantly decreased in both males and females, indicating dysfunctions in the kidney caused by exposure to vinclozolin. These results suggest that the RSI was more sensitive than body length and weight to vinclozolin. Histopathological investigations are useful for assessing direct effects of chemical compounds within target organs of fish
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159
157
Fig. 2. Effects of vinclozolin on the expression of crf (A), pomc (B), gr (C) and nka (D) in the brain of rare minnow (Gobiocypris rarus). Horizontal axis represents vinclozolin concentrations (g/L); and vertical axis represents relative expression of target genes (fold). Data are expressed as mean ± SEM (n = 6). Within series the letters (a, b, c, d) denote statistically significant differences among groups in the relative expression of target genes (Dunnett’s test; p < 0.05).
(Schwaiger et al., 2000; Zha et al., 2007). In this study, the glomerulus, which encloses a cluster of capillaries, exhibited shrinkage in both male and female rare minnows exposed to vinclozolin, and this shrinkage resulted in an increase in the Bowman’s space. Contraction of the glomerulus and expansion of the Bowman’s space have also been reported in the carps (Cyprinus carpio) exposed to deltamethrin (Cengiz, 2006) and Cirrhinus mrigala exposed to fenvalerate (Velmurugan et al., 2007). According to Roy and Bhattacharya (2006), who made similar observations in spotted murrel (Channa punctatus) exposed to arsenic, the expansion in the Bowman’s space indicated an increase in the filtration rate, and
the shrinkage of the glomerulus suggested that treated fish adopt some other routes of nitrogen excretion. These alterations might be a mechanism to overcome the toxic effects of exposure to chemical pollutants. Plasma cortisol concentration has been used as a good indicator of the stress response of fish to various environmental factors (Vijayan et al., 2003). The basal levels of plasma cortisol in male and female rare minnows found in this study were similar to those of adult sockeye salmon (Oncorhynchus nerka) (Kubokawa et al., 1999) and Coho salmon (Oncorhynchus kisutch) (Stratholt et al., 1997). In addition, the plasma cortisol concentrations in female rare
Fig. 3. Effects of vinclozolin on the expression of crf (A), pomc (B), gr (C) and nka (D) in the kidney of rare minnow (Gobiocypris rarus). Horizontal axis represents vinclozolin concentrations (g/L); and vertical axis represents relative expression of target genes (fold). Data are expressed as mean ± SEM (n = 6). Within series the letters (a, b, c, d) denote statistically significant differences among groups in the relative expression of target genes (Dunnett’s test; p < 0.05).
158
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159
minnows were much higher than those in males within both control and treated groups, which agrees with earlier observations in sockeye salmon (Kubokawa et al., 1999). In general, exposure to vinclozolin resulted in significantly elevated plasma cortisol levels in both female and male rare minnows compared to the control, indicating that physical stress was evoked. Many environmental pollutants, including benzo(a)pyrene (BaP) and atrazine, result in elevation of plasma cortisol in rainbow trout (Oncorhynchus mykiss) (Tintos et al., 2008) and Atlantic salmon (Salmo salar) smolts (Waring and Moore, 2004). Previous studies have reported that chronic elevation of circulating cortisol caused by exogenous stress may be primarily responsible for suppression of growth (Barton et al., 1987). However, body length and weight of rare minnows were not affected in this study, which may be because the exposure duration (28 d) was short. Real-time PCR assays were used to evaluate the relative mRNA expression of relevant genes in the HPI axis (crf, pomc, gr, and nka) in the brain and kidney of rare minnow. The activation of the HPI axis by various stressors normally begins in the brain and is followed by a series of biochemical reactions (Wendelaar Bonga, 1997). The observed differences among vinclozolin treatments in brain crf, pomc, and nka mRNA levels in female fish might be attributable to different response mechanisms, but this issue is very complicated and will not be further discussed here. In general, no significant differences in the mRNA levels of the four genes were observed in the brains of vinclozolin-treated fish compared to the controls. Doyon et al. (2005) found that preoptic area CRF1 mRNA levels in rainbow trout were up-regulated 4 h after physical stress (isolation) and then returned to control values 72 h later. Considering that one important function of the HPI axis is to adapt to environmental challenges, a restoring process might occur in the brain and/or compensatory mechanism(s) at other levels might develop to negate the influence of vinclozolin during exposure. Time course effects on gene expression specifically in the hypothalamus should be addressed in future experiments. In contrast to the brain, profound changes in mRNA levels of the crf, pomc, gr, and nka genes were found in the kidney of rare minnows. This finding corroborates earlier results showing that changes in the kidney were more severe than in other tissues in the white seabass (Lates calcarifer) after subchronic exposure to cadmium (Thophona et al., 2003). Moreover, Sierra-Santoyo et al. (2008) found that the bioaccumulation of vinclozolin in the kidney of rats was three-fold higher than that in the brain. This may explain why the kidney was more sensitive than the brain in our study. Keller-Wood and Dallman (1984) suggested that the activation of a negative feedback mechanism is a consistent effect of chronic elevation of circulating glucocorticoids in mammals. Down-regulated crf mRNA expression accompanied by elevated plasma cortisol was also reported in goldfish (Capito auratus) (Bernier et al., 2004). In our study of rare minnows, the expression of renal crf and pomc mRNA was suppressed only in females, which may be relevant to the higher basal cortisol levels in female fish. The glucocorticoid receptor (GR) plays an important role in cortisol-mediated responses such as water electrolyte imbalance, abnormal growth, and development in mammalians (Kleiman and Tuckermann, 2007) and fish (Bernier et al., 2004). Down-regulated GR protein levels have been reported in Coho salmon (Maule and Schreck, 1991) and rainbow trout (Shrimpton and McCormick, 1999) treated with exogenous cortisol. In this study, the transcripts of interrenal gr decreased remarkably in fish exposed to vinclozolin compared to control fish. These decreases may have resulted in the decreased RSI and the presence of histopathological changes, as gr signaling is mainly responsible for energy metabolism in teleosts (Mommsen et al., 1999; Vijayan et al., 2003).
nka is involved in osmoregulation and is commonly used as an indication of adaptive responses (Richards et al., 2003). In our study, the expression of nka mRNA was significantly suppressed in the kidney of both female and male fish, which indicates that exposure to vinclozolin may impair the fish’s ability to acclimatize to the environment. Decreased NKA activity caused by endocrine disruptors has been reported in Atlantic salmon (Waring and Moore, 2004). We previously found that the effects of pollutant exposure on the nka transcripts were more profound in the kidney than in the gill of rare minnows (Yang et al., 2010). These results support the theory that the interrenal tissue is more sensitive than other tissues in its response to environmental stressors. 5. Conclusions In conclusion, exposure to vinclozolin evoked stress on the HPI axis of the rare minnow, and interrenal tissue was more sensitive than brain tissue in its response to vinclozolin exposure. These results provide additional data about modes of action of vinclozolin and about assessing toxicological effects of vinclozolin on fish. Acknowledgements This work was supported by the Chinese Academy of Science (KZCX2-YW-Q02-05), the National Basic Research Program (2007CB407304), and the National Natural Science Foundation of China (20737003). We would like to thank Dr. Qingwei Bu from the State Key Laboratory of Environmental Aquatic Chemistry, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences for his assistance with chemical analysis and Dr. Satyanarayanan Senthil Kumaran from Unit of Toxicology, Bharathiar University for revising an earlier version of this manuscript. References Barton, B.A., Schreck, C.B., Barton, L.D., 1987. Effects of chronic cortisol administration and daily acute stress on growth, physiological conditions, and stress responses in juvenile rainbow trout. Dis. Aquat. Org. 2, 173–185. Bernier, N.J., Bedard, N., Peter, R.E., 2004. Effects of cortisol on food intake, growth and forebrain neuropeptide Y and corticotropin releasing factor gene expression in goldfish. Gen. Comp. Endocrinol. 135, 230–240. Bisson, M., Hontela, A., 2002. Cytotoxic and endocrine-disrupting potential of atrazine, diazinon, endosulfan, and mancozeb in adrenocortical steroidogenic cells of rainbow trout exposed in vitro. Toxicol. Appl. Pharmacol. 180, 110–117. Cengiz, E.I., 2006. Gill and kidney histopathology in the freshwater fish Cyprinus carpio after acute exposure to deltamethrin. Environ. Toxicol. Pharmacol. 22, 200–204. Crespi, E.J., Denver, R.J., 2004. Ontogeny of corticotropin-releasing factor effects on locomotion and foraging in the Western spadefoot toad (Spea hammondii). Horm. Behav. 46, 399–410. Doyon, C., Trudeau, V.L., Moon, T.W., 2005. Stress elevates corticotropinreleasing factor and CRF-binding protein mRNA levels in rainbow trout (Oncorhynchus mykiss). J. Endocrinol. 186, 123–130. Ehrhart-Bornstein, M., Hinson, J.P., Bornstein, S.R., Scherbaum, W.A., Vinson, G.P., 1998. Intraadrenal interactions in the regulation of adrenocortical steroidogenesis. Endocr. Rev. 19, 101–143. European Commission, 2001. Communication to the Council and the European Parliament on the Implementation of the Community Strategy for Endocrine Disrupters—A Range of Substances Suspected of Interfering with the Hormone Systems of Humans and Wildlife. Commission of the European Communities, Brussels, Belgium. Gray, L.E., Ostby, J., Furr, J., Wolf, C.J., Lambright, C., Parks, L., Veeramachaneni, D.N., Wilson, V., Price, M., Hotchkiss, A., Orlando, E., Guillette, L., 2001. Effects of environmental antiandrogens on reproductive development in experimental animals. Hum. Reprod. Update 7, 248–264. Huising, M.O., van der Aa, L.M., Metz, J.R., Mazon, A.F., Verburg-van Kemenade, B.M.L., Flik, G., 2007. Corticotropin-releasing factor (CRF) and CRF-binding protein expression in and release from the head kidney of common carp: evolutionary conservation of the adrenal CRF system. J. Endocrinol. 193, 349–357. Kelce, W.R., Monosson, E., Gamcsik, M.P., Laws, S.C., Gray Jr., L.E., 1994. Environmental hormone disrupters: evidence that vinclozolin developmental toxicity is mediated by antiandrogenic metabolites. Toxicol. Appl. Pharmacol. 126, 276–285. Keller-Wood, M.E., Dallman, M.F., 1984. Corticosteroid inhibition of ACTH secretion. Endocr. Rev. 5, 1–24.
L. Yang et al. / Aquatic Toxicology 104 (2011) 153–159 Kiparissis, Y., Metcalfe, T.L., Balch, G.C., Metcalfe, C.D., 2003. Effects of the antiandrogens, vinclozolin and cyproterone acetate on gonadal development in the Japanese medaka (Oryzias latipes). Aquat. Toxicol. 63, 391–403. Kleiman, A., Tuckermann, J.P., 2007. Glucocorticoid receptor action in beneficial and side effects of steroid therapy: lessons from conditional knockout mice. Mol. Cell. Endocrinol. 275, 98–108. Kokolakis, G., Panagis, L., Stathopoulos, E., Giannikaki, E., Tosca, A., KrügerKrasagakis, S., 2008. From the protein to the graph: how to quantify immunohistochemistry staining of the skin using digital imaging. J. Immunol. Methods 331, 140–146. Kubokawa, K., Watanabe, T., Yoshioka, M., Iwata, M., 1999. Effects of acute stress on plasma cortisol, sex steroid hormone and glucose levels in male and female sockeye salmon during the breeding season. Aquaculture 172, 335–349. Martinovic, D., Blake, L.S., Durhan, E.J., Greene, K.J., Kahl, M.D., Jensen, K.M., Makynen, E.A., Villeneuve, D.L., Ankley, G.T., 2008. Reproductive toxicity of vinclozolin in the fathead minnow: confirming an anti-androgenic mode of action. Environ. Toxicol. Chem. 27, 478–488. Maule, A.G., Schreck, C.B., 1991. Stress and cortisol treatment changed affinity and number of glucocorticoid receptors in leukocytes and gill of coho salmon. Gen. Comp. Endocrinol. 84, 83–93. Mommsen, T.P., Vijayan, M.M., Moon, T.W., 1999. Cortisol in teleosts: dynamics, mechanisms of action, and metabolic regulation. Rev. Fish Boil. Fish. 9, 211–268. Ojima, N., Yamashita, M., Watabe, S., 2005. Quantitative mRNA expression profiling of heat-shock protein families in rainbow trout cells. Biochem. Biophys. Res. Commun. 329, 51–57. Oskam, G., Van, Genderen, J., Hopman, R., Noij, T.H.M., Noordsij, A., Puijker, L.M., 1993. General view of the problem, with special reference to the Dutch situation. Water Supply 11, 1–17. Papadopoulou-Mourkidou, E., 1991. Postharvest-applied agrochemicals and their residues in fresh fruits and vegetables. J. Assoc. Off. Anal. Chem. 74, 745–765. Richards, J.G., Semple, J.W., Bystriansky, J.S., Schulte, P.M., 2003. Na+/K+-ATPaseisoform switching in gill of rainbow trout (Oncorhynchus mykiss) during salinity transfer. J. Exp. Biol. 206, 4475–4486. Roy, S., Bhattacharya, S., 2006. Arsenic-induced histopathology and synthesis of stress proteins in liver and kidney of Channa punctatus. Ecotoxicol. Environ. Saf. 65, 218–229. Schwaiger, J., Spieser, O.H., Bauer, C., 2000. Chronic toxicity of nonylphenol and ethinylestradiol: haematological and histopathological effects in juvenile Common carp (Cyprinus carpio). Aquat. Toxicol. 51, 69–78. Shrimpton, J.M., McCormick, S.D., 1999. Responsiveness of gill Na+/K+-ATPase to cortisol is related to gill corticosteroid receptor concentration in juvenile rainbow trout. J. Exp. Biol. 202, 987–995.
159
Sierra-Santoyo, A., Castaneda-Hernández, G., Harrison, R.A., Barton, H.A., Hughes, M.F., 2008. Pharmacokinetics and dosimetry of the antiandrogen vinclozolin after oral administration in the rat. Toxicol. Sci. 106, 55–63. Steeger, T., Garber, K., 2009. Risks of Vinclozolin Use to Federally Threatened California Red-legged Frog (Rana aurora draytonii). Environmental Fate and Effects Division. Office of Pesticide Programs, Washington, DC, 20460. Stratholt, M.L., Donaldson, E.M., Liley, N.R., 1997. Stress-induced elevation of plasma cortisol in adult female coho salmon (Oncorhynchus kisutch), is reflected in egg cortisol content, but does not appear to affect early development. Aquaculture 158, 141–153. Thophona, S., Kruatrachuea, M., Upathama, E.S., Pokethitiyooka, P., Sahaphongb, S., Jaritkhuanc, S., 2003. Histopathological alterations of white seabass Lates calcarifer, in acute and subchronic cadmium exposure. Environ. Pollut. 121, 307–320. Tintos, A., Gesto, M., Mıguez, J.M., Soengas, J.L., 2008. -Naphthoflavone and benzo(a)pyrene treatment affect liver intermediary metabolism and plasma cortisol levels in rainbow trout Oncorhynchus mykiss. Ecotoxicol. Environ. Saf. 69, 180–186. U.S. EPA, 2000. Reregistration Eligibility Decision for Vinclozolin. Office of Prevention, Pesticides and Toxic Substances, Washington, DC, USA. U.S. EPA, 2009. Contaminant Candidate List 3. Washington, DC, USA. Velmurugan, B., Selvanayagam, M., Cengiz, E.I., Unlu, E., 2007. The effects of fenvalerate on different tissues of freshwater fish Cirrhinus mrigala. J. Environ. Sci. Health B 42, 157–163. Vijayan, M.M., Raptis, S., Sathiyaa, R., 2003. Cortisol treatment affects glucocorticoid receptor and glucocorticoid-responsive genes in the liver of rainbow trout. Gen. Comp. Endocrinol. 132, 256–263. Volkoff, H., Peter, R.E., 2004. Effects of lipopolysaccharide treatment on feeding of goldfish: role of appetite-regulating peptides. Brain Res. 998, 139–147. Waring, C.P., Moore, A., 2004. The effect of atrazine on Atlantic salmon (Salmo salar) smolts in fresh water and after sea water transfer. Aquat. Toxicol. 66, 93–104. Wendelaar Bonga, S.E., 1997. The stress response in fish. Physiol. Rev. 77, 591–625. West, G., 1990. Methods of assessing ovarian development in fishes—a review. Aust. J. Mar. Freshwater Res. 41, 199–222. Wolf, J.C., Dietrich, D.R., Friederich, U., Caunter, J., Brown, A.R., 2004. Qualitative and quantitative histomorphologic assessment of fathead minnow (Pimephales promelas) gonads as an endpoint for evaluating endocrine-active compounds: a pilot methodology study. Toxicol. Pathol. 32, 600–612. Yang, L., Zha, J., Li, W., Li, Z., Wang, Z., 2010. Atrazine affects kidney and adrenal hormones (AHs) related genes expressions of rare minnow (Gobiocypris rarus). Aquat. Toxicol. 97, 204–211. Zha, J., Wang, Z., Wang, N., Ingersoll, C., 2007. Histological alternation and vitellogenin induction in adult rare minnow (Gobiocypris rarus) after exposure to ethynylestradiol and nonylphenol. Chemosphere 66, 488–495.