Visual detection of white spot syndrome virus using DNA-functionalized gold nanoparticles as probes combined with loop-mediated isothermal amplification

Molecular and Cellular Probes 27 (2013) 71e79

Contents lists available at SciVerse ScienceDirect

Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr

Visual detection of white spot syndrome virus using DNA-functionalized gold nanoparticles as probes combined with loop-mediated isothermal amplification Yortyot Seetang-Nun a, b, Wansadaj Jaroenram a, Siriporn Sriurairatana a, Rungkarn Suebsing a, b, Wansika Kiatpathomchai a, b, * a b

CENTEX Shrimp, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Pathumthani 12120, Thailand

a r t i c l e i n f o

a b s t r a c t

Article history: Received 10 July 2012 Accepted 23 November 2012 Available online 1 December 2012

The integration of loop-mediated isothermal amplification (LAMP) and DNA-functionalized AuNPs as visual detection probes (LAMPeAuNPs) was developed and applied for the detection of white spot syndrome virus (WSSV) from Penaeid shrimp in this study. The principle of this combination assay relies on the basis of stability characteristics of the DNA-functionalized AuNPs upon hybridization with the complementary target DNA toward salt-induced aggregation. If the detected target DNA is not complementary to the ssDNA probes, the DNA-functionalized AuNPs will be aggregated due to the screening effect of salt, resulting in the change of solution color from red to blue/gray and shift of the surface plasmon peak to longer wavelength. While the DNA-functionalized AuNPs are perfectly matched to the detected target DNA, the color of solution still remains red in color and no surface plasmon spectral shift. This assay provides simply technique, time-saving and its detection results could be achieved qualitatively and quantitatively by visualization using the naked eye due to the colorimetric change and by measurement using the UVevis spectroscopy due to the surface plasmon spectral shift, respectively. In this study, LAMPeAuNPs assay was successfully developed with the detection of WSSVLAMP generated product at 0.03 mg/reaction, and showed the sensitivity of 2
102 copies WSSV plasmid DNA, that is comparable to the most sensitive method reported to date. The LAMPeAuNPs assay described in this study revealed a highly sensitive, rapid and reliable diagnostic protocol for detection of WSSV. This technique has a potential as a routine method for assessing the infectious diseases in Penaeid shrimp not only for WSSV, but also for other shrimp pathogens, and can be useful tool in field conditions for the diagnosis or surveillance programs. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Colorimetric assay DNA-functionalized gold nanoparticles Loop-mediated isothermal amplification White spot syndrome virus

1. Introduction White spot syndrome virus (WSSV), a causative agent of white spot disease (WSD), is a rod-shaped enveloped double-stranded DNA virus belonging to the genus Whispovirus of the family Nimaviridae [1]. It was first discovered in shrimp farms in Taiwan in the early 1990s [2], and then rapidly spread to different parts of the world within decades, leading to large economic losses in shrimp industry worldwide [3]. It has been reported that infection with WSSV can cause a high rate of mortality in cultured shrimps up to 100% within a few day post-infections [2,4,5]. In addition, WSSV can also infect a wide range of hosts including both decapod and

* Corresponding author. CENTEX Shrimp, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand. Tel.: þ66 2 2015878; fax: þ66 2 3547344. E-mail address: [email protected] (W. Kiatpathomchai). 0890-8508/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.mcp.2012.11.005

non-decapod animals with more than hundred species described to date [3,6e8]. Molecular tools such as polymerase chain reaction (PCR) and nested PCR, originally developed by Lo et al. [9,10], have been widely used and recommended by the Office of International Epizootics (OIE) to be used as standard methods for the detection of WSSV [11,12]. Despite their excellence in specificity and sensitivity, these methods were not suited in some circumstances due to their complications, the requirement of thermal cycler, time-consuming, and labor-intensive. Moreover, the classical agarose gel electrophoresis with ethidium bromide staining, following the visualization under the ultraviolet (UV) transilluminator required to analyze the resulting PCR products. Therefore, these features could be limited their applications, particularly in the resource-limited areas and nonlaboratory environments such as at the pond or station sites. To overcome these limitations, we have recently developed a novel ultrasensitive assay based on the loop-mediated isothermal ampli

72

Y. Seetang-Nun et al. / Molecular and Cellular Probes 27 (2013) 71e79

fication (LAMP) reaction, originally invented by Notomi et al. [13,14], to detect the WSSV under isothermal conditions using a simple heat block. The assay has high sensitivity and specificity in a similar manner to those of the nested PCR, analyzed based on the IQ2000Ô WSSV Detection and Prevention System (Farming IntelliGene Technology Corporation, Taiwan), while the total assay time was remarkably reduced from hours to minutes [15]. The combination of WSSV-LAMP products with the conventional nucleic acid lateral-flow immunoassay (NALFIA) was based on the sequence-specific probe hybridization, followed by the proteineligand interactions which allowed to detect by the naked eye without the need of specialized instruments [15]. Thus, this novel assay is considered to be an ideal system for the point-of-care (POC) detection of WSSV. Such assay has also been successfully applied to detect many kinds of shrimp infectious viruses such as taura syndrome virus (TSV) [16], hepatopancreatic parvovirus (HPV) [17], infectious myonecrosis virus (IMNV) [18], monodon baculovirus (MBV) [19], Macrobrachium rosenbergii nodavirus (MrNV) [20], infectious hypodermal and hematopoietic necrosis virus (IHHNV) [21], and Laem-Singh virus (LSNV) [22]. The use of LAMP less time is required for detection, allowing more time to use management practices to minimize the spread of disease by screening the specific pathogen-free stocks which is in turn to prevent the introduction of disease-causing agents into culture systems. In this study, to establish next generation detection platforms of WSSV, gold nanoparticles (AuNPs) were employed to develop a novel colorimetric assay for detection WSSV-LAMP amplified product due to its ability to interact with, disulfides modified DNA and the ability to change color on self-assembly. A novel colorimetric assay for the detection of WSSV-LAMP amplified product that relies based on the stability characteristics of the DNA-functionalized AuNPs upon hybridization with their complementary target DNA against salt-induced aggregation. 2. Materials and methods

USA). Transmission electron microscopy (TEM) was performed using the Hitachi H-7100 transmission electron microscope at 100 kV of the accelerating voltage (Hitachi High-Technologies Co., Japan). TEM images were captured using the Gatan CCD cameraES500W-782 and analyzed by the Gatan DigitalMicrographÔ software package (Gatan Inc., USA). TEM samples were prepared by dropping 2 mL of AuNPs solution on the formvar-coated copper grid, and the excess liquids were then wiped by the filter paper and dried at room temperature overnight. Color photographs were recorded using the Fuji FinePix S3Pro digital camera (Fuji, Japan). Electrophoresis was carried out on 2.5% agarose gel using the MupidÒ-exU Gel electrophoresis system (Takara Bio Inc., Japan). 2.3. Analytical procedures 2.3.1. Preparation of the DNA-functionalized AuNPs A monosense ssDNA probe was designed to the sequence spanned by the B1ceB2c region of the WSSV-LAMP amplicon and labeled with a thiol group at the 50 -end (Table 1). DNAfunctionalized AuNPs were prepared according to previously described [23] with minor modifications. In brief, 1 mL of 7.6 nM colloidal AuNPs solution was incubated with 1 mM 50 -thiol-modified ssDNA probes at 45  C overnight. Then, the solution was transferred to phosphate buffer (10 mM sodium phosphate buffer, pH 7.6) containing 0.1 M NaCl and 0.01% SDS, and incubated for another 48 h. The unbound ssDNA probes were removed by centrifugation at 20,000
g 4  C for 20 min, and then the obtained DNA-functionalized AuNPs were washed once with phosphate buffer containing 0.1 M NaCl and 0.01% SDS, and twice with phosphate buffer containing 0.3 M NaCl and 0.01% SDS. Finally, the DNA-functionalized AuNPs were resuspended in phosphate buffer containing 0.3 M NaCl and 0.01% SDS, and stored at 4  C until used. The concentration of DNA-functionalized AuNPs was determined according to BeereLambert law using the extinction coefficient of 1
108 (M cm)1 for 10 nm AuNPs at 520 nm [24].

2.1. Materials The colloidal AuNPs solution (10  2 nm; w0.76 A520 mL1) was purchased from SigmaeAldrich (USA). Primers and 50 thiol-modified ssDNA probes (50 -SH-A10-ACAATGGTGAATGGAAAGATA-30 ) were obtained from SigmaeAldrich (USA) and Bio Basic Canada Inc. (Canada), respectively. Di-sodium hydrogen phosphate anhydrous (Na2HPO4), magnesium sulfate heptahydrate (MgSO4.7H2O), and sodium dihydrogen phosphate dihydrate (NaH2PO4.2H2O) were from Ajax Finechem Pty Ltd. (New Zealand). Sodium dodecyl sulfate (SDS) and TrizmaÒ base were from SigmaeAldrich (USA). Sodium chloride (NaCl) was from Merck (Germany). All solutions were prepared using the sterile water from Wisent Inc. (Canada). All other chemicals were of analytical and/or molecular biology grade, and were used as received. 2.2. Apparatus The UVevis absorption spectra were measured using the NanoDropÔ 2000 UVevis spectrophotometer (Thermo Scientific,

2.3.2. LAMP assay for WSSV detection LAMP assay for WSSV detection was performed according to the previously reported and WSSV-specific LAMP primers were based on the published sequence of ORF 191 (GenBank accession no. AF332093) [15], except the non-biotin-labeled FIP primer was used instead (Table 1). The reaction mixtures (25 mL) consisted of 0.2 mM outer primers (F3 and B3), 2 mM inner primers (FIP and BIP), 0.2 mM loop primers (LF and LB), 1.4 mM dNTPs (Promega, USA), 6 mM MgSO4 (SigmaeAldrich, USA), 0.4 M betaine (USB Corporation, USA), 8 U Bst DNA polymerase large fragment with 1
ThermoPol buffer (New England Biolabs, USA) and 100 ng WSSV-free DNA from the SPF shrimp. DNA extracted from the uninfected shrimp sample and sterile water was included as negative control, and the linearized plasmid DNA containing 213 bp of wssv191 gene amplified from total DNA of WSSV-infected shrimp by outer primers (F3 and B3) was used as positive controls. LAMP reactions were incubated at 63  C for 60 min, followed by heating at 80  C for 10 min to stop the reaction. The WSSV-LAMP products were purified using the

Table 1 Primer and probe sequences for the WSSV-LAMP/AuNPs probe assay [15]. Primer

Position

Sequence (50 e30 )

WSSV-F3 WSSV-B3 WSSV-FIP WSSV-BIP WSSV-LF WSSV-LB WSSV-thiol probe

99438e99460 99650e99633 99528e99506/TTTT/99466e99484 99537e99559/TTTT/99619e99601 99503e99485 99564e99588 99575e99595

AAAGTCTCATTTTAACAAGAGGA ATTGGTCCAGTCTCAGCC CCATCTCTCTGAAGCGAGGAAAATTTTAATTTCTTTGCTCGAGGCC TGCTCTAGAGAATGCAGTACCTCTTTTGCGTAGTTCTTGCACGATT TCTCCAGCCGGAGCCAAGT ACAGAACCATAACAATGGTGAATGG SH-AAAAAAAAAAACAATGGTGAATGGAAAGATA

Y. Seetang-Nun et al. / Molecular and Cellular Probes 27 (2013) 71e79

NucleoSpinÒ Gel and PCR Clean-up (MACHEREY-NAGEL GmbH & Co., Germany). 2.3.3. Colorimetric detection of the WSSV-LAMP product The colorimetric detection of WSSV-LAMP product was carried out in a total volume of 12 mL reaction. Firstly, 5 mL each of 2.5 nM DNA-functionalized AuNPs and WSSV-LAMP products were mixed and incubated at room temperature (25  1  C) for 1 h. Secondly, 2 mL of 0.18 M MgSO4 was added into the reactions to obtain a final concentration of 30 mM, and then incubated for another 5 min to develop the solution color. To quantitatively study this color change, aliquots of the reaction mixtures (2 mL) were analyzed using the UVevis spectroscopy. The phosphate buffer was used as a blank. 2.4. Application for WSSV infection from positive field samples WSSV-infected Penaeus monodon were collected from WSSV outbreak farms in Samutsakorn, Chachoengsao and Surat Thani provinces of Central, Eastern and Southern parts of Thailand, respectively. The pleopod was tested for presence of WSSV using IQ2000Ô WSSV Detection and Prevention System (Farming IntelliGene Technology Corporation). The positive WSSV-infected samples were then used as the templates for LAMPeAuNPs to test whether the technique could detect WSSV from field samples. 3. Results and discussion 3.1. Principle of the colorimetric assay The working principle of the proposed colorimetric assay for the detection of WSSV was illustrated in Fig. 1. It showed the advantage of the stability characteristics of the DNA-functionalized AuNPs upon hybridization with their complementary target DNA toward salt-induced aggregation as visual detection probes. Initially, the idea of our LAMP-AuNPs was inspired by Baptista et al. [25], Li et al. [26], and Song et al. [23]. Its detection process is carried out in a stepwise fashion: (1) the functionalization of WSSV-specific

73

ssDNA probes to AuNPs, (2) the hybridization between ssDNA probes and WSSV-LAMP products, and (3) the modulation of the stability of DNA-functionalized AuNPs by increasing the ionic strength of solution using MgSO4 as a salt. With the increasing MgSO4 concentrations, the DNA-functionalized AuNPs in the blank sample, and in the test samples containing only primers, primer‒dimers (control sample), or the target DNA without sequence complementary to the ssDNA probe (negative sample) was unstable due to the screening effect of salt and undergoes to form aggregates immediately, as indicated by the solution color changes from red to blue and/or gray, and the surface plasmon spectral shift toward longer wavelength. Conversely, in the presence of WSSV-LAMP products contained sequence complementary to the ssDNA probe (positive sample), the DNAfunctionalized AuNPs were still stable and stay dispersed in solutions due to the increased electrostatic repulsive forces and steric hindrance upon hybridization, and as a result, no colorimetric change and shift of the surface plasmon peak could be observed. 3.2. Preparation and characterization of the DNA-functionalized AuNPs To perform a proof-of-concept, the colloidal AuNPs were first functionalized with the WSSV-specific ssDNA probes modified with the extra d(A)10 as spacers and the thiol group at the 50 -end, so that they were chemically adsorbed onto the surface of AuNPs through thiolemetal interactions [27]. The probes were designed as previously reported to recognize the sequences between B1c and B2c region within the LAMP product that targeted to wssv191 gene of WSSV [15]. The UVevis spectra characteristics of AuNPs after functionalization with the ssDNA probes were performed (Fig. 2). As compared to the citrated-capped AuNPs, the surface plasmon band of the DNA-functionalized AuNPs was slightly shifted from 520 to 525 nm (Fig. 2A) due to the change of refractive index surrounding the AuNPs, further implied the successful adsorption of ssDNA probes onto the surface of AuNPs. Similar phenomenon was also observed in the case of 13 nm AuNPs, as previously reported [28,29].

Fig. 1. Schematic illustration for the detection of WSSV using DNA-functionalized AuNPs as colorimetric probes. Step 1: The WSSV-specific ssDNA probes are functionalized to AuNPs through the thiolemetal interactions. Step 2: The resulting DNA-functionalized AuNPs are hybridized with the DNA target. Step 3: The addition of MgSO4 as a salt to develop the solution color. A sample is recorded as a positive if the color of solution still retains red and no surface plasmon peak shift, and vice versa. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

74

Y. Seetang-Nun et al. / Molecular and Cellular Probes 27 (2013) 71e79

Moreover, the DNA-functionalized AuNPs were found to exhibit high stability even in the presence of high salt concentration (up to 0.3 M NaCl), as indicated by the initial red color (in web version) of solution (Fig. 2B). This is because of the increasing of electrostatic and/or steric repulsive forces arising from the phosphate backbone of ssDNA probes, which led to the stabilization of DNA-functionalized AuNPs against salt-induced aggregation [23,25,26,28,30,31]. However, under this salt concentration, the citrated-capped AuNPs were unstable and appeared to form aggregation that associated with the change of solution color from red to blue and/or gray, and the shift of surface plasmon peak to longer wavelength (600e 700 nm) was clearly observed (Fig. 2A). In addition, with the increased salt concentration, for example by the addition of MgSO4 (at least 13 mM), the DNA-functionalized AuNPs were less stable due to the screening of salt that minimized the repulsive forces between the DNA-functionalized AuNPs, and thus triggering them to form aggregation subsequently. Upon aggregation, the obvious colorimetric change and the surface plasmon spectral shift were clearly observed, similar to those found in the case of citrated-capped AuNPs. Finally, the colorless of solution with the black precipitates settled to the bottom that irreversible were observed (Fig. 2B). The TEM analysis also clearly showed the large aggregation of the AuNPs corresponding to the observation by the naked eye or by UVevis spectroscopy analysis (Fig. 2C). Therefore, on the basis of these characteristics, a novel colorimetric assay for the detection of WSSV, as proposed in Fig. 1, could be established using the prepared DNA-functionalized AuNPs as visual reporter probes, and the results can be detected qualitatively and quantitatively by visualization using the naked eye due to the change of solution color and by measurement using the UVevis spectroscopy due to the surface plasmon spectral shift, respectively.

3.3. Optimization of the assay conditions To obtain the best results for the detection of WSSV-LAMP amplified product, several parameters such as the concentration of probes, the temperature and incubation time for the hybridization reaction, and the concentration of MgSO4 were systematically investigated and optimized. 3.3.1. Effect of probe concentration The effect of the concentration of DNA-functionalized AuNPs as hybridizing probes for the detection of WSSV-LAMP amplified product was first assessed. The DNA-functionalized AuNPs were effectively stabilized against salt-induced aggregation in presence of WSSV-LAMP amplified product, and no significant different of DAbs values were observed in these samples even the concentration of probes was increased from 1.5 to 2.5 nM (Fig. 3A). In the parallel experiment using the sterile water as the LAMP-negative control, the primers and/or primer‒dimers were only presented, the negligible signals were observed by reflecting the aggregation of DNA-functionalized AuNPs. Therefore, the DNA-functionalized AuNPs at 2.5 nM were selected for the following experiments to obtain the high sensitivity. 3.3.2. Effect of temperature and incubation time The effect of temperature on the hybridization efficiency between ssDNA probes and WSSV-LAMP amplified product was conducted. It revealed that the DAbs values in the samples contained WSSV were almost similar in all range of the temperature tested (room temperature, 55  C, and 63  C) (Fig. 3B), while the control samples showed negligible responses (Fig. 3B), indicating that the highly selective detection of WSSV could be achieved even without the stringently controlling the temperature during hybridization,

Fig. 2. (A) UVevis spectra of containing DNA-functionalized AuNPs before (b) and after (d) addition of MgSO4 (13 mM) to induce aggregation. As a comparison, the solution of citrate-capped AuNPs was used: a, before, and c after MgSO4 addition. (B) Digital photographs corresponding to the samples in (A). (C) TEM images of the DNA-functionalized AuNPs before and after salt-induced aggregation. Scale bars indicate 50 nm and/or 100 nm.

Y. Seetang-Nun et al. / Molecular and Cellular Probes 27 (2013) 71e79

A

B

0.8

0.8 0.7

absorbance (a.u.)

absorbance (a.u.)

0.7 0.6 0.5 0.4 0.3 0.2

0.6 0.5 0.4 0.3 0.2 0.1

0.1

0

0 1.5

RT

2.5

63

D 0.8

0.8

absorbance (a.u.)

absorbance (a.u.)

55

Hybridization temperature (C)

Probe concentration (nM)

C

75

0.7

0.6 0.5 0.4 0.3 0.2 0.1 0.0 0

20

40

60

80

100

120

0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0 10

Hybridization time (min)

20

30

50

100

MgSO4 concentration (mM)

Fig. 3. Optimization of the assay conditions. (A) Effect of probes concentration. (B) Effect of hybridization temperature. (C) Effect of hybridization time. (D) Effect of MgSO4 concentration. Black bars and/or circles are the sample containing WSSV, and white bars and/or circles are the control sample, where the sterile water was used instead of the template DNA. Values are mean  SD (n ¼ 3).

absorbance (a.u.)

A

B

0.7

0.6 0.5

0.8

y = 0.3506x + 0.6276 R² = 0.9793

0.4

0.6 0.4

0.3

0.2

0.2

0 -1.50 -1.00 -0.50 0.00

0.1 0

0

0.2

0.4

0.6

0.8

1

1.2

WSSV LAMP products (µg)

C

Fig. 4. Sensitivity of the assay. (A) Optical signals (DAbs) of the DNA-functionalized AuNPs solutions after salt-induced aggregation in the presence of different concentrations of WSSV-LAMP products. Inset shows the linear relationship between DAbs plotted as a function of the log concentration of WSSV-LAMP products. (B) and (C) Digital photographs and agarose gel (2%) electrophoresis corresponding to the samples in (A), respectively. Neg () indicates the control sample. Upper and lower panels are the color of solutions before and after salt-induced aggregation, respectively. Values are mean  SD (n ¼ 4).

76

Y. Seetang-Nun et al. / Molecular and Cellular Probes 27 (2013) 71e79

and thus implying the feasibility of the LAMPeAuNPs to be operated. Therefore, the hybridization reaction was conducted at room temperature. At room temperature, the effect of incubation time on the hybridization efficiency was further investigated. The DAbs values were gradually increased with the increasing of incubation time up to 60 min, and then appeared to reach a plateau, indicating the almost completion of the hybridization reaction between ssDNA probes and WSSV-LAMP amplified product (Fig. 3C). In the control experiments, the DAbs values were found to be negligible as expected (Fig. 3C). Thus, to obtain the stable optical signals, the hybridization time was determined to be 60 min at room temperature. 3.3.3. Effect of MgSO4 concentration The effect of the increasing MgSO4 concentration on WSSV detection was also examined. Under the low-salt concentration (10 mM MgSO4), the DNA-functionalized AuNPs were still stabilized either in the control or the sample containing WSSV (Fig. 3D). As the MgSO4 concentration increased to 20 mM and/or 30 mM, the

extensive aggregation of DNA-functionalized AuNPs in the control sample was clearly observed, and this can be readily distinguishable from the samples containing WSSV (Fig. 3D). These results demonstrated that the destabilization of DNA-functionalized AuNPs is highly dependent on the concentration of salt used. On the other hand, the presence of WSSV-LAMP amplified product seemed to less-protect the DNA-functionalized AuNPs under too high MgSO4 concentrations (Fig. 3D). Thus, the optimal MgSO4 concentration was hence determined to be 30 mM to ensure the completely screening of repulsive forces. These salt concentrations were in good agreement with those previously reports, when MgCl2 was used as a salt instead [32,33]. In addition, other salts such as Na2SO4, (NH4)2SO4, NH4Cl, and KCl were also tested, and the result showed that none of them can cause the aggregation of DNA-functionalized AuNPs in both the control and the sample containing WSSV under the tested concentrations at high as 0.1 M, while CaCl2 and MnCl2 caused the coagulation of DNA-functionalized AuNPs in these samples that cannot be differentiated from each other (data not shown).

Fig. 5. Colorimetric detection of WSSV-LAMP products. (A) Digital photographs of DNA-functionalized AuNPs solutions in the presence of WSSV-LAMP products amplified using the linearized plasmid DNA containing 213 bp of wssv191 gene as a template: (a), 2
104; (b), 2
103; (c), 2
102; (d), 2
10; (e), 2 copies, respectively. (B) and (C) UVevis spectra and agarose gel (2%) electrophoresis corresponding to the samples in (A), respectively. Upper and lower panels are the color of solutions before and after salt-induced aggregation, respectively. Blk or g, and f indicate blank, and the control sample, respectively.

Y. Seetang-Nun et al. / Molecular and Cellular Probes 27 (2013) 71e79

3.4. Sensitivity of the assay Under the optimal conditions, the sensitivity and dynamic range of the LAMPeAuNPs on the detection of interested target DNA amplified by the LAMP assay were validated using the WSSVLAMP products as a sample. The DAbs values were gradually increased beside the increasing amount of WSSV-LAMP products ranging from 0.05 to 1 mg/reaction (Fig. 4A). In the inset, a good linear relationship was obtained when these DAbs values were plotted as a function of the log concentration of WSSV-LAMP products with a correlation coefficient (R2) of 0.9793 (Fig. 4A). The regression equation was DAbs ¼ 0.3506C  0.6276, where C is the log concentration of WSSV-LAMP products. A series of seven repetitive measurements of the WSSV-LAMP products at 0.05, 0.15, and 0.6 mg yielded a good reproducible signal with an estimated relative standard deviation of 13.06, 2.75, and 1.49%, respectively. Based on the calculation of the 3s/S, where s and S are the standard deviation (SD) of y-intercept and slope of the regression line, respectively, the LAMPeAuNPs was able to detect the WSSV-LAMP generated product at approximately 0.03 mg/ reaction, corresponding to the observation of color change by naked eyes (Fig. 4B), and its sensitivity was greatly improved when compared to those of visualization on agarose gel electrophoresis (Fig. 4C).

77

LAMPeAuNPs for WSSV detection using ten-fold serial dilutions of the plasmid DNA containing the WSSV-related sequence (2
104 to 2 copies) was showed a detection limit 2
102 copies plasmid DNA or equivalent to 1 fg total DNA, since there was no observation of the change of solution color (Fig. 5A), and shift of the surface plasmon peak, as shown in (Fig. 5B). This detection amount was also comparable to those of agarose gel electrophoresis (Fig. 5C), the NALFIA or test strips [15], the real-time LAMP reaction with the turbidity detection of the precipitated magnesium pyrophosphate, the byproducts of LAMP reaction [32], and the real-time LAMP reaction with the fluorescent resonance energy transfer (FRET) as reporter probes [33], which LAMPeAuNPs showed the most sensitive method for visualization of LAMP product. 3.5. Selectivity of the assay The selectivity is one of the most important parameters to evaluate the analytical performance of this assay. In the present study, a series of LAMP products containing non-complementary sequence to the WSSV such as IHHNV [21] and yellow head virus [unpublished], corresponding to the most of common DNA- and RNA-infectious viruses found in the cultured Penaeid shrimp in Thailand, respectively, was tested under the optimal conditions described above. None of these samples were stabilized the DNA-

Fig. 6. Selectivity of the assay. (A) Digital photographs of DNA-functionalized AuNPs solutions in the presence of phosphate buffer or blank (a), WSSV-LAMP products (b), IHHNVLAMP products (c), YHV-LAMP products (d), and competitor oligonucleotides (e) before (upper) and after (lower) salt-induced aggregation. (B) and (C) are UVevis spectra and TEM images corresponding to the samples in (A), respectively. The scale bars indicate 100 nm.

78

Y. Seetang-Nun et al. / Molecular and Cellular Probes 27 (2013) 71e79

Fig. 7. Detection of WSSV from field samples obtained from Samutsakorn (a), Chachoengsao (b) and Surat Thani (c) provinces of Thailand using (A) IQ2000Ô WSSV Detection and Prevention System detected by UVevis spectra and agarose gel (2%); (B) LAMP plus UVevis spectra and agarose gel (2%) electrophoresis. (C) LAMPeAuNP and collected data by Digital photographs. Lane M: molecular marker, lane Pos1(þ): positive control of IQ2000Ô WSSV Detection kit, lane Pos2(þ): positive control of LAMP reaction using plasmid DNA containing 213 bp of wssv191 gene as template, lane Neg: negative control using uninfected shrimp DNA as template showing 680 bp internal control fragment by IQ2000Ô (A) but nothing by LAMP-gel (B) and turned to gray coloration by LAMPeAuNP (C).

functionalized AuNPs against salt-induced aggregation, as indicated by the distinct colorimetric change of solution and shift of the surface plasmon peak to longer wavelength (Fig. 6B), even their amounts used were high as 1 mg per assay. TEM images clearly showed the aggregation of DNA-functionalized AuNPs in these samples (Fig. 6C), in agreement with those observations by naked eye (Fig. 6A) and by UVevis spectroscopy (Fig. 6B). In contrast, the DNA-functionalized AuNPs were found to be stabilized in the presence of WSSV-LAMP amplified product, as indicated by the initial red color (in web version) of solution and no surface plasmon spectral shift (Fig. 6B). The TEM results showed no aggregation of the DNA-functionalized AuNPs in this sample, but forming a small cluster with varying sizes of the nanoparticles (Fig. 6C). Further competitive experiment, using the competitor oligonucleotides to the ssDNA probes excluding the extra dA(10) at the 50 -end was also carried out. Aliquots of this competitor (50 mM) were first preincubated with the WSSV-LAMP amplified product for 5 min before hybridization with the DNA-functionalized AuNPs. Following the addition of MgSO4, the gradual colorimetric change of solution and shift of the surface plasmon peak were observed (Fig. 6A), indicating the formation of the aggregated DNA-functionalized AuNPs. The TEM image was also used to confirm these observations (Fig. 6B). These changes are likely due to the fact that, in the presence of the competitor, the WSSV-LAMP amplified product could have negligible tendency to hybridize with the ssDNA probes due to the competitive binding between this competitor and ssDNA probes toward WSSV-LAMP amplified product, and thus leading to the aggregation of the DNA-functionalized AuNPs upon salt addition. In this study, the highly selective detection of WSSV without any non-specific binding target could be expected when used in conjunction with our prepared DNA-functionalized AuNPs as probes. 3.6. Detection WSSV using LAMPeAuNPs from field samples The positive WSSV-infected shrimp samples tested by nested PCR using IQ2000Ô WSSV Detection and Prevention System (Farming IntelliGene Technology Corporation) (Fig. 7A) obtained from outbreak farms in Samutsakorn, Chachoengsao and Surat Thani provinces of Central, Eastern and Southern parts of Thailand,

respectively, also gave positive WSSV infection reactions when using LAMP plus gel electrophoresis assay (Fig. 7B) and LAMPe AuNPs (Fig. 7C). It was indicated that LAMPeAuNPs could detect WSSV in 3 regions of the outbreaks comparable to the most sensitive method reported to date. 4. Conclusions In the present study, a novel colorimetric assay for the detection of WSSV-LAMP amplified product was developed. The principle of the LAMPeAuNPs relies based on the stability characteristics of the DNA-functionalized AuNPs upon hybridization with their complementary target DNA against salt-induced aggregation, and the results obtained could be detected qualitatively and quantitatively by visualization using the naked eye without the requirement of instrumentation and by measurement using the UVevis spectroscopy, when the instrument is available for more precisely and quantitatively analyses the results, respectively. Under the optimal conditions, the selectivity of the LAMPe AuNPs on the detection of WSSV is remarkably high and its LOD toward the LAMP products detection is 40 ng per assay. Moreover, in combination with the LAMP reaction, the sensitivity of the LAMPeAuNPs is 2
102 copies of WSSV plasmid DNA without the additional purification step, and the detection result is comparable to the most sensitive method reported to date. Therefore, LAMPe AuNPs has a high potential to serve as alternative tools for the detection of WSSV not only for the laboratory but also for the nonlaboratory applications such as under field detection as well. Acknowledgments This work was supported by the Office of the Higher Education Commission and Mahidol University under the National Research Universities Initiative. Y.S. and R.S. would like to thank the National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Thailand for his postdoctoral research fellowship, and the Oral Biology Research Center, Faculty of Dentistry, Chulalongkorn University, Thailand for the laboratory facilities, and staffs therein for their helps.

Y. Seetang-Nun et al. / Molecular and Cellular Probes 27 (2013) 71e79

References [1] Mayo MA. Names of viruses and virus species e an editorial note. Arch Virol 2002;147:1463e4. [2] Chou HY, H C, W CH, C HC, L CF. Pathogenicity of a baculovirus infection causing white spot syndrome in cultured penaeid shrimp in Taiwan. Dis Aquat Org 1995;23:165e73. [3] Escobedo-Bonilla CM, Alday-Sanz V, Wille M, Sorgeloos P, Pensaert MB, Nauwynck HJ. A review on the morphology, molecular characterization, morphogenesis and pathogenesis of white spot syndrome virus. J Fish Dis 2008;31:1e18. [4] Wang CS, Tang KFJ, Kou GH, Chen SN. Light and electron microscopic evidence of white spot disease in the giant tiger shrimp, Penaeus monodon (Fabricius), and the kuruma shrimp, Penaeus japonicus (Bate), cultured in Taiwan. J Fish Dis 1997;20:323e31. [5] Guoxing Z, Yalin S, Kai Z, Zhi C. Bacilliform virus infection in cultured Chinese shrimp, Penaeus orientalis, in China. J Mar Biotechnol 1997;5:113e8. [6] Sanchez-Paz A. White spot syndrome virus: an overview on an emergent concern. Vet Res 2010:41. [7] Chang YS, Chen TC, Liu WJ, Hwang JS, Kou GH, Lo CF. Assessment of the roles of copepod Apocyclops royi and bivalve mollusk Meretrix lusoria in white spot syndrome virus transmission. Mar Biotechnol 2011;13:909e17. [8] Marques JS, Muller IC, Moser JR, Sincero TC, Marques MRF. Wild captured crab, Chasmagnathus granulata (Dana, 1851), a new host for white spot syndrome virus (WSSV). Aquaculture 2011;318:20e4. [9] Lo CF, Leu JH, Ho CH, Chen CH, Peng SE, Chen YT, et al. Detection of baculovirus associated with white spot syndrome (WSBV) in penaeid shrimps using polymerase chain reaction. Dis Aquat Org 1996;25(1e2):133e41. [10] Lo CFHC, Peng SE, Chen CH, Hsu HC, Chiu YL, Chang CF, et al. White spot syndrome baculovirus (WSBV) detected in cultured and captured shrimp, crabs and other arthropods. Dis Aquat Org 1996;27:215e25. [11] OIE. Office International des Epizooties. 6th ed. Paris: OIE; 2009. p. 121e31. [12] Lightner DV, Redman RM, Pantoja CR, Tang KFJ, Noble BL, Schofield P, et al. Historic emergence, impact and current status of shrimp pathogens in the Americas. J Invertebr Pathol 2012;110:174e83. [13] Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 2000;28:E63. [14] Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes 2002;16:223e9. [15] Jaroenram W, Kiatpathomchai W, Flegel TW. Rapid and sensitive detection of white spot syndrome virus by loop-mediated isothermal amplification combined with a lateral flow dipstick. Mol Cell Probes 2009;23:65e70. [16] Kiatpathomchai W, Jaroenram W, Arunrut N, Jitrapakdee S, Flegel TW. Shrimp taura syndrome virus detection by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick. J Virol Methods 2008;153:214e7. [17] Nimitphak T, Kiatpathomchai W, Flegel TW. Shrimp hepatopancreatic parvovirus detection by combining loop-mediated isothermal amplification with a lateral flow dipstick. J Virol Methods 2008;154:56e60.

79

[18] Puthawibool T, Senapin S, Kiatpathomchai W, Flegel TW. Detection of shrimp infectious myonecrosis virus by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick. J Virol Methods 2009;156:27e31. [19] Nimitphak T, Meemetta W, Arunrut N, Senapin S, Kiatpathomchai W. Rapid and sensitive detection of Penaeus monodon nucleopolyhedrovirus (PemoNPV) by loop-mediated isothermal amplification combined with a lateral-flow dipstick. Mol Cell Probes 2010;24:1e5. [20] Puthawibool T, Senapin S, Flegel TW, Kiatpathomchai W. Rapid and sensitive detection of Macrobrachium rosenbergii nodavirus in giant freshwater prawns by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick. Mol Cell Probes 2010;24:244e9. [21] Arunrut N, Prombun P, Saksmerprome V, Flegel TW, Kiatpathomchai W. Rapid and sensitive detection of infectious hypodermal and hematopoietic necrosis virus by loop-mediated isothermal amplification combined with a lateral flow dipstick. J Virol Methods 2011;171:21e5. [22] Arunrut N, Seetang-Nun Y, Phromjai J, Panphut W, Kiatpathomchai W. Rapid and sensitive detection of Laem-Singh virus by reverse transcription loopmediated isothermal amplification combined with a lateral flow dipstick. J Virol Methods 2011;177:71e4. [23] Song J, Li Z, Cheng Y, Liu C. Self-aggregation of oligonucleotide-functionalized gold nanoparticles and its applications for highly sensitive detection of DNA. Chem Commun 2010;46:5548e50. [24] Taton TA. Preparation of gold nanoparticleeDNA conjugates. Current protocols in nucleic acid chemistry. John Wiley & Sons, Inc; 2001. [25] Baptista P, Pereira E, Eaton P, Doria G, Miranda A, Gomes I, et al. Gold nanoparticles for the development of clinical diagnosis methods. Anal Bioanal Chem 2008;391:943e50. [26] Zhao W, Brook MA, Li Y. Design of gold nanoparticle-based colorimetric biosensing assays. ChemBioChem 2008;9:2363e71. [27] Weisbecker CS, Merritt MV, Whitesides GM. Molecular self-assembly of aliphatic thiols on gold colloids. Langmuir 1996;12:3763e72. [28] Storhoff JJ, Elghanian R, Mucic RC, Mirkin CA, Letsinger RL. One-pot colorimetric differentiation of polynucleotides with single base imperfections using gold nanoparticle probes. J Am Chem Soc 1998;120:1959e64. [29] Yang J, Lee JY, Deivaraj TC, Too HP. Molecular engineering of biological and chemical systems (MEBCS); 2004. [30] Storhoff JJ, Elghanian R, Mirkin CA, Letsinger RL. Sequence-dependent stability of DNA-modified gold nanoparticles. Langmuir 2002;18:6666e70. [31] Cárdenas M, Barauskas J, Schillén K, Brennan JL, Brust M, Nylander T. Thiolspecific and nonspecific interactions between DNA and gold nanoparticles. Langmuir 2006;22:3294e9. [32] Mekata T, Sudhakaran R, Kono T, Supamattaya K, Linh NTH, Sakai M, et al. Real-time quantitative loop-mediated isothermal amplification as a simple method for detecting white spot syndrome virus. Lett Appl Microbiol 2009; 48:25e32. [33] Chou P-H, Lin Y-C, Teng P-H, Chen C-L, Lee P-Y. Real-time target-specific detection of loop-mediated isothermal amplification for white spot syndrome virus using fluorescence energy transfer-based probes. J Virol Methods 2011;173:67e74.