- Email: [email protected]
Vinpocetine mitigates aluminum-induced cognitive impairment in socially isolated rats
Physiology & Behavior 208 (2019) 112571
Contents lists available at ScienceDirect
Physiology & Behavior journal homepage: www.elsevier.com/locate/physbeh
Vinpocetine mitigates aluminum-induced cognitive impairment in socially isolated rats
T
⁎
Azza A. Alia, Hebatalla I. Ahmeda,b, Sahar A. Khaleela,c, , Karema Abu-Elfotuha a
Pharmacology and Toxicology Department, Faculty of Pharmacy, Al-Azhar University, Cairo, Egypt Pharmacology and Toxicology Department, Faculty of Pharmacy, Heliopolis University for sustainable development, Cairo, Egypt c Davis Heart and Lung Research Institute, Division of Cardiovascular Medicine, College of Medicine, The Ohio State University, Columbus, OH 43210, USA b
A R T I C LE I N FO
A B S T R A C T
Keywords: Alzheimer's disease Social isolation Vinpocetine Oxidative stress Inflammation GSK3β/BACE1
Several reports have highlighted the role of vinpocetine in Alzheimer's disease (AD). However, the role of vinpocetine in AD under social isolation conditions has not yet been elucidated. Henceforth, this study aimed to investigate the potential neuroprotective effect of vinpocetine in aluminum-induced AD model associated with social isolation. Social isolation increased the escape latency in Morris water maze (MWM) test, elevated the immobility score and decreased swimming score in forced swimming test (FST) in aluminum treated rats. However, vinpocetine enhanced acquisition in MWM test and exerted anti-depressive effect in FST. The histopathological examination showed marked deterioration in the cerebral cortex and hippocampus of AD isolated rats, while vinpocetine revealed overt improvement. In addition, the levels of amyloid-β protein (Aβ), phosphorylated-tau (Ser396), malondialdehyde (MDA), interleukin 1-beta (IL-1β), tumor necrosis alpha (TNFα), pGlycogen synthase kinase-3β (p-GSK3β) (Tyr216), and β-secretase (BACE1) gene expression were increased in socially isolated aluminum treated rats, yet, vinpocetine treatment reversed these deteriorating effects. Hence, this study provides profound insights into the role of vinpocetine in AD particularly in the conditions of social isolation. The effects of vinpocetine might be attributed not only to its antioxidant and anti-inflammatory properties, but also to its suppressing effect on GSK3β activity and its downstream BACE1.
1. Introduction Alzheimer's disease (AD) is a progressive neurodegenerative disease characterized by memory decline and cognitive dysfunction. It is the most common form of dementia in the elderly, leading to socioeconomic burden for patient's family and society. By 2050, the number of AD patients is expected to reach 131.5 million worldwide [1]. In neuropathological examination, the distinctive feature of AD is the abnormal accumulation of neurofibrillary tangles of amyloid-β protein (Aβ) and hyperphosphorylated tau protein in the brain [2,3]. The accumulation of these structures in different brain regions leads to memory deficit and neuronal damage [4,5]. AD was reported to be associated with aluminum, a neurotoxic metal, accumulation in the brain. Aluminum consumption was considered a risk factor for AD and people with higher daily intake of aluminum showed a greater cognitive decline [6]. The pathological and biochemical alterations seen in the brain with high aluminum content is akin to that seen during AD [7–9]. Therefore, aluminum-induced AD in rats is a well-known model
for exploring the etiology and innovative therapies for AD [10,11]. In the last decade, it has been postulated that social isolation is a main contributor to mental and psychosocial stress, leading to the high prevalence of neurological diseases [12]. For example, social isolation has been associated with cognitive and functional impairment as well as increased risk of AD dementia [13–15]. Furthermore, in experimental animal models of AD, social isolation was found to exacerbate memory deficit [16–18]. Several mechanisms have been suggested to mediate this deterioration such as increased production of Aβ peptide and phosphorylated tau [19], elevated oxidative stress and inflammatory reaction [20], reduction of brain-derived neurotrophic factors (BDNF) and myelination [21]. Moreover, social isolation is a potent stressor for inducing depressive state which, consecutively, might exacerbate AD [22–24]. As social isolation might be inevitable in old age [25,26], it is intriguing to elucidate pharmacological approaches to mitigate the deteriorating effect of social isolation on AD. Vinpocetine is a synthetic ethyl ester of apovincamine, an alkaloid extracted from the leaves of Vinca minor [27]. It has been widely used as
⁎ Corresponding author at: Davis Heart and Lung Research Institute, Division of Cardiovascular Medicine, College of Medicine, The Ohio State University, Columbus, OH 43210, USA. E-mail addresses: [email protected], [email protected] (S.A. Khaleel).
https://doi.org/10.1016/j.physbeh.2019.112571 Received 24 November 2018; Received in revised form 11 May 2019; Accepted 4 June 2019 Available online 06 June 2019 0031-9384/ © 2019 Published by Elsevier Inc.
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 1. Schematic experimental protocol for treatments and assessments of various parameters. MWM: Morris water maze; FST: Forced swimming test.
2.5. Behavioral testing
a dietary supplement for cerebrovascular disorders and cognitive impairment such as stroke, senile dementia, and memory disturbances [28–31]. These profitable effects are presumably attributed to its selective phosphodiesterase (PDE)-1 inhibition [32], blockage of sodium channels [33], as well as its antioxidant [34,35] and anti-inflammatory activity [36–38]. Vinpocetine revealed neuroprotective properties on PC12 cells treated with Aβ which highlights its efficacy in the treatment of AD [39]. Several reports, albeit inconclusive, revealed the beneficial effect of vinpocetine in AD patients [27,40]. Although the effect of vinpocetine on AD has been extensively studied, its effect on AD accompanied with social isolation has not yet been investigated. In this study, we aimed to verify the potential protective effect of vinpocetine in an isolation-associated aluminum model of AD and to gain better insight into its putative underlying mechanisms.
Behavioral tests were conducted between 8:00 AM and 4:00 PM at standard laboratory conditions.
2.5.1. Morris water maze test Spatial learning and memory were evaluated by Morris water maze test [43]. A circular water tank (150 cm diameter and 60 cm height) was filled with tap water to a depth of 30 cm (25 ± 2 °C). A non-toxic white paint was used to render the water opaque. The pool was divided virtually into four equal quadrants (north, south, east, and west). An escape platform of 10 cm in diameter was hidden 2 cm below the surface of water on a fixed location in the center of one of the quadrants. The platform was maintained in the same quadrant throughout experiment. The swimming track of the rats was recorded via a videotracking camera located above the pool. Each rat was placed in the water facing the pool wall from a specific point in each quadrant and was allowed to swim freely to find the platform. Rats received a daily training session for 3 consecutive days, consisting of four trials per session. The animals were permitted 60 s maximally to find the hidden platform and left to rest on it for 20 s before commencement of the next trial. If 60 s was elapsed before finding the platform, they were gently placed on the platform and allowed to rest for 20 s. The amount of time spent finding the platform (escape latency) was recorded. On day 4, a probe test was performed by removing the hidden platform and allowing rats to swim freely for 60 s. The time spent in the target quadrant was recorded (Fig. 1).
2. Methods 2.1. Chemicals Vinpocetine was purchased from Sigma Chemical Co. (St. Louis, MO, USA). All other chemicals were of reagent-grade quality. 2.2. Animals Adult male Wistar rats weighing 300 ± 20 g were purchased from the National Institute for Research, Cairo, Egypt. The animals were housed in a temperature and light-controlled room (23 ± 1 °C, 12/12 h light/dark cycle; lights out between 6:00 PM and 6:00 AM). They were acclimatized for one week before any experimental procedures and were allowed standard rat chow and water ad libitum. The Animal Ethics Committee of the Faculty of Pharmacy, Al-Azhar University, Egypt approved the experimental protocol used in this study (No. 65/ 2016).
2.5.2. Forced swimming test (FST) FST is a conventional test for assessing depressive-like behavior [44]. It was conducted according to Porsolt et al. with minor modifications [45]. On the day before the measurements, rats were individually placed into a cylindrical tank (diameter 20 cm, height 40 cm) filled with fresh water (24 ± 2 °C) to a depth of 30 cm. The animals were left to swim for 15 min, then removed from the cylinder, dried and placed into their original cage. Twenty four hours after the pretest session, rats were placed again in the tank for 5 min and the following behaviors were recorded by a previously trained observer (blind to the drug treatments); immobility (time spent floating immobile or with only small limb movements to keep head above the water), swimming (time spent swimming actively); climbing (time spent with upward movements of the forepaws directed to the cylinder wall) (Fig. 1).
2.3. Experimental protocol Rats were divided into 5 groups (8 rats each) as follows; Group I: control group received vehicle (one ml of 1% carboxymethyl cellulose, p.o.) and (0.2 ml saline i.p.) in group-housing condition; Group II: AD rats received AlCl3 (70 mg/kg, i.p.) [41] daily in group-housing condition; Group III AD isolated rats received AlCl3 (70 mg/kg, i.p.) daily in social isolation condition; Group IV: AD/vinpocetine rats received AlCl3 (70 mg/kg, i.p.) and vinpocetine (20 mg/kg, p.o.) daily in grouphousing condition; Group V: AD isolated/vinpocetine received AlCl3 (70 mg/kg, i.p.) and vinpocetine (20 mg/kg, p.o.) daily in social isolation condition. All treatments were maintained for five weeks. The dose of vinpocetine was selected based on a previous report [42] and a preliminary experiment.
2.6. Histopathological examination Rats were sacrificed 24 h after the last behavioral test by decapitation under anesthesia using a mixture of ketamine (50 mg/kg) and xylazine (20 mg/kg) intraperitoneally [46]. Brain samples were fixed in 10% formalin, embedded in paraffin, cut into sections of 5 μm thickness and stained with haematoxylin and eosin [47]. Assessment of specimens was conducted by an experienced histopathologist blinded to the identity of the examined samples to avoid bias (Fig. 1).
2.4. Housing conditions Socially isolated rats were housed individually in laboratory cages. The animals in group housing condition were placed in laboratory cages of same size in groups of 4 animals per cage. All rats were kept in their assigned housing conditions till the end of the experiments. 2
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 2. Effect of vinpocetine on escape latency (A) and time spent in target quadrant (B) in Morris water maze test in isolated aluminum-treated rats. Values are means ± SD (n = 8). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated.
2 μl cDNA, and 6 μl water. The primer sequences of were as following; BACE1 forward primer: 5′-GCACCCAGCACAATGAAGATCAAG −3′ and reverse primer: 5′- TCATACTCCTGCTTGCTGATCCAC -3′.GAPDH was used as reference housekeeping gene with forward primer 5′- TATCG GACGCCTGGTTAC-3′ and reverse primer: 5′- CTGTGCCGTTGAACT TGC-3′. The relative expression was calculated from the 2-ΔΔCT formula [48].
2.7. Biochemical testing Another part of the excised brains was snap-frozen by liquid nitrogen and stored at −80 °C for subsequent testing. 2.7.1. Estimation of oxidative stress markers Malondialdehyde (MDA) content, as a marker of lipid peroxidation, and SOD activity were assessed using commercially available kits (Biodiagnostics, Giza, Egypt) according to manufacturer's instructions.
2.8. Statistical analysis
2.7.2. Determination of amyloid-β protein, interleukin 1-beta (IL-1β), and tumor necrosis alpha (TNFα) Brain level of amyloid-β 1–42 protein, IL-1β, and TNFα were evaluated by ELISA kit (MyBioSource, Inc., SanDiego, USA) according to the manufacturer's instructions.
The statistical analysis was performed using GraphPad Prism 5 (GraphPad Software Inc., CA, USA) and the results were expressed as means ± SD. The statistical significance was determined using one-way analysis of variance (ANOVA) followed by Tukey-Kramer as a post-hoc test. Total histopathological scoring was analyzed using Kruskal–Wallis nonparametric one-way ANOVA followed by Dunn's multiple comparisons. Statistical significance was considered at p < .05.
2.7.3. Determination of phosphorylated tau and Glycogen synthase kinase3β (GSK3β) Western blot was used to assess the level of p-tau (Ser396) and pGSK3β (Tyr216). In brief, tissues were homogenized in a RIPA buffer (Sigma-Aldrich, USA) with protease inhibitors. The homogenate was centrifuged for 20 min at 4 °C and the supernatant was collected. Samples were subjected to 7% SDS-PAGE gel and then transferred to nitrocellulose membranes (Bio-Rad). The membranes were blocked in 7.5% non-fat dried milk in TBST (0.05% Tween-20 Tris-buffered saline) for 2 h at room temperature and then incubated overnight at 4 °C with specific antibodies against p-tau and p-GSK3β at 1:1000 (Invitrogen, Thermofisher scientific, Waltham, MA, USA). The membranes were washed and then incubated with secondary horseradish peroxidaseconjugated anti-rabbit IgG antibody (1:25000, Bio-Rad, Hercules, CA, USA) for 1 h and then protein bands were detected.
3. Results 3.1. Vinpocetine improved acquisition impairment and depressive behavior in socially isolated aluminum treated rats Morris water maze assesses spatial learning and memory. Rats readily move toward the escape platform away from the water bath. In the present study, the escape latency gradually declined over the four days of training, revealing improved acquisition performance in all groups (Fig. 2A). However, average latency to find the platform in the fourth day of training trials was significantly higher (p < .05) in aluminum treated group compared to control animals. Moreover, social isolation significantly increased (p < .05) the latency compared to AD group. However, vinpocetine treatment significantly improved (p < .05) the escape latency in AD and AD isolated rats. Furthermore, the amount of time in target quadrant was significantly less (p < .05) in AD rats compared to control rats (Fig. 2B). In addition, social isolation significantly deteriorates aluminum-induced memory deficits as evidenced by less time spent in target quadrant compared to AD group. However, vinpocetine treatment increased the time in target quadrant in both AD and AD isolated rats. Taken together, these findings showed an improved acquisition and memory with vinpocetine treatment in AD isolated rats. In FST, the results of Fig. 3 showed that the immobility and climbing time increased significantly (p < .05), while the swimming time
2.7.4. Real time PCR Total RNA extraction from cells was performed using RNeasy Mini Kit® (Qiagen Inc. Valencia, CA, USA) according to the manufacturer's protocol. The purity of obtained RNA was verified spectrophotometrically at 260/280 nm. Equal amounts of RNA (4 μg) were reverse transcribed into cDNA using High-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). The archived cDNA was then subjected to quantitative real time PCR reactions (Fermentas Inc., Glen Burnie, MD, USA). The PCR reaction mixture consisted of 10 μl SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA), 1 μl forward primer (nM), 1 μl reverse primer (nM), 3
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 3. Effect of vinpocetine on forced swimming test in isolation-associated aluminum-treated rats. Values are means ± SD (n = 8). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated.
decreased significantly (p < .05) in aluminum treated rats, revealing the depressive response in AD rats. Moreover, social isolation deteriorated the depressive state by significantly increasing (p < .05) the immobility time and decreasing the swimming time compared to AD group, while it, counterintuitively, reduced the climbing time significantly compared to AD group. However, vinpocetine treatment significantly decreased (p < .05) the immobility time and increased the swimming time in AD isolated rats. Hence, vinpocetine exerted antidepressive effects which might enhance the cognitive deficits in AD associated with social isolation. On the other hand, vinpocetine effect on the climbing time did not reveal a marked improvement.
aluminum treated rats compared to control group (Fig. 6A). Moreover, social isolation significantly elevated (p < .05) MDA content by 24.32% compared to AD group. However, vinpocetine treatment significantly decreased (p < .05) MDA level in AD and AD isolated groups by 45.73% and 40.13%, respectively. In addition, SOD activity was significantly reduced by 81.87% in aluminum treated group compared to control group, while social isolation significantly reduced (p < .05) SOD activity by 44.81% compared to AD group (Fig. 6B). Yet, vinpocetine treatment induced a remarkable increase (p < .05) in SOD activity by 2.7 fold and 4.1 fold compared to AD and AD isolated group, respectively.
3.2. Vinpocetine mitigated hippocampal degeneration induced by aluminum in socially isolated rats
3.5. Vinpocetine down-regulated IL-1β, and TNFα in socially isolated aluminum treated rats
Histopathological examination of the brain of aluminum-treated rats showed no histopathological alterations in the cerebral cortex (Fig. 4A), while the pyramidal cells in hippocampus showed nuclear pyknosis and degeneration (Fig. 4B). In addition, in AD isolated group, nuclear necrosis and degeneration were observed in the cerebral cortex (Fig. 4A), while the hippocampus revealed nuclear pyknosis and degeneration with congestion in the blood vessels (Fig. 4B). However, vinocetine/AD group revealed normal histological structure of cerebral cortex and hippocampus, while vinpocetine/AD isolated group showed less nuclear pyknosis and degeneration in the neurons of the cerebral cortex while the subiculum in the hippocampus was intact (Fig. 4A & B). No histopathological alterations were found in the control group.
IL-1β and TNFα are pro-inflammatory cytokines commonly elevated in AD, promoting chronic inflammation and continued aggregation of Aβ and p-tau (Li et al., 2018; Zhu et al., 2015). As shown in Fig. 6, social isolation induced a significant increase (p < .05) in IL-1β (Fig. 7A), and TNFα (Fig. 7B) levels compared to AD group. Yet, vinpocetine treatment significantly lowered (p < .05) the levels of IL-1β, and TNFα in both AD and AD isolated groups, emphasizing its role in mitigating neuroinflammation in the brain.
3.3. Vinpocetine reduced the levels of amyloid-β protein (Aβ) and phosphorylated-tau (Ser396) in socially isolated aluminum treated rats
Western blot assessment of p-GSK3β (Tyr216) showed a significant increase (p < .05) in the stimulatory GSK3β in AD group by 5.7 fold compared to control group, while vinpocetine treatment significantly decreased Tyr216 phosphorylation compared to AD group (Fig. 8A). Furthermore, aluminum treatment in social isolation conditions induce a significant increase (p < .05) in the level of p-GSK3β (Tyr216) compared to AD group. Yet, vinpocetine treatment significantly ameliorated this effect compared to AD isolated group. In addition, BACE1 cleaves APP and generates the formation of Aβ. Herein, we investigated the expression levels of BACE1 using real time PCR technique. The levels of BACE1 mRNA were significantly increased (p < .05) in AD group compared with control group (4 fold), while vinpocetine treatment down-regulated the level of BACE1 mRNA significantly (p < .05) compared to AD group (Fig. 8B). Moreover, social isolation induced a significant elevation in BACE1 gene expression compared to AD group. However, vinpocetine treatment in AD isolated group significantly reversed (p < .05) this up-regulation.
3.6. Vinpocetine decreased the stimulatory GSK3β (Tyr216) phosphorylation and the downstream gene expression of BACE1 in socially isolated aluminum treated rats
The increased levels of Aβ and phosphorylated tau at Ser396 (pS396-tau) are strongly associated with the severity of AD (Hu et al., 2002; Lue et al., 1999). We determined the levels of Aβ and p-tau to verify the neuroprotective effect of vinpocetine. The levels of Aβ (Fig. 5A) and p-tau (Fig. 5B) were significantly increased (p < .05) in aluminum treated group by 5 fold and 3 fold, respectively, compared to control group. However, a significant decrease (p < .05) in the level of Aβ and p-tau was seen in AD/vinpocetine group compared to AD group. In addition, in AD isolated group there was a significant increase (p < .05) in the level of Aβ and p-tau compared to AD group. Yet, vinpocetine treatment in AD isolated group significantly declined Aβ and p-tau contents. These findings show that vinpocetine is effective in preventing the accumulation of p-tau and Aβ in aluminum treated rats either in group housing or in social isolation conditions.
4. Discussion
3.4. Vinpocetine reduced MDA level and increased SOD activity in socially isolated aluminum treated rats
The present study demonstrated the neuroprotective role of vinpocetine against aluminum-induced cognitive impairment in socially
The level of MDA was significantly increased (p < .05) in 4
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 4. Histopathological features in the cerebral cortex (cc) (A) and hippocampus (hp) (B) in isolation-associated aluminum-treated rats. Control group showed normal features; AD group showed no histopathological alteration in the cerebral cortex but showed nuclear pyknosis (np) and degeneration (dn) in hippocampal pyramidal cells; AD isolated group showed nuclear necrosis (nn) and degeneration (dn) in cerebral cortex and nuclear pyknosis (np) and degeneration (dn) with congestion (cg) in the blood vessels in the hippocampus; AD/vinpocetine showed normal histological structure of cerebral cortex and hippocampus; AD isolated/ vinpocetine showed nuclear pyknosis (np) and degeneration (dn) in the cerebral cortex neurons and subiculum in the hippocampus was intact. (Magnification 40×) and Total histopathological score for the cerebral cortex and hippocampus. Values are means ± SD (n = 7). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated (C).
apparently ameliorated by vinpocetine treatment emphasizing its role in the prevention of cell death and, consequently, interpreting the improved results in Morris water maze test and FST. Amyloid-β 42 is a major contributor to synaptic plasticity, neuronal death and neurotransmitter deficiency [53]. In addition, hyperphosphorylation of tau affects the dynamics of microtubules and the neurons' polarity, leading to neurodegeneration [54]. As the levels of Aβ protein and p-tau correlates with the extent of memory impairment [4,5,55], social isolation contributed significantly, herein, to the impaired cognitive state by overtly increasing these levels. Interestingly, vinpocetine reversed the increase in Aβ and p-tau levels which might further explain the enhanced performance in behavioral tests. Oxidative stress plays a pivotal role in the initiation and progression of AD [56] and elevated oxidative markers have been reported in the brain, blood and cerebrospinal fluid (CSF) of AD patients [57]. Concordantly, the antioxidant defense has been reported to be markedly decreased in socially isolated rats [58], which might explain the
isolated rats. We demonstrated that social isolation overtly deteriorates the cognitive and behavioral state of AD rats as evidenced by prolonged latency time in Morris water maze test, and by elevated immobility score and lowered swimming score in FST. While social isolation, unexpectedly, decreased the climbing time of AD group, that should not contradict the other two scores as the immobility time is the primary dependent measure in FST [49]. Consistently, several reports have revealed the tendency of social isolation to induce depressive-like behaviors and cognitive impairment in rodents [50,51]. However, herein, vinpocetine exerted anti-depressive and memory improving effects in AD isolated rats. The behavioral tests were further supported by assessing the histopathological and biochemical hallmarks of AD. Neurons in the hippocampus and cerebral cortex showed marked necrosis and pyknosis which characterize the structural toxicity induced by neurotoxins such as aluminum [52]. Our results showed that social isolation deteriorated aluminum induced neurodegeneration. Such degenerative features are 5
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 5. Effect of vinpocetine on the levels of amyloid-β protein (Aβ) and p-tau (S396) in socially isolated aluminum treated rats. Values are means ± SD (n = 8). Western blotting was done in triplicates. *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated.
Fig. 6. Effect of vinpocetine on MDA level and SOD activity in socially isolated aluminum treated rats. Values are means ± SD (n = 8). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated.
Aβ-peptides in PC12 cells [39]. Moreover, vinpocetine alleviated redox imbalance in intracerebroventricular streptozotocin and chronic cerebral hypoperfusion-induced cognitive dysfunction and oxidative stress in rats [60,61]. Therefore, the neuromodulatory effect of vinpocetine in AD isolated rats might be attributed to its antioxidant effects. Not only oxidative stress, but also neuroinflammation contributes significantly to the pathogenesis of AD [56]. Furthermore, the persistence of Aβ aggregates leads to chronic inflammation and a vicious circle of mutual activation [62]. Similarly, social isolation is a potential trigger to inflammatory responses [63,64]. For instance, social isolation was found to increase the expression of pro-IL-1β, IL-1β, IL6 and TNF-α in the hippocampus of APP/PS1 mice [16]. The findings of the present study are in accordance with the aforementioned reports as AD isolated
significant decrease in SOD activity and increase in MDA content in AD isolated rats. SOD plays a pivotal role in the antioxidant defense system against ROS generated during oxidative stress. It catalyzes the transformation of superoxide radical to hydrogen peroxide, preventing the formation of hydroxyl radical which is the most reactive oxidant to macromolecules. Increased levels of free radicals stimulate lipid peroxidation resulting in the formation of more stable toxicants such as MDA. Typically, oxidative stress induces the accumulation of Aβ and the hyperphosphorylation of tau protein [59]. In the present study, vinpocetine ameliorated oxidative stress in AD isolated rats which might partly explain vinpocetine's down regulating effect on Aβ and phosphorylated tau levels. Consistently, a previous report revealed the ameliorating effect of vinpocetine against oxidative stress induced by
6
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 7. Effect of vinpocetine on IL-1β, and TNFα in socially isolated aluminum treated rats. Values are means ± SD (n = 8). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated.
deteriorating effects of GSK-3β in the brain [72]. Moreover, several studies showed that Aβ activates GSK-3β signaling by preventing serine 9 phosphorylation and a feed forward loop is established by the subsequent activation of Aβ pathology [72]. Furthermore, GSK-3β repression was found to decrease Aβ production in AD experimental models [73,74] and ameliorate Aβ-induced neurotoxicity in neuronal cells in vitro [75]. GSK-3β-induced production of Aβ might be mediated by upregulation of BACE1 gene expression which increases amyloid precursor protein (APP) processing [76,77]. BACE1 cleavage of APP to Aβ is one of the fastest pathologic events in the progression of AD preceding clinical symptoms [78]. Thus, counteracting BACE1 activity might hinder an early and critical pathologic event in AD. In the present study, social isolation was found to increase the activity of GSK-3β which is in agreement with previous reports showing enhanced expression of GSK-3β in the hippocampus of AD rats [79,80]. Interestingly, GSK-3β activity and BACE1 gene expression was declined by vinpocetine in AD and AD isolated rats which might accounts for the overt parallel reduction in p-tau and Aβ. Reduced GSK3 activity might
rats showed augmented inflammatory response, manifested by the increased levels of TNF-α and IL-1β, compared to AD rats in grouphousing. Interestingly, vinpocetine reversed the inflammatory reaction in both AD and AD isolated rats. Several reports revealed the anti-inflammatory properties of vinpocetine in the brain and peripheral tissues as well. For example, vinpocetine hampered LPS and carrageenan-induced NF-κB activation and its downstream pro-inflammatory cytokines such as TNF-α and IL-1β [65,66]. Hence, it seems likely that the neuromodulatory effect on AD isolated rats is attributed, at least in part, to its antioxidant and anti-inflammatory properties. Glycogen synthase kinase-3β (GSK-3β) is a serine/threonine kinase that has been highlighted as a central factor in AD as it is a key regulator of tau phosphorylation and Aβ production [67–69]. In AD patients' brain, high expression levels of GSK-3β are manifested, resulting in the over-phosphorylation of tau and the formation of neurofibrillary tangles [70]. Typically, GSK-3β is activated by phosphorylation at tyrosine 216 and deactivated by phosphorylation at serine 9 [71]. Enhancing GSK-3Ser9 or decreasing GSK-3Tyr216 attenuates the
Fig. 8. Effect of vinpocetine on p-GSK3β (Tyr216) and BACE1 in isolation-associated aluminum-treated rats. Values are means ± SD (n = 3). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated. 7
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
be attributed to the increased cAMP and cGMP levels induced by phosphodiesterase inhibition, leading to reduction of tau phosphorylation [81,82]. In accordance with our findings, vinpocetine increased the level of GSK-3Ser9 in ethanol-treated rats, preventing alterations in learning and memory-related proteins [83]. In conclusion, the present work highlights the role of vinpocetine in mitigating aluminum-induced cognitive deficits and in reversing biochemical and histopathological deteriorations in socially isolated rats. This neuro-modulatory effect of vinpocetine might be attributed to the inhibition of GSK3β/BACE-1 signaling cascade in addition to its conventional antioxidant and anti-inflammatory effects.
1230–1237, https://doi.org/10.1001/jamapsychiatry.2016.2657. [14] B. Friedler, J. Crapser, L. McCullough, One is the deadliest number: the detrimental effects of social isolation on cerebrovascular diseases and cognition, Acta Neuropathol. 129 (2015) 493–509, https://doi.org/10.1007/s00401-014-1377-9. [15] R.S. Wilson, K.R. Krueger, S.E. Arnold, J.A. Schneider, J.F. Kelly, L.L. Barnes, Y. Tang, D.A. Bennett, Loneliness and risk of Alzheimer disease, Arch. Gen. Psychiatry 64 (2007) 234, https://doi.org/10.1001/archpsyc.64.2.234. [16] M. Cao, P.-P. Hu, Y.-L. Zhang, Y.-X. Yan, C.B. Shields, Y.-P. Zhang, G. Hu, M. Xiao, Enriched physical environment reverses spatial cognitive impairment of socially isolated APPswe/PS1dE9 transgenic mice before amyloidosis onset, CNS Neurosci. Ther. 24 (2018) 202–211, https://doi.org/10.1111/cns.12790. [17] N. Leser, S. Wagner, The effects of acute social isolation on long-term social recognition memory, Neurobiol. Learn. Mem. 124 (2015) 97–103, https://doi.org/10. 1016/j.nlm.2015.07.002. [18] A.A. Ali, M.G. Khalil, H.A. Elariny, Karema A. Elfotuh, Study on social isolation as a risk factor in development of Alzheimer's disease in rats, Brain Disord. Ther. 06 (2017), https://doi.org/10.4172/2168-975X.1000230. [19] H. Huang, L. Wang, M. Cao, C. Marshall, J. Gao, N. Xiao, G. Hu, M. Xiao, Isolation housing exacerbates Alzheimer's disease-like pathophysiology in aged APP/PS1 mice, Int. J. Neuropsychopharmacol. 18 (2015) pyu116, https://doi.org/10.1093/ ijnp/pyu116. [20] N.D. Powell, E.K. Sloan, M.T. Bailey, J.M.G. Arevalo, G.E. Miller, E. Chen, M.S. Kobor, B.F. Reader, J.F. Sheridan, S.W. Cole, Social stress up-regulates inflammatory gene expression in the leukocyte transcriptome via -adrenergic induction of myelopoiesis, Proc. Natl. Acad. Sci. 110 (2013) 16574–16579, https://doi. org/10.1073/pnas.1310655110. [21] A. Djordjevic, M. Adzic, J. Djordjevic, M.B. Radojcic, Chronic social isolation is related to both upregulation of plasticity genes and initiation of proapoptotic signaling in Wistar rat hippocampus, J. Neural Transm. 116 (2009) 1579–1589, https://doi.org/10.1007/s00702-009-0286-x. [22] J.N.-M. Chan, J.C.-D. Lee, S.S.P. Lee, K.K.Y. Hui, A.H.L. Chan, T.K.-H. Fung, D.I. Sánchez-Vidaña, B.W.-M. Lau, S.P.-C. Ngai, Interaction effect of social isolation and high dose corticosteroid on neurogenesis and emotional behavior, Front. Behav. Neurosci. 11 (2017) 18, https://doi.org/10.3389/fnbeh.2017.00018. [23] R. Rodrigues, R.B. Petersen, G. Perry, Parallels between major depressive disorder and Alzheimer's disease: role of oxidative stress and genetic vulnerability, Cell. Mol. Neurobiol. 34 (2014) 925–949, https://doi.org/10.1007/s10571-014-0074-5. [24] B. Chen, X. Zhong, N. Mai, Q. Peng, Z. Wu, C. Ouyang, W. Zhang, W. Liang, Y. Wu, S. Liu, L. Chen, Y. Ning, Cognitive impairment and structural abnormalities in late life depression with olfactory identification impairment: an Alzheimer's disease-like pattern, Int. J. Neuropsychopharmacol. (2018), https://doi.org/10.1093/ijnp/ pyy016. [25] Y. Luo, L.C. Hawkley, L.J. Waite, J.T. Cacioppo, Loneliness, health, and mortality in old age: a national longitudinal study, Soc. Sci. Med. 74 (2012) 907–914, https:// doi.org/10.1016/j.socscimed.2011.11.028. [26] G.D. Cohen, Loneliness in later life, Am. J. Geriatr. Psychiatry 8 (2000) 273–275 http://www.ncbi.nlm.nih.gov/pubmed/11069265 , Accessed date: 6 April 2018. [27] S. Szatmári, P. Whitehouse, et al., Cochrane Database Syst. Rev. (2003) CD003119, https://doi.org/10.1002/14651858.CD003119. [28] R. Deshmukh, V. Sharma, S. Mehan, N. Sharma, K.L. Bedi, Amelioration of intracerebroventricular streptozotocin induced cognitive dysfunction and oxidative stress by vinpocetine — a PDE1 inhibitor, Eur. J. Pharmacol. 620 (2009) 49–56, https://doi.org/10.1016/j.ejphar.2009.08.027. [29] E. Bagoly, G. Fehér, L. Szapáry, The role of vinpocetine in the treatment of cerebrovascular diseases based in human studies, Orv. Hetil. 148 (2007) 1353–1358, https://doi.org/10.1556/OH.2007.28115. [30] S. Patyar, A. Prakash, M. Modi, B. Medhi, Role of vinpocetine in cerebrovascular diseases, Pharmacol. Reports. 63 (2011) 618–628, https://doi.org/10.1016/S17341140(11)70574-6. [31] A. Valikovics, Investigation of the effect of vinpocetine on cerebral blood flow and cognitive functions, Ideggyogy. Sz. 60 (2007) 301–310 http://www.ncbi.nlm.nih. gov/pubmed/17713111 , Accessed date: 27 March 2018. [32] T.R. Dunkern, A. Hatzelmann, Characterization of inhibitors of phosphodiesterase 1C on a human cellular system, FEBS J. 274 (2007) 4812–4824, https://doi.org/10.1111/j.1742-4658.2007.06001.x. [33] M. Sitges, E. Galván, V. Nekrassov, Vinpocetine blockade of sodium channels inhibits the rise in sodium and calcium induced by 4-aminopyridine in synaptosomes, Neurochem. Int. 46 (2005) 533–540, https://doi.org/10.1016/J.NEUINT.2005.02. 001. [34] N. Herrera-Mundo, M. Sitges, Vinpocetine and α-tocopherol prevent the increase in DA and oxidative stress induced by 3-NPA in striatum isolated nerve endings, J. Neurochem. 124 (2013) 233–240, https://doi.org/10.1111/jnc.12082. [35] G. Mendoza, A.I. Álvarez, M.M. Pulido, A.J. Molina, G. Merino, R. Real, P. Fernandes, J.G. Prieto, Inhibitory effects of different antioxidants on hyaluronan depolymerization, Carbohydr. Res. 342 (2007) 96–102, https://doi.org/10.1016/J. CARRES.2006.10.027. [36] K.-I. Jeon, X. Xu, T. Aizawa, J.H. Lim, H. Jono, D.-S. Kwon, J.I. Abe, B.C. Berk, J.D. Li, C. Yan, Vinpocetine inhibits NF- B-dependent inflammation via an IKK-dependent but PDE-independent mechanism, Proc. Natl. Acad. Sci. 107 (2010) 9795–9800, https://doi.org/10.1073/pnas.0914414107. [37] R.T. Liu, A. Wang, E. To, J. Gao, S. Cao, J.Z. Cui, J.A. Matsubara, Vinpocetine inhibits amyloid-beta induced activation of NF-κB, NLRP3 inflammasome and cytokine production in retinal pigment epithelial cells, Exp. Eye Res. 127 (2014) 49–58, https://doi.org/10.1016/j.exer.2014.07.003. [38] F. Zhang, C. Yan, C. Wei, Y. Yao, X. Ma, Z. Gong, S. Liu, D. Zang, J. Chen, F.-D. Shi, J. Hao, Vinpocetine inhibits NF-κB-dependent inflammation in acute ischemic stroke patients, Transl. Stroke Res. 9 (2018) 174–184, https://doi.org/10.1007/ s12975-017-0549-z. [39] C. Pereira, P. Agostinho, C.R. Oliveira, Vinpocetine attenuates the metabolic dysfunction induced by amyloid beta-peptides in PC12 cells, Free Radic. Res. 33 (2000)
Acknowledgments We wish to acknowledge Dr. Adel Bakeer. Department of Pathology, Faculty of Veterinary Medicine, Cairo University, for his kind help in histological analysis. Author contributions Azza A. Ali developed the research idea, designed the experiments, supervised the experiment execution, and revised the manuscript; Hebatalla I. Ahmed shared developing the idea, supervised the experiments execution, supervised the data analysis and revised the manuscript; Sahar A. Khaleel supervised the data analysis and wrote the manuscript; Karema Abu-Elfotuh performed the experiments, collected the data, analyzed the data, performed the graphical and statistical analysis and revised the manuscript. References [1] C. Hölscher, Novel dual GLP-1/GIP receptor agonists show neuroprotective effects in Alzheimer’s and Parkinson’s disease models, Neuropharmacology (2018), https://doi.org/10.1016/j.neuropharm.2018.01.040. [2] G.G. Glenner, C.W. Wong, Alzheimer's disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein, Biochem. Biophys. Res. Commun. 120 (1984) 885–890 http://www.ncbi.nlm.nih.gov/pubmed/ 6375662 , Accessed date: 24 March 2018. [3] I. Grundke-Iqbal, K. Iqbal, Y.C. Tung, M. Quinlan, H.M. Wisniewski, L.I. Binder, Abnormal phosphorylation of the microtubule-associated protein tau (tau) in Alzheimer cytoskeletal pathology, Proc. Natl. Acad. Sci. U. S. A. 83 (1986) 4913–4917 http://www.ncbi.nlm.nih.gov/pubmed/3088567 , Accessed date: 24 March 2018. [4] A.M. Fjell, L. McEvoy, D. Holland, A.M. Dale, K.B. Walhovd, Alzheimer's Disease Neuroimaging Initiative, What is normal in normal aging? Effects of aging, amyloid and Alzheimer's disease on the cerebral cortex and the hippocampus, Prog. Neurobiol. 117 (2014) 20–40, https://doi.org/10.1016/j.pneurobio.2014.02.004. [5] L.F. Lue, Y.M. Kuo, A.E. Roher, L. Brachova, Y. Shen, L. Sue, T. Beach, J.H. Kurth, R.E. Rydel, J. Rogers, Soluble amyloid beta peptide concentration as a predictor of synaptic change in Alzheimer's disease, Am. J. Pathol. 155 (1999) 853–862 http:// www.ncbi.nlm.nih.gov/pubmed/10487842 , Accessed date: 26 March 2018. [6] J.R. Walton, Aluminum involvement in the progression of Alzheimer's disease, J. Alzheimers Dis. 35 (2013) 7–43, https://doi.org/10.3233/JAD-121909. [7] T. Garcia, J.L. Esparza, M.R. Nogués, M. Romeu, J.L. Domingo, M. Gómez, Oxidative stress status and RNA expression in hippocampus of an animal model of Alzheimer's disease after chronic exposure to aluminum, Hippocampus. 20 (2010) 218–225, https://doi.org/10.1002/hipo.20612. [8] J.R. Walton, Evidence for participation of aluminum in neurofibrillary tangle formation and growth in Alzheimer's disease, J. Alzheimers Dis. 22 (2010) 65–72, https://doi.org/10.3233/JAD-2010-100486. [9] Z. Cao, X. Yang, H. Zhang, H. Wang, W. Huang, F. Xu, C. Zhuang, X. Wang, Y. Li, Aluminum chloride induces neuroinflammation, loss of neuronal dendritic spine and cognition impairment in developing rat, Chemosphere. 151 (2016) 289–295, https://doi.org/10.1016/j.chemosphere.2016.02.092. [10] A. Justin Thenmozhi, T.R. William Raja, T. Manivasagam, U. Janakiraman, M.M. Essa, Hesperidin ameliorates cognitive dysfunction, oxidative stress and apoptosis against aluminium chloride induced rat model of Alzheimer's disease, Nutr. Neurosci. 20 (2017) 360–368, https://doi.org/10.1080/1028415X.2016. 1144846. [11] Z. Cao, F. Wang, C. Xiu, J. Zhang, Y. Li, Hypericum perforatum extract attenuates behavioral, biochemical, and neurochemical abnormalities in aluminum chlorideinduced Alzheimer's disease rats, Biomed. Pharmacother. 91 (2017) 931–937, https://doi.org/10.1016/j.biopha.2017.05.022. [12] L.F. Berkman, T. Glass, I. Brissette, T.E. Seeman, From social integration to health: Durkheim in the new millennium, Soc. Sci. Med. 51 (2000) 843–857 http://www. ncbi.nlm.nih.gov/pubmed/10972429 , Accessed date: 24 March 2018. [13] N.J. Donovan, O.I. Okereke, P. Vannini, R.E. Amariglio, D.M. Rentz, G.A. Marshall, K.A. Johnson, R.A. Sperling, Association of Higher Cortical Amyloid Burden with Loneliness in cognitively Normal older adults, JAMA Psychiatry. 73 (2016)
8
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
[40]
[41]
[42]
[43]
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
[60]
[61]
[62]
497–506 http://www.ncbi.nlm.nih.gov/pubmed/11200083 , Accessed date: 27 March 2018. M.U. Farooq, J. Min, C. Goshgarian, P.B. Gorelick, Pharmacotherapy for vascular cognitive impairment, CNS Drugs. 31 (2017) 759–776, https://doi.org/10.1007/ s40263-017-0459-3. A.A. Ali, H.I. Ahmed, The potential effect of caffeine and nicotine co-administration against aluminum-induced Alzheimer's disease in rats, J. Alzheimer's Dis. Park. 6 (2016), https://doi.org/10.4172/2161-0460.1000236. S. Sharma, R. Deshmukh, Vinpocetine attenuates MPTP-induced motor deficit and biochemical abnormalities in Wistar rats, Neuroscience. 286 (2015) 393–403, https://doi.org/10.1016/j.neuroscience.2014.12.008. R. Morris, Developments of a water-maze procedure for studying spatial learning in the rat, J. Neurosci. Methods 11 (1984) 47–60 http://www.ncbi.nlm.nih.gov/ pubmed/6471907 , Accessed date: 12 March 2018. J.F. Cryan, A. Markou, I. Lucki, Assessing antidepressant activity in rodents: recent developments and future needs, Trends Pharmacol. Sci. 23 (2002) 238–245 http:// www.ncbi.nlm.nih.gov/pubmed/12008002 , Accessed date: 28 March 2018. R.D. Porsolt, A. Bertin, M. Jalfre, Behavioral despair in mice: a primary screening test for antidepressants, Arch. Int. Pharmacodyn. Ther. 229 (1977) 327–336 http:// www.ncbi.nlm.nih.gov/pubmed/596982 , Accessed date: 28 March 2018. R. Teruya, D.J. Fagundes, C.T.F. Oshima, J.L. Brasileiro, G. Marks, C.M. Ynouye, M. J. Simões, The effects of pentoxifylline into the kidneys of rats in a model of unilateral hindlimb ischemia/reperfusion injury., Acta Cir. Bras. 23 (n.d.) 29–35. http://www.ncbi.nlm.nih.gov/pubmed/18278390 (accessed May 6, 2019). D.A. Levison, Book Reviews :Theory and practice of histological techniques, 4th edition, 183 Johnd. Bancroft and Alan Stevens, Churchill Livingstone, Edinburgh, 1996, pp. 243–244, https://doi.org/10.1002/(SICI)1096-9896(199710) 183:2<243::AID-PATH770>3.0.CO;2-F No. of pages: 766 Price £79.50, J. Pathol.. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(−Delta Delta C(T)) method, Methods. 25 (2001) 402–408, https://doi.org/10.1006/meth.2001.1262. O.V. Bogdanova, S. Kanekar, K.E. D'Anci, P.F. Renshaw, Factors influencing behavior in the forced swim test, Physiol. Behav. 118 (2013) 227–239, https://doi.org/ 10.1016/j.physbeh.2013.05.012. H. Famitafreshi, M. Karimian, S. Fatima, Synergistic effects of social isolation and morphine addiction on reduced neurogenesis and BDNF levels and the resultant deficits in cognition and emotional state in male rats, Curr. Mol. Pharmacol. 9 (2016) 337–347 http://www.ncbi.nlm.nih.gov/pubmed/27550421 , Accessed date: 30 March 2018. J.N.-M. Chan, J.C.-D. Lee, S.S.P. Lee, K.K.Y. Hui, A.H.L. Chan, T.K.-H. Fung, D.I. Sánchez-Vidaña, B.W.-M. Lau, S.P.-C. Ngai, Interaction effect of social isolation and high dose corticosteroid on neurogenesis and emotional behavior, Front. Behav. Neurosci. 11 (2017) 18, https://doi.org/10.3389/fnbeh.2017.00018. O.J. Olajide, E.O. Yawson, I.T. Gbadamosi, T.T. Arogundade, E. Lambe, K. Obasi, I.T. Lawal, A. Ibrahim, K.Y. Ogunrinola, Ascorbic acid ameliorates behavioural deficits and neuropathological alterations in rat model of Alzheimer's disease, Environ. Toxicol. Pharmacol. 50 (2017) 200–211, https://doi.org/10.1016/j.etap. 2017.02.010. V.H. Finder, I. Vodopivec, R.M. Nitsch, R. Glockshuber, The recombinant amyloidbeta peptide Abeta1-42 aggregates faster and is more neurotoxic than synthetic Abeta1-42, J. Mol. Biol. 396 (2010) 9–18, https://doi.org/10.1016/j.jmb.2009.12. 016. J. Dubey, N. Ratnakaran, S.P. Koushika, Neurodegeneration and microtubule dynamics: death by a thousand cuts, Front. Cell. Neurosci. 9 (2015) 343, https://doi. org/10.3389/fncel.2015.00343. J. Näslund, Correlation between elevated levels of amyloid β-peptide in the brain and cognitive decline, JAMA. 283 (2000) 1571, https://doi.org/10.1001/jama.283. 12.1571. P. Agostinho, R.A. Cunha, C. Oliveira, Neuroinflammation, oxidative stress and the pathogenesis of Alzheimer's disease, Curr. Pharm. Des. 16 (2010) 2766–2778 http://www.ncbi.nlm.nih.gov/pubmed/20698820 , Accessed date: 31 March 2018. I. Guidi, D. Galimberti, S. Lonati, C. Novembrino, F. Bamonti, M. Tiriticco, C. Fenoglio, E. Venturelli, P. Baron, N. Bresolin, E. Scarpini, Oxidative imbalance in patients with mild cognitive impairment and Alzheimer's disease, Neurobiol. Aging 27 (2006) 262–269, https://doi.org/10.1016/j.neurobiolaging.2005.01.001. S. Schiavone, G.M. Camerino, E. Mhillaj, M. Zotti, M. Colaianna, A. De Giorgi, A. Trotta, F.P. Cantatore, E. Conte, M. Bove, P. Tucci, M.G. Morgese, L. Trabace, Visceral fat dysfunctions in the rat social isolation model of psychosis, Front. Pharmacol. 8 (2017) 787, https://doi.org/10.3389/fphar.2017.00787. S. Melov, P.A. Adlard, K. Morten, F. Johnson, T.R. Golden, D. Hinerfeld, B. Schilling, C. Mavros, C.L. Masters, I. Volitakis, Q.-X. Li, K. Laughton, A. Hubbard, R.A. Cherny, B. Gibson, A.I. Bush, Mitochondrial oxidative stress causes hyperphosphorylation of tau, PLoS One 2 (2007) e536, , https://doi.org/10.1371/ journal.pone.0000536. R. Deshmukh, V. Sharma, S. Mehan, N. Sharma, K.L. Bedi, Amelioration of intracerebroventricular streptozotocin induced cognitive dysfunction and oxidative stress by vinpocetine — a PDE1 inhibitor, Eur. J. Pharmacol. 620 (2009) 49–56, https://doi.org/10.1016/j.ejphar.2009.08.027. S. Gupta, P. Singh, B. Sharma, B. Sharma, Neuroprotective effects of Agomelatine and Vinpocetine against chronic cerebral Hypoperfusion induced vascular dementia, Curr. Neurovasc. Res. 12 (2015) 240–252, https://doi.org/10.2174/ 1567202612666150603130235. M. Zhu, X. Wang, M. Schultzberg, E. Hjorth, Differential regulation of resolution in
[63]
[64]
[65]
[66]
[67]
[68]
[69]
[70]
[71]
[72]
[73]
[74]
[75]
[76]
[77]
[78]
[79]
[80]
[81]
[82]
[83]
9
inflammation induced by amyloid-β42 and lipopolysaccharides in human microglia, J. Alzheimers Dis. 43 (2015) 1237–1250, https://doi.org/10.3233/JAD141233. G.L. Hermes, L. Rosenthal, A. Montag, M.K. McClintock, Social isolation and the inflammatory response: sex differences in the enduring effects of a prior stressor, Am. J. Physiol. Integr. Comp. Physiol. 290 (2006) R273–R282, https://doi.org/10. 1152/ajpregu.00368.2005. M. Cao, T. Pu, L. Wang, C. Marshall, H. He, G. Hu, M. Xiao, Early enriched physical environment reverses impairments of the hippocampus, but not medial prefrontal cortex, of socially-isolated mice, Brain Behav. Immun. 64 (2017) 232–243, https:// doi.org/10.1016/j.bbi.2017.04.009. K.W. Ruiz-Miyazawa, F.A. Pinho-Ribeiro, A.C. Zarpelon, L. Staurengo-Ferrari, R.L. Silva, J.C. Alves-Filho, T.M. Cunha, F.Q. Cunha, R. Casagrande, W.A. Verri, Vinpocetine reduces lipopolysaccharide-induced inflammatory pain and neutrophil recruitment in mice by targeting oxidative stress, cytokines and NF-κB, Chem. Biol. Interact. 237 (2015) 9–17, https://doi.org/10.1016/j.cbi.2015.05.007. K.W. Ruiz-Miyazawa, A.C. Zarpelon, F.A. Pinho-Ribeiro, G.F. Pavão-de-Souza, R. Casagrande, W.A. Verri, Vinpocetine reduces carrageenan-induced inflammatory hyperalgesia in mice by inhibiting oxidative stress, cytokine production and NF-κB activation in the paw and spinal cord, PLoS One 10 (2015) e0118942, , https://doi. org/10.1371/journal.pone.0118942. A. Martinez, C. Gil, D.I. Perez, Glycogen synthase kinase 3 inhibitors in the next horizon for Alzheimer's disease treatment, Int. J. Alzheimers Dis. 2011 (2011) 280502, https://doi.org/10.4061/2011/280502. M. Hong, D.C. Chen, P.S. Klein, V.M. Lee, Lithium reduces tau phosphorylation by inhibition of glycogen synthase kinase-3, J. Biol. Chem. 272 (1997) 25326–25332 http://www.ncbi.nlm.nih.gov/pubmed/9312151 , Accessed date: 2 April 2018. X.L. Shi, J. De Wu, P. Liu, Z.P. Liu, Synthesis and evaluation of novel GSK-3β inhibitors as multifunctional agents against Alzheimer's disease, Eur. J. Med. Chem. 167 (2019) 211–225, https://doi.org/10.1016/j.ejmech.2019.02.001. A.A. Asuni, C. Hooper, C.H. Reynolds, S. Lovestone, B.H. Anderton, R. Killick, GSK3alpha exhibits beta-catenin and tau directed kinase activities that are modulated by Wnt, Eur. J. Neurosci. 24 (2006) 3387–3392, https://doi.org/10.1111/j. 1460-9568.2006.05243.x. W. Qian, J. Shi, X. Yin, K. Iqbal, I. Grundke-Iqbal, C.-X. Gong, F. Liu, PP2A regulates tau phosphorylation directly and also indirectly via activating GSK-3beta, J. Alzheimers Dis. 19 (2010) 1221–1229, https://doi.org/10.3233/JAD-2010-1317. M. Llorens-Maratin, J. Jurado, F. Hernandez, J.A. Vila, GSK-3I2, a pivotal kinase in Alzheimer disease, Front. Mol. Neurosci. 7 (2014) 46, https://doi.org/10.3389/ fnmol.2014.00046. C.J. Phiel, C.A. Wilson, V.M.-Y. Lee, P.S. Klein, GSK-3α regulates production of Alzheimer's disease amyloid-β peptides, Nature. 423 (2003) 435–439, https://doi. org/10.1038/nature01640. E. Rockenstein, M. Torrance, A. Adame, M. Mante, P. Bar-on, J.B. Rose, L. Crews, E. Masliah, Neuroprotective effects of regulators of the glycogen synthase Kinase-3 signaling pathway in a transgenic model of Alzheimer's disease are associated with reduced amyloid precursor protein phosphorylation, J. Neurosci. 27 (2007) 1981–1991, https://doi.org/10.1523/JNEUROSCI.4321-06.2007. S.-H. Koh, M.Y. Noh, S.H. Kim, Amyloid-beta-induced neurotoxicity is reduced by inhibition of glycogen synthase kinase-3, Brain Res. 1188 (2008) 254–262, https:// doi.org/10.1016/j.brainres.2007.10.064. P.T.T. Ly, Y. Wu, H. Zou, R. Wang, W. Zhou, A. Kinoshita, M. Zhang, Y. Yang, F. Cai, J. Woodgett, W. Song, Inhibition of GSK3β-mediated BACE1 expression reduces Alzheimer-associated phenotypes, J. Clin. Invest. 123 (2013) 224–235, https://doi. org/10.1172/JCI64516. P.H. Reddy, Amyloid beta-induced glycogen synthase kinase 3β phosphorylated VDAC1 in Alzheimer's disease: implications for synaptic dysfunction and neuronal damage, Biochim. Biophys. Acta - Mol. Basis Dis. 1832 (2013) 1913–1921, https:// doi.org/10.1016/J.BBADIS.2013.06.012. G. Koelsch, BACE1 function and inhibition: implications of intervention in the amyloid pathway of Alzheimer's disease pathology, Molecules 22 (2017), https:// doi.org/10.3390/molecules22101723. L.R. Wang, S.-S. Baek, Treadmill exercise activates PI3K/Akt signaling pathway leading to GSK-3β inhibition in the social isolated rat pups, J. Exerc. Rehabil. 14 (2018) 4–9, https://doi.org/10.12965/jer.1836054.027. Q.-G. Ren, W.-G. Gong, Y.-J. Wang, Q.-D. Zhou, Z.-J. Zhang, Citalopram attenuates tau hyperphosphorylation and spatial memory deficit induced by social isolation rearing in middle-aged rats, J. Mol. Neurosci. 56 (2015) 145–153, https://doi.org/ 10.1007/s12031-014-0475-4. R. Perez-Gonzalez, C. Pascual, D. Antequera, M. Bolos, M. Redondo, D.I. Perez, V. Pérez-Grijalba, A. Krzyzanowska, M. Sarasa, C. Gil, I. Ferrer, A. Martinez, E. Carro, Phosphodiesterase 7 inhibitor reduced cognitive impairment and pathological hallmarks in a mouse model of Alzheimer's disease, Neurobiol. Aging 34 (2013) 2133–2145, https://doi.org/10.1016/J.NEUROBIOLAGING.2013.03.011. M. Cuadrado-Tejedor, I. Hervias, A. Ricobaraza, E. Puerta, J. Pérez-Roldán, C. García-Barroso, R. Franco, N. Aguirre, A. García-Osta, Sildenafil restores cognitive function without affecting β-amyloid burden in a mouse model of Alzheimer's disease, Br. J. Pharmacol. 164 (2011) 2029–2041, https://doi.org/10.1111/j.14765381.2011.01517.x. P.C. Swart, C.B. Currin, V.A. Russell, J.J. Dimatelis, Early ethanol exposure and vinpocetine treatment alter learning- and memory-related proteins in the rat hippocampus and prefrontal cortex, J. Neurosci. Res. 95 (2017) 1204–1215, https:// doi.org/10.1002/jnr.23894.
Contents lists available at ScienceDirect
Physiology & Behavior journal homepage: www.elsevier.com/locate/physbeh
Vinpocetine mitigates aluminum-induced cognitive impairment in socially isolated rats
T
⁎
Azza A. Alia, Hebatalla I. Ahmeda,b, Sahar A. Khaleela,c, , Karema Abu-Elfotuha a
Pharmacology and Toxicology Department, Faculty of Pharmacy, Al-Azhar University, Cairo, Egypt Pharmacology and Toxicology Department, Faculty of Pharmacy, Heliopolis University for sustainable development, Cairo, Egypt c Davis Heart and Lung Research Institute, Division of Cardiovascular Medicine, College of Medicine, The Ohio State University, Columbus, OH 43210, USA b
A R T I C LE I N FO
A B S T R A C T
Keywords: Alzheimer's disease Social isolation Vinpocetine Oxidative stress Inflammation GSK3β/BACE1
Several reports have highlighted the role of vinpocetine in Alzheimer's disease (AD). However, the role of vinpocetine in AD under social isolation conditions has not yet been elucidated. Henceforth, this study aimed to investigate the potential neuroprotective effect of vinpocetine in aluminum-induced AD model associated with social isolation. Social isolation increased the escape latency in Morris water maze (MWM) test, elevated the immobility score and decreased swimming score in forced swimming test (FST) in aluminum treated rats. However, vinpocetine enhanced acquisition in MWM test and exerted anti-depressive effect in FST. The histopathological examination showed marked deterioration in the cerebral cortex and hippocampus of AD isolated rats, while vinpocetine revealed overt improvement. In addition, the levels of amyloid-β protein (Aβ), phosphorylated-tau (Ser396), malondialdehyde (MDA), interleukin 1-beta (IL-1β), tumor necrosis alpha (TNFα), pGlycogen synthase kinase-3β (p-GSK3β) (Tyr216), and β-secretase (BACE1) gene expression were increased in socially isolated aluminum treated rats, yet, vinpocetine treatment reversed these deteriorating effects. Hence, this study provides profound insights into the role of vinpocetine in AD particularly in the conditions of social isolation. The effects of vinpocetine might be attributed not only to its antioxidant and anti-inflammatory properties, but also to its suppressing effect on GSK3β activity and its downstream BACE1.
1. Introduction Alzheimer's disease (AD) is a progressive neurodegenerative disease characterized by memory decline and cognitive dysfunction. It is the most common form of dementia in the elderly, leading to socioeconomic burden for patient's family and society. By 2050, the number of AD patients is expected to reach 131.5 million worldwide [1]. In neuropathological examination, the distinctive feature of AD is the abnormal accumulation of neurofibrillary tangles of amyloid-β protein (Aβ) and hyperphosphorylated tau protein in the brain [2,3]. The accumulation of these structures in different brain regions leads to memory deficit and neuronal damage [4,5]. AD was reported to be associated with aluminum, a neurotoxic metal, accumulation in the brain. Aluminum consumption was considered a risk factor for AD and people with higher daily intake of aluminum showed a greater cognitive decline [6]. The pathological and biochemical alterations seen in the brain with high aluminum content is akin to that seen during AD [7–9]. Therefore, aluminum-induced AD in rats is a well-known model
for exploring the etiology and innovative therapies for AD [10,11]. In the last decade, it has been postulated that social isolation is a main contributor to mental and psychosocial stress, leading to the high prevalence of neurological diseases [12]. For example, social isolation has been associated with cognitive and functional impairment as well as increased risk of AD dementia [13–15]. Furthermore, in experimental animal models of AD, social isolation was found to exacerbate memory deficit [16–18]. Several mechanisms have been suggested to mediate this deterioration such as increased production of Aβ peptide and phosphorylated tau [19], elevated oxidative stress and inflammatory reaction [20], reduction of brain-derived neurotrophic factors (BDNF) and myelination [21]. Moreover, social isolation is a potent stressor for inducing depressive state which, consecutively, might exacerbate AD [22–24]. As social isolation might be inevitable in old age [25,26], it is intriguing to elucidate pharmacological approaches to mitigate the deteriorating effect of social isolation on AD. Vinpocetine is a synthetic ethyl ester of apovincamine, an alkaloid extracted from the leaves of Vinca minor [27]. It has been widely used as
⁎ Corresponding author at: Davis Heart and Lung Research Institute, Division of Cardiovascular Medicine, College of Medicine, The Ohio State University, Columbus, OH 43210, USA. E-mail addresses: [email protected], [email protected] (S.A. Khaleel).
https://doi.org/10.1016/j.physbeh.2019.112571 Received 24 November 2018; Received in revised form 11 May 2019; Accepted 4 June 2019 Available online 06 June 2019 0031-9384/ © 2019 Published by Elsevier Inc.
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 1. Schematic experimental protocol for treatments and assessments of various parameters. MWM: Morris water maze; FST: Forced swimming test.
2.5. Behavioral testing
a dietary supplement for cerebrovascular disorders and cognitive impairment such as stroke, senile dementia, and memory disturbances [28–31]. These profitable effects are presumably attributed to its selective phosphodiesterase (PDE)-1 inhibition [32], blockage of sodium channels [33], as well as its antioxidant [34,35] and anti-inflammatory activity [36–38]. Vinpocetine revealed neuroprotective properties on PC12 cells treated with Aβ which highlights its efficacy in the treatment of AD [39]. Several reports, albeit inconclusive, revealed the beneficial effect of vinpocetine in AD patients [27,40]. Although the effect of vinpocetine on AD has been extensively studied, its effect on AD accompanied with social isolation has not yet been investigated. In this study, we aimed to verify the potential protective effect of vinpocetine in an isolation-associated aluminum model of AD and to gain better insight into its putative underlying mechanisms.
Behavioral tests were conducted between 8:00 AM and 4:00 PM at standard laboratory conditions.
2.5.1. Morris water maze test Spatial learning and memory were evaluated by Morris water maze test [43]. A circular water tank (150 cm diameter and 60 cm height) was filled with tap water to a depth of 30 cm (25 ± 2 °C). A non-toxic white paint was used to render the water opaque. The pool was divided virtually into four equal quadrants (north, south, east, and west). An escape platform of 10 cm in diameter was hidden 2 cm below the surface of water on a fixed location in the center of one of the quadrants. The platform was maintained in the same quadrant throughout experiment. The swimming track of the rats was recorded via a videotracking camera located above the pool. Each rat was placed in the water facing the pool wall from a specific point in each quadrant and was allowed to swim freely to find the platform. Rats received a daily training session for 3 consecutive days, consisting of four trials per session. The animals were permitted 60 s maximally to find the hidden platform and left to rest on it for 20 s before commencement of the next trial. If 60 s was elapsed before finding the platform, they were gently placed on the platform and allowed to rest for 20 s. The amount of time spent finding the platform (escape latency) was recorded. On day 4, a probe test was performed by removing the hidden platform and allowing rats to swim freely for 60 s. The time spent in the target quadrant was recorded (Fig. 1).
2. Methods 2.1. Chemicals Vinpocetine was purchased from Sigma Chemical Co. (St. Louis, MO, USA). All other chemicals were of reagent-grade quality. 2.2. Animals Adult male Wistar rats weighing 300 ± 20 g were purchased from the National Institute for Research, Cairo, Egypt. The animals were housed in a temperature and light-controlled room (23 ± 1 °C, 12/12 h light/dark cycle; lights out between 6:00 PM and 6:00 AM). They were acclimatized for one week before any experimental procedures and were allowed standard rat chow and water ad libitum. The Animal Ethics Committee of the Faculty of Pharmacy, Al-Azhar University, Egypt approved the experimental protocol used in this study (No. 65/ 2016).
2.5.2. Forced swimming test (FST) FST is a conventional test for assessing depressive-like behavior [44]. It was conducted according to Porsolt et al. with minor modifications [45]. On the day before the measurements, rats were individually placed into a cylindrical tank (diameter 20 cm, height 40 cm) filled with fresh water (24 ± 2 °C) to a depth of 30 cm. The animals were left to swim for 15 min, then removed from the cylinder, dried and placed into their original cage. Twenty four hours after the pretest session, rats were placed again in the tank for 5 min and the following behaviors were recorded by a previously trained observer (blind to the drug treatments); immobility (time spent floating immobile or with only small limb movements to keep head above the water), swimming (time spent swimming actively); climbing (time spent with upward movements of the forepaws directed to the cylinder wall) (Fig. 1).
2.3. Experimental protocol Rats were divided into 5 groups (8 rats each) as follows; Group I: control group received vehicle (one ml of 1% carboxymethyl cellulose, p.o.) and (0.2 ml saline i.p.) in group-housing condition; Group II: AD rats received AlCl3 (70 mg/kg, i.p.) [41] daily in group-housing condition; Group III AD isolated rats received AlCl3 (70 mg/kg, i.p.) daily in social isolation condition; Group IV: AD/vinpocetine rats received AlCl3 (70 mg/kg, i.p.) and vinpocetine (20 mg/kg, p.o.) daily in grouphousing condition; Group V: AD isolated/vinpocetine received AlCl3 (70 mg/kg, i.p.) and vinpocetine (20 mg/kg, p.o.) daily in social isolation condition. All treatments were maintained for five weeks. The dose of vinpocetine was selected based on a previous report [42] and a preliminary experiment.
2.6. Histopathological examination Rats were sacrificed 24 h after the last behavioral test by decapitation under anesthesia using a mixture of ketamine (50 mg/kg) and xylazine (20 mg/kg) intraperitoneally [46]. Brain samples were fixed in 10% formalin, embedded in paraffin, cut into sections of 5 μm thickness and stained with haematoxylin and eosin [47]. Assessment of specimens was conducted by an experienced histopathologist blinded to the identity of the examined samples to avoid bias (Fig. 1).
2.4. Housing conditions Socially isolated rats were housed individually in laboratory cages. The animals in group housing condition were placed in laboratory cages of same size in groups of 4 animals per cage. All rats were kept in their assigned housing conditions till the end of the experiments. 2
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 2. Effect of vinpocetine on escape latency (A) and time spent in target quadrant (B) in Morris water maze test in isolated aluminum-treated rats. Values are means ± SD (n = 8). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated.
2 μl cDNA, and 6 μl water. The primer sequences of were as following; BACE1 forward primer: 5′-GCACCCAGCACAATGAAGATCAAG −3′ and reverse primer: 5′- TCATACTCCTGCTTGCTGATCCAC -3′.GAPDH was used as reference housekeeping gene with forward primer 5′- TATCG GACGCCTGGTTAC-3′ and reverse primer: 5′- CTGTGCCGTTGAACT TGC-3′. The relative expression was calculated from the 2-ΔΔCT formula [48].
2.7. Biochemical testing Another part of the excised brains was snap-frozen by liquid nitrogen and stored at −80 °C for subsequent testing. 2.7.1. Estimation of oxidative stress markers Malondialdehyde (MDA) content, as a marker of lipid peroxidation, and SOD activity were assessed using commercially available kits (Biodiagnostics, Giza, Egypt) according to manufacturer's instructions.
2.8. Statistical analysis
2.7.2. Determination of amyloid-β protein, interleukin 1-beta (IL-1β), and tumor necrosis alpha (TNFα) Brain level of amyloid-β 1–42 protein, IL-1β, and TNFα were evaluated by ELISA kit (MyBioSource, Inc., SanDiego, USA) according to the manufacturer's instructions.
The statistical analysis was performed using GraphPad Prism 5 (GraphPad Software Inc., CA, USA) and the results were expressed as means ± SD. The statistical significance was determined using one-way analysis of variance (ANOVA) followed by Tukey-Kramer as a post-hoc test. Total histopathological scoring was analyzed using Kruskal–Wallis nonparametric one-way ANOVA followed by Dunn's multiple comparisons. Statistical significance was considered at p < .05.
2.7.3. Determination of phosphorylated tau and Glycogen synthase kinase3β (GSK3β) Western blot was used to assess the level of p-tau (Ser396) and pGSK3β (Tyr216). In brief, tissues were homogenized in a RIPA buffer (Sigma-Aldrich, USA) with protease inhibitors. The homogenate was centrifuged for 20 min at 4 °C and the supernatant was collected. Samples were subjected to 7% SDS-PAGE gel and then transferred to nitrocellulose membranes (Bio-Rad). The membranes were blocked in 7.5% non-fat dried milk in TBST (0.05% Tween-20 Tris-buffered saline) for 2 h at room temperature and then incubated overnight at 4 °C with specific antibodies against p-tau and p-GSK3β at 1:1000 (Invitrogen, Thermofisher scientific, Waltham, MA, USA). The membranes were washed and then incubated with secondary horseradish peroxidaseconjugated anti-rabbit IgG antibody (1:25000, Bio-Rad, Hercules, CA, USA) for 1 h and then protein bands were detected.
3. Results 3.1. Vinpocetine improved acquisition impairment and depressive behavior in socially isolated aluminum treated rats Morris water maze assesses spatial learning and memory. Rats readily move toward the escape platform away from the water bath. In the present study, the escape latency gradually declined over the four days of training, revealing improved acquisition performance in all groups (Fig. 2A). However, average latency to find the platform in the fourth day of training trials was significantly higher (p < .05) in aluminum treated group compared to control animals. Moreover, social isolation significantly increased (p < .05) the latency compared to AD group. However, vinpocetine treatment significantly improved (p < .05) the escape latency in AD and AD isolated rats. Furthermore, the amount of time in target quadrant was significantly less (p < .05) in AD rats compared to control rats (Fig. 2B). In addition, social isolation significantly deteriorates aluminum-induced memory deficits as evidenced by less time spent in target quadrant compared to AD group. However, vinpocetine treatment increased the time in target quadrant in both AD and AD isolated rats. Taken together, these findings showed an improved acquisition and memory with vinpocetine treatment in AD isolated rats. In FST, the results of Fig. 3 showed that the immobility and climbing time increased significantly (p < .05), while the swimming time
2.7.4. Real time PCR Total RNA extraction from cells was performed using RNeasy Mini Kit® (Qiagen Inc. Valencia, CA, USA) according to the manufacturer's protocol. The purity of obtained RNA was verified spectrophotometrically at 260/280 nm. Equal amounts of RNA (4 μg) were reverse transcribed into cDNA using High-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). The archived cDNA was then subjected to quantitative real time PCR reactions (Fermentas Inc., Glen Burnie, MD, USA). The PCR reaction mixture consisted of 10 μl SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA), 1 μl forward primer (nM), 1 μl reverse primer (nM), 3
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 3. Effect of vinpocetine on forced swimming test in isolation-associated aluminum-treated rats. Values are means ± SD (n = 8). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated.
decreased significantly (p < .05) in aluminum treated rats, revealing the depressive response in AD rats. Moreover, social isolation deteriorated the depressive state by significantly increasing (p < .05) the immobility time and decreasing the swimming time compared to AD group, while it, counterintuitively, reduced the climbing time significantly compared to AD group. However, vinpocetine treatment significantly decreased (p < .05) the immobility time and increased the swimming time in AD isolated rats. Hence, vinpocetine exerted antidepressive effects which might enhance the cognitive deficits in AD associated with social isolation. On the other hand, vinpocetine effect on the climbing time did not reveal a marked improvement.
aluminum treated rats compared to control group (Fig. 6A). Moreover, social isolation significantly elevated (p < .05) MDA content by 24.32% compared to AD group. However, vinpocetine treatment significantly decreased (p < .05) MDA level in AD and AD isolated groups by 45.73% and 40.13%, respectively. In addition, SOD activity was significantly reduced by 81.87% in aluminum treated group compared to control group, while social isolation significantly reduced (p < .05) SOD activity by 44.81% compared to AD group (Fig. 6B). Yet, vinpocetine treatment induced a remarkable increase (p < .05) in SOD activity by 2.7 fold and 4.1 fold compared to AD and AD isolated group, respectively.
3.2. Vinpocetine mitigated hippocampal degeneration induced by aluminum in socially isolated rats
3.5. Vinpocetine down-regulated IL-1β, and TNFα in socially isolated aluminum treated rats
Histopathological examination of the brain of aluminum-treated rats showed no histopathological alterations in the cerebral cortex (Fig. 4A), while the pyramidal cells in hippocampus showed nuclear pyknosis and degeneration (Fig. 4B). In addition, in AD isolated group, nuclear necrosis and degeneration were observed in the cerebral cortex (Fig. 4A), while the hippocampus revealed nuclear pyknosis and degeneration with congestion in the blood vessels (Fig. 4B). However, vinocetine/AD group revealed normal histological structure of cerebral cortex and hippocampus, while vinpocetine/AD isolated group showed less nuclear pyknosis and degeneration in the neurons of the cerebral cortex while the subiculum in the hippocampus was intact (Fig. 4A & B). No histopathological alterations were found in the control group.
IL-1β and TNFα are pro-inflammatory cytokines commonly elevated in AD, promoting chronic inflammation and continued aggregation of Aβ and p-tau (Li et al., 2018; Zhu et al., 2015). As shown in Fig. 6, social isolation induced a significant increase (p < .05) in IL-1β (Fig. 7A), and TNFα (Fig. 7B) levels compared to AD group. Yet, vinpocetine treatment significantly lowered (p < .05) the levels of IL-1β, and TNFα in both AD and AD isolated groups, emphasizing its role in mitigating neuroinflammation in the brain.
3.3. Vinpocetine reduced the levels of amyloid-β protein (Aβ) and phosphorylated-tau (Ser396) in socially isolated aluminum treated rats
Western blot assessment of p-GSK3β (Tyr216) showed a significant increase (p < .05) in the stimulatory GSK3β in AD group by 5.7 fold compared to control group, while vinpocetine treatment significantly decreased Tyr216 phosphorylation compared to AD group (Fig. 8A). Furthermore, aluminum treatment in social isolation conditions induce a significant increase (p < .05) in the level of p-GSK3β (Tyr216) compared to AD group. Yet, vinpocetine treatment significantly ameliorated this effect compared to AD isolated group. In addition, BACE1 cleaves APP and generates the formation of Aβ. Herein, we investigated the expression levels of BACE1 using real time PCR technique. The levels of BACE1 mRNA were significantly increased (p < .05) in AD group compared with control group (4 fold), while vinpocetine treatment down-regulated the level of BACE1 mRNA significantly (p < .05) compared to AD group (Fig. 8B). Moreover, social isolation induced a significant elevation in BACE1 gene expression compared to AD group. However, vinpocetine treatment in AD isolated group significantly reversed (p < .05) this up-regulation.
3.6. Vinpocetine decreased the stimulatory GSK3β (Tyr216) phosphorylation and the downstream gene expression of BACE1 in socially isolated aluminum treated rats
The increased levels of Aβ and phosphorylated tau at Ser396 (pS396-tau) are strongly associated with the severity of AD (Hu et al., 2002; Lue et al., 1999). We determined the levels of Aβ and p-tau to verify the neuroprotective effect of vinpocetine. The levels of Aβ (Fig. 5A) and p-tau (Fig. 5B) were significantly increased (p < .05) in aluminum treated group by 5 fold and 3 fold, respectively, compared to control group. However, a significant decrease (p < .05) in the level of Aβ and p-tau was seen in AD/vinpocetine group compared to AD group. In addition, in AD isolated group there was a significant increase (p < .05) in the level of Aβ and p-tau compared to AD group. Yet, vinpocetine treatment in AD isolated group significantly declined Aβ and p-tau contents. These findings show that vinpocetine is effective in preventing the accumulation of p-tau and Aβ in aluminum treated rats either in group housing or in social isolation conditions.
4. Discussion
3.4. Vinpocetine reduced MDA level and increased SOD activity in socially isolated aluminum treated rats
The present study demonstrated the neuroprotective role of vinpocetine against aluminum-induced cognitive impairment in socially
The level of MDA was significantly increased (p < .05) in 4
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 4. Histopathological features in the cerebral cortex (cc) (A) and hippocampus (hp) (B) in isolation-associated aluminum-treated rats. Control group showed normal features; AD group showed no histopathological alteration in the cerebral cortex but showed nuclear pyknosis (np) and degeneration (dn) in hippocampal pyramidal cells; AD isolated group showed nuclear necrosis (nn) and degeneration (dn) in cerebral cortex and nuclear pyknosis (np) and degeneration (dn) with congestion (cg) in the blood vessels in the hippocampus; AD/vinpocetine showed normal histological structure of cerebral cortex and hippocampus; AD isolated/ vinpocetine showed nuclear pyknosis (np) and degeneration (dn) in the cerebral cortex neurons and subiculum in the hippocampus was intact. (Magnification 40×) and Total histopathological score for the cerebral cortex and hippocampus. Values are means ± SD (n = 7). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated (C).
apparently ameliorated by vinpocetine treatment emphasizing its role in the prevention of cell death and, consequently, interpreting the improved results in Morris water maze test and FST. Amyloid-β 42 is a major contributor to synaptic plasticity, neuronal death and neurotransmitter deficiency [53]. In addition, hyperphosphorylation of tau affects the dynamics of microtubules and the neurons' polarity, leading to neurodegeneration [54]. As the levels of Aβ protein and p-tau correlates with the extent of memory impairment [4,5,55], social isolation contributed significantly, herein, to the impaired cognitive state by overtly increasing these levels. Interestingly, vinpocetine reversed the increase in Aβ and p-tau levels which might further explain the enhanced performance in behavioral tests. Oxidative stress plays a pivotal role in the initiation and progression of AD [56] and elevated oxidative markers have been reported in the brain, blood and cerebrospinal fluid (CSF) of AD patients [57]. Concordantly, the antioxidant defense has been reported to be markedly decreased in socially isolated rats [58], which might explain the
isolated rats. We demonstrated that social isolation overtly deteriorates the cognitive and behavioral state of AD rats as evidenced by prolonged latency time in Morris water maze test, and by elevated immobility score and lowered swimming score in FST. While social isolation, unexpectedly, decreased the climbing time of AD group, that should not contradict the other two scores as the immobility time is the primary dependent measure in FST [49]. Consistently, several reports have revealed the tendency of social isolation to induce depressive-like behaviors and cognitive impairment in rodents [50,51]. However, herein, vinpocetine exerted anti-depressive and memory improving effects in AD isolated rats. The behavioral tests were further supported by assessing the histopathological and biochemical hallmarks of AD. Neurons in the hippocampus and cerebral cortex showed marked necrosis and pyknosis which characterize the structural toxicity induced by neurotoxins such as aluminum [52]. Our results showed that social isolation deteriorated aluminum induced neurodegeneration. Such degenerative features are 5
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 5. Effect of vinpocetine on the levels of amyloid-β protein (Aβ) and p-tau (S396) in socially isolated aluminum treated rats. Values are means ± SD (n = 8). Western blotting was done in triplicates. *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated.
Fig. 6. Effect of vinpocetine on MDA level and SOD activity in socially isolated aluminum treated rats. Values are means ± SD (n = 8). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated.
Aβ-peptides in PC12 cells [39]. Moreover, vinpocetine alleviated redox imbalance in intracerebroventricular streptozotocin and chronic cerebral hypoperfusion-induced cognitive dysfunction and oxidative stress in rats [60,61]. Therefore, the neuromodulatory effect of vinpocetine in AD isolated rats might be attributed to its antioxidant effects. Not only oxidative stress, but also neuroinflammation contributes significantly to the pathogenesis of AD [56]. Furthermore, the persistence of Aβ aggregates leads to chronic inflammation and a vicious circle of mutual activation [62]. Similarly, social isolation is a potential trigger to inflammatory responses [63,64]. For instance, social isolation was found to increase the expression of pro-IL-1β, IL-1β, IL6 and TNF-α in the hippocampus of APP/PS1 mice [16]. The findings of the present study are in accordance with the aforementioned reports as AD isolated
significant decrease in SOD activity and increase in MDA content in AD isolated rats. SOD plays a pivotal role in the antioxidant defense system against ROS generated during oxidative stress. It catalyzes the transformation of superoxide radical to hydrogen peroxide, preventing the formation of hydroxyl radical which is the most reactive oxidant to macromolecules. Increased levels of free radicals stimulate lipid peroxidation resulting in the formation of more stable toxicants such as MDA. Typically, oxidative stress induces the accumulation of Aβ and the hyperphosphorylation of tau protein [59]. In the present study, vinpocetine ameliorated oxidative stress in AD isolated rats which might partly explain vinpocetine's down regulating effect on Aβ and phosphorylated tau levels. Consistently, a previous report revealed the ameliorating effect of vinpocetine against oxidative stress induced by
6
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
Fig. 7. Effect of vinpocetine on IL-1β, and TNFα in socially isolated aluminum treated rats. Values are means ± SD (n = 8). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated.
deteriorating effects of GSK-3β in the brain [72]. Moreover, several studies showed that Aβ activates GSK-3β signaling by preventing serine 9 phosphorylation and a feed forward loop is established by the subsequent activation of Aβ pathology [72]. Furthermore, GSK-3β repression was found to decrease Aβ production in AD experimental models [73,74] and ameliorate Aβ-induced neurotoxicity in neuronal cells in vitro [75]. GSK-3β-induced production of Aβ might be mediated by upregulation of BACE1 gene expression which increases amyloid precursor protein (APP) processing [76,77]. BACE1 cleavage of APP to Aβ is one of the fastest pathologic events in the progression of AD preceding clinical symptoms [78]. Thus, counteracting BACE1 activity might hinder an early and critical pathologic event in AD. In the present study, social isolation was found to increase the activity of GSK-3β which is in agreement with previous reports showing enhanced expression of GSK-3β in the hippocampus of AD rats [79,80]. Interestingly, GSK-3β activity and BACE1 gene expression was declined by vinpocetine in AD and AD isolated rats which might accounts for the overt parallel reduction in p-tau and Aβ. Reduced GSK3 activity might
rats showed augmented inflammatory response, manifested by the increased levels of TNF-α and IL-1β, compared to AD rats in grouphousing. Interestingly, vinpocetine reversed the inflammatory reaction in both AD and AD isolated rats. Several reports revealed the anti-inflammatory properties of vinpocetine in the brain and peripheral tissues as well. For example, vinpocetine hampered LPS and carrageenan-induced NF-κB activation and its downstream pro-inflammatory cytokines such as TNF-α and IL-1β [65,66]. Hence, it seems likely that the neuromodulatory effect on AD isolated rats is attributed, at least in part, to its antioxidant and anti-inflammatory properties. Glycogen synthase kinase-3β (GSK-3β) is a serine/threonine kinase that has been highlighted as a central factor in AD as it is a key regulator of tau phosphorylation and Aβ production [67–69]. In AD patients' brain, high expression levels of GSK-3β are manifested, resulting in the over-phosphorylation of tau and the formation of neurofibrillary tangles [70]. Typically, GSK-3β is activated by phosphorylation at tyrosine 216 and deactivated by phosphorylation at serine 9 [71]. Enhancing GSK-3Ser9 or decreasing GSK-3Tyr216 attenuates the
Fig. 8. Effect of vinpocetine on p-GSK3β (Tyr216) and BACE1 in isolation-associated aluminum-treated rats. Values are means ± SD (n = 3). *p < .05 compared with control; #p < .05 compared with AD; δ p < .05 compared with AD isolated. 7
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
be attributed to the increased cAMP and cGMP levels induced by phosphodiesterase inhibition, leading to reduction of tau phosphorylation [81,82]. In accordance with our findings, vinpocetine increased the level of GSK-3Ser9 in ethanol-treated rats, preventing alterations in learning and memory-related proteins [83]. In conclusion, the present work highlights the role of vinpocetine in mitigating aluminum-induced cognitive deficits and in reversing biochemical and histopathological deteriorations in socially isolated rats. This neuro-modulatory effect of vinpocetine might be attributed to the inhibition of GSK3β/BACE-1 signaling cascade in addition to its conventional antioxidant and anti-inflammatory effects.
1230–1237, https://doi.org/10.1001/jamapsychiatry.2016.2657. [14] B. Friedler, J. Crapser, L. McCullough, One is the deadliest number: the detrimental effects of social isolation on cerebrovascular diseases and cognition, Acta Neuropathol. 129 (2015) 493–509, https://doi.org/10.1007/s00401-014-1377-9. [15] R.S. Wilson, K.R. Krueger, S.E. Arnold, J.A. Schneider, J.F. Kelly, L.L. Barnes, Y. Tang, D.A. Bennett, Loneliness and risk of Alzheimer disease, Arch. Gen. Psychiatry 64 (2007) 234, https://doi.org/10.1001/archpsyc.64.2.234. [16] M. Cao, P.-P. Hu, Y.-L. Zhang, Y.-X. Yan, C.B. Shields, Y.-P. Zhang, G. Hu, M. Xiao, Enriched physical environment reverses spatial cognitive impairment of socially isolated APPswe/PS1dE9 transgenic mice before amyloidosis onset, CNS Neurosci. Ther. 24 (2018) 202–211, https://doi.org/10.1111/cns.12790. [17] N. Leser, S. Wagner, The effects of acute social isolation on long-term social recognition memory, Neurobiol. Learn. Mem. 124 (2015) 97–103, https://doi.org/10. 1016/j.nlm.2015.07.002. [18] A.A. Ali, M.G. Khalil, H.A. Elariny, Karema A. Elfotuh, Study on social isolation as a risk factor in development of Alzheimer's disease in rats, Brain Disord. Ther. 06 (2017), https://doi.org/10.4172/2168-975X.1000230. [19] H. Huang, L. Wang, M. Cao, C. Marshall, J. Gao, N. Xiao, G. Hu, M. Xiao, Isolation housing exacerbates Alzheimer's disease-like pathophysiology in aged APP/PS1 mice, Int. J. Neuropsychopharmacol. 18 (2015) pyu116, https://doi.org/10.1093/ ijnp/pyu116. [20] N.D. Powell, E.K. Sloan, M.T. Bailey, J.M.G. Arevalo, G.E. Miller, E. Chen, M.S. Kobor, B.F. Reader, J.F. Sheridan, S.W. Cole, Social stress up-regulates inflammatory gene expression in the leukocyte transcriptome via -adrenergic induction of myelopoiesis, Proc. Natl. Acad. Sci. 110 (2013) 16574–16579, https://doi. org/10.1073/pnas.1310655110. [21] A. Djordjevic, M. Adzic, J. Djordjevic, M.B. Radojcic, Chronic social isolation is related to both upregulation of plasticity genes and initiation of proapoptotic signaling in Wistar rat hippocampus, J. Neural Transm. 116 (2009) 1579–1589, https://doi.org/10.1007/s00702-009-0286-x. [22] J.N.-M. Chan, J.C.-D. Lee, S.S.P. Lee, K.K.Y. Hui, A.H.L. Chan, T.K.-H. Fung, D.I. Sánchez-Vidaña, B.W.-M. Lau, S.P.-C. Ngai, Interaction effect of social isolation and high dose corticosteroid on neurogenesis and emotional behavior, Front. Behav. Neurosci. 11 (2017) 18, https://doi.org/10.3389/fnbeh.2017.00018. [23] R. Rodrigues, R.B. Petersen, G. Perry, Parallels between major depressive disorder and Alzheimer's disease: role of oxidative stress and genetic vulnerability, Cell. Mol. Neurobiol. 34 (2014) 925–949, https://doi.org/10.1007/s10571-014-0074-5. [24] B. Chen, X. Zhong, N. Mai, Q. Peng, Z. Wu, C. Ouyang, W. Zhang, W. Liang, Y. Wu, S. Liu, L. Chen, Y. Ning, Cognitive impairment and structural abnormalities in late life depression with olfactory identification impairment: an Alzheimer's disease-like pattern, Int. J. Neuropsychopharmacol. (2018), https://doi.org/10.1093/ijnp/ pyy016. [25] Y. Luo, L.C. Hawkley, L.J. Waite, J.T. Cacioppo, Loneliness, health, and mortality in old age: a national longitudinal study, Soc. Sci. Med. 74 (2012) 907–914, https:// doi.org/10.1016/j.socscimed.2011.11.028. [26] G.D. Cohen, Loneliness in later life, Am. J. Geriatr. Psychiatry 8 (2000) 273–275 http://www.ncbi.nlm.nih.gov/pubmed/11069265 , Accessed date: 6 April 2018. [27] S. Szatmári, P. Whitehouse, et al., Cochrane Database Syst. Rev. (2003) CD003119, https://doi.org/10.1002/14651858.CD003119. [28] R. Deshmukh, V. Sharma, S. Mehan, N. Sharma, K.L. Bedi, Amelioration of intracerebroventricular streptozotocin induced cognitive dysfunction and oxidative stress by vinpocetine — a PDE1 inhibitor, Eur. J. Pharmacol. 620 (2009) 49–56, https://doi.org/10.1016/j.ejphar.2009.08.027. [29] E. Bagoly, G. Fehér, L. Szapáry, The role of vinpocetine in the treatment of cerebrovascular diseases based in human studies, Orv. Hetil. 148 (2007) 1353–1358, https://doi.org/10.1556/OH.2007.28115. [30] S. Patyar, A. Prakash, M. Modi, B. Medhi, Role of vinpocetine in cerebrovascular diseases, Pharmacol. Reports. 63 (2011) 618–628, https://doi.org/10.1016/S17341140(11)70574-6. [31] A. Valikovics, Investigation of the effect of vinpocetine on cerebral blood flow and cognitive functions, Ideggyogy. Sz. 60 (2007) 301–310 http://www.ncbi.nlm.nih. gov/pubmed/17713111 , Accessed date: 27 March 2018. [32] T.R. Dunkern, A. Hatzelmann, Characterization of inhibitors of phosphodiesterase 1C on a human cellular system, FEBS J. 274 (2007) 4812–4824, https://doi.org/10.1111/j.1742-4658.2007.06001.x. [33] M. Sitges, E. Galván, V. Nekrassov, Vinpocetine blockade of sodium channels inhibits the rise in sodium and calcium induced by 4-aminopyridine in synaptosomes, Neurochem. Int. 46 (2005) 533–540, https://doi.org/10.1016/J.NEUINT.2005.02. 001. [34] N. Herrera-Mundo, M. Sitges, Vinpocetine and α-tocopherol prevent the increase in DA and oxidative stress induced by 3-NPA in striatum isolated nerve endings, J. Neurochem. 124 (2013) 233–240, https://doi.org/10.1111/jnc.12082. [35] G. Mendoza, A.I. Álvarez, M.M. Pulido, A.J. Molina, G. Merino, R. Real, P. Fernandes, J.G. Prieto, Inhibitory effects of different antioxidants on hyaluronan depolymerization, Carbohydr. Res. 342 (2007) 96–102, https://doi.org/10.1016/J. CARRES.2006.10.027. [36] K.-I. Jeon, X. Xu, T. Aizawa, J.H. Lim, H. Jono, D.-S. Kwon, J.I. Abe, B.C. Berk, J.D. Li, C. Yan, Vinpocetine inhibits NF- B-dependent inflammation via an IKK-dependent but PDE-independent mechanism, Proc. Natl. Acad. Sci. 107 (2010) 9795–9800, https://doi.org/10.1073/pnas.0914414107. [37] R.T. Liu, A. Wang, E. To, J. Gao, S. Cao, J.Z. Cui, J.A. Matsubara, Vinpocetine inhibits amyloid-beta induced activation of NF-κB, NLRP3 inflammasome and cytokine production in retinal pigment epithelial cells, Exp. Eye Res. 127 (2014) 49–58, https://doi.org/10.1016/j.exer.2014.07.003. [38] F. Zhang, C. Yan, C. Wei, Y. Yao, X. Ma, Z. Gong, S. Liu, D. Zang, J. Chen, F.-D. Shi, J. Hao, Vinpocetine inhibits NF-κB-dependent inflammation in acute ischemic stroke patients, Transl. Stroke Res. 9 (2018) 174–184, https://doi.org/10.1007/ s12975-017-0549-z. [39] C. Pereira, P. Agostinho, C.R. Oliveira, Vinpocetine attenuates the metabolic dysfunction induced by amyloid beta-peptides in PC12 cells, Free Radic. Res. 33 (2000)
Acknowledgments We wish to acknowledge Dr. Adel Bakeer. Department of Pathology, Faculty of Veterinary Medicine, Cairo University, for his kind help in histological analysis. Author contributions Azza A. Ali developed the research idea, designed the experiments, supervised the experiment execution, and revised the manuscript; Hebatalla I. Ahmed shared developing the idea, supervised the experiments execution, supervised the data analysis and revised the manuscript; Sahar A. Khaleel supervised the data analysis and wrote the manuscript; Karema Abu-Elfotuh performed the experiments, collected the data, analyzed the data, performed the graphical and statistical analysis and revised the manuscript. References [1] C. Hölscher, Novel dual GLP-1/GIP receptor agonists show neuroprotective effects in Alzheimer’s and Parkinson’s disease models, Neuropharmacology (2018), https://doi.org/10.1016/j.neuropharm.2018.01.040. [2] G.G. Glenner, C.W. Wong, Alzheimer's disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein, Biochem. Biophys. Res. Commun. 120 (1984) 885–890 http://www.ncbi.nlm.nih.gov/pubmed/ 6375662 , Accessed date: 24 March 2018. [3] I. Grundke-Iqbal, K. Iqbal, Y.C. Tung, M. Quinlan, H.M. Wisniewski, L.I. Binder, Abnormal phosphorylation of the microtubule-associated protein tau (tau) in Alzheimer cytoskeletal pathology, Proc. Natl. Acad. Sci. U. S. A. 83 (1986) 4913–4917 http://www.ncbi.nlm.nih.gov/pubmed/3088567 , Accessed date: 24 March 2018. [4] A.M. Fjell, L. McEvoy, D. Holland, A.M. Dale, K.B. Walhovd, Alzheimer's Disease Neuroimaging Initiative, What is normal in normal aging? Effects of aging, amyloid and Alzheimer's disease on the cerebral cortex and the hippocampus, Prog. Neurobiol. 117 (2014) 20–40, https://doi.org/10.1016/j.pneurobio.2014.02.004. [5] L.F. Lue, Y.M. Kuo, A.E. Roher, L. Brachova, Y. Shen, L. Sue, T. Beach, J.H. Kurth, R.E. Rydel, J. Rogers, Soluble amyloid beta peptide concentration as a predictor of synaptic change in Alzheimer's disease, Am. J. Pathol. 155 (1999) 853–862 http:// www.ncbi.nlm.nih.gov/pubmed/10487842 , Accessed date: 26 March 2018. [6] J.R. Walton, Aluminum involvement in the progression of Alzheimer's disease, J. Alzheimers Dis. 35 (2013) 7–43, https://doi.org/10.3233/JAD-121909. [7] T. Garcia, J.L. Esparza, M.R. Nogués, M. Romeu, J.L. Domingo, M. Gómez, Oxidative stress status and RNA expression in hippocampus of an animal model of Alzheimer's disease after chronic exposure to aluminum, Hippocampus. 20 (2010) 218–225, https://doi.org/10.1002/hipo.20612. [8] J.R. Walton, Evidence for participation of aluminum in neurofibrillary tangle formation and growth in Alzheimer's disease, J. Alzheimers Dis. 22 (2010) 65–72, https://doi.org/10.3233/JAD-2010-100486. [9] Z. Cao, X. Yang, H. Zhang, H. Wang, W. Huang, F. Xu, C. Zhuang, X. Wang, Y. Li, Aluminum chloride induces neuroinflammation, loss of neuronal dendritic spine and cognition impairment in developing rat, Chemosphere. 151 (2016) 289–295, https://doi.org/10.1016/j.chemosphere.2016.02.092. [10] A. Justin Thenmozhi, T.R. William Raja, T. Manivasagam, U. Janakiraman, M.M. Essa, Hesperidin ameliorates cognitive dysfunction, oxidative stress and apoptosis against aluminium chloride induced rat model of Alzheimer's disease, Nutr. Neurosci. 20 (2017) 360–368, https://doi.org/10.1080/1028415X.2016. 1144846. [11] Z. Cao, F. Wang, C. Xiu, J. Zhang, Y. Li, Hypericum perforatum extract attenuates behavioral, biochemical, and neurochemical abnormalities in aluminum chlorideinduced Alzheimer's disease rats, Biomed. Pharmacother. 91 (2017) 931–937, https://doi.org/10.1016/j.biopha.2017.05.022. [12] L.F. Berkman, T. Glass, I. Brissette, T.E. Seeman, From social integration to health: Durkheim in the new millennium, Soc. Sci. Med. 51 (2000) 843–857 http://www. ncbi.nlm.nih.gov/pubmed/10972429 , Accessed date: 24 March 2018. [13] N.J. Donovan, O.I. Okereke, P. Vannini, R.E. Amariglio, D.M. Rentz, G.A. Marshall, K.A. Johnson, R.A. Sperling, Association of Higher Cortical Amyloid Burden with Loneliness in cognitively Normal older adults, JAMA Psychiatry. 73 (2016)
8
Physiology & Behavior 208 (2019) 112571
A.A. Ali, et al.
[40]
[41]
[42]
[43]
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
[60]
[61]
[62]
497–506 http://www.ncbi.nlm.nih.gov/pubmed/11200083 , Accessed date: 27 March 2018. M.U. Farooq, J. Min, C. Goshgarian, P.B. Gorelick, Pharmacotherapy for vascular cognitive impairment, CNS Drugs. 31 (2017) 759–776, https://doi.org/10.1007/ s40263-017-0459-3. A.A. Ali, H.I. Ahmed, The potential effect of caffeine and nicotine co-administration against aluminum-induced Alzheimer's disease in rats, J. Alzheimer's Dis. Park. 6 (2016), https://doi.org/10.4172/2161-0460.1000236. S. Sharma, R. Deshmukh, Vinpocetine attenuates MPTP-induced motor deficit and biochemical abnormalities in Wistar rats, Neuroscience. 286 (2015) 393–403, https://doi.org/10.1016/j.neuroscience.2014.12.008. R. Morris, Developments of a water-maze procedure for studying spatial learning in the rat, J. Neurosci. Methods 11 (1984) 47–60 http://www.ncbi.nlm.nih.gov/ pubmed/6471907 , Accessed date: 12 March 2018. J.F. Cryan, A. Markou, I. Lucki, Assessing antidepressant activity in rodents: recent developments and future needs, Trends Pharmacol. Sci. 23 (2002) 238–245 http:// www.ncbi.nlm.nih.gov/pubmed/12008002 , Accessed date: 28 March 2018. R.D. Porsolt, A. Bertin, M. Jalfre, Behavioral despair in mice: a primary screening test for antidepressants, Arch. Int. Pharmacodyn. Ther. 229 (1977) 327–336 http:// www.ncbi.nlm.nih.gov/pubmed/596982 , Accessed date: 28 March 2018. R. Teruya, D.J. Fagundes, C.T.F. Oshima, J.L. Brasileiro, G. Marks, C.M. Ynouye, M. J. Simões, The effects of pentoxifylline into the kidneys of rats in a model of unilateral hindlimb ischemia/reperfusion injury., Acta Cir. Bras. 23 (n.d.) 29–35. http://www.ncbi.nlm.nih.gov/pubmed/18278390 (accessed May 6, 2019). D.A. Levison, Book Reviews :Theory and practice of histological techniques, 4th edition, 183 Johnd. Bancroft and Alan Stevens, Churchill Livingstone, Edinburgh, 1996, pp. 243–244, https://doi.org/10.1002/(SICI)1096-9896(199710) 183:2<243::AID-PATH770>3.0.CO;2-F No. of pages: 766 Price £79.50, J. Pathol.. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(−Delta Delta C(T)) method, Methods. 25 (2001) 402–408, https://doi.org/10.1006/meth.2001.1262. O.V. Bogdanova, S. Kanekar, K.E. D'Anci, P.F. Renshaw, Factors influencing behavior in the forced swim test, Physiol. Behav. 118 (2013) 227–239, https://doi.org/ 10.1016/j.physbeh.2013.05.012. H. Famitafreshi, M. Karimian, S. Fatima, Synergistic effects of social isolation and morphine addiction on reduced neurogenesis and BDNF levels and the resultant deficits in cognition and emotional state in male rats, Curr. Mol. Pharmacol. 9 (2016) 337–347 http://www.ncbi.nlm.nih.gov/pubmed/27550421 , Accessed date: 30 March 2018. J.N.-M. Chan, J.C.-D. Lee, S.S.P. Lee, K.K.Y. Hui, A.H.L. Chan, T.K.-H. Fung, D.I. Sánchez-Vidaña, B.W.-M. Lau, S.P.-C. Ngai, Interaction effect of social isolation and high dose corticosteroid on neurogenesis and emotional behavior, Front. Behav. Neurosci. 11 (2017) 18, https://doi.org/10.3389/fnbeh.2017.00018. O.J. Olajide, E.O. Yawson, I.T. Gbadamosi, T.T. Arogundade, E. Lambe, K. Obasi, I.T. Lawal, A. Ibrahim, K.Y. Ogunrinola, Ascorbic acid ameliorates behavioural deficits and neuropathological alterations in rat model of Alzheimer's disease, Environ. Toxicol. Pharmacol. 50 (2017) 200–211, https://doi.org/10.1016/j.etap. 2017.02.010. V.H. Finder, I. Vodopivec, R.M. Nitsch, R. Glockshuber, The recombinant amyloidbeta peptide Abeta1-42 aggregates faster and is more neurotoxic than synthetic Abeta1-42, J. Mol. Biol. 396 (2010) 9–18, https://doi.org/10.1016/j.jmb.2009.12. 016. J. Dubey, N. Ratnakaran, S.P. Koushika, Neurodegeneration and microtubule dynamics: death by a thousand cuts, Front. Cell. Neurosci. 9 (2015) 343, https://doi. org/10.3389/fncel.2015.00343. J. Näslund, Correlation between elevated levels of amyloid β-peptide in the brain and cognitive decline, JAMA. 283 (2000) 1571, https://doi.org/10.1001/jama.283. 12.1571. P. Agostinho, R.A. Cunha, C. Oliveira, Neuroinflammation, oxidative stress and the pathogenesis of Alzheimer's disease, Curr. Pharm. Des. 16 (2010) 2766–2778 http://www.ncbi.nlm.nih.gov/pubmed/20698820 , Accessed date: 31 March 2018. I. Guidi, D. Galimberti, S. Lonati, C. Novembrino, F. Bamonti, M. Tiriticco, C. Fenoglio, E. Venturelli, P. Baron, N. Bresolin, E. Scarpini, Oxidative imbalance in patients with mild cognitive impairment and Alzheimer's disease, Neurobiol. Aging 27 (2006) 262–269, https://doi.org/10.1016/j.neurobiolaging.2005.01.001. S. Schiavone, G.M. Camerino, E. Mhillaj, M. Zotti, M. Colaianna, A. De Giorgi, A. Trotta, F.P. Cantatore, E. Conte, M. Bove, P. Tucci, M.G. Morgese, L. Trabace, Visceral fat dysfunctions in the rat social isolation model of psychosis, Front. Pharmacol. 8 (2017) 787, https://doi.org/10.3389/fphar.2017.00787. S. Melov, P.A. Adlard, K. Morten, F. Johnson, T.R. Golden, D. Hinerfeld, B. Schilling, C. Mavros, C.L. Masters, I. Volitakis, Q.-X. Li, K. Laughton, A. Hubbard, R.A. Cherny, B. Gibson, A.I. Bush, Mitochondrial oxidative stress causes hyperphosphorylation of tau, PLoS One 2 (2007) e536, , https://doi.org/10.1371/ journal.pone.0000536. R. Deshmukh, V. Sharma, S. Mehan, N. Sharma, K.L. Bedi, Amelioration of intracerebroventricular streptozotocin induced cognitive dysfunction and oxidative stress by vinpocetine — a PDE1 inhibitor, Eur. J. Pharmacol. 620 (2009) 49–56, https://doi.org/10.1016/j.ejphar.2009.08.027. S. Gupta, P. Singh, B. Sharma, B. Sharma, Neuroprotective effects of Agomelatine and Vinpocetine against chronic cerebral Hypoperfusion induced vascular dementia, Curr. Neurovasc. Res. 12 (2015) 240–252, https://doi.org/10.2174/ 1567202612666150603130235. M. Zhu, X. Wang, M. Schultzberg, E. Hjorth, Differential regulation of resolution in
[63]
[64]
[65]
[66]
[67]
[68]
[69]
[70]
[71]
[72]
[73]
[74]
[75]
[76]
[77]
[78]
[79]
[80]
[81]
[82]
[83]
9
inflammation induced by amyloid-β42 and lipopolysaccharides in human microglia, J. Alzheimers Dis. 43 (2015) 1237–1250, https://doi.org/10.3233/JAD141233. G.L. Hermes, L. Rosenthal, A. Montag, M.K. McClintock, Social isolation and the inflammatory response: sex differences in the enduring effects of a prior stressor, Am. J. Physiol. Integr. Comp. Physiol. 290 (2006) R273–R282, https://doi.org/10. 1152/ajpregu.00368.2005. M. Cao, T. Pu, L. Wang, C. Marshall, H. He, G. Hu, M. Xiao, Early enriched physical environment reverses impairments of the hippocampus, but not medial prefrontal cortex, of socially-isolated mice, Brain Behav. Immun. 64 (2017) 232–243, https:// doi.org/10.1016/j.bbi.2017.04.009. K.W. Ruiz-Miyazawa, F.A. Pinho-Ribeiro, A.C. Zarpelon, L. Staurengo-Ferrari, R.L. Silva, J.C. Alves-Filho, T.M. Cunha, F.Q. Cunha, R. Casagrande, W.A. Verri, Vinpocetine reduces lipopolysaccharide-induced inflammatory pain and neutrophil recruitment in mice by targeting oxidative stress, cytokines and NF-κB, Chem. Biol. Interact. 237 (2015) 9–17, https://doi.org/10.1016/j.cbi.2015.05.007. K.W. Ruiz-Miyazawa, A.C. Zarpelon, F.A. Pinho-Ribeiro, G.F. Pavão-de-Souza, R. Casagrande, W.A. Verri, Vinpocetine reduces carrageenan-induced inflammatory hyperalgesia in mice by inhibiting oxidative stress, cytokine production and NF-κB activation in the paw and spinal cord, PLoS One 10 (2015) e0118942, , https://doi. org/10.1371/journal.pone.0118942. A. Martinez, C. Gil, D.I. Perez, Glycogen synthase kinase 3 inhibitors in the next horizon for Alzheimer's disease treatment, Int. J. Alzheimers Dis. 2011 (2011) 280502, https://doi.org/10.4061/2011/280502. M. Hong, D.C. Chen, P.S. Klein, V.M. Lee, Lithium reduces tau phosphorylation by inhibition of glycogen synthase kinase-3, J. Biol. Chem. 272 (1997) 25326–25332 http://www.ncbi.nlm.nih.gov/pubmed/9312151 , Accessed date: 2 April 2018. X.L. Shi, J. De Wu, P. Liu, Z.P. Liu, Synthesis and evaluation of novel GSK-3β inhibitors as multifunctional agents against Alzheimer's disease, Eur. J. Med. Chem. 167 (2019) 211–225, https://doi.org/10.1016/j.ejmech.2019.02.001. A.A. Asuni, C. Hooper, C.H. Reynolds, S. Lovestone, B.H. Anderton, R. Killick, GSK3alpha exhibits beta-catenin and tau directed kinase activities that are modulated by Wnt, Eur. J. Neurosci. 24 (2006) 3387–3392, https://doi.org/10.1111/j. 1460-9568.2006.05243.x. W. Qian, J. Shi, X. Yin, K. Iqbal, I. Grundke-Iqbal, C.-X. Gong, F. Liu, PP2A regulates tau phosphorylation directly and also indirectly via activating GSK-3beta, J. Alzheimers Dis. 19 (2010) 1221–1229, https://doi.org/10.3233/JAD-2010-1317. M. Llorens-Maratin, J. Jurado, F. Hernandez, J.A. Vila, GSK-3I2, a pivotal kinase in Alzheimer disease, Front. Mol. Neurosci. 7 (2014) 46, https://doi.org/10.3389/ fnmol.2014.00046. C.J. Phiel, C.A. Wilson, V.M.-Y. Lee, P.S. Klein, GSK-3α regulates production of Alzheimer's disease amyloid-β peptides, Nature. 423 (2003) 435–439, https://doi. org/10.1038/nature01640. E. Rockenstein, M. Torrance, A. Adame, M. Mante, P. Bar-on, J.B. Rose, L. Crews, E. Masliah, Neuroprotective effects of regulators of the glycogen synthase Kinase-3 signaling pathway in a transgenic model of Alzheimer's disease are associated with reduced amyloid precursor protein phosphorylation, J. Neurosci. 27 (2007) 1981–1991, https://doi.org/10.1523/JNEUROSCI.4321-06.2007. S.-H. Koh, M.Y. Noh, S.H. Kim, Amyloid-beta-induced neurotoxicity is reduced by inhibition of glycogen synthase kinase-3, Brain Res. 1188 (2008) 254–262, https:// doi.org/10.1016/j.brainres.2007.10.064. P.T.T. Ly, Y. Wu, H. Zou, R. Wang, W. Zhou, A. Kinoshita, M. Zhang, Y. Yang, F. Cai, J. Woodgett, W. Song, Inhibition of GSK3β-mediated BACE1 expression reduces Alzheimer-associated phenotypes, J. Clin. Invest. 123 (2013) 224–235, https://doi. org/10.1172/JCI64516. P.H. Reddy, Amyloid beta-induced glycogen synthase kinase 3β phosphorylated VDAC1 in Alzheimer's disease: implications for synaptic dysfunction and neuronal damage, Biochim. Biophys. Acta - Mol. Basis Dis. 1832 (2013) 1913–1921, https:// doi.org/10.1016/J.BBADIS.2013.06.012. G. Koelsch, BACE1 function and inhibition: implications of intervention in the amyloid pathway of Alzheimer's disease pathology, Molecules 22 (2017), https:// doi.org/10.3390/molecules22101723. L.R. Wang, S.-S. Baek, Treadmill exercise activates PI3K/Akt signaling pathway leading to GSK-3β inhibition in the social isolated rat pups, J. Exerc. Rehabil. 14 (2018) 4–9, https://doi.org/10.12965/jer.1836054.027. Q.-G. Ren, W.-G. Gong, Y.-J. Wang, Q.-D. Zhou, Z.-J. Zhang, Citalopram attenuates tau hyperphosphorylation and spatial memory deficit induced by social isolation rearing in middle-aged rats, J. Mol. Neurosci. 56 (2015) 145–153, https://doi.org/ 10.1007/s12031-014-0475-4. R. Perez-Gonzalez, C. Pascual, D. Antequera, M. Bolos, M. Redondo, D.I. Perez, V. Pérez-Grijalba, A. Krzyzanowska, M. Sarasa, C. Gil, I. Ferrer, A. Martinez, E. Carro, Phosphodiesterase 7 inhibitor reduced cognitive impairment and pathological hallmarks in a mouse model of Alzheimer's disease, Neurobiol. Aging 34 (2013) 2133–2145, https://doi.org/10.1016/J.NEUROBIOLAGING.2013.03.011. M. Cuadrado-Tejedor, I. Hervias, A. Ricobaraza, E. Puerta, J. Pérez-Roldán, C. García-Barroso, R. Franco, N. Aguirre, A. García-Osta, Sildenafil restores cognitive function without affecting β-amyloid burden in a mouse model of Alzheimer's disease, Br. J. Pharmacol. 164 (2011) 2029–2041, https://doi.org/10.1111/j.14765381.2011.01517.x. P.C. Swart, C.B. Currin, V.A. Russell, J.J. Dimatelis, Early ethanol exposure and vinpocetine treatment alter learning- and memory-related proteins in the rat hippocampus and prefrontal cortex, J. Neurosci. Res. 95 (2017) 1204–1215, https:// doi.org/10.1002/jnr.23894.