- Email: [email protected]
Visual detection of STAT5B gene expression in living cell using the hairpin DNA modified gold nanoparticle beacon
Biosensors and Bioelectronics 41 (2013) 71–77
Contents lists available at SciVerse ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
Visual detection of STAT5B gene expression in living cell using the hairpin DNA modified gold nanoparticle beacon Jianpeng Xue a, Lingling Shan a, Haiyan Chen a, Yang Li a, Hongyan Zhu a, Dawei Deng a, Zhiyu Qian b, Samuel Achilefu c,n, Yueqing Gu a,nn a Department of Biomedical Engineering, State Key Laboratory of Natural Medicines, School of Life Science and Technology, China Pharmaceutical University, Nanjing 210009, PR China b Department of Biomedical Engineering, Nanjing University of Aeronautics and Astronautics, PR China c Department of Radiology, School of Medicine, Washington University in St. Louis, MO, USA
a r t i c l e i n f o
abstract
Article history: Received 30 March 2012 Received in revised form 22 June 2012 Accepted 24 June 2012 Available online 9 October 2012
Signal transducer and activator of transcription 5B (STAT5B) is an important protein in JAK-STAT signaling pathway that is responsible for the metastasis and proliferation of tumor cells. Determination of the STAT5B messenger Ribonucleic Acid (mRNA) relating to the STAT5B expression provides insight into the mechanism of tumor progression. In this study, we designed and used a special hairpin deoxyribonucleic acid (DNA) for human STAT5B mRNA to functionalize gold nanoparticles, which served as a beacon for detecting human STAT5B expression. Up to 90% quenching efficiency was achieved. Upon hybridizing with the target mRNA, the hairpin DNA modified gold nanoparticle beacons (hDAuNP beacons) release the fluorophores attached at 50 end of the oligonucleotide sequence. The fluorescence properties of the beacon before and after the hybridization with the complementary DNA were confirmed in vitro. The stability of hDAuNP beacons against degradation by DNase I and GSH indicated that the prepared beacon is stable inside cells. The detected fluorescence in MCF-7 cancer cells correlates with the specific STAT5B mRNA expression, which is consistent with the result from PCR measurement. Fluorescence microscopy showed that the hDAuNP beacons internalized in cells without using transfection agents, with intracellular distribution in the cytoplasm rather than the nucleus. The results demonstrated that this beacon could directly provide quantitative measurement of the intracellular STAT5B mRNA in living cells. Compared to the previous approaches, this beacon has advantages of higher target to background ratio of detection and an increased resistance to nuclease degradation. The strategy reported in this study is a promising approach for the intracellular measurement of RNA or protein expression in living cells, and has great potential in the study of drug screening and discovery. & 2012 Elsevier B.V. All rights reserved.
Keywords: STAT5B mRNA Gold nanoparticle Beacon Hairpin DNA Imaging Visual detection
1. Introduction Cancer is well known as a genetic disease (Bishop, 1987; Hahn and Weinberg, 2002), which is usually related to the abnormity of a number of signaling pathways that especially include some transcription factors (Cantley, 2002; Darnell, 2002; Hahn and Weinberg, 2002). One of the most recently recognized oncogenic signaling pathways is JAK-STAT pathway, which involves the STAT proteins. This protein family comprises seven members— STAT1 to STAT4, STAT6, and the closely related STAT5A and STAT5B proteins (Darnell, 1997; Darnell et al., 1994). Recent n
Corresponding author. Tel.: þ1 314 362 8599; fax: þ 1 314 747 5191. Co-corresponding author. Tel.: þ86 25 83271080; fax: þ86 25 83271046. E-mail addresses: [email protected] (S. Achilefu), [email protected] (Y. Gu). nn
0956-5663/$ - see front matter & 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.bios.2012.06.062
studies have shown that Janus kinase 2-signal transducer and activator of transcription 5A/B (JAK2-STAT5A/B) signaling pathway is of significant interest in the search for new therapeutic strategies in both breast and prostate cancers. In prostate cancer, the components of the JAK2-STAT5A/B signaling pathway provide molecular targets for small-molecule inhibitors of cellular survival and growth signals. New evidence suggests that the STAT5A/B signaling pathway is involved in the transition from organconfined prostate cancer to hormone-refractory disease. This implies that the active JAK2-STAT5A/B signaling pathway potentially provides a method for pharmacological intervention in clinical prostate cancer progression. In addition, active STAT5A/B may serve as a prognostic marker for identifying primary prostate cancers that are likely to progress to metastatic disease. In breast cancer, the role of STAT5A/B is more complex. STAT5A/B may have a dual role in the regulation of malignant mammary
72
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
Fig. 1. Schematic diagram of hairpin DNA (black) assembling to gold nanoparticle (yellow) for synthesizing probe and detection of mRNA. The monolayer hairpin DNA was coupled to a gold nanoparticle surface by the thiol at 30 end. The hairpin conformation was maintained by the complementarity of the stem sequences, the fluorescence of the 50 dye was quenched by the AuNPs according to FRET. When the hDAuNP beacon hybridized specifically with target mRNA, the hairpin DNA sequence was opened, and then the 50 fluorophore was away from the surface of AuNP and overcome fluorescence quenching, fluorescence explored.
epithelium (Tan and Nevalainen, 2008). In particular, STAT5B is a crucial transcription factor involved in the proliferative and survival signaling in a number of solid tumors, including breast cancer and prostate cancer (Fox et al., 2008; Gu et al., 2010; Liang et al., 2009). Therefore, detection of STAT5B expression could be a useful strategy to stage and investigate tumor status. Following the discovery of the DNA structure half a century ago, RNA was long considered as a supporting player during cellular information transfer from DNA to proteins. The normal function of cells depends on accurate expression of a large number of protein-coding RNAs (messenger RNAs) and noncoding RNAs. Messenger RNA (mRNA) is a single-strand ribonucleic acid with genetic information, which is the blueprint for the cellular production of proteins. The mRNA level is related to the protein expression and the mRNA measurement indirectly reports the protein expression. Several techniques for detecting mRNA are available, including polymerase chain reaction PCR (Gong and Maquat, 2011; Moore et al., 2010) and in situ hybridization (Bassell et al., 1994; Bishop, 1987; Ottem et al., 2010). However, these techniques have several limitations associated with imaging fixed or lysed cells. Moreover, these techniques are timeconsuming and cannot be used to detect mRNA in living cells. To meet the increasing demand for live cell imaging, molecular probes for visualizing and detecting intracellular RNA, including those used for in situ staining (Kloosterman et al., 2006; Madathil et al., 2011), molecular beacons (Lennon et al., 2010; Peng et al., 2005; Tyagi and Kramer, 1996), and fluorescent resonance energy transfer (FRET) pairs (Sando and Kool, 2002; Santangelo et al., 2004; Zhu et al., 2010) have been developed and served as important tools to detect and quantify RNA in living systems in response to external stimuli (Santangelo et al., 2006). However, transfection of these probes into living cells is often difficult and typically requires additional agents for cellular internalization. Some of these agents are unstable in cellular environments. These factors could lead to a high background signal and diminish the inability to detect targets with high sensitivity. Recently, an oligonucleotide-functionalized gold nanoparticle (AuNP) probe was reported to address these limitations. Compared to previous approaches, AuNP probes uniquely offer efficient intracellular delivery without transfection or permeabilization reagents, an increased resistance to nuclease degradation and high target to background ratio of detection (Rosi et al., 2006; Seferos et al., 2007). However, since the fluorescent reporter of the probe used in previous studies was not hybridized to the target RNA, but was competitively displaced and diffuses away from the site of hybridization, it is difficult to use this strategy to determine intracellular mRNA localization. This challenge led to the development of a new mRNA detection methodology in living cells, where the monolayer hairpin DNA was coupled to a gold nanoparticle surface (Harry et al., 2010; Jayagopal et al., 2010; Qiao et al., 2011).
The probes take advantage of the highly efficient fluorescence quenching properties of gold (Dubertret et al., 2001), cellular uptake capability of oligonucleotide—nanoparticle conjugates without the use of transfection agents, the enzymatic stability of such conjugates (Rosi et al., 2006), and preserving spatial localization of target mRNA within the cell. Thus, this approach overcame many of the challenges of previous techniques by creating highly sensitive and effective intracellular probes for monitoring gene expression. The hairpin DNA structure consists of a 50 end with a fluorophore, a stem-loop-stem sequence and a 10-base polyadenine linker sequence followed by a thiol at the 30 end. The loop region was designed to hybridize with the target mRNA. Fig. 1 illustrates the schematic diagram of the probe. In the closed state, the hairpin conformation was maintained by the complementarity of the stem sequences. Additionally, in this state, the 30 thiol group enabled linkage to the surface of gold nanoparticle with sufficient proximity to permit AuNP quenching of dye fluorescence from the 50 dye. This probe is abbreviated as hDAuNP in this work. When the probe hybridized specifically with a target mRNA, the hairpin DNA sequence stretched out, positioning the 50 fluorophore away from the 30 AuNP at a sufficient distance to give off fluorescence. The use of hairpin DNA functionalized gold nanoparticle as a new detection methodology of mRNA in living cell have only been described for detecting survivin mRNA, cyclin D1 mRNA and tyrosinase gene expression (Jayagopal et al., 2010; Qiao et al., 2011). Although the structure of hDAuNP beacon used in this study is similar to those reported previously, our special hairpin DNA for human STAT5B mRNA used to modify gold nanoparticle was designed by bioinformatics method. The conjugates served as a beacon to visualize and quantify human STAT5B mRNA in living cells, which extended the usable range of this class of probes.
2. Materials and experiment methods 2.1. Chemical reagents Chloroauric acid (HAuCl4) was purchased from Shanghai Chemical Reagent Co., Ltd. Sodium citrate (Na3C6H5O7), Sodium borohydride (NaBH4), sodium chloride (NaCl), Magnesium chloride hexahydrate (MgCl2 6H2O), triethylamine, ethylacetate and Tween-20 were purchased from Sinopharm Chemical Reagent Co., Ltd. Dithiothreitol (DTT), glutathione (GSH), sodium dodecylsulphate (SDS) and dimethyl sulphoxide (DMSO) were purchased from Sigma-Aldrich Co. Roswell Park Memorial Institute medium 1640 (RPMI 1640), TRIzol reagent and tetrazolium salt (MTT) were purchased from America Invitrogen. Bovine Serum Albumin and DNase I were purchased from Sangon Biotech (Shanghai) Co., Ltd. All water used in this study was distilled and subsequently
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
purified to Millipore Milli-Q quality. All glassware used was cleaned in a bath of freshly prepared aqua regia solution (HCl/ HNO3 ¼ 3:1), then rinsed thoroughly with H2O before use.
73
above beacon solution for 1 h at 70 1C for complete hybridization. The solution was subsequently cooled gradually to 25 1C for 12 h in the dark, and the fluorescence of the solution was re-measured to study the recovery properties.
2.2. Experiment methods 2.2.1. Design of the oligonucleotides sequence The sequence of the STAT5B mRNA was obtained from the nucleotide database on the website of the National Center for Biotechnology Information (NCBI). Several 20-base mRNA recognition sequences were chosen for target and studied by extensive BLAST search analysis to evaluate specificity as the cellular mRNA target. The sequences were as follow: Sequence Sequence Sequence Sequence Sequence
1: 2: 3: 4: 5:
50 -GAAAGAATGTTTTGGAATCT-30 50 -AGGCTCACTATAACATGTAC-30 50 -TTGCCGTGCCTGACAAAGTG-30 50 -TTACTGAAGATCAAGCTGGG-30 50 -ATTGAGGTGCGGCATTATTT-30
By extensive BLAST search analysis, sequence 5 was identified as unique for STAT5B mRNA. The loop section of the hairpin DNA was designed according to the complementary base-pair specificity. GCGAG and CTCGC were used as the stem section of the hairpin DNA. Subsequently, the hairpin DNA modified by fluorescein isothiocyanate (FITC) at the 50 end and thiol at the 30 end was designed and ordered from Sangon Biotech (Shanghai) Co., Ltd. The following sequences were designed and prepared for this study: Hairpin DNA: 50 -(FITC) GCGAGAAATAATGCCGCACCTCAATCTCGCA (A)9SH-30 Complementary DNA: 50 -ATTGAGGTGCGGCATTATTT-30 Mismatched DNA: 50 -ATTGAG t TGC a GCA g TATTT-30
2.2.2. Synthesis of the hDAuNP beacon The gold particles with average diameter of 15 nm were synthesized by the method developed by Frens (1973). The above alkylthiol-modified hairpin oligonucleotides were first activated by 100 mM DTT in phosphate buffer (PBS, pH¼8.0) and then added to a solution of gold nanoparticles. The molar ratio of oligonucleotides to particles was 100:1. After 12 h incubation in the dark, 10% sodium dodecylsulphate and 2 M sodium chloride were added to achieve final concentrations of 0.1% and 0.1 M, respectively. An additional aliquot of sodium chloride was gradually added to achieve a final concentration of 0.3 M, and the mixture was kept at 4 1C overnight in dark. The solution was then centrifuged at 13,000 rpm for 20 min. The unreacted oligonucleotides in the supernatant were recovered and used to improve conjugation efficacy. The precipitated hDAuNP beacons were further re-suspended in PBS (pH¼7.0). The process of centrifugation and re-suspension was repeated three times. 2.2.3. Fluorescence quenching and recovery properties Spectrofluorometer (F96, Lengguang, Shanghai, China) was used to study the fluorescence quenching and recovery properties of the beacons. The excitation and emission peaks of FITC are at about 450 nm and 520 nm, respectively. To obtain broad fluorescence signal, we scanned the fluorescence of FITC from 500 to 600 nm. hDAuNP beacons (1.5 nM) in PBS (pH¼7.0, 0.1% Tween20) was used to determine the fluorescence quenching properties of the beacons. This was followed by incubating 500 nM of the complementary DNA (50 -ATTGAGGTGCGGCATTATTT-30 ) or the mismatched DNA (50 -ATTGAG t TGC a GCA g TATTT-30 ) in the
2.2.4. Cytotoxicity of the hDAuNP beacon The cytotoxicity of the beacon on MCF-7 and C6 cell lines were investigated. Briefly, cells were plated in 96-well microtiter plates at initial densities of 3000 cells per well in RPMI1640 Medium and cultured for 24 h at a 37 1C in a humidified atmosphere of 5% CO2. The solution of hDAuNP beacons was treated by 0.22 mm filter membrane. Cells were then incubated with the beacons at concentrations of 0.5 nM, 1 nM, and 2 nM. Cell viability was calculated based on the colorimetric MTT assay. Absorption of the samples was measured with a Bio-RAD Model 680 Microplate Reader at 570 nm and 630 nm. All experiments were carried out in triplicates.
2.2.5. Cellular uptake of hDAuNP beacons TEM (200 kv, JEM-2100, JEOL, Japan) was used to image the intracellular gold particles during the beacon incubation. Briefly, cells were incubated with 1.5 nM hDAuNP beacons for 12 h at 37 1C in 5% CO2. Afterwards, the medium was discarded, and the cells were thoroughly washed three times with PBS buffer (pH¼7.4). Cells were then detached from the culture dish and centrifuged at 5000 rpm for 5 min, and the supernatant was removed. The cell pellets were fixed in a 0.1 M PBS solution (pH¼7.4) containing 2.5% gluteraldehyde and 4% paraformaldehyde for 1 h. They were then rinsed with 0.1 M PBS (pH¼7.4), embedded in 2% agarose gel, post-fixed in 4% osmium tetroxide (caution! extremely toxic) solution for 1 h, rinsed with distilled water, stained with 0.5% uranyl acetate for 1 h, dehydrated in a graded series of ethanol (30, 60, 70, 90, and 100%), and embedded in epoxy resin. The resin was polymerized at 60 1C for 48 h. Ultrathin sections (50–70 nm) obtained with a LKB ultramicrotome were stained with 5% aqueous uranyl acetate and 2% aqueous lead citrate and imaged under TEM. 2.2.6. Qualitative imaging STAT5B mRNA in MCF-7 and C6 cell lines Cells were grown on glass bottom wells to 50% confluence and were then treated with media containing hDAuNP beacons (1 nM) for 16 h. The fluorescence signal was recovered after the complete hybridization of the beacon oligonucleotide with that of STAT5B in the living cells. The cells were washed three times with PBS (pH 7.4). The recovered fluorescence signals were imaged under a microscope (Olympus FV300 LSM) with excitation and emission wavelengths at 488 nm and 520 nm, respectively. 2.2.7. Quantitative measurement by flow cytometry To obtain a quantitative data, flow cytometry was used to measure the recovered fluorescence signal. Cells were treated in the same way as in the imaging measurement. After washing with PBS (pH 7.4), the cells were detached from the growth surface using the trypsin, and collected. Flow cytometry was performed using a BD FACSCanto flow cytometer with 488 nm excitation. 2.2.8. Assessment of STAT5B expression in MCF-7 and C6 by RT-PCR RT-PCR was used to correlate the expression of STAT5B with the recovered fluorescence signal after hybridization. Briefly, total RNA was extracted from freshly isolated MCF-7 and C6 cells using RNeasy Kit. RNA (3 mg) from each cell line was converted into cDNA with Superscript III reverse transcriptase. Subsequently, 1.0 mL cDNA was used for PCR amplification with STAT5B-specific primers: sense, 50 -CAGCGCCACGTACATG-GACCA-30 , and antisense,
74
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
50 -GCGTGCGGGATCC-ACTGACTGTC-30 . The 1.0 mL cDNA was used for PCR amplification using actin-specific primers: sense, 50 -GCGTGCGGGATCCACTGACTGTC-30 , and antisense, 50 -GCCGTCAGGCAGCTCGT-AGC-30 . The product (5 mL) was used for 2% agarose gel electrophoresis. The relative abundance of STAT5B mRNA transcript was normalized to actin expression. The standard deviation for these data was calculated from three independent experiments.
our study that thiol–thiol exchange can occur on the surface of AuNP by adding excess DTT. Intracellularly, this ligand exchange can also occur through the thiol group of GSH. The intracellular concentration of GSH is within the range of 1–10 mM, which is more than extracellular thiol levels (Anderson, 1998; Sies, 1999). Our results show that the hDAuNP beacons were stable against GSH at a concentration of 10 mM. The packing of the hairpin DNA on the gold nanoparticle surface likely caused steric inhibition of nuclease degradation. Thus, the prepared hDAuNP beacons are stable inside cells and the detected fluorescence is related to the level of STAT5B mRNA.
3. Results and discussion 3.1. Characterization of hDAuNP beacon The absorption spectra showed that the hDAuNP beacon possesses the same absorption peak at 520 nm with the bare gold nanoparticles (Fig. S1a). The absorption peak of hairpin DNA at 260 nm was not detected clearly (Fig. S1a) because there were about 36 strands of hairpin DNA per gold nanoparticle, resulting in the high absorption of the gold nanoparticles at 260 nm compared with that of hairpin DNA. The hydrodynamic diameter of the beacon and bare Au particles were measured by dynamic light scattering (DLS) (Fig. S1b). It indicated that the beacon exhibited larger diameter (32 nm in average) compared with the bare Au particles (20 nm in average), providing evidence that the hairpin DNA had assembled to the surface of nanoparticles. In addition, the hydrodynamic diameters of beacons covered a broad size distribution (27 45 nm) rather than a narrow diameter range. This could be attributed to the different amounts of DNA molecules per gold particle. The particle size of hDAuNP beacon and bare AuNP were further observed under a transmission electron microscope (Fig. S1c and d). TEM indicated that the diameter of gold core of beacon is same as that of bare Au particle (15 nm in average), and the conjugation of the hairpin DNA had no appreciable effect on the size or shape of the resulting nanoparticles and did not induce AuNPs aggregation. The oligonucleotide-to-particle ratio was calculated to be 36 strands in average per hDAuNP beacon. 3.2. Stability of hDAuNP beacons The stability of hDAuNP beacons against degradation by DNase I and damage by GSH was quantified using a fluorescence assay (Fig. S2). The addition of the DTT resulted in the rapid increase in the fluorescence associated with FITC release from the surface of AuNPs due to thiol-exchange with the excess DTT. However, the fluorescence increased slowly after the addition of DNase I. More interestingly, the solutions of the beacons exhibited a low fluorescence signal when GSH was added, similar to that without any agents. These results demonstrate that the fluorescence emission resulted from the degradation of DNA or thiol-exchange, which release the fluorophore from the quenching effect of the AuNP surface. The process was monitored throughout the duration of the reaction using a spectrofluorometer for reading hDAuNP beaconspecific emission. The degradation rate of hDAuNP beacons by DNase I was evaluated from the slope of the linear region of the degradation curves (Jayagopal et al., 2010), which was 0.041 nmol/min for DNase I in our study. However, a previous fluorophore–quencher paired molecular beacons was reported to exhibit degradation rates of up to 1.25 nmol/min (Santangelo et al., 2006), and gold-linear oligonucleotide probes for live cell mRNA detection were degraded at a rate of 0.275 nmol/min (Seferos et al., 2007). The degradation rate of hDAuNP beacons was lower than 0.1 nmol/min in our study, which facilitate imaging of mRNA with higher target to background ratios. Obviously, our beacons exhibited improved stability against nuclease degradation compared to previous approaches. It was confirmed in
3.3. Fluorescence quenching and recovery properties To characterize the fluorescence quenching and recovery properties of the beacons for their complementary target, fluorescence of the beacon was measured before and after addition of target or mismatched DNA (Fig. 2). In the absence of a target, the solution of beacons exhibited a low fluorescence signal similar to that of the bare AuNP solution. The addition of the target resulted in significant increase in the hDAuNP beacon fluorescence. After adding mismatched DNA as control, the solution also showed a fluorescence increase. However, this signal was easily distinguished from that of the fully complementary target because it is 70% less intense. These findings confirmed that hDAuNP beacon was specific for the target oligonucleotide sequences. The quenching efficiency (QE) of the probe is defined as 100 (1(fclosed/fopen)), where fclosed is the fluorescence intensity of beacon in the absence of target, and fopen is its fluorescence when bound to target. By this method, the quenching efficiency of hDAuNP beacon was up to 90% (Fig. 2), which improves the target to background ratio of detection. The unique optical properties of gold nanoparticles were used in hDAuNP beacons. Compared to the commonly used molecular quenchers, AuNPs quench fluorescence with a greater efficiency (Dubertret et al., 2001) and over greater distances (Dulkeith et al., 2005). We designed the beacons using 15 nm AuNP because these nanoparticles are efficient fluorescence quencher and can be densely functionalized with oligonucleotides (Alivisatos et al., 1996). 3.4. Cytotoxicity of the hDAuNP beacon The cytotoxicity of hDAuNP beacons was tested on both human breast cancer MCF-7 and mouse glioma C6 cell lines.
Fig. 2. Fluorescence spectra of hDAuNP beacon before and after addition of target DNA or mismatched DNA. In the absence of a target or the addition of mismatched DNA, the solutions of beacons exhibited a low fluorescence signal. The addition of the target resulted in significantly increase in the fluorescence.
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
Cell viability was determined by the MTT assay following 24 h of continuous exposure to the beacons or bare AuNPs (Fig. 3). Both bare 15 nm gold nanoparticles and beacons did not appear to be toxic at concentrations up to 2 nM. Gold nanoparticles are widely used in biomedical imaging and diagnostic tests. Based on their established application in the laboratory and the chemical stability of Au0, gold nanoparticles are expected to be safe. In recent reports, the cytotoxicity of these particles in four cell lines representing major functional cell types was tested (Pan et al., 2007). Connective tissue fibroblasts, epithelial cells, macrophages and melanoma cells proved most sensitive to gold particles of 1.4 nm in size, which caused predominantly rapid cell death within 12 h. In contrast, gold particles with diameter of 15 nm were shown to be nontoxic at concentrations up to 60-fold higher than 1.4 nm gold particles. Therefore, the cellular response is size dependent. This factor played an important role in the choice of the 15 nm AuNP used in this study. The MTT assay showed that 80 85% of the cells incubated with the beacons were still metabolically active at concentrations up to 2 nM (Fig. 3). The result revealed that the beacon from 0.5 nM to 2 nM did not remarkable alter the cell viability, supporting the safety and effectiveness of the beacon for in vivo imaging.
Fig. 3. Cytotoxicity of the bare AuNP and hDAuNP beacon. Cell viability was determined by the MTT assay following 24 h of continuous exposure to the beacons or bare AuNPs. Both bare 15 nm gold nanoparticles and beacons did not appear to be toxic at concentrations up to 2 nM.
75
3.5. Cellular uptake of hDAuNP beacons The uptake of the beacons into cells was confirmed by TEM (Fig. 4). The beacons were clustered in a subcellular location that appeared to be endocytic vesicles. After incubation with cells, the beacons were trapped in vesicles that were subsequently internalized, presumably by endocytosis (Fig. 4a). Further experiments would be necessary to conclusively confirm the exact intracellular localization of the nanoparticles. After initial internalization, the beacons were released into the cytoplasm, but they did not enter the nucleus, even after a longer incubation time (Fig. 4b). Interestingly, the images showed that the gross morphology of the beacons had not changed dramatically, which appeared as 15 nm spheres, even after cell internalization (Fig. 4c). The ability of gold nanoparticles to enter the cell without using a transfection agent is an important feature that is useful for targeted DNA or drug delivery.
3.6. Detection of mRNA in living cells The above experiments indicated that hDAuNP beacons could be taken up by living cells with low inherent cytotoxicity and higher stability. Thus, it can be subsequently imaged in living cells. To accomplish this goal, cells were cultured on glass microscope cover slips, incubated with hDAuNP beacons, and imaged using scanning confocal microscopy (Fig. 5). MCF-7 cells treated with the STAT5B hDAuNP beacons were highly fluorescent compared with C6 cell line (mouse glioma), which was used as a control because it does not contain the human STAT5B transcript. To quantify the intracellular fluorescent signals of hDAuNP beacons, cells treated with probes were analyzed by flow cytometry. Due to the capability of flow cytometry to allow the collection of fluorescence data from a large population of cells, fluorescence intensity variations and experimental artifacts were eliminated. These variations are usually observed using other techniques such as regular fluorescence imaging, which only allow the examination of a small sample of cells. Flow cytometry measurements revealed that MCF-7 cells treated with STAT5B hDAuNP beacons were highly fluorescent and displayed 4.7 times more fluorescence than that of C6 cell models. These flow cytometry experiments were consistent with the confocal imaging and demonstrated the uniform cellular internalization and intracellular fluorescent signaling of hDAuNP beacons (Fig. 5). These results indicated the relative high expression of STAT5B in MCF-7 human breast cancer cells and minimal expression of STAT5B in C6 mouse glioma cells.
Fig. 4. TEM images of cellular uptake of hDAuNP beacons. (a) hDAuNP beacons were taken up by cells. (b) The beacons are in the cytoplasm (Cp), but not in the nucleus (Nu). (c) The beacons had not changed dramatically, which appeared as 15 nm spheres even after being taken up by the cells.
76
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
Fig. 5. Fluorescence images of human STAT5B-expressing MCF-7 cells (Fig. 5a) and non-human STAT5B-expressing C6 cells (Fig. 5b), treated with STAT5B beacon and a live-cell nuclear stain with Hoechst33342 (blue). DIC composite (left), Hoechst33342 (center) and STAT5B beacon (right). Flow cytometry data are shown below image. The mean fluorescence of STAT5B beacon in MCF-7 and C6 cells is 176 (Fig. 5c) and 37 (Fig. 5d), respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
4. Conclusion In this study, we have designed, synthesized, and characterized an intracellular mRNA beacon that could detect intracellular STAT5B mRNA levels in living cells. This beacon reported the presence of target STAT5B mRNA through specific hybridization of complementary oligonucleotides. It can be used to study other JAK-STAT signaling pathway and visualize STAT5B gene expression in real time. The method described could facilitate rapid identification of different stages of tumor progression and assess treatment outcomes. In addition, the hDAuNP beacons may also be useful in other areas such as the discovery of new molecular targets, early diagnostic strategies and real-time drug validation studies.
Acknowledgments Fig. 6. Relative expression of STAT5B in MCF-7 and C6 cell lines. The level of STAT5B mRNA in MCF-7 cell lines was 5.1 times than that in C6 cell lines.
3.7. STAT5B expression assessed by RT-PCR To evaluate the above living cell mRNA detection strategy, the relative amount of STAT5B mRNA was measured using reversetranscription PCR (RT-PCR), as shown in Fig. 6. STAT5B mRNA level was normalized to actin mRNA. The level of STAT5B mRNA in MCF-7 cell lines was higher than that in C6 cell lines by a factor of 5.1 (Fig. 6). The expression difference between the two types of cells was similar to result of the fluorescence imaging in live cells. It demonstrated that this beacon strategy is useful for detecting human STAT5B mRNA in living cells.
The authors gratefully acknowledge the funding support from the National Natural Science Foundation of China (NSFC 30672015, 30700779, 30800257, 30970776, 81000666, 81071194, 31050110123, 81171395), Graduate Innovation Project of Jiangsu Province (CX09B_288Z) and the major project from the Ministry of Science and Technology for new drug development (2009ZX09310004).
Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2012.06.062.
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
References Anderson, M.E., 1998. Chemico-biological Interactions 111–112, 1–14. Alivisatos, P.A., Johnsson, P.K., Peng, X., Wilson, E.T., Loweth Jr., J.C., Bruchez, P.M., Schultz, G.P., 1996. Nature 382, 609–611. Bassell, G.J., Powers, C.M., Taneja, K.L., Singer, R.H., 1994. The Journal of Cell Biology 126 (4), 863–876. Bishop, J.M., 1987. Science 235 (4786), 305–311. Cantley, L.C., 2002. Science 296 (5573), 1655–1657. Darnell, J.E., 2002. Nature Reviews Cancer 2 (10), 740–749. Darnell Jr., J.E., 1997. Science 277 (5332), 1630–1635. Darnell Jr., J.E., Kerr, I.M., Stark, G.R., 1994. Science 264 (5164), 1415–1421. Dubertret, B., Calame, M., Libchaber, A.J., 2001. Nature Biotechnology 19 (4), 365–370. Dulkeith, E., Ringler, M., Klar, T.A., Feldmann, J., Munoz Javier, A., Parak, W.J., 2005. Nano Letters 5 (4), 585–589. Fox, E.M., Bernaciak, T.M., Wen, J., Weaver, A.M., Shupnik, M.A., Silva, C.M., 2008. Molecular Endocrinology 22 (8), 1781–1796. Frens, G., 1973. Nature (London) Physical Science 241, 20–22. Gong, C., Maquat, L.E., 2011. Nature 470 (7333), 284–288. Gu, L., Dagvadorj, A., Lutz, J., Leiby, B., Bonuccelli, G., Lisanti, M.P., Addya, S., Fortina, P., Dasgupta, A., Hyslop, T., Bubendorf, L., Nevalainen, M.T., 2010. American Journal of Pathology 176 (4), 1959–1972. Hahn, W.C., Weinberg, R.A., 2002. The New England Journal of Medicine 347 (20), 1593–1603. Harry, S.R., Hicks, D.J., Amiri, K.I., Wright, D.W., 2010. Chemical Communications 46 (30), 5557–5559. Jayagopal, A., Halfpenny, K.C., Perez, J.W., Wright, D.W., 2010. Journal of the American Chemical Society 132 (28), 9789–9796. Kloosterman, W.P., Wienholds, E., de Bruijn, E., Kauppinen, S., Plasterk, R.H., 2006. Nature Methods 3 (1), 27–29.
77
Lennon, F.E., Hermann, C.D., Olivares-Navarrete, R., Rhee, W.J., Schwartz, Z., Bao, G., Boyan, B.D., 2010. Biomaterials 31 (30), 7640–7647. Liang, Q.C., Xiong, H., Zhao, Z.W., Jia, D., Li, W.X., Qin, H.Z., Deng, J.P., Gao, L., Zhang, H., Gao, G.D., 2009. Cancer Letters 273 (1), 164–171. Madathil, S.K., Nelson, P.T., Saatman, K.E., Wilfred, B.R., 2011. BioEssays 33 (1), 21–26. Moore, M.J., Wang, Q., Kennedy, C.J., Silver, P.A., 2010. Cell 142 (4), 625–636. Ottem, E.N., Poort, J.E., Wang, H., Jordan, C.L., Breedlove, S.M., 2010. Molecular and Cellular Endocrinology 328 (1–2), 40–46. Pan, Y., Neuss, S., Leifert, A., Fischler, M., Wen, F., Simon, U., Schmid, G., Brandau, W., Jahnen-Dechent, W., 2007. Small 3 (11), 1941–1949. Peng, X.H., Cao, Z.H., Xia, J.T., Carlson, G.W., Lewis, M.M., Wood, W.C., Yang, L., 2005. Cancer Research 65 (5), 1909–1917. Qiao, G., Gao, Y., Li, N., Yu, Z., Zhuo, L., Tang, B., 2011. Chemistry 17 (40), 11210–11215. Rosi, N.L., Giljohann, D.A., Thaxton, C.S., Lytton-Jean, A.K., Han, M.S., Mirkin, C.A., 2006. Science 312 (5776), 1027–1030. Sando, S., Kool, E.T., 2002. Journal of the American Chemical Society 124 (10), 2096–2097. Santangelo, P., Nitin, N., Bao, G., 2006. Annals of Biomedical Engineering 34 (1), 39–50. Santangelo, P.J., Nix, B., Tsourkas, A., Bao, G., 2004. Nucleic Acids Research 32 (6), e57. Seferos, D.S., Giljohann, D.A., Hill, H.D., Prigodich, A.E., Mirkin, C.A., 2007. Journal of the American Chemical Society 129 (50), 15477–15479. Sies, H., 1999. Free Radical Biology and Medicine 27 (9–10), 916–921. Tan, S.H., Nevalainen, M.T., 2008. Endocrine-Related Cancer 15 (2), 367–390. Tyagi, S., Kramer, F.R., 1996. Nature Biotechnology 14 (3), 303–308. Zhu, J., Lu, Y., Deng, C., Huang, G., Chen, S., Xu, S., Lv, Y., Mitchelson, K., Cheng, J., 2010. Analytical Chemistry 82 (12), 5304–5312.
Contents lists available at SciVerse ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
Visual detection of STAT5B gene expression in living cell using the hairpin DNA modified gold nanoparticle beacon Jianpeng Xue a, Lingling Shan a, Haiyan Chen a, Yang Li a, Hongyan Zhu a, Dawei Deng a, Zhiyu Qian b, Samuel Achilefu c,n, Yueqing Gu a,nn a Department of Biomedical Engineering, State Key Laboratory of Natural Medicines, School of Life Science and Technology, China Pharmaceutical University, Nanjing 210009, PR China b Department of Biomedical Engineering, Nanjing University of Aeronautics and Astronautics, PR China c Department of Radiology, School of Medicine, Washington University in St. Louis, MO, USA
a r t i c l e i n f o
abstract
Article history: Received 30 March 2012 Received in revised form 22 June 2012 Accepted 24 June 2012 Available online 9 October 2012
Signal transducer and activator of transcription 5B (STAT5B) is an important protein in JAK-STAT signaling pathway that is responsible for the metastasis and proliferation of tumor cells. Determination of the STAT5B messenger Ribonucleic Acid (mRNA) relating to the STAT5B expression provides insight into the mechanism of tumor progression. In this study, we designed and used a special hairpin deoxyribonucleic acid (DNA) for human STAT5B mRNA to functionalize gold nanoparticles, which served as a beacon for detecting human STAT5B expression. Up to 90% quenching efficiency was achieved. Upon hybridizing with the target mRNA, the hairpin DNA modified gold nanoparticle beacons (hDAuNP beacons) release the fluorophores attached at 50 end of the oligonucleotide sequence. The fluorescence properties of the beacon before and after the hybridization with the complementary DNA were confirmed in vitro. The stability of hDAuNP beacons against degradation by DNase I and GSH indicated that the prepared beacon is stable inside cells. The detected fluorescence in MCF-7 cancer cells correlates with the specific STAT5B mRNA expression, which is consistent with the result from PCR measurement. Fluorescence microscopy showed that the hDAuNP beacons internalized in cells without using transfection agents, with intracellular distribution in the cytoplasm rather than the nucleus. The results demonstrated that this beacon could directly provide quantitative measurement of the intracellular STAT5B mRNA in living cells. Compared to the previous approaches, this beacon has advantages of higher target to background ratio of detection and an increased resistance to nuclease degradation. The strategy reported in this study is a promising approach for the intracellular measurement of RNA or protein expression in living cells, and has great potential in the study of drug screening and discovery. & 2012 Elsevier B.V. All rights reserved.
Keywords: STAT5B mRNA Gold nanoparticle Beacon Hairpin DNA Imaging Visual detection
1. Introduction Cancer is well known as a genetic disease (Bishop, 1987; Hahn and Weinberg, 2002), which is usually related to the abnormity of a number of signaling pathways that especially include some transcription factors (Cantley, 2002; Darnell, 2002; Hahn and Weinberg, 2002). One of the most recently recognized oncogenic signaling pathways is JAK-STAT pathway, which involves the STAT proteins. This protein family comprises seven members— STAT1 to STAT4, STAT6, and the closely related STAT5A and STAT5B proteins (Darnell, 1997; Darnell et al., 1994). Recent n
Corresponding author. Tel.: þ1 314 362 8599; fax: þ 1 314 747 5191. Co-corresponding author. Tel.: þ86 25 83271080; fax: þ86 25 83271046. E-mail addresses: [email protected] (S. Achilefu), [email protected] (Y. Gu). nn
0956-5663/$ - see front matter & 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.bios.2012.06.062
studies have shown that Janus kinase 2-signal transducer and activator of transcription 5A/B (JAK2-STAT5A/B) signaling pathway is of significant interest in the search for new therapeutic strategies in both breast and prostate cancers. In prostate cancer, the components of the JAK2-STAT5A/B signaling pathway provide molecular targets for small-molecule inhibitors of cellular survival and growth signals. New evidence suggests that the STAT5A/B signaling pathway is involved in the transition from organconfined prostate cancer to hormone-refractory disease. This implies that the active JAK2-STAT5A/B signaling pathway potentially provides a method for pharmacological intervention in clinical prostate cancer progression. In addition, active STAT5A/B may serve as a prognostic marker for identifying primary prostate cancers that are likely to progress to metastatic disease. In breast cancer, the role of STAT5A/B is more complex. STAT5A/B may have a dual role in the regulation of malignant mammary
72
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
Fig. 1. Schematic diagram of hairpin DNA (black) assembling to gold nanoparticle (yellow) for synthesizing probe and detection of mRNA. The monolayer hairpin DNA was coupled to a gold nanoparticle surface by the thiol at 30 end. The hairpin conformation was maintained by the complementarity of the stem sequences, the fluorescence of the 50 dye was quenched by the AuNPs according to FRET. When the hDAuNP beacon hybridized specifically with target mRNA, the hairpin DNA sequence was opened, and then the 50 fluorophore was away from the surface of AuNP and overcome fluorescence quenching, fluorescence explored.
epithelium (Tan and Nevalainen, 2008). In particular, STAT5B is a crucial transcription factor involved in the proliferative and survival signaling in a number of solid tumors, including breast cancer and prostate cancer (Fox et al., 2008; Gu et al., 2010; Liang et al., 2009). Therefore, detection of STAT5B expression could be a useful strategy to stage and investigate tumor status. Following the discovery of the DNA structure half a century ago, RNA was long considered as a supporting player during cellular information transfer from DNA to proteins. The normal function of cells depends on accurate expression of a large number of protein-coding RNAs (messenger RNAs) and noncoding RNAs. Messenger RNA (mRNA) is a single-strand ribonucleic acid with genetic information, which is the blueprint for the cellular production of proteins. The mRNA level is related to the protein expression and the mRNA measurement indirectly reports the protein expression. Several techniques for detecting mRNA are available, including polymerase chain reaction PCR (Gong and Maquat, 2011; Moore et al., 2010) and in situ hybridization (Bassell et al., 1994; Bishop, 1987; Ottem et al., 2010). However, these techniques have several limitations associated with imaging fixed or lysed cells. Moreover, these techniques are timeconsuming and cannot be used to detect mRNA in living cells. To meet the increasing demand for live cell imaging, molecular probes for visualizing and detecting intracellular RNA, including those used for in situ staining (Kloosterman et al., 2006; Madathil et al., 2011), molecular beacons (Lennon et al., 2010; Peng et al., 2005; Tyagi and Kramer, 1996), and fluorescent resonance energy transfer (FRET) pairs (Sando and Kool, 2002; Santangelo et al., 2004; Zhu et al., 2010) have been developed and served as important tools to detect and quantify RNA in living systems in response to external stimuli (Santangelo et al., 2006). However, transfection of these probes into living cells is often difficult and typically requires additional agents for cellular internalization. Some of these agents are unstable in cellular environments. These factors could lead to a high background signal and diminish the inability to detect targets with high sensitivity. Recently, an oligonucleotide-functionalized gold nanoparticle (AuNP) probe was reported to address these limitations. Compared to previous approaches, AuNP probes uniquely offer efficient intracellular delivery without transfection or permeabilization reagents, an increased resistance to nuclease degradation and high target to background ratio of detection (Rosi et al., 2006; Seferos et al., 2007). However, since the fluorescent reporter of the probe used in previous studies was not hybridized to the target RNA, but was competitively displaced and diffuses away from the site of hybridization, it is difficult to use this strategy to determine intracellular mRNA localization. This challenge led to the development of a new mRNA detection methodology in living cells, where the monolayer hairpin DNA was coupled to a gold nanoparticle surface (Harry et al., 2010; Jayagopal et al., 2010; Qiao et al., 2011).
The probes take advantage of the highly efficient fluorescence quenching properties of gold (Dubertret et al., 2001), cellular uptake capability of oligonucleotide—nanoparticle conjugates without the use of transfection agents, the enzymatic stability of such conjugates (Rosi et al., 2006), and preserving spatial localization of target mRNA within the cell. Thus, this approach overcame many of the challenges of previous techniques by creating highly sensitive and effective intracellular probes for monitoring gene expression. The hairpin DNA structure consists of a 50 end with a fluorophore, a stem-loop-stem sequence and a 10-base polyadenine linker sequence followed by a thiol at the 30 end. The loop region was designed to hybridize with the target mRNA. Fig. 1 illustrates the schematic diagram of the probe. In the closed state, the hairpin conformation was maintained by the complementarity of the stem sequences. Additionally, in this state, the 30 thiol group enabled linkage to the surface of gold nanoparticle with sufficient proximity to permit AuNP quenching of dye fluorescence from the 50 dye. This probe is abbreviated as hDAuNP in this work. When the probe hybridized specifically with a target mRNA, the hairpin DNA sequence stretched out, positioning the 50 fluorophore away from the 30 AuNP at a sufficient distance to give off fluorescence. The use of hairpin DNA functionalized gold nanoparticle as a new detection methodology of mRNA in living cell have only been described for detecting survivin mRNA, cyclin D1 mRNA and tyrosinase gene expression (Jayagopal et al., 2010; Qiao et al., 2011). Although the structure of hDAuNP beacon used in this study is similar to those reported previously, our special hairpin DNA for human STAT5B mRNA used to modify gold nanoparticle was designed by bioinformatics method. The conjugates served as a beacon to visualize and quantify human STAT5B mRNA in living cells, which extended the usable range of this class of probes.
2. Materials and experiment methods 2.1. Chemical reagents Chloroauric acid (HAuCl4) was purchased from Shanghai Chemical Reagent Co., Ltd. Sodium citrate (Na3C6H5O7), Sodium borohydride (NaBH4), sodium chloride (NaCl), Magnesium chloride hexahydrate (MgCl2 6H2O), triethylamine, ethylacetate and Tween-20 were purchased from Sinopharm Chemical Reagent Co., Ltd. Dithiothreitol (DTT), glutathione (GSH), sodium dodecylsulphate (SDS) and dimethyl sulphoxide (DMSO) were purchased from Sigma-Aldrich Co. Roswell Park Memorial Institute medium 1640 (RPMI 1640), TRIzol reagent and tetrazolium salt (MTT) were purchased from America Invitrogen. Bovine Serum Albumin and DNase I were purchased from Sangon Biotech (Shanghai) Co., Ltd. All water used in this study was distilled and subsequently
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
purified to Millipore Milli-Q quality. All glassware used was cleaned in a bath of freshly prepared aqua regia solution (HCl/ HNO3 ¼ 3:1), then rinsed thoroughly with H2O before use.
73
above beacon solution for 1 h at 70 1C for complete hybridization. The solution was subsequently cooled gradually to 25 1C for 12 h in the dark, and the fluorescence of the solution was re-measured to study the recovery properties.
2.2. Experiment methods 2.2.1. Design of the oligonucleotides sequence The sequence of the STAT5B mRNA was obtained from the nucleotide database on the website of the National Center for Biotechnology Information (NCBI). Several 20-base mRNA recognition sequences were chosen for target and studied by extensive BLAST search analysis to evaluate specificity as the cellular mRNA target. The sequences were as follow: Sequence Sequence Sequence Sequence Sequence
1: 2: 3: 4: 5:
50 -GAAAGAATGTTTTGGAATCT-30 50 -AGGCTCACTATAACATGTAC-30 50 -TTGCCGTGCCTGACAAAGTG-30 50 -TTACTGAAGATCAAGCTGGG-30 50 -ATTGAGGTGCGGCATTATTT-30
By extensive BLAST search analysis, sequence 5 was identified as unique for STAT5B mRNA. The loop section of the hairpin DNA was designed according to the complementary base-pair specificity. GCGAG and CTCGC were used as the stem section of the hairpin DNA. Subsequently, the hairpin DNA modified by fluorescein isothiocyanate (FITC) at the 50 end and thiol at the 30 end was designed and ordered from Sangon Biotech (Shanghai) Co., Ltd. The following sequences were designed and prepared for this study: Hairpin DNA: 50 -(FITC) GCGAGAAATAATGCCGCACCTCAATCTCGCA (A)9SH-30 Complementary DNA: 50 -ATTGAGGTGCGGCATTATTT-30 Mismatched DNA: 50 -ATTGAG t TGC a GCA g TATTT-30
2.2.2. Synthesis of the hDAuNP beacon The gold particles with average diameter of 15 nm were synthesized by the method developed by Frens (1973). The above alkylthiol-modified hairpin oligonucleotides were first activated by 100 mM DTT in phosphate buffer (PBS, pH¼8.0) and then added to a solution of gold nanoparticles. The molar ratio of oligonucleotides to particles was 100:1. After 12 h incubation in the dark, 10% sodium dodecylsulphate and 2 M sodium chloride were added to achieve final concentrations of 0.1% and 0.1 M, respectively. An additional aliquot of sodium chloride was gradually added to achieve a final concentration of 0.3 M, and the mixture was kept at 4 1C overnight in dark. The solution was then centrifuged at 13,000 rpm for 20 min. The unreacted oligonucleotides in the supernatant were recovered and used to improve conjugation efficacy. The precipitated hDAuNP beacons were further re-suspended in PBS (pH¼7.0). The process of centrifugation and re-suspension was repeated three times. 2.2.3. Fluorescence quenching and recovery properties Spectrofluorometer (F96, Lengguang, Shanghai, China) was used to study the fluorescence quenching and recovery properties of the beacons. The excitation and emission peaks of FITC are at about 450 nm and 520 nm, respectively. To obtain broad fluorescence signal, we scanned the fluorescence of FITC from 500 to 600 nm. hDAuNP beacons (1.5 nM) in PBS (pH¼7.0, 0.1% Tween20) was used to determine the fluorescence quenching properties of the beacons. This was followed by incubating 500 nM of the complementary DNA (50 -ATTGAGGTGCGGCATTATTT-30 ) or the mismatched DNA (50 -ATTGAG t TGC a GCA g TATTT-30 ) in the
2.2.4. Cytotoxicity of the hDAuNP beacon The cytotoxicity of the beacon on MCF-7 and C6 cell lines were investigated. Briefly, cells were plated in 96-well microtiter plates at initial densities of 3000 cells per well in RPMI1640 Medium and cultured for 24 h at a 37 1C in a humidified atmosphere of 5% CO2. The solution of hDAuNP beacons was treated by 0.22 mm filter membrane. Cells were then incubated with the beacons at concentrations of 0.5 nM, 1 nM, and 2 nM. Cell viability was calculated based on the colorimetric MTT assay. Absorption of the samples was measured with a Bio-RAD Model 680 Microplate Reader at 570 nm and 630 nm. All experiments were carried out in triplicates.
2.2.5. Cellular uptake of hDAuNP beacons TEM (200 kv, JEM-2100, JEOL, Japan) was used to image the intracellular gold particles during the beacon incubation. Briefly, cells were incubated with 1.5 nM hDAuNP beacons for 12 h at 37 1C in 5% CO2. Afterwards, the medium was discarded, and the cells were thoroughly washed three times with PBS buffer (pH¼7.4). Cells were then detached from the culture dish and centrifuged at 5000 rpm for 5 min, and the supernatant was removed. The cell pellets were fixed in a 0.1 M PBS solution (pH¼7.4) containing 2.5% gluteraldehyde and 4% paraformaldehyde for 1 h. They were then rinsed with 0.1 M PBS (pH¼7.4), embedded in 2% agarose gel, post-fixed in 4% osmium tetroxide (caution! extremely toxic) solution for 1 h, rinsed with distilled water, stained with 0.5% uranyl acetate for 1 h, dehydrated in a graded series of ethanol (30, 60, 70, 90, and 100%), and embedded in epoxy resin. The resin was polymerized at 60 1C for 48 h. Ultrathin sections (50–70 nm) obtained with a LKB ultramicrotome were stained with 5% aqueous uranyl acetate and 2% aqueous lead citrate and imaged under TEM. 2.2.6. Qualitative imaging STAT5B mRNA in MCF-7 and C6 cell lines Cells were grown on glass bottom wells to 50% confluence and were then treated with media containing hDAuNP beacons (1 nM) for 16 h. The fluorescence signal was recovered after the complete hybridization of the beacon oligonucleotide with that of STAT5B in the living cells. The cells were washed three times with PBS (pH 7.4). The recovered fluorescence signals were imaged under a microscope (Olympus FV300 LSM) with excitation and emission wavelengths at 488 nm and 520 nm, respectively. 2.2.7. Quantitative measurement by flow cytometry To obtain a quantitative data, flow cytometry was used to measure the recovered fluorescence signal. Cells were treated in the same way as in the imaging measurement. After washing with PBS (pH 7.4), the cells were detached from the growth surface using the trypsin, and collected. Flow cytometry was performed using a BD FACSCanto flow cytometer with 488 nm excitation. 2.2.8. Assessment of STAT5B expression in MCF-7 and C6 by RT-PCR RT-PCR was used to correlate the expression of STAT5B with the recovered fluorescence signal after hybridization. Briefly, total RNA was extracted from freshly isolated MCF-7 and C6 cells using RNeasy Kit. RNA (3 mg) from each cell line was converted into cDNA with Superscript III reverse transcriptase. Subsequently, 1.0 mL cDNA was used for PCR amplification with STAT5B-specific primers: sense, 50 -CAGCGCCACGTACATG-GACCA-30 , and antisense,
74
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
50 -GCGTGCGGGATCC-ACTGACTGTC-30 . The 1.0 mL cDNA was used for PCR amplification using actin-specific primers: sense, 50 -GCGTGCGGGATCCACTGACTGTC-30 , and antisense, 50 -GCCGTCAGGCAGCTCGT-AGC-30 . The product (5 mL) was used for 2% agarose gel electrophoresis. The relative abundance of STAT5B mRNA transcript was normalized to actin expression. The standard deviation for these data was calculated from three independent experiments.
our study that thiol–thiol exchange can occur on the surface of AuNP by adding excess DTT. Intracellularly, this ligand exchange can also occur through the thiol group of GSH. The intracellular concentration of GSH is within the range of 1–10 mM, which is more than extracellular thiol levels (Anderson, 1998; Sies, 1999). Our results show that the hDAuNP beacons were stable against GSH at a concentration of 10 mM. The packing of the hairpin DNA on the gold nanoparticle surface likely caused steric inhibition of nuclease degradation. Thus, the prepared hDAuNP beacons are stable inside cells and the detected fluorescence is related to the level of STAT5B mRNA.
3. Results and discussion 3.1. Characterization of hDAuNP beacon The absorption spectra showed that the hDAuNP beacon possesses the same absorption peak at 520 nm with the bare gold nanoparticles (Fig. S1a). The absorption peak of hairpin DNA at 260 nm was not detected clearly (Fig. S1a) because there were about 36 strands of hairpin DNA per gold nanoparticle, resulting in the high absorption of the gold nanoparticles at 260 nm compared with that of hairpin DNA. The hydrodynamic diameter of the beacon and bare Au particles were measured by dynamic light scattering (DLS) (Fig. S1b). It indicated that the beacon exhibited larger diameter (32 nm in average) compared with the bare Au particles (20 nm in average), providing evidence that the hairpin DNA had assembled to the surface of nanoparticles. In addition, the hydrodynamic diameters of beacons covered a broad size distribution (27 45 nm) rather than a narrow diameter range. This could be attributed to the different amounts of DNA molecules per gold particle. The particle size of hDAuNP beacon and bare AuNP were further observed under a transmission electron microscope (Fig. S1c and d). TEM indicated that the diameter of gold core of beacon is same as that of bare Au particle (15 nm in average), and the conjugation of the hairpin DNA had no appreciable effect on the size or shape of the resulting nanoparticles and did not induce AuNPs aggregation. The oligonucleotide-to-particle ratio was calculated to be 36 strands in average per hDAuNP beacon. 3.2. Stability of hDAuNP beacons The stability of hDAuNP beacons against degradation by DNase I and damage by GSH was quantified using a fluorescence assay (Fig. S2). The addition of the DTT resulted in the rapid increase in the fluorescence associated with FITC release from the surface of AuNPs due to thiol-exchange with the excess DTT. However, the fluorescence increased slowly after the addition of DNase I. More interestingly, the solutions of the beacons exhibited a low fluorescence signal when GSH was added, similar to that without any agents. These results demonstrate that the fluorescence emission resulted from the degradation of DNA or thiol-exchange, which release the fluorophore from the quenching effect of the AuNP surface. The process was monitored throughout the duration of the reaction using a spectrofluorometer for reading hDAuNP beaconspecific emission. The degradation rate of hDAuNP beacons by DNase I was evaluated from the slope of the linear region of the degradation curves (Jayagopal et al., 2010), which was 0.041 nmol/min for DNase I in our study. However, a previous fluorophore–quencher paired molecular beacons was reported to exhibit degradation rates of up to 1.25 nmol/min (Santangelo et al., 2006), and gold-linear oligonucleotide probes for live cell mRNA detection were degraded at a rate of 0.275 nmol/min (Seferos et al., 2007). The degradation rate of hDAuNP beacons was lower than 0.1 nmol/min in our study, which facilitate imaging of mRNA with higher target to background ratios. Obviously, our beacons exhibited improved stability against nuclease degradation compared to previous approaches. It was confirmed in
3.3. Fluorescence quenching and recovery properties To characterize the fluorescence quenching and recovery properties of the beacons for their complementary target, fluorescence of the beacon was measured before and after addition of target or mismatched DNA (Fig. 2). In the absence of a target, the solution of beacons exhibited a low fluorescence signal similar to that of the bare AuNP solution. The addition of the target resulted in significant increase in the hDAuNP beacon fluorescence. After adding mismatched DNA as control, the solution also showed a fluorescence increase. However, this signal was easily distinguished from that of the fully complementary target because it is 70% less intense. These findings confirmed that hDAuNP beacon was specific for the target oligonucleotide sequences. The quenching efficiency (QE) of the probe is defined as 100 (1(fclosed/fopen)), where fclosed is the fluorescence intensity of beacon in the absence of target, and fopen is its fluorescence when bound to target. By this method, the quenching efficiency of hDAuNP beacon was up to 90% (Fig. 2), which improves the target to background ratio of detection. The unique optical properties of gold nanoparticles were used in hDAuNP beacons. Compared to the commonly used molecular quenchers, AuNPs quench fluorescence with a greater efficiency (Dubertret et al., 2001) and over greater distances (Dulkeith et al., 2005). We designed the beacons using 15 nm AuNP because these nanoparticles are efficient fluorescence quencher and can be densely functionalized with oligonucleotides (Alivisatos et al., 1996). 3.4. Cytotoxicity of the hDAuNP beacon The cytotoxicity of hDAuNP beacons was tested on both human breast cancer MCF-7 and mouse glioma C6 cell lines.
Fig. 2. Fluorescence spectra of hDAuNP beacon before and after addition of target DNA or mismatched DNA. In the absence of a target or the addition of mismatched DNA, the solutions of beacons exhibited a low fluorescence signal. The addition of the target resulted in significantly increase in the fluorescence.
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
Cell viability was determined by the MTT assay following 24 h of continuous exposure to the beacons or bare AuNPs (Fig. 3). Both bare 15 nm gold nanoparticles and beacons did not appear to be toxic at concentrations up to 2 nM. Gold nanoparticles are widely used in biomedical imaging and diagnostic tests. Based on their established application in the laboratory and the chemical stability of Au0, gold nanoparticles are expected to be safe. In recent reports, the cytotoxicity of these particles in four cell lines representing major functional cell types was tested (Pan et al., 2007). Connective tissue fibroblasts, epithelial cells, macrophages and melanoma cells proved most sensitive to gold particles of 1.4 nm in size, which caused predominantly rapid cell death within 12 h. In contrast, gold particles with diameter of 15 nm were shown to be nontoxic at concentrations up to 60-fold higher than 1.4 nm gold particles. Therefore, the cellular response is size dependent. This factor played an important role in the choice of the 15 nm AuNP used in this study. The MTT assay showed that 80 85% of the cells incubated with the beacons were still metabolically active at concentrations up to 2 nM (Fig. 3). The result revealed that the beacon from 0.5 nM to 2 nM did not remarkable alter the cell viability, supporting the safety and effectiveness of the beacon for in vivo imaging.
Fig. 3. Cytotoxicity of the bare AuNP and hDAuNP beacon. Cell viability was determined by the MTT assay following 24 h of continuous exposure to the beacons or bare AuNPs. Both bare 15 nm gold nanoparticles and beacons did not appear to be toxic at concentrations up to 2 nM.
75
3.5. Cellular uptake of hDAuNP beacons The uptake of the beacons into cells was confirmed by TEM (Fig. 4). The beacons were clustered in a subcellular location that appeared to be endocytic vesicles. After incubation with cells, the beacons were trapped in vesicles that were subsequently internalized, presumably by endocytosis (Fig. 4a). Further experiments would be necessary to conclusively confirm the exact intracellular localization of the nanoparticles. After initial internalization, the beacons were released into the cytoplasm, but they did not enter the nucleus, even after a longer incubation time (Fig. 4b). Interestingly, the images showed that the gross morphology of the beacons had not changed dramatically, which appeared as 15 nm spheres, even after cell internalization (Fig. 4c). The ability of gold nanoparticles to enter the cell without using a transfection agent is an important feature that is useful for targeted DNA or drug delivery.
3.6. Detection of mRNA in living cells The above experiments indicated that hDAuNP beacons could be taken up by living cells with low inherent cytotoxicity and higher stability. Thus, it can be subsequently imaged in living cells. To accomplish this goal, cells were cultured on glass microscope cover slips, incubated with hDAuNP beacons, and imaged using scanning confocal microscopy (Fig. 5). MCF-7 cells treated with the STAT5B hDAuNP beacons were highly fluorescent compared with C6 cell line (mouse glioma), which was used as a control because it does not contain the human STAT5B transcript. To quantify the intracellular fluorescent signals of hDAuNP beacons, cells treated with probes were analyzed by flow cytometry. Due to the capability of flow cytometry to allow the collection of fluorescence data from a large population of cells, fluorescence intensity variations and experimental artifacts were eliminated. These variations are usually observed using other techniques such as regular fluorescence imaging, which only allow the examination of a small sample of cells. Flow cytometry measurements revealed that MCF-7 cells treated with STAT5B hDAuNP beacons were highly fluorescent and displayed 4.7 times more fluorescence than that of C6 cell models. These flow cytometry experiments were consistent with the confocal imaging and demonstrated the uniform cellular internalization and intracellular fluorescent signaling of hDAuNP beacons (Fig. 5). These results indicated the relative high expression of STAT5B in MCF-7 human breast cancer cells and minimal expression of STAT5B in C6 mouse glioma cells.
Fig. 4. TEM images of cellular uptake of hDAuNP beacons. (a) hDAuNP beacons were taken up by cells. (b) The beacons are in the cytoplasm (Cp), but not in the nucleus (Nu). (c) The beacons had not changed dramatically, which appeared as 15 nm spheres even after being taken up by the cells.
76
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
Fig. 5. Fluorescence images of human STAT5B-expressing MCF-7 cells (Fig. 5a) and non-human STAT5B-expressing C6 cells (Fig. 5b), treated with STAT5B beacon and a live-cell nuclear stain with Hoechst33342 (blue). DIC composite (left), Hoechst33342 (center) and STAT5B beacon (right). Flow cytometry data are shown below image. The mean fluorescence of STAT5B beacon in MCF-7 and C6 cells is 176 (Fig. 5c) and 37 (Fig. 5d), respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
4. Conclusion In this study, we have designed, synthesized, and characterized an intracellular mRNA beacon that could detect intracellular STAT5B mRNA levels in living cells. This beacon reported the presence of target STAT5B mRNA through specific hybridization of complementary oligonucleotides. It can be used to study other JAK-STAT signaling pathway and visualize STAT5B gene expression in real time. The method described could facilitate rapid identification of different stages of tumor progression and assess treatment outcomes. In addition, the hDAuNP beacons may also be useful in other areas such as the discovery of new molecular targets, early diagnostic strategies and real-time drug validation studies.
Acknowledgments Fig. 6. Relative expression of STAT5B in MCF-7 and C6 cell lines. The level of STAT5B mRNA in MCF-7 cell lines was 5.1 times than that in C6 cell lines.
3.7. STAT5B expression assessed by RT-PCR To evaluate the above living cell mRNA detection strategy, the relative amount of STAT5B mRNA was measured using reversetranscription PCR (RT-PCR), as shown in Fig. 6. STAT5B mRNA level was normalized to actin mRNA. The level of STAT5B mRNA in MCF-7 cell lines was higher than that in C6 cell lines by a factor of 5.1 (Fig. 6). The expression difference between the two types of cells was similar to result of the fluorescence imaging in live cells. It demonstrated that this beacon strategy is useful for detecting human STAT5B mRNA in living cells.
The authors gratefully acknowledge the funding support from the National Natural Science Foundation of China (NSFC 30672015, 30700779, 30800257, 30970776, 81000666, 81071194, 31050110123, 81171395), Graduate Innovation Project of Jiangsu Province (CX09B_288Z) and the major project from the Ministry of Science and Technology for new drug development (2009ZX09310004).
Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2012.06.062.
J. Xue et al. / Biosensors and Bioelectronics 41 (2013) 71–77
References Anderson, M.E., 1998. Chemico-biological Interactions 111–112, 1–14. Alivisatos, P.A., Johnsson, P.K., Peng, X., Wilson, E.T., Loweth Jr., J.C., Bruchez, P.M., Schultz, G.P., 1996. Nature 382, 609–611. Bassell, G.J., Powers, C.M., Taneja, K.L., Singer, R.H., 1994. The Journal of Cell Biology 126 (4), 863–876. Bishop, J.M., 1987. Science 235 (4786), 305–311. Cantley, L.C., 2002. Science 296 (5573), 1655–1657. Darnell, J.E., 2002. Nature Reviews Cancer 2 (10), 740–749. Darnell Jr., J.E., 1997. Science 277 (5332), 1630–1635. Darnell Jr., J.E., Kerr, I.M., Stark, G.R., 1994. Science 264 (5164), 1415–1421. Dubertret, B., Calame, M., Libchaber, A.J., 2001. Nature Biotechnology 19 (4), 365–370. Dulkeith, E., Ringler, M., Klar, T.A., Feldmann, J., Munoz Javier, A., Parak, W.J., 2005. Nano Letters 5 (4), 585–589. Fox, E.M., Bernaciak, T.M., Wen, J., Weaver, A.M., Shupnik, M.A., Silva, C.M., 2008. Molecular Endocrinology 22 (8), 1781–1796. Frens, G., 1973. Nature (London) Physical Science 241, 20–22. Gong, C., Maquat, L.E., 2011. Nature 470 (7333), 284–288. Gu, L., Dagvadorj, A., Lutz, J., Leiby, B., Bonuccelli, G., Lisanti, M.P., Addya, S., Fortina, P., Dasgupta, A., Hyslop, T., Bubendorf, L., Nevalainen, M.T., 2010. American Journal of Pathology 176 (4), 1959–1972. Hahn, W.C., Weinberg, R.A., 2002. The New England Journal of Medicine 347 (20), 1593–1603. Harry, S.R., Hicks, D.J., Amiri, K.I., Wright, D.W., 2010. Chemical Communications 46 (30), 5557–5559. Jayagopal, A., Halfpenny, K.C., Perez, J.W., Wright, D.W., 2010. Journal of the American Chemical Society 132 (28), 9789–9796. Kloosterman, W.P., Wienholds, E., de Bruijn, E., Kauppinen, S., Plasterk, R.H., 2006. Nature Methods 3 (1), 27–29.
77
Lennon, F.E., Hermann, C.D., Olivares-Navarrete, R., Rhee, W.J., Schwartz, Z., Bao, G., Boyan, B.D., 2010. Biomaterials 31 (30), 7640–7647. Liang, Q.C., Xiong, H., Zhao, Z.W., Jia, D., Li, W.X., Qin, H.Z., Deng, J.P., Gao, L., Zhang, H., Gao, G.D., 2009. Cancer Letters 273 (1), 164–171. Madathil, S.K., Nelson, P.T., Saatman, K.E., Wilfred, B.R., 2011. BioEssays 33 (1), 21–26. Moore, M.J., Wang, Q., Kennedy, C.J., Silver, P.A., 2010. Cell 142 (4), 625–636. Ottem, E.N., Poort, J.E., Wang, H., Jordan, C.L., Breedlove, S.M., 2010. Molecular and Cellular Endocrinology 328 (1–2), 40–46. Pan, Y., Neuss, S., Leifert, A., Fischler, M., Wen, F., Simon, U., Schmid, G., Brandau, W., Jahnen-Dechent, W., 2007. Small 3 (11), 1941–1949. Peng, X.H., Cao, Z.H., Xia, J.T., Carlson, G.W., Lewis, M.M., Wood, W.C., Yang, L., 2005. Cancer Research 65 (5), 1909–1917. Qiao, G., Gao, Y., Li, N., Yu, Z., Zhuo, L., Tang, B., 2011. Chemistry 17 (40), 11210–11215. Rosi, N.L., Giljohann, D.A., Thaxton, C.S., Lytton-Jean, A.K., Han, M.S., Mirkin, C.A., 2006. Science 312 (5776), 1027–1030. Sando, S., Kool, E.T., 2002. Journal of the American Chemical Society 124 (10), 2096–2097. Santangelo, P., Nitin, N., Bao, G., 2006. Annals of Biomedical Engineering 34 (1), 39–50. Santangelo, P.J., Nix, B., Tsourkas, A., Bao, G., 2004. Nucleic Acids Research 32 (6), e57. Seferos, D.S., Giljohann, D.A., Hill, H.D., Prigodich, A.E., Mirkin, C.A., 2007. Journal of the American Chemical Society 129 (50), 15477–15479. Sies, H., 1999. Free Radical Biology and Medicine 27 (9–10), 916–921. Tan, S.H., Nevalainen, M.T., 2008. Endocrine-Related Cancer 15 (2), 367–390. Tyagi, S., Kramer, F.R., 1996. Nature Biotechnology 14 (3), 303–308. Zhu, J., Lu, Y., Deng, C., Huang, G., Chen, S., Xu, S., Lv, Y., Mitchelson, K., Cheng, J., 2010. Analytical Chemistry 82 (12), 5304–5312.