Virulence, sporulation, and elicitin production in three clonal lineages of Phytophthora ramorum

Physiological and Molecular Plant Pathology 74 (2010) 317e322

Contents lists available at ScienceDirect

Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp

Virulence, sporulation, and elicitin production in three clonal lineages of Phytophthora ramorum D.K. Manter a, *, E.H. Kolodny a, E.M. Hansen b, J.L. Parke c a

USDA-ARS, Soil-Plant-Nutrient Research, 2150 Centre Ave., Bldg. D, Suite 100, Fort Collins, CO 80526, USA Botany and Plant Pathology, Oregon State University, Corvallis, USA c Department of Crop and Soil Science, Oregon State University, Corvallis, USA b

a r t i c l e i n f o

a b s t r a c t

Article history: Accepted 27 April 2010

Phytophthora ramorum populations are clonal and consist of three lineages. Recent studies have shown that the clonal lineages may have varying degrees of aggressiveness on some host species, such as Quercus rubra. In this study, we examined virulence, sporulation and elicitin production of five P. ramorum isolates from each of the three clonal lineages. Virulence (lesion size) and sporulation (sporangia production) were determined on wound-inoculated detached leaves of Rhododendron catawbiense ‘Nova Zembla’. Lesion area differed between the clonal lineages (p < 0.001) with the EU1 and NA2 isolates producing significantly greater lesion areas than did NA1 isolates on inoculated leaves (approx. 4.2, 3.6, and 0.8 cm2 respectively). Similarly, lineages EU1 and NA2 produced significantly more sporangia per leaf (p < 0.001) than did lineage NA1 (approx. 800, 1000, and 300 sporangia per leaf respectively). Real-time PCR assays detected expression of the class I elicitins (ram-a1 and ram-a2) in all 15 isolates. Of the two elicitins, only the ram-a2 differed between lineage (p < 0.0001) with nearly 2-fold higher levels of expression in the EU1 and NA2 lineages as compared to the NA1 lineage. Ram-a2 expression showed a positive linear relationship with isolate virulence or lesion size (R2 ¼ 0.707). A significant, positive, linear relationship was also observed between ram-a2 expression and sporulation although it was not as strong (R2 ¼ 0.209). In summary, isolates belonging to clonal lineages EU1 and NA2 are generally more virulent, produce more sporangia, and produce more ram-a2 elicitin in vitro than isolates belonging to lineage NA1. Published by Elsevier Ltd.

Keywords: Sudden oak death Plant disease Rhododendron qPCR ELISA

1. Introduction Sudden Oak Death caused by the plant pathogenic oomycete, Phytophthora ramorum, contributes to significant mortality in various oak species from central coastal California to southern Oregon [1]. Currently, three clonal lineages of P. ramorum have been identified in the United States [2]; the North American lineage (lineage NA1, mating type A2) is responsible for infections in CA and OR forests [3]. The European lineage (lineage EU1, predominantly A1) is responsible for infections in Europe, but has also been found in nurseries in OR and WA [4]. A third lineage (NA2, mating type A2) has only been isolated in a few instances from nurseries in WA and CA [5]. Phenotypic and adaptive differences have been observed between NA1 and EU1 isolates of P. ramorum [6e8]. NA1 isolates were slower growing, and varied more between isolates, than their

* Corresponding author. Tel.: þ1 970 492 7255; fax: þ1 970 492 7213. E-mail address: [email protected] (D.K. Manter). 0885-5765/$ e see front matter Published by Elsevier Ltd. doi:10.1016/j.pmpp.2010.04.008

EU1 counterparts [7]. Within the NA1 isolates, Brasier et al. [7] noted two general colony morphologies, wild type (fast-growing) and non-wild type (typically slow-growing). Interestingly, subcultures from individual NA1 isolates gave rise to both the wild type and non-wild type morphologies, although the factors responsible for this variability are unknown. Virulence of the EU1 and NA1 isolates was also examined by phloem inoculations of mature Quercus rubra stems, a rigorous test of comparative pathogenic ability. In three different experiments, Brasier et al. [7] found that populations of EU1 isolates produced greater lesion areas as compared to populations of NA1 isolates. The lower virulence in the NA1 isolates, as compared to the EU1 isolates, was present for both the wild type and non-wild type NA1 morphologies, although the slow-growing non-wild type cultures were the least virulent. Elicitins are 10 kDa proteins produced by most Phytophthora and Pythium spp. and are thought to aid in sterol uptake from the environment, an absolute requirement for sporulation [9]. Phytophthora spp. can discriminate between sterols and differentially utilize sterols from their growth media, affecting growth and sexual reproduction [10,11]. In addition, Phytophthora elicitin production

318

D.K. Manter et al. / Physiological and Molecular Plant Pathology 74 (2010) 317e322

has been shown to vary by isolate [12] and the host species [13,14]. In this study, we compared two measures of fitness, sporulation and virulence, of P. ramorum isolates from its three clonal lineages on Rhododendron catawbiense ‘Nova Zembla’. Elicitin gene expression was also measured in these same isolates in vitro and examined for possible correlations with virulence and sporulation. 2. Materials and methods

Table 2 TaqMan probe/primer sets used for Phytophthora ramorum elicitin gene expression. Target ram-a1

ram-a2

b-tubulin

2.1. P. ramorum elicitin production Fifteen isolates, including five isolates from each of the three clonal lineages NA1, NA2, and EU1, were included in the experiments (Tables 1 and 2). Although NA1 isolates have been noted to degenerate upon sub-culturing to become morphologically irregular [7], all NA1 isolates used in this study appeared to be ‘wild type’ and had a uniform culture morphology. Three replicate cultures (50 ml) of each of the 15 P. ramorum isolates were grown in V8 broth (100 ml clarified V8 juice, 1.65 g CaCO3, 1200 ml dH2O) for 30 days at 18  C, at which point, mycelia and culture filtrates were separated by vacuum filtration (0.45 mm) and stored at 20  C. Two independent trials were conducted. 2.1.1. Elicitin gene expression Total RNA was extracted from the stored mycelia (50 mg) of the 15 isolates (n ¼ 3) using the RNeasy Total RNA Extraction kit (Qiagen, Germantown, MD, USA) and cDNA synthesized using the RETROscript kit (Applied Biosystems/Ambion, Austin, TX, USA) using the manufacturer’s recommendations. TaqMan chemistry was used to determine gene expression for two elicitin genes: rama1 [GenBank accession no. DQ680026] and ram-a2 [GenBank accession no. DQ680027]. For each sample, a single multiplex reaction was run and analyzed using the BioRad iCycler machine and software (Hercules, CA, USA). All PCR reactions had a final volume of 20 ml and contained 2 ml cDNA template, 10 ml of 2 Sigma Jumpstart Reaction mix (SigmaeAldrich, St. Louis, MO, USA), 2.8 ml 25 mM MgCl2, and 3.2 ml dH2O. All three probe/primer sets (Table 1) were added at 0.8 ml 10 mM forward primer, 0.8 ml 10 mM reverse primer, and 0.4 ml 10 mM probe. Amplification conditions were as follows: an initial denaturation of 95  C 2 min followed by 40 cycles of 95  C 15 s and 60  C for 45 s. Gene expression for each primer set was determined using a four-point external curve

Table 1 Phytophthora ramorum isolates. Lineage

Isolatea

Original name

Source

Location

Year

NA1

4313 4353 9488 9650 9770 PR-05-002 PR-05-166 PR-07-031 PR-07-057 PR-07-058 CSL-1727 CSL-2026 CSL-2065 CSL-2066 CSL-2097

e e e e e RHCC-4 MR31 15-WA-M 43-WA-SU 44-WA-SU 2 028 528 20 302 104 20 304 595 20 305 086 20 309 382

Rhododendron Lithocarpus Lithocarpus Lithocarpus Lithocarpus Rhododendron Rhododendron soil Rhododendron Rhododendron Pieris Kalmia Leucothoe Syringa Hamamelis

OR OR OR OR OR CA WA WA WA WA UK UK Ireland UK UK

2002 2003 2006 2006 2006 2005 2004 2006 2005 2005 2002 2003 2003 2003 2003

NA2

EU1

a Isolates were obtained from E.M. Hansen, Oregon State Univ (4313, 4353); C.D. Nelson, USDA-FS-SRS (9488, 9650); J. Laine, Oregon Dept Foresty (9770); D.M. Rizzo, UC Davis (PR-05-002); M. Garbelotto, UC Berkeley (PR-05-166); G.A. Chastagner, Washington State Univ (PR-07-031, PR-07-057, PR-07-058); The Food and Environment Research Agency (formerly CSL), UK (CSL-1727, CSL-2026, CSL-2065, CSL-2066, CSL-2097).

Sequence (50 e 30 )

Probe/primer a

RAMA1_102F1 RAMA1_123R1b RAMA1_172Pc RAMA2_102F4a RAMA2_118R2b RAMA2_170Pc PGBT308Fa,d PGBT429Rb,d PG336BTUBPc,d

GCTCGTGAGCATCCT CCGTCAGCATCGAGTAG CTCGTCGTTCAACCAGTGCGC TACGTGGCGCTCGTG GTCAGCATCGAGTAGC TCGGAATCGTCCTTCTCGACGT GGTACAATGGCACGTCTGATCTC GGACGCCTATATCGCAAGTCA CGAGCGCATGAACGTCTACTTCAACG

a

Forward primer. Reverse primer. c TaqMan probes: RAMA1_172P is labeled with the reporter dye ROX, RAMA2_170P is labeled with the reporter dye HEX, PG336BTUBP is labeled with the reporter dye 6-FAM. d Winton et al. [30]. b

(0.1e100 ng ml1) using cDNA pooled from all 15 isolates, and reported elicitin gene expression values are relativized to b-tubulin. 2.1.2. ELISA assay The concentration of elicitin proteins secreted into the culture filtrates by the 15 isolates (n ¼ 3) was determined using a custom, indirect ELISA assay using rabbit anti-elicitin polyclonal antibodies (Covance Research, Denver, PA, USA). The ELISA assay was performed as follows. Three technical replicates of each isolate’s culture filtrate (200 ml each) were added to individual wells of a Grenier BioOne Microlon 96-well ELISA plate (San Francisco, CA, USA) and incubated at 37  C for 1hr. After removal of the antigen solution, the plate was then washed 3 with 300 ml of PBST (0.05% tween 80 in 10 mM PBS) and blocked with 300 ml of PBST plus 3% BSA Fraction V for 1 h at 37  C. After removal of the blocking solution, 100 ml of the diluted (1:5000 with PBST plus 3% BSA) primary antibody (rabbit anti-elicitin polyclonal antibody) was added to each well and incubated at 37  C for 1 h. After washing 5 times with 300 ml PBST, 100 ml of the diluted (1:5000 with PBST plus 3% BSA) secondary antibody (HRP-conjugated goat anti-rabbit IgG antibody, Jackson Immuno Research, West Grove, PA, USA) was added to each well and incubated at 37  C for 1 h. The plate was then washed 5 with 300 ml of PBST and reacted with 100 ml of 1 mg ml1 ABTS (2,20 -azino-bis [3-ethylbenzthiazoline-6-sulphonic acid]) plus 0.03% hydrogen peroxide. Absorbance at 650 nm was recorded every 30 s for 15 min with shaking using a Biotek ELx808 microplate reader (Winooski, VT, USA). Elicitin concentrations were determined using an external standard curve (100, 50, 25, 12.5, 6.3, 3.1, 1.6, 0.8, 0.4, 0.2 mM) using the purified recombinant P. ramorum elicitin obtained with a Pichia expression system (Supplementary methods). 2.2. Fitness experiments: inoculation and incubation Five isolates of P. ramorum from each of three different clonal lineages (Table 1) were collected and grown on V8 agar (100 ml clarified V8 juice, 23.4 g Bacto-agar, 1.65 g CaCO3, 1200 ml water) for 10 days to establish viable mycelia. Ten healthy detatched R. catawbiense ‘Nova Zembla’ leaves were subsequently inoculated with each of the 15 isolates by first wounding the leaf with a sterile push pin and then placing an agar plug containing the isolate directly on the wound, mycelium side toward the leaf. Leaves were incubated at room temperature (19e20  C) in Rubbermaid containers lined with paper towels saturated with sterile water. There were two trials; Trial 1 was conducted in March and Trial 2 was conducted in April, 2008. After four days of incubation, the agar plug was removed from the leaf. In trial 1, leaves were misted on the fourth, seventh, and

D.K. Manter et al. / Physiological and Molecular Plant Pathology 74 (2010) 317e322

tenth day with sterile water. For trial 2, leaves were misted on the fourth, sixth, ninth, and tenth day. After ten (trial 1) or 11 (trial 2) days of incubation, leaves were processed for sporangia and lesion size as outlined below. 2.2.1. Lesion area All ten leaves inoculated with the same isolate were blotted dry with a paper towel, labeled and scanned with a flatbed scanner. Leaf and lesion areas were analyzed using Assess digital imaging software (American Phytopathological Society, St. Paul, MN, USA). 2.2.2. Sporangia production Sporangia production was quantified on five of the ten leaves per isolate. Individual leaves were placed in 50 ml conical tubes (BD FalconÔ, FranklinLakes, NJ) tubes containing 20 ml of sterile dH2O and vortexed for 20 s. To stop further development of the inoculum, 60 ml of 0.16M CuSO4 was added to each tube. Tubes were stored at 4  C. Sporangia suspensions were prepared for counting by passing through a 5 mm filter, which was then placed onto a drop of 0.01% Calcofluor White (VWR Scientific, West Chester, PA) on a glass slide. A second drop of Calcofluor White solution was placed on top of the filter. The slide was allowed to dry at room temperature and permanently mounted with Polymount (Polysciences, Warrington, PA, USA). The total number of sporangia on each slide was determined at 100 magnification using a Zeiss Axiostar epifluorescence microscope (Carl Zeiss MicroImaging, Inc., Thornwood, NY) fitted with a 425 nm emission filter. 2.3. Statistical analyses Statistically significant differences in lesion size (n ¼ 10 per trial), sporangia production (n ¼ 5 per trial), elicitin gene expression (n ¼ 3 per trial), and secreted elicitin protein (n ¼ 3 per trial) were tested using a two-way ANOVA with trial and isolate information (lineage or isolate) as fixed effects. Pairwise comparisons between lineages, or isolates, were determined using Fisher’s LSD post hoc test. All reported values are the LSmeans and pooled standard errors averaged across both trials. 3. Results Detectable levels of ram-a1 and ram-a2 gene expression were found in all 15 P. ramorum isolates (Table 3), and for all 3 clonal lineages ram-a1 expression was more than 20 percentage points higher than ram-a2 (Table 4). No difference in ram-a1 expression was observed between isolates (Table 3) or lineages (Table 4); whereas, significant differences were observed for ram-a2 expression between isolates (Table 3) or lineages (Table 4). At the isolate level, ram-a2 expression differed approximately three-fold between the lowest (NA1: 9770) and highest (EU1: CSL-2026) isolates (Table 3). Pairwise comparisons showed that lineages EU1 and NA2 had similar levels of ram-a2 gene expression, which was approximately two-fold higher than the NA1 lineage (Table 4). A western blot, using purified recombinant ram-a1 and ram-a2 elicitins [15], showed that the polyclonal antibodies detect both the ram-a1 and ram-a2 elicitins (Fig. S1). Data mining of the P. ramorum genome revealed a total of 17 elicitin and 31 elicitin-like domains [16], and it is unknown how many of these additional proteins may have been secreted by the various P. ramorum isolates or the relative contribution of each individual elicitin or elicitin-like protein to the total amount of secreted elicitin detected. Regardless, similar to elicitin gene expression, significant differences in secreted elicitin were observed by isolate (Table 3) and lineage (Table 4). Based on the level of elicitin gene expression, it is likely that ram-a2 comprises a larger component of the amount of elicitin

319

Table 3 Virulence, sporulation, and elicitin production by Phytophthora ramorum isolates. Data are the LSmeans and pooled standard errors, isolates with different letters are significantly different (p < 0.05) using Fisher’s LSD post hoc test. Values are averaged across both trials. Lineage Isolate

Lesion areaa Sporangiab Gene expressionc ram-a1 ram-a2

NA1 NA1 NA1 NA1 NA1 NA2 NA2 NA2 NA2 NA2 EU1 EU1 EU1 EU1 EU1

4313 4353 9488 9650 9770 Pr-05-002 Pr-05-166 Pr-07-031 Pr-07-057 Pr-07-058 CSL-1727 CSL-2026 CSL-2065 CSL-2066 CSL-2097

Std. Error p-value

0.22 0.83 0.90 1.22 0.42 5.64 1.60 3.89 3.92 3.83 4.01 4.43 4.29 3.51 5.66

a a a a a c a b b b b bc bc b c

0.52 <0.0001

57 a 189 ab 82 ab 95 ab 375 abcd 590 de 212 abc 1134 f 368 abcd 286 abcd 251 abcd 540 cde 142 ab 764 ef 455 bcde

0.83 0.84 0.71 0.70 0.75 0.77 0.80 0.85 0.84 0.84 1.00 0.86 0.67 0.77 0.86

a a a a a a a a a a a a a a a

125 <0.0001

0.08 0.293

0.29 0.28 0.35 0.28 0.26 0.51 0.50 0.67 0.62 0.68 0.68 0.76 0.57 0.56 0.67

a a a a a ab ab b ab b b b ab ab b

Secreted elicitind 5.12 4.52 4.21 4.52 4.80 7.92 4.95 7.55 6.34 7.23 6.75 7.86 6.23 5.87 7.54

abcde abcd abc abcd abcd cde abcde bcde abcde abcde abcde cde abcde abcde bcde

0.07 0.58 <0.0001 <0.0001

a Lesion area (cm2) produced by P. ramorum on artificially inoculated Rhododendron catawbiense ‘Nova Zembla’ leaves. b Sporangia (number per leaf) produced by P. ramorum on artificially inoculated Rhododendron catawbiense ‘Nova Zembla’ leaves. c Relative expression of ram-a1 and ram-a2 elicitin genes by P. ramorum isolates grown in vitro. d Elicitin protein (mg ml1) secreted by Phytophthora ramorum isolates grown in vitro.

secreted; indeed, the amount of secreted elicitin was better correlated with ram-a2 gene expression presumably due to its greater variation between isolates (R2 ¼ 0.746, Fig. 1). Artificial inoculation of R. catawbiense ‘Nova Zembla’ leaves with all 15 P. ramorum isolates resulted in visible lesions (Fig. 2). Average lesion size ranged from 0.22 cm2 (NA1: 4313) to 5.66 cm2 (EU1: CSL-2097), which is nearly a 26-fold difference (Table 3). Lesion size (cm2) differed significantly between clonal lineages (Table 4). Similar to elicitin expression, EU1 and NA2 isolates did not differ significantly with regard to lesion size, and both produced lesions approximately four-fold greater than NA1 isolates. Sporangia obtained from the artificially inoculated Rhododendron leaves were readily visible by fluorescence microscopy using Calcofluor White. Like lesion size and ram-a2 expression, sporangia production differed significantly between isolates and ranged from

Table 4 Virulence, sporulation, and elicitin production by Phytophthora ramorum isolates. Data are the LSmeans and pooled standard errors, lineages with different letters are significantly different (p < 0.05) using Fisher’s LSD post hoc test. Values are averaged across both trials. Lineage

Lesion areaa

Sporangiab

Gene expressionc

160 a 397 b 429 b

0.76 a 0.82 a 0.83 a

0.29 a 0.59 b 0.63 b

4.63 a 6.80 b 6.85 b

65 <0.0001

0.03 0.087

0.06 <0.0001

0.52 <0.0001

ram-a1 NA1 NA2 EU1 Std. Error p-value

0.72 a 3.78 b 4.38 b 0.24 <0.0001

Secreted elicitind

ram-a2

a Lesion area (cm2) produced by P. ramorum on artificially inoculated Rhododendron catawbiense ‘Nova Zembla’ leaves. b Sporangia (number per leaf) produced by P. ramorum on artificially inoculated Rhododendron catawbiense ‘Nova Zembla’ leaves. c Relative expression of ram-a1 and ram-a2 elicitin genes by P. ramorum isolates grown in vitro. d Elicitin protein (mg ml1) secreted by P. ramorum isolates grown in vitro.

D.K. Manter et al. / Physiological and Molecular Plant Pathology 74 (2010) 317e322

Relative expression

320

1.0

R = 0.196 2

0.8 0.6 0.4 R 2 = 0.746

0.2 4

5

6

7

8

Elicitin secreted (mg

ml-1)

Fig. 1. Relationship between ram-a1 (closed symbols) or ram-a2 (open symbols) gene expression and elicitin secretion for Phytophthora ramorum isolates grown in vitro. Symbols are the LSmeans for each individual isolate averaged across both trials.

a low of 57 per leaf (NA1: 4313) to 1134 per leaf (NA2: Pr-05-166) or approx. 20-fold (Table 3). Lineages EU1 and NA2 produced significantly more (approx. two-fold) sporangia per leaf than did lineage NA1 (p < 0.001, Table 4). We further explored the relationship between P. ramorum virulence and sporulation with elicitin gene expression at the isolate level using regression analysis. As expected, no relationship between rama1 gene expression and P. ramorum virulence, or sporangia production, was observed (data not shown). However, ram-a2 gene expression was positively correlated with virulence (R2 ¼ 0.707, Fig. 3A). The correlation between ram-a2 gene expression and sporulation production was not as strong (R2 ¼ 0.209, Fig. 3B) but again showed a positive linear relationship. Similar correlations were also observed between the amount of secreted elicitin and virulence (R2 ¼ 0.831, Fig. 3C) and sporulation (R2 ¼ 0.379, Fig. 3D). 4. Discussion P. ramorum isolates belonging to two known lineages, NA1 and EU1, were shown previously to exhibited significant differences in

growth rate and pathogenicity [7,8,17]. In the current study, we compared isolates from all three clonal lineages and provide evidence that isolates belonging to lineages EU1 and NA2 are more virulent and produce more sporangia in planta than isolates belonging to clonal lineage NA1. Moreover, we also show that EU1 and NA2 isolates produce more ram-a2 elicitin in vitro than isolates belonging to lineage NA1. The positive correlation of virulence with ram-a2 expression suggests a potential role for this elicitin in pathogenesis. No statistical significance was found for ram-a1 gene expression across all the isolates. However, a statistically lower level of ram-a2 gene expression in the NA1 clonal lineage isolates was observed as compared to either the NA2 or EU1 clonal lineages. In addition, the NA1 lineage caused significantly smaller lesion areas and fewer sporangia per leaf as compared to either the NA2 or EU1 clonal lineages. At the isolate level, we observed a significant correlation between ram-a2 expression and both lesion area and sporangia production. The polyclonal ELISA assay used in this study detected both the ram-a1 and ram-a2 elicitins, and was better correlated with the ram-a2 gene expression. A genomic analysis suggests that P. ramorum is capable of producing a wide variety of elicitin and elicitin-like proteins [16]; however, culture filtrate analysis suggests that the major elicitins secreted are ram-a1 and ram-a2 [15]. In this study, isolate differences in sporulation and colonization were best correlated with ram-a2 gene expression, suggesting that ram-a2 is a major contributor to the fitness of P. ramorum. Further studies are needed to determine what quantities of ram-a2 are produced in planta and any additional factors that may directly influence its activity, since elicitin gene expression in both Phytophthora parasitica [13] and Phytophthora infestans [14] was downregulated during plant infection. Furthermore, Horta et al. [18] observed a decline in elicitin gene expression in 15 day-old cultures, suggesting that the elicitin expression is maximized during active mycelial growth. Fleischmann et al. [19] found that aelicitin gene expression peaks at the onset of host necrosis and the onset of sporulation. Thus, they speculate that the role of a-elicitins is connected with the process of sporulation and/or pathogen survival under saprophytic conditions. Conversely, a number of

Fig. 2. Visible lesions produced by two representative Phytophthora ramorum isolates, (A) EU1: CSL-2097 (B) NA1: 4313, on artificially inoculated Rhododendron catawbiense ‘Nova Zembla’ leaves.

D.K. Manter et al. / Physiological and Molecular Plant Pathology 74 (2010) 317e322

C

5

4

4

3

3

2

2

1

1

0 Sporangia production (# per leaf)

6

ram- a 1 ram- a 2

5

1250

2

2

R = 0.707

B

R = 0.831

D

0 1250

1000

1000

750

750

500

500

250

250

0

2

2

R = 0.209 0.2

0.4

0.6

0.8

Relative expression

R = 0.379 4

5

6

7

0

Sporangia production (# per leaf)

A

Lesion (cm 2)

Lesion (cm 2)

6

321

8 -1

Elicitin secreted (mg ml )

Fig. 3. Relationship between in vitro ram-a2 elicitin gene expression (A, B) or secreted elicitin protein (C, D) and lesion size (A, C) or sporangia production (B, D) on artificially inoculated Rhododendron catawbiense ‘Nova Zembla’ leaves with Phytophthora ramorum isolates. Symbols are the LSmeans for each individual isolate: EU1 (circles), NA1 (triangles), and NA2 (squares) clonal lineages. Values are averaged across both trials.

studies have suggested that elicitins are not required for Phytophthora virulence. For example, Ricci et al. [20] found that virulent isolates of P. parasitica do not produce the elicitin, parasiticein, in culture, and Kamoun et al. [21] showed that silencing of the elicitin (INF1) gene enhanced virulence of P. infestans in Nicotiana benthamiana. As observed here, the differential results between elicitins may be due to the specific elicitin chosen. We only observed a strong correlation between virulence and sporulation with rama2 expression, but not ram-a1, whereas in our previous work [15], exogenous applications of ram-a1 induced greater amounts of ethylene production and photosynthetic declines in host plants, as compared to ram-a2. Despite their high molecular homology, individual elicitins can each contribute differentially to disease development. The biological activity and production of the entire family of elicitins may be required to fully explain the pathogenicity and virulence of Phytophthora spp. The mechanistic basis of any elicitin-associated pathogenicity in Phytophthora remains unresolved. For example, it has been suggested that elicitins are non-specific toxins capable of inducing necrosis in any plant species [22,23], perhaps associated with lipid membrane disruption [24], while other authors have shown that necrosis is restricted to specific plant species or cultivars [14,25e27]. Evidence is accumulating, however, that elicitins can trigger a variety of non-necrotic physiological changes in host plants including photosynthetic declines and ethylene production [15] and the accumulation of phenolics [28]. It is possible that pathogenesis involves two components: (i) a slow or incomplete HR-like response by the host that, although it cannot limit pathogen colonization, leads to cell death and/or physiological impairment, and (ii) the role of elicitins on Phytophthora growth and colonization in planta. In regard to the latter, elicitins appear to be necessary for the acquisition of plant sterols by Phytophthora spp., which are necessary for spore production and hyphal growth [9,10,18,29]. More work is clearly needed to identify the full role,

and mechanism(s), of the elicitin family in Phytophthora spp. pathogenicity and disease development. Appendix. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.pmpp.2010.04.008. References [1] Rizzo DM, Garbelotto M, Davidson JM, Slaughter GW, Koike S. Phytophthora ramorum as the cause of extensive mortality of Quercus spp. and Lithocarpus densiflorus in California. Plant Dis 2002;86:205e14. [2] Ivors K, Garbelotto M, Vries ID, Ruyter-Spira C, Te Hekkert B, Rosenzweig N, et al. Microsatellite markers identify three lineages of Phytophthora ramorum in US nurseries, yet single lineages in US forest and European nursery populations. Mol Ecol 2006;15:1493e505. [3] Grunwald NJ, Goss EM, Ivors K, Garbelotto M, Martin FN, Prospero S, et al. Standardizing the nomenclature for clonal lineages of the sudden oak death pathogen, Phytophthora ramorum. Phytopathology 2009;99:792e5. [4] Hansen EM, Reeser PW, Sutton W, Winton LM, Osterbauer N. First report of A1 compatibility type of Phytophthora ramorum in North America. Plant Dis 2003;87:1267. [5] Goss EM, Larsen M, Chastagner GA, Givens DR, Grunwald NJ. Population genetic analysis infers migration pathways of Phytophthora ramorum in US nurseries. PLoS Path 2009;5:e1000583. [6] Brasier C, Kirk S. Production of gemetangia by Phytophthora ramorum in vitro. Mycol Res 2004;108:823e7. [7] Brasier C, Kirk S, Rose J. Differences in phenotypic stability and adaptive variation between the main European and American lineages of Phytophthora ramorum. In: Brasier CM, Jung T, Osswald W, editors. Progress in research on Phytophthora diseases of forest trees: forest research; 2006. p. 166e73. Farnham, U.K. [8] Huberli D, Harnik T, Meshriy M, Mikes L, Garbelotto M. Phenotypic variation among Phytophthora ramorum isolates from California and Oregon. vol. PSW-GTR-196. In: Proceedings of the 2nd sudden oak death science symposium: the state of our knowledge. Monterey, CA: USDA Forest Service; 2005. p. 131e4. [9] Hendrix JW. Sterols in growth and reproduction of fungi. Annu Rev Phytopathol 1970;8:111e30.

322

D.K. Manter et al. / Physiological and Molecular Plant Pathology 74 (2010) 317e322

[10] Elliot CG, Knight BA. Uptake and interconversion of cholesterol and cholesteryl esters by Phytophthora cactorum. Lipids 1981;16:1e7. [11] Nes WD, Stafford AE. Evidence for metabolic and functional discrimination of sterols by Phytophthora cactorum. Proc Natl Acad Sci U S A 1983;80: 3227e31. [12] Kamoun S, Young M, Forster H, Coffey MD, Tyler BM. Potential role of elicitins in the interaction between Phytophthora species and tobacco. Appl Environ Microbiol 1994;60:1593e8. [13] Colas V, Conrod S, Venard P, Keller H, Ricci P, Panabieres F. Elicitin genes expressed in vitro by certain tobacco isolates of Phytophthora parasitica are down regulated during compatible interactions. Mol Plant-Microbe Interact 2001;14:326e35. [14] Kamoun S, van West P, de Jong AK, De Groot KE, Vleeshouwers VGAA, Govers F. A gene encoding a protein elicitor of Phytophthora infestans is down-regulated during infection of potato. Mol Plant-Microbe Interact 1997; 10:13e20. [15] Manter DK, Kelsey RG, Karchesy JJ. Photosynthetic declines in Phytophthora ramorum-infected plants develop prior to water stress and in response to exogenous application of elicitins. Phytopathology 2007;97:850e6. [16] Tyler BM, Tripathy S, Zhang X, Dehal P, Jiang RH, Aerts A, et al. Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science 2006;313:1261e6. [17] Brasier C. Sudden oak death: Phytophthora ramorum exhibits transatlantic differences. Mycol Res 2003;107:258e9. [18] Horta M, Sousa N, Coelho AC, Neves D, Cravador A. In vitro and in vivo quantification of elicitin expression in Phytophthora cinnamomi. Physiol Mol Plant Pathol 2008;73:48e57. [19] Fleischmann F, Koehl J, Portz R, Beltrame AB, Oßwald W. Physiological changes of Fagus sylvatica seedlings infected with Phytophthora citricola and the contribution of its elicitin “citricolin” to pathogenesis. Plant Biol (Stuttg) 2005;7:650e8. [20] Ricci P, Trentin F, Bonnet P, Venard P, Mouton-Perronnet F, Bruneteau M. Differential production of parasiticein, an elicitor of necrosis and resistance

[21]

[22]

[23]

[24]

[25]

[26]

[27] [28]

[29]

[30]

in tobacco, by isolates of Phytophthora parasitica. Plant Pathol 1992;41: 298e307. Kamoun S, van West P, Vleeshouwers VGAA, de Groot KE, Govers F. Resistance of Nicotiana benthamiana to Phytophthora infestans is mediated by the recognition of the elicitor protein INF1. The Plant Cell 1998;10:1413e25. Huet J-C, Salle-Tourne M, Pernollet J- C. Amino acid sequence and toxicity of the a-elicitin secreted with ubiquitin by Phytophthora infestans. Mol PlantMicrobe Interact 1994;7:302e4. Pernollet J-C, Sallantin M, Salle-Tourne M, Huet J- C. Elicitin isoforms from seven Phytophthora species: comparison of their physico-chemical properties and toxicity to tobacco and other plant species. Physiol Mol Plant Pathol 1993;42:53e67. Nespoulos C, Guaudemer O, Huet J-C, Pernollet J-C. Characterization of elicitin-like phospholipases isolated from Phytophthora capsici culture filtrate. FEBS Lett 1999;452:400e6. Bonnet P, Bourdon E, Ponchet M, Blein J-P, Ricci P. Acquired resistance triggered by elicitins in tobacco and other plants. Eur J Plant Pathol 1996; 102:181e92. Kamoun S, Young M, Glascock C, Tyler BM. Extracellular protein elicitors from Phytophthora: host-specificity and induction of resistance to fungal and bacterial phytopathogens. Mol Plant-Microbe Interact 1993;6:15e25. Yu LM. Elicitins from Phytophthora and basic resistance in tobacco. Proc Natl Acad Sci U S A 1995;92:4088e94. Dutsadee C, Nunta C. Induction of peroxidase, scopoletin, phenolic compounds and resistance in Hevea brasilensis by elicitin and a novel protein elicitor purified from Phytophthora palmivora. Physiol Mol Plant Pathol 2008;72:179e87. Ponchet M, Panabieres F, Milat M-L, Mikes V, Montillet J-L, Suty L, et al. Are elicitins cryptograms in plant-oomycete communications? Cell Mol Life Sci 1999;56:1020e47. Winton LM, Stone JK, Watrud LS, Hansen EM. Simultaneous one-tube quantification of host and pathogen DNA with real-time polymerase chain reaction. Phytopathology 2002;92:112e6.