Virulence genes of Shiga toxin-producing Escherichia coli isolated from food, animals and humans

International Journal of Food Microbiology 45 (1998) 229–235

Short Communication

Virulence genes of Shiga toxin-producing Escherichia coli isolated from food, animals and humans a, 1 ,a b Jianghong Meng *, Shaohua Zhao , Michael P. Doyle

b

a Department of Nutrition and Food Science, University of Maryland, College Park, MD 20742, USA The Center for Food Safety and Quality Enhancement and Department of Food Science and Technology, University of Georgia, Griffin, GA 30223, USA

Received 22 January 1998; received in revised form 3 September 1998; accepted 25 September 1998

Abstract The presence of virulence genes, encoding enterohemorrhagic Escherichia coli (EHEC)-hemolysin (EHEC-hlyA), intimin (eae), and Shiga toxins 1 (stx1) and 2 (stx2), in 178 isolates of pathogenic E. coli, was determined using the polymerase chain reaction with primers specific for each virulence gene. The tested organisms were 120 isolates of E. coli O157:H7 from human patients, cattle, sheep and foods, 16 non-O157:H7 EHEC isolates from patients suffering from hemorrhagic colitis or hemolytic uremic syndrome, 15 non-O157:H7 Shiga toxin-producing E. coli (STEC) isolates from cattle and foods, 26 isolates of enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC) and enterotoxigenic E. coli (ETEC), and an E. coli K12 strain. Results revealed that all isolates of O157:H7 carried EHEC-hlyA, eae, and one or both stx genes; 15 of the 16 non-O157:H7 EHEC isolates had EHEC-hlyA, but all possessed eae and one or both stx genes; only seven of the 15 non-O157 STEC isolated from cattle and foods contained both EHEC-hlyA and eae genes. The EPEC, EIEC, ETEC, and the E. coli K12 strain did not carry these virulence genes, except eight EPEC isolates were positive for eae. Results suggest that a combination of EHEC-hlyA and eae genes could serve as markers to differentiate EHEC from less pathogenic STEC, and other pathogenic or non-pathogenic E. coli.  1998 Elsevier Science B.V. All rights reserved. Keywords: Escherichia coli; Shiga toxin; Virulence genes

1. Introduction Shiga-toxin producing Escherichia coli (STEC) were first recognized as human pathogens in 1982 *Corresponding author. Tel.: 1 1-301-405-1399; fax: 1 1-301314-9327; e-mail: [email protected] 1 Present address: Division of Animal Research, Office of Research, Center for Veterinary Medicine, Food and Drug Administration, Laural, MD 20708, USA. 0168-1605 / 98 / $ – see front matter PII: S0168-1605( 98 )00163-9

when E. coli O157:H7 caused two outbreaks of hemorrhagic colitis associated with consumption of undercooked ground beef (Doyle and Padhye, 1989; Griffin, 1995; Doyle et al., 1997). Since then, more than 100 serotypes of STEC have been isolated from animals, food and other sources. Most outbreaks of STEC in North America and Europe have been associated with serotype O157:H7 (Griffin, 1995; Thomas et al., 1996), but several were caused by

 1998 Elsevier Science B.V. All rights reserved.

230

J. Meng et al. / International Journal of Food Microbiology 45 (1998) 229 – 235

STEC of other serotypes. Outbreaks caused by O111:NM and O26 have been reported in Italy (Caprioli et al., 1994). E. coli O103:H2 was isolated from patients suffering from hemolytic uremic syndrome (HUS) in France (Mariani-Kurkdjian et al., 1993). In Japan, STEC serotypes O?:H19, O111:NM, O145:NM and O118:H2 were the cause of several outbreaks (Takeda, 1997). Studies in Australia have revealed that serotype O157:H7 was uncommon but other less well recognized serotypes such as O111:NM, O46:H31, O98:NM and O48:H21 were responsible for hemorrhagic colitis and HUS (Goldwater and Bettelheim, 1994). More than 50 serotypes of STEC have been classified as enterohemorrhagic E. coli (EHEC) which was originally defined as those serotypes that cause a clinical illness similar to that caused by E. coli O157:H7, produce one or more phage-encoded Shiga toxins (Stx), possess a 60 megadalton virulence plasmid, and produce attaching–effacing lesions in an animal model (Griffin, 1995). However, no single marker has yet been identified that reliably differentiates EHEC from the broader group of STEC. Although the precise mechanism of pathogenicity of EHEC has not been fully elucidated, Shiga toxins and adherence factors have been identified as significant virulence factors (Barrett et al., 1992; Griffin, 1995; Doyle et al., 1997). Intimin encoded by the eae gene is an important adherence factor which is responsible for the attaching and effacing lesion caused by EHEC and enteropathogenic E. coli (EPEC) in the intestine (Donnenberg et al., 1993). It is hypothesized that some STEC possess unidentified virulence factors that determine their pathogenicity for humans. A large plasmid of approximately 90 kilobase (kb) (pO157) is present in virtually all clinical EHEC O157:H7 isolates (Levine et al., 1987) and several studies have been carried out to determine the function of pO157. Whereas some of the studies revealed that the plasmid was involved in adherence to epithelial cells in culture (Karch et al., 1987; Tzipori et al., 1987), others could not confirm these observations (Junkins and Doyle, 1989; Toth et al., 1990). A hemolytic determinant, EHEC hemolysin (EHEC HlyA), was recently cloned from pO157, and DNA sequence analysis revealed its similarity to E. coli a-hemolysin (HlyA) and that the EHEC HlyA shared some common epitopes with HlyA (Schmidt et al., 1995). A role in virulence of

EHEC HlyA or any products of the common plasmid pO157 in EHEC strains has yet to be established. However, the association of RTX (repeats in toxin) toxins with pathogens, the establishment of HlyA as a virulence factor in uropathogenic E. coli, and the specific immune response of sera from patients with HUS infected with E. coli O157:H7 to EHEC HlyA suggest that EHEC HlyA may play an important role in the pathogenesis of EHEC infection. It has been suggested that EHEC HlyA acts synergistically with Shiga toxins to disrupt important cell functions (Schmidt et al., 1995). The objective of the present study was to examine the presence of identified virulence genes (EHEChlyA, eae, stx1 and stx2) in EHEC and STEC using polymerase chain reaction (PCR) assays and determine the association of specific virulence genes with EHEC strains. Such genes may be useful markers to differentiate EHEC from other STEC found in foods and animals that are not human pathogens.

2. Materials and methods

2.1. Bacterial strains and growth conditions One hundred and seventy-eight isolates of E. coli were tested. These included 120 isolates of E. coli O157:H7 from foods, animals and humans, 16 isolates of non-O157 EHEC from human patients suffering from hemorrhagic colitis and / or HUS, 15 isolates of non-O157:H7 STEC from foods and animals, 26 additional E. coli, comprising 15 EPEC, five enterotoxigenic E. coli (ETEC), two enteroinvasive E. coli (EIEC), and four unclassified pathogenic strains, and a laboratory strain, E. coli K12 (Table 1). Bacterial strains were stored in a brain heart infusion broth–glycerol mixture (3:1; v / v) at 2 808C until use. They were grown in Lennex Broth overnight at 378C, and boiled for 10 min at 958C for PCR assay.

2.2. Primer design and synthesis Primers for amplifying EHEC-hlyA, eae, stx1, and stx2 genes were designed based on the DNA sequence data obtained from GeneBank with the aid of two computer programs, PCR Designer (Research

J. Meng et al. / International Journal of Food Microbiology 45 (1998) 229 – 235

231

Table 1 Groups, serotypes and sources of E. coli strains used in the study Group

Serotype

No.of isolates

Sources

E. coli O157:H7

O157:H7 O157:H7 O157:H7 O157:H7 O-:H11 OR:H9 O5:NM O26:NM O26:H11 O45:H2 O50:H7 O68:NM O103:H2 O104:NM O111:NM O113:K75:H21 O125:NM O153:H2 O157:NM U:NM O5:NM O22:H8 O26:H11 O46:H38 O88:H49 O91:NM O91:H21 O103:H2 O111:H8 O111:H11 O111:NM O126:H8 O18:K1:H7 O18a,18c:K77(B21):H6 O55:H7 O55:H7 O55:NM O126:H8 O142:K86(B):H6 O?:H? O6:H16 O9:K103 O78:H11 O28ac:NM O124:HO2:K1:H7 O157:H? O157:H25 O157:H19

26 31 56 7 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 2 1 2 1 1 1 1 5 1 5 1 1 1 1 1 2 1 1 1 1 1 1 1

Human Foods Cattle Sheep Human Human Human Human Human Human Human Human Human Human Human Human Human Human Human Sheep Sheep Food Cattle Food Food Sheep Cow Calf Calf Calf Calf Calf Human Human Unknown Human Unknown Human Human Unknown Human Human Human Human Human Unknown Unknown Unknown Swine

Non-O157:H7 EHEC

Non-O157 STEC

Enteropathogenic E. coli

Enterotoxigenic E. coli

Enteroinvasive E. coli Unclassified E. coli

Nonpathogenic E. coli K12

232

J. Meng et al. / International Journal of Food Microbiology 45 (1998) 229 – 235

Genetics, Huntsville, AL, USA) and OLIGO Primer Analysis Software (National Biosciences, Plymouth, MN, USA). The primer sequences and characteristics are shown in Table 2. Primers for the eae gene were selected from the conserved region of the DNA sequence alignment of the eae genes of EHEC and EPEC, with the aid of programs in the GCG (Genetic Computer Group, Madison, WI, USA) package (Zhao et al., 1995). All primers were synthesized by Life Technologies (Gaithersburg, MD, USA).

2.3. PCR assay PCR assays were performed as described previously (Meng et al., 1997). A PCR Core Reagents kit (Perkin–Elmer, Norwalk, CT, USA) was used. Two multiplex PCR assays were performed for each isolate, one detecting EHEC-hlyA and eae genes and the other detecting stx1 and stx2 genes. Each reaction mixture consisted of 1 3 reaction buffer, 1.5 mM MgCl 2 , 200 mM each of dATP, dCTP, dGTP, and dTTP, 10 pmole of each primer, 0.2 unit of AmpliTaq polymerase, and 10 ml of boiled broth culture of an E. coli strain. Distilled water was added to bring the final volume to 50 ml. The reaction was carried out through 30 cycles in a thermal cycler (GeneAmp PCR System 9600, Perkin–Elmer). The cycle consisted of denaturation at 948C for 1 min, primer annealing at 608C for 1 min and primer extension at 728C for 1 min. For each E. coli strain, amplicons from the two multiplex PCR assays were pooled, and visualized under UV light after standard submarine gel electrophoresis in a 1.5% agarose gel stained with ethidium bromide. A 1 kb ladder (Life Technologies) was used as molecular weight marker.

3. Results and discussion All of the 120 E. coli O157:H7 isolates contained EHEC-hlyA and eae genes. Most of these isolates (81.6%) also carried both stx1 and stx2 genes, compared to 16.7% isolates carrying stx2 only and 1.7% carrying stx1 only (Table 3). Fifteen of the 16 non-O157:H7 EHEC strains (15 serotypes) from human patients possessed EHEC-hlyA, eae and one or both stx genes, and the other possessed eae and stx2. Interestingly, profiles of the virulence genes were more diverse among the non-O157 STEC isolated from cattle and foods. For the 15 non-O157 STEC isolates, less than half (7) contained EHEChlyA, eae and stx1, and EHEC-hlyA and eae were not always present in the other eight STEC isolates (Table 3). The prevalence of stx1 only was higher in non-O157 STEC compared with O157:H7 (Table 3). This is consistent with reports by others who determined that a high percentage of bovine STEC from diseased animals produced Stx1 as the only Stx (Sandhu et al., 1996). Our results also revealed that there was a strong association between EHEC-hlyA and eae genes among E. coli O157:H7 and other EHEC strains, but not among the non-O157 STEC from cattle and foods (Table 3). Other studies involving more STEC isolates revealed a similar trend (Beutin et al., 1995; Blanco et al., 1996). Eight of the EPEC isolates were positive for eae, which was not surprising because the EPEC eae gene has a high homology with the EHEC eae gene (Table 3). The remaining 18 isolates of EPEC, ETEC, and EIEC, and the E. coli K12 strain did not contain these virulence genes. Overall, regardless of the source, all isolates of serotype O157:H7 possessed

Table 2 Primers used for PCR amplification of virulence genes of E. coli Virulence gene

Primers

Sequence (59–39)

Td (8C)a

Size of PCR product (bp)

stx1

VT1-f VT1-r VT2-f VT2-r2 943U 1356L hlyA-f hlyA-r

TGTAACTGGAAAGGTGGAGTATACA GCTATTCTGAGTCAACGAAAAATAAC GTTTTTCTTCGGTATCCTATTCC GATGCATCTCTGGTCATTGTATTAC GTGGCGAATACTGGCGAGACTA GATCGTAACGGCTGCCTGATATAA AGCCGGAACAGTTCTCTCAG CCAGCATAACAGCCGATGT

64 65 63 64 67 67 64 54

210

stx2 eae hly a

Td, dimer dissociation temperature.

484 435 526

J. Meng et al. / International Journal of Food Microbiology 45 (1998) 229 – 235

233

Table 3 Presence of EHEC-hlyA, eae, stx1 and stx2 genes in EHEC, other STEC and other E. coli Group

No. of isolates

E. coli O157:H7

120 98 20 2 16 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 15 1 1 1 1 1 1 1 1 2 1 2 1 1 26 8 18 1 178

Non-O157 EHEC

Non-O157 STEC

Other pathogenic E. coli

E. coli K12 Total a

Serotype a

EHEC-hlyA

eae

stx1

stx2

1 1 1

1 1 1

1 2 1

1 1 2

O-:H11 OR:H9 O5:NM O26:NM O26:H11 O45:H2 O50:H7 O68:NM O103:H2 O104:NM O111:NM O113:K75:H21 O125:NM O153:H2 O157:NM

1 1 1 1 1 1 1 2 1 1 1 1 1 1 1

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

1 1 1 1 1 1 2 2 1 2 1 2 1 1 2

1 2 2 1 2 2 1 1 1 1 2 1 2 1 1

U:NM O5:NM O22:H8 O26:H11 O46:H38 O88:H49 O91:NM O91:H21 O103:H2 O111:H8 O111:H11 O111:NM O126:H8

1 1 1 1 1 1 2 1 1 1 1 2 2

1 2 2 1 2 2 2 2 1 1 1 1 1

1 1 2 1 1 2 1 1 1 1 1 1 1

2 1 1 2 1 1 2 1 2 2 2 1 1

2 2 2

1 2 2

2 2 2

2 2 2

These data are given only for non-O157 EHEC and non-O157 STEC.

the three important virulence factors (EHEC HlyA, intimin and Shiga toxin), and so did most of the non-O157 EHEC isolated from patients. Several studies have been done to determine virulence genes associated with STEC isolated from animals and foods, but few have involved non-O157 EHEC. STEC isolates from animals have been found to be very heterogeneous (Beutin et al., 1993, 1995; Blanco et al., 1996). Studies on STEC isolated from healthy domestic animals of six species revealed that

only three (1.4%) of the 208 STEC isolates were positive for the eae gene and 130 (63%) of 208 isolates hybridized with the EHEC plasmid probe that carries the EHEC-hlyA gene (Beutin et al., 1995). A higher percentage (8%) of eae-positive bovine STEC was reported by Blanco et al. (1996) in Spain. Sandhu et al. (1997) reported that 98% of 101 eae-positive STEC isolated from cattle were also positive for EHEC-hlyA and were hemolytic on washed sheep red blood cell agar, whereas only 36%

234

J. Meng et al. / International Journal of Food Microbiology 45 (1998) 229 – 235

of eae-negative isolates were EHEC-hlyA positive. There was also a clear association of the eae gene with certain serotypes, including O5:NM, O26:H11, O103:H2, O111:NM and O157:H7, which have all been associated with disease in calves or humans (Sandhu et al., 1996). Non-O157 STEC have been frequently detected in foods. A recent study of 67 STEC isolated from raw meats (Pierard et al., 1997) revealed that serotype O157:H7 was not found among the isolates and that eae and EHEC-hlyA were present in two and 20 meat isolates, respectively. The lack of additional virulence factors in most STEC isolates from meats suggested that these isolates were probably less pathogenic or non-pathogenic to humans. However, a recent report revealed that a new STEC serotype, OX3:H21, could cause HUS and this particular strain was eae-negative (Keskimaki et al., 1997). STEC O113:H21 and O104:H2 that were involved in two different disease outbreaks also lacked the eae gene (Strockbine, 1998). Vila et al. (1997) reported that some STEC strains that did not carry eae and EHEChlyA caused long-duration watery diarrhea and that such STEC may be a cause of traveler’s diarrhea. E. coli O157:H7 has also been isolated from healthy individuals on dairy farms, suggesting that continuing or recurrent exposure to STEC in the farm environment may offer protection against subsequent exposure to E. coli O157:H7 or other virulent STEC serotypes (Wilson et al., 1996). Therefore, in addition to differences in the virulence of etiologic agents, individual host differences and preexposure to STEC are also important in determining the outcome of STEC infection. Shiga toxins and intimin have been studied extensively and are well-established virulence factors. Although more studies are needed to understand what role EHEC HlyA may play in the pathogenicity of EHEC infection, the present study and other studies have determined that EHEC HlyA present in all E. coli O157:H7, most of non-O157 EHEC strains and most eae-positive STEC isolates from animals, suggesting that it may serve as a virulence marker as well as a virulence factor. Perhaps, Shiga toxins, intimin and EHEC HlyA act synergistically to cause disease during EHEC infection. Combinations of eae and EHEC-hlyA may be useful to differentiating virulent STEC from harmless or less pathogenic STEC.

Acknowledgements This study was supported in part by Maryland Agricultural Experimental Station. The authors thank Drs. Robert Hall, Carolyn Hovde and Helge Karch for providing some of the STEC strains.

References Barrett, T.J., Kaper, J.B., Jerse, A.E., Wachsmuth, I.K., 1992. Virulence factors in Shiga-like toxin-producing Escherichia coli isolated from humans and cattle. J. Infect. Dis. 165, 979–980. Beutin, L., Geier, D., Steinruck, H., Zimmermann, S., Scheutz, F., 1993. Prevalence and some properties of verotoxin (Shiga-like toxin)-producing Escherichia coli in seven different species of healthy domestic animals. J. Clin. Microbiol. 31, 2483–2488. Beutin, L., Geier, D., Zimmermann, S., Karch, H., 1995. Virulence markers of Shiga-like toxin-producing Escherichia coli strains originating from healthy domestic animals of different species. J. Clin. Microbiol. 33, 631–635. Blanco, M., Blanco, J.E., Blanco, J., Gonzalez, E.A., Mora, A., Prado, C., Fernandez, L., Rio, M., Ramos, J., Alonso, M.P., 1996. Prevalence and characteristics of Escherichia coli serotype O157:H7 and other verotoxin-producing E. coli in healthy cattle. Epidemiol. Infect. 117, 251–257. Caprioli, A., Luzzi, I., Minelli, F., Benedetti, I., Tozzi, A.E., Niccolini, A., Gianviti, A., Prinicipato, F., Rizzoni, G., 1994. Hemolytic uremic syndrome and verotoxin-producing Escherichia coli infection in Italy, 1988–1993. In: Karmali, M., Goglio, A. (Eds.), Recent Advances in Verocytotoxin-Producing Escherichia coli Infections, Elsevier, Amsterdam, pp. 29–32. Donnenberg, M.S., Tzipori, S., McKee, M.L., O’Brien, A.D., Alroy, J., Kaper, J.B., 1993. The role of the eae gene of enterohemorrhagic Escherichia coli in intimate attachment in vitro and in a porcine model. J. Clin. Invest. 92, 1418–1424. Doyle, M.P., Padhye, V.V., 1989. Escherichia coli. In: Doyle, M.P. (Ed.), Foodborne Bacterial Pathogens, Marcel Dekker, New York, pp. 236–282. Doyle, M.P., Zhao, T., Meng, J., Zhao, S., 1997. Escherichia coli O157:H7. In: Doyle, M.P., Beuchat, L., Montville, T. (Eds.), Food Microbiology—Fundamentals and Frontiers, ASM Press, Washington, DC, pp. 171–191. Goldwater, P.N., Bettelheim, O., 1994. The role of enterohaemorrhagic E. coli serotypes other than O157:H7 as causes of disease. In: Karmali, M., Goglio, A. (Eds.), Recent Advances in Verocytotoxin-Producing Escherichia coli Infections, Elsevier, Amsterdam, pp. 57–60. Griffin, P.M., 1995. Escherichia coli O157:H7 and other enterohemorrhagic Escherichia coli. In: Blaser, M.J., Smith, P.D., Ravdin, J.I., Greenberg, H.B., Guerrant, R.L. (Eds.), Infections of Gastrointestinal Tract, Raven Press, New York, pp. 739–761. Junkins, A.D., Doyle, M.P., 1989. Comparison of adherence

J. Meng et al. / International Journal of Food Microbiology 45 (1998) 229 – 235 properties of Escherichia coli O157:H7 and a 60-megadalton plasmid-cured derivative. Curr. Microbiol. 19, 21–27. Karch, H., Heesemann, J., Laufs, R., O’Brien, A.D., Tacket, C.O., Levine, M.M., 1987. A plasmid of enterohemorrhagic Escherichia coli O157:H7 is required for expression of a new fimbrial antigen and for adhesion to epithelial cells. Infect. Immunol. 55, 455–461. Keskimaki, M., Ikaheimo, R., Karkkainen, P., Scheutz, F., Ratiner, Y., Puohiniemi, R., Siltonen, A., 1997. Shiga toxin-producing Escherichia coli serotype OX3:H21 as a cause of hemolytic– uremic syndrome. Clin. Infect. Dis. 24, 1278–1279. Levine, M.M., Xu, J.G., Kaper, J.B., Lior, H., Prado, V., Tall, B., Nataro, J., Karch, H., Wachsmuth, K., 1987. A DNA probe to identify enterohemorrhagic Escherichia coli of O157:H7 and other serotypes that cause hemorrhagic colitis and hemolytic uremic syndrome. J. Infect. Dis. 156, 175–182. Mariani-Kurkdjian, P., Denamur, E., Milon, A., Picard, B., Cave, H., 1993. Identification of a clone of Escherichia coli O103:H2 as a potential agent of hemolytic uremic syndrome in France. J. Clin. Microbiol. 31, 296–301. Meng, J., Zhao, S., Doyle, M.P., Mitchell, S.E., Kresovich, S., 1997. A multiplex PCR for identifying Shiga-like toxinproducing Escherichia coli O157:H7. Lett. Appl. Microbiol. 24, 172–176. Pierard, D., Van Damme, L., Moriau, L., Stevens, D., Lauwers, S., 1997. Virulence factors of verocytotoxin-producing Escherichia coli isolated from raw meats. Appl. Environ. Microbiol. 63, 4585–4587. Sandhu, K.S., Clark, R.C., Gyles, C.L., 1997. Hemolysin phenotypes and genotypes of eaeA-positive and eaeA-negative bovine verotoxigenic Escherichia coli. Adv. Exp. Med. Biol. 412, 295–302. Sandhu, K.S., Clark, R.C., McFadden, K., Brouwer, A., Louie, M., Wilson, J., Lior, H., Gyles, C.L., 1996. Prevalence of the eaeA gene in verotoxigenic Escherichia coli strains from dairy cattle in Southwest Ontario. Epidemiol. Infect. 116, 1–7.

235

Schmidt, H., Beutin, L., Karch, H., 1995. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect. Immunol. 63, 1055–1061. Strockbine, N., 1998. Personal communication. Takeda, Y., 1997. Enterohaemorrhagic Escherichia coli. World Health Stat. Q. 50, 74–80. Thomas, A., Cheasty, T., Frost, J.A., Chart, H., Smith, H.R., Rowe, B., 1996. Verocytotoxin-producing Escherichia coli, particularly serogroup O157, associated with human infections in England and Wales: 1992–4. Epidemiol. Infect. 117, 1–10. Toth, I., Cohen, M.L., Rumschlag, H.S., Riley, L.W., White, E.H., Carr, J.H., Bond, W.W., Wachsmuth, I.K., 1990. Influence of the 60-megadalton plasmid on adherence of Escherichia coli O157:H7 and genetic derivatives. Infect. Immunol. 58, 1223– 1231. Tzipori, S.R., Karch, H., Wachsmuth, I.K., Robins-Browne, R.M., O’Brien, A.D., Lior, H., Cohen, M.L., Smithers, J., Levine, M.M., 1987. Role of a 60-megadalton plasmid and Shiga-like toxins in the pathogenesis of infection caused by enterohemorrhagic Escherichia coli O157:H7 in gnotobiotic piglets. Infect. Immunol. 55, 3117–3125. Vila, J., Vargas, M., Ruiz, J., Gallardo, F.L., Jimenez de Anta, M.T., Gascon, J., 1997. Isolation of verotoxin-producing Escherichia coli O-rough:K1:H7 from two patients with traveler’s diarrhea. J. Clin. Microbiol. 35, 2279–2282. Wilson, J.B., Clarke, R.C., Renwick, S.A., Rahn, K., Johnson, R.P., Karmali, M.A., Lior, H., Alves, D., Gyles, C.L., Sandhu, K.S., McEwen, S.A., Spika, J.S., 1996. Vero cytotoxigenic Escherichia coli infection in dairy farm families. J. Infect. Dis. 174, 1021–1027. Zhao, S., Mitchell, S.E., Meng, J., Doyle, M.P., Kresovich, S., 1995. Cloning and nucleotide sequence of a gene upstream of the eaeA gene of enterohemorrhagic Escherichia coli O157:H7. FEMS Microbiol. Lett. 133, 35–39.