Visualization of Rab5 Activity in Living Cells Using FRET Microscopy

[11]

visualizing of Rab5 using FRET microscopy

119

[11] Visualization of Rab5 Activity in Living Cells Using FRET Microscopy By EMILIA GALPERIN and ALEXANDER SORKIN Abstract

Rab5 is a member of the large family of small GTPases involved in membrane trafficking. Two genetically encoded sensors were developed to visualize Rab5 in its GTP‐bound conformation in living cells. Rab5‐binding fragments of Rabaptin5 or early endosomal antigen 1 (EEA.1) were fused to yellow fluorescent protein (YFP) and used in the fluorescent resonance energy transfer (FRET) assay together with Rab5‐tagged cyan fluorescent protein (CFP). The presence of energy transfer between CFP‐Rab5 and YFP‐Rab5 binding fragments detected by sensitized FRET microscopy has validated the utility of these generated sensors to visualize the localization of GTP‐bound Rab5. GTP‐bound Rab5 was found in endosomes, often concentrated in distinct microdomains. Molecular architecture of the Rab5 microdomains was analyzed by three‐chromophore FRET (3‐FRET) microscopy, utilizing YFP, CFP, and monomeric red fluorescent proteins (mRFP.l). The results of the 3‐FRET analysis suggest that GTP‐bound Rab5 is capable of oligomerization and present in multiprotein complexes. Introduction

The Rab family of small GTPases functions as compartment‐specific scaffolds forming multiprotein complexes that coordinate vesicle motility, budding, and fusion. The role of Rab GTPases in membrane trafficking has been studied extensively (Szymkiewicz et al., 2004; Zerial et al., 2001). The activity of the Rab proteins depends of the rate of GTP hydrolysis and requires a switch between two conformations: GTP‐bound or GDP‐bound, respectively. The GTP‐bound form is commonly considered an active conformation because in this conformation Rabs are capable of binding their interacting proteins or ‘‘effectors’’ (Stenmark et al., 2001). Rab5 is located on the cytoplasmic surface of early endosomes and is a key component of the protein complex responsible for homotypic fusion and cargo sorting in these organelles (Stenmark et al., 1994). GTP‐Loaded Rab5 interacts with several cytosolic effectors that stabilize Rab5 in its active conformation and, together with other membrane components, coordinates membrane docking and fusion. Q79L mutation in Rab5 results in METHODS IN ENZYMOLOGY, VOL. 403 Copyright 2005, Elsevier Inc. All rights reserved.

0076-6879/05 $35.00 DOI: 10.1016/S0076-6879(05)03011-9

120

GTPases regulating membrane targeting and fusion

[11]

significant reduction of GTP hydrolysis, as a result keeping Rab5 in a GTP‐ bound state. Overexpression of the Rab5(Q79L) mutant causes dramatic enlargement of early endosomes (Stenmark et al., 1994). S34N mutation yields a Rab5 mutant that binds GDP with much higher affinity than GTP, thus keeping Rab5 in an inactive state (Stenmark et al., 2001). The GTP‐ bound Rab5 interacts with several effectors, such as early endosomal autoantigen 1 (EEA.1), Rabaptin5, Rabenosin5 (Christoforidis et al., 2000; Lippe et al., 2001), and hVps34 (Christoforidis et al., 2000). EEA.1 and Rabenosyn5 possess FYVE domains that bind to phosphatidylinositol‐ 3‐phosphate (PtdIns[3]P) (Nielsen et al., 2000). Binding of the FYVE domain to PtdIns(3)P in concert with Rab5 interaction is responsible for specific targeting of these proteins to early endosomes. Rabaptin5 is associated with the Rab5 exchange factor (Rabex5). The Rabaptin5/Rabex complex is recruited to GTP‐loaded Rab5 and positively regulates Rab5 activity by slowing down GTP hydrolysis (Horiuchi et al., 1997). To visualize the active form of Rab5, and to molecularly dissect the Rab5 scaffold complex in living cells, fluorescence resonance energy transfer (FRET) microscopy has been developed. This chapter describes the design of the FRET‐based sensors for Rab5 activity in living cells. It subsequently describes the 3‐chromophore FRET approach to analyze multiprotein interactions within the Rab5 complex. Description of Methods

Expression Constructs To visualize Rab5 activity and its interactions in living cells, several fluorescently labeled fusion versions of Rab5a were prepared. Rab5 was fused to enhanced cyan (CFP) and yellow (YFP) fluorescent proteins that have been used in many FRET studies and, more recently, to monomeric red fluorescent protein (mRFP.1). To generate YFP/CFP fusion proteins, Rab5 full‐length cDNAs were transferred from pcDNA‐Rab5a vectors, obtained from Guthrie cDNA Resource Center (Guthrie Research Institute, Sayre, PA), using BamHI and XhoI restriction sites, and ligated into pEYFP‐C1 (Clontech) digested with BglII and XhoI enzymes (Fig. 1A). To generate a CFP‐tagged Rab4 fusion protein, Rab4 full‐length cDNAs were transferred from pcDNA‐Rab4a vectors, obtained from Guthrie cDNA Resource Center (Guthrie Research Institute, Sayre, PA), using BamHI and XhoI restriction sites, and ligated into pEYFP‐C1 (Clontech) digested with Bg1II and XhoI enzymes. To generate the mRFP‐Rab5 expression vector, full‐length mRFP cDNA was amplified by polymerase chain

[11]

visualizing of Rab5 using FRET microscopy

121

FIG. 1. Schematic representation and immunodetection of fusion proteins. (A) Depicted are Rab5, fragments of Rabaptin5, and EEA.1 proteins fused to CFP/YFP at the amino‐ or carboxyl‐terminus. Numbers represent the amino acid residues in Rabaptin5 (R5RB) and EEA.1 (EEA.1sh) fragments according to the full‐length sequences. The FYVE domain of EEA.1 is indicated. PAE cells transiently expressing CFP‐Rab5 mutants ([wt], Q79L or S34N), YFP‐EEA.1, or R5BD‐YFP were lysed, and CFPtYFP‐fusion proteins were detected by Western blotting. All fusion proteins generated in this work migrated on sodium dodecyl sulfate – polyacrylamide gel electrophoresis (SDS–PAGE) according to their predicted molecular masses. (B) PAE cells transiently expressing mRFP‐Rab5 and YFP‐Rab5 fusion proteins were lysed, and mRFPIYFP‐fusion proteins were detected by Western blotting with anti‐Rab5. All fusion proteins generated in this work migrated on SDS–PAGE according to their predicted molecular masses.

reaction (PCR) (50 GGACTTGTACAGGGCGCCGGTGGAGTGGCG30 and 50 CCGCTAGCGGTCGCCACCATGGCCTCCTCCGAGGACG 0 TC3 ) using the pRSET‐mRFP vector as a template (Campbell et al., 2002) and ligated into pYFP‐Rab5 (Cl) digested with NheI and BsrGI enzymes, thus replacing YFP (Fig. 1B). Pfu polymerase was purchased

122

GTPases regulating membrane targeting and fusion

[11]

from Stratagene (La Jolla, CA). Q79L and S34N mutants of CFP‐Rab5 were also generated. Point mutations in CFP‐Rab5 constructs were introduced using a QuickChange site‐directed mutagenesis kit (Stratagene) (50 GGGATACAGCTGGTCTAGAACGATACCAT AG30 ,50 GCTATG GTAACGTTCTAGACCAGCTGT ATCCC30 , 50 TCCGCTGTTGGC AAAAATAGCCTAGTGCTTCGTTTTG30 , and 50 CAAAACGAAG CACT AGCGT ATTTTTGCCAACAGCGGA30 ). Two fluorescent sensors of the active form of Rab5 were generated based on known interactors of Rab5, Rabaptin5, and EEAl (Fig. 1A). Rabaptin5‐Based Sensor. To generate a GTP‐Rab5 sensor based on Rabaptin5, we used the previously characterized Rab5‐interacting domain of Rabaptin5 (referred further as R5BD), which was mapped in in vitro experiments to the residues 551–862 of the carboxyl‐terminus of Rabaptin5 (Vitale et al., 1998). The DNA fragment corresponding to amino acid residues 551–862 of Rabaptin5 was amplified by PCR (50 GCCGCTC GAGGCCGCCATGGAAACGAGAGACCAGGTG30 and 50 GGTACC GTCGACTGTGTCTCAGGAAGCTG30 ) and ligated into pEYFP‐Nl (Clontech) by using SalI and XhoI restriction sites. YFP was also fused to the amino‐terminus of R5BD (YFP‐R5BD, Fig. 1A) using the pYFP‐C3 vector and EcoRI and PstI enzymes (50 GGGAATTCTATGGAAACG AGAGACCAGGTG30 and 50 CATTGGCTGCAGTGTCTCAGGAAG CTGG30 ). EEA.1‐Based Sensor. A 30‐amino acid region upstream of the FYVE domain of EEA.1 was shown to be essential for Rab5 binding in vitro, although the functional FYVE domain is also required for efficient interaction. Therefore, a fragment corresponding to amino acid residues 1256–1411 of EEA.1 (further referred as EEA.1sh) was amplified by PCR (50 CCCAAGCTTAAACTTACCATGCAGATTAC30 and 50 CGG ATCCTTATCCTTGCAAGTCATTGAAAG30 ) and ligated into pEYFP‐ C3 (Clontech) using HindIII and BamHI restriction sites (Fig. 1A). A similar fusion protein was previously characterized and used as an early endosomal marker (Gaullier et al., 1998; Lawe et al., 2000). A mutated version of YFP‐EEA.1sh was prepared, in which histidine 1372 was mutated to tyrosine using a QuickChange site‐directed mutagenesis kit (50 GT AACA GTGAGACGGCATTACTGCCGACAGTGTGG30 and 50 CCACACTG TCGGCAGTAATGCCGTCTCACTGTTAC30 ). H1372Y mutation on the PIP3 binding pocket of the FYVE domain (Kutateladze et al., 2001) prevented endosomal targeting of the full‐length EEA.1. Moreover, we generated a second EEA.1‐based sensor (further referred to as EEA.1ln) containing a longer fragment of EEA.1. A cDNA fragment corresponding to amino acids 1098–1411 was obtained by digestion with EcoRI and BamHI enzymes and ligated into the pYFP‐C3 vector using the

[11]

visualizing of Rab5 using FRET microscopy

123

same restriction sites. All constructs were verified by dideoxynucleotide sequencing. Choice of Cell Type, Transfections, and Imaging

The localization of fluorescently fused proteins was examined in several cell lines. Two cell lines, porcine aortic endothelium (PAE) and Cos‐1, were chosen as preferred expression systems. These cells have minimal autofluorescence background and flattened cell shape, convenient for epifluorescent microscopy. Moreover, Cos‐1 cells that express large T antigen allow pEYFP/CFP vectors, containing an SV40 origin of replication, to induce high levels of fluorescent protein expression and, therefore, better visualization of the chromophores with low brightness such as CFP. PAE cells were grown in F12 (HAM) medium (Gibco) containing 10% fetal bovine serum (HyClone) and supplemented with antibiotics and glutamine. CoS‐1 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) containing 10% newborn bovine serum (HyClone), and supplemented with antibiotics and glutamine. For fluorescent microscopy, cells were transfected using Effectene reagent (Qiagen, Hilden, Germany) in six‐well plates. Cells were replated 1 day after transfection onto 25‐mm untreated autoclaved glass coverslips (No. 1.5 thickness [Fisher]). Coverslips with cells were then mounted in a microscopy chamber (Molecular Probes) and imaged at room temperature in serum and phenol red‐free medium. Our fluorescence Marianas imaging workstation (Intelligent Imaging Innovation, Denver, CO) is based on an inverted Axiovert 200M Zeiss microscope equipped with a 100 plan‐apo/1.4NA objective, 175W Xenon illumination source (Sutter Instruments Company, Novato, CA), CoolSNAP HQ CCD camera (Roper Scientific, Tucson, AZ), z‐step motor, independently controlled excitation and emission filter wheels (Sutter Instruments Company, Novato, CA), and a micropoint FRAP system (Photonic Instruments, Arlington Heights, IL), all controlled by SlideBook software (Intelligent Imaging Innovation, Denver, CO). The Axiovert reflector turret allows easy changing of custom reflector modules optimized for FRET experiments with different fluorochromes. Independently controlled filter wheels provide fast, automated, and efficient optical filter changing that is required in FRET experiments. A tunable dye VSL‐337ND‐S nitrogen ablation laser unit (Spectra‐Physics, Mountain View, CA) allows FRET analysis using a method of donor fluorescence recovery after photobleaching (DFRAP) in small regions of the cell. The VSL‐337ND‐S laser is capable of generating 30 pulses at a repetition rate of 30 MHz and has a wavelength tunable from 337 to 590 nm using cut dyes (Photonic

124

GTPases regulating membrane targeting and fusion

[11]

Instruments). SlideBook software was used to calculate corrected FRET images and apparent FRET efficiencies. The final arrangement of images was performed using Adobe Photoshop (Adobe Systems, Mountain View, CA). Visualization of GTP‐Bound Form of Rab5 in Living Cells The correct molecular weight of CFP/YFP and mRFP‐fused Rab5 proteins was confirmed by Western blot analysis using monoclonal antibodies to Rab5 (BD Transduction Laboratories, San Diego, CA) (Fig. 1). R5BD‐YFP expression was confirmed using antibodies to GFP (Zymed, San Francisco, CA) (Fig. 1A). Fluorescently tagged proteins were expressed in Cos‐1 cells, as described above. CFP‐Rab5 displayed typical pattern of endosomal localization. When the R5BD‐YFP fusion protein was expressed in Cos‐l cells it was found only in the cytosol rather than in endosomes (Galperin et al., 2003). The absence of R5BD‐YFP binding to endogenous Rab5 is most probably related to its inability to compete with endogenous Rabaptin5 and other proteins for binding to Rab5. However, when CFP‐Rab5 and R5BD‐YFP were coexpressed, a significant pool of R5BD‐YFP was recruited to CFP‐Rab5‐containing endosomes (Fig. 2A). R5BD‐YFP‐ containing endosomes were most clearly seen in the peripheral areas of the cell, whereas large amount of cytosolic R5BD‐YFP often interfered with clear visualization of endosomes in the perinuclear area (Fig. 2A). Coexpression of the CFP‐Rab5(Q79L) mutant and R5BD‐YFP resulted in the appearance of enlarged endosomes and massive recruitment of R5BD‐ YFP to Rab5‐containing endosomal complexes. In contrast, coexpression of the CFP‐Rab5(S34N) mutant and R5BD‐YFP fusion proteins did not result in the recruitment of either R5BD‐YFP or CFP‐Rab5 (S34N) to endosomes. In some cells CFP‐Rab5(S34N) was often located in the perinuclear area of the cell (Fig. 2A). Rabaptin5 has been reported to be a divalent Rab effector possessing distinct binding domains for two Rabs, Rab4 and Rab5 (Vitale et al., 1998). Therefore, as a control we coexpressed CFP‐Rab4a and R5BD‐YFP in Cos‐1 cells; however, no recruitment of R5BD‐YFP to Rab4 endosomes was detected (Fig. 2B). These data suggest that the R5BD protein is recruited specifically to endosomes containing overexpressed CFP‐Rab5. FRET Measurements and Calculations. To examine whether R5BD‐ YFP is bound to CFP‐Rab5, sensitized FRET efficiencies between CFP and YFP were measured on a pixel‐by‐pixel basis as described below. For two‐chromophore FRET (2‐FRET) measurements, three images were acquired sequentially through YFP (excitation 500/20 nm, emission

[11]

visualizing of Rab5 using FRET microscopy

125

FIG. 2. Detection of GTP‐bound Rab5 in living cells. CFP‐Rab5, CFP‐Rab5(Q79L), and CFP‐Rab5(S34N) were coexpressed with R5BD‐YFP (R5BD‐YFP in Cos1 cells) or in Cos‐1 cells (A). CFP‐Rab4 was coexpressed with R5BD‐YFP in Cos‐1 cells (B). YFP, CFP, and FRET images were acquired from living cells at room temperature. FRETC images were calculated as described and presented in a pseudocolor mode. Mean Ed values measured for individual endosomes of the presented cell are shown next to the corresponding image. Intensity bars are presented in arbitrary linear units of fluorescence intensity. Bar ¼ 10
m. A. l.u.f.i. is arbitrary linear units of fluorescence intensity.

535/30 nm), CFP (excitation 436/10 nm, emission 470/30 nm), and FRET (cy) (excitation 436/10 nm, emission 535/30 nm) filter channels. An 86004BS dichroic mirror was utilized (Chroma, Inc.). Images were acquired

126

GTPases regulating membrane targeting and fusion

[11]

using 2  2 binning mode and 100–250 ms integration times at room temperature. The integration time was identical for all three channels. We have noticed that at 37 , endosomes often move during image capturing through three filter channels. As a result YFP, CFP, and FRET images were often shifted. Such shifts lead to overestimation or underestimation of FRET efficiencies for cellular compartments or regions. Room temperature significantly reduced organelle movement, thus images were acquired at room temperature. For further reduction of organelle shifting, cells were treated with low concentrations of the microtubule polymerization inhibitor, nocodazole (Sigma) (20
g/ml for 15 min at 37 ). Nocodazole treatment did not alter cell shape and the morphological appearance of endosomes but dramatically reduced endosomal motility. Prior to FRET calculations the backgrounds were subtracted from the raw images. Background values can be measured in cells that express fluorescent proteins and have been completely photobleached. Photobleaching did not affect cell autofluorescence, so images acquired after photobleaching provide correct background values. Additional images of cells that do not express fluorescent proteins have also been obtained. The average intensities of these images and images obtained after photobleaching represent the most accurate background values. However, the intensity values measured for the areas that do not contain cells were not statistically significantly different from the background values obtained using methods described above, and in most experiments with relatively bright samples, the latter method is the most practical for the analysis of multiple cells. Corrected FRET (FRETC) was calculated for the two‐chromophore FRET pairs on a pixel‐by‐pixel basis for the entire image, using the formula shown in Eq. (1) in the notation of Gordon et al. (1998): FRET C ¼ Ff

Df ðFd=DdÞ

Af ðFa=AaÞ

ð1Þ

Df or Af is the fluorescence signal using the donor or acceptor filter channel, respectively, in the presence of three fluorochromes; Ff is the fluorescence signal through the FRET filter channel in the presence of three fluorochromes; and Fd/Dd and Fa/Aa are cross‐bleed coefficients measured in cells expressing only the donor or acceptor, correspondingly. Coefficients represent the fraction of the donor or acceptor fluorescence passing through the corresponding FRET channel. These coefficients are characteristic of the particular filter sets and do not depend on whether both YFP and CFP are present. These coefficients have been calculated as a constant proportion of the donor and acceptor bleed through the FRET filter sets. Hence, ratios Fd/Dd and Fa/Aa were determined using

[11]

visualizing of Rab5 using FRET microscopy

127

cells expressing either YFP‐tagged or CFP‐tagged proteins. Images were acquired for three channels in the presence of only one fluorochrome. These coefficients were 0.52 and 0.017 for CFP and YFP fluorescence, respectively. Bleed‐through coefficients of CFP and YFP fluorescence were slightly overestimated for ‘‘safe’’ calculations of FRETC, which could result in some underestimation of FRETC and, in several cases, negative FRETC values. Calculations were done using the ‘‘FRET’’ functional module of SlideBook software. Primarily, FRETC values were calculated for the whole image and presented in pseudocolor mode. FRETC intensity is displayed stretched between the low and high renormalization values, according to a temperature‐based lookup table with blue (cold) indicating low values and red (hot) indicating hot values. FRETC values were also calculated from the mean fluorescence intensities for each selected subregion of the image (regional analysis) containing individual endosomes, ruffles, and diffuse fluorescence areas according to Eq. (1). Regional analysis allowed us to prevent overestimation and underestimation of FRET signals due to temporal shifts of organelles during image acquisition by selecting for calculations in the compartments that did not shift. ‘‘Mask’’ and ‘‘Image’’ functions of SlideBook software were utilized. Detection of Rab5 Interaction with R5BD by FRET. As seen in Fig. 2A, FRETC images revealed energy transfer between CFP‐Rab5 and R5BD‐ YFP, suggesting that these two proteins form a complex in early endosomes. Positive FRETC signals were also detected in cells coexpressing CFP‐Rab(Q79L) and R5BD‐YFP. However, in cells expressing a GDP‐ bound mutant of RabS, CFP‐Rab5(S34N), no FRETC signals were revealed (Fig. 2A). An R5BD‐YFP fusion protein was not associated with Rab4‐containing endosomes, and no FRETC signal was observed. These data show that R5BD‐YFP may serve as a specific sensor molecule for detecting active Rab5 in living cells. While FRETC images offer a qualitative indication of FRET, measurements of FRETC signals do not allow quantitative comparison of FRET efficiencies between different experimental samples. True FRET efficiencies (E) can be calculated for the samples with a known stoichiometric ratio of donor and acceptor (Gordon et al., 1998). In experiments where the stoichiometry of donor–acceptor interactions is unknown (Figs. 2–4), we calculated apparent FRET efficiencies (Ed). Ed roughly represents FRETC normalized by the donor concentration. In fact, direct comparison of different methods of calculation of FRET efficiencies and indices suggested that Ed is the most reliable method to calculate the apparent

128

GTPases regulating membrane targeting and fusion

[11]

FRET efficiency for samples with an unknown stoichiometry of interacting components (Berney et al., 2003). To calculate Ed we used regional analysis that produces less computational noise of low‐intensity pixels. The apparent FRET efficiency Ed for each subregion was calculated according to Eq. (2): Ed ¼ FRET C=ðDf
G þ FRET C Þ

ð2Þ

where G is the factor relating the loss of donor signal due to FRET with the donor filter set to the increase of the acceptor emission through the FRET filter set due to FRET (Gordon et al., 1998). The value of G(cy) ¼ 3.099 for the CFP‐YFP donor–acceptor pair was calculated, as described by Gordon et al. (1998). Ed values for the same donor–acceptor pair often vary in different experiments, which implies that Ed calculations can be best used in analyses of experiments with cells that express fluorescently tagged proteins at comparable levels. Comment. Among different ways to measure FRET efficiencies, we have used a donor fluorescence recovery after photobleaching (DFRAP) approach (Wouters et al., 1998). DFRAP can be easily used to calculate apparent E values. We have utilized this method to measure true FRET efficiencies (E) for the entire cell image in living cells (Galperin et al., 2004). However, use of DFRAP to calculate E for small compartments of living cells was extremely difficult due to fast organelle movement during photobleaching. Therefore, we had to fix cells in order to avoid undesired endosomal shifts. Another factor that can affect results of DFRAP analysis is partial donor photobleaching during acceptor photobleaching. Possible experimental error should also be considered due to a low signal‐to‐noise ratio for a donor, like CFP, with low intensity brightness. The general advantages of the sensitized FRET over the DFRAB method is the substantially shorter time required for the FRET measurement and the possibility of multiple FRET measurements of the same cell using the former method. Detection of Rab5 Interaction with EEA.1sh by FRET. To visualize GTP‐bound Rab5 using an EEA.1 Rab5 binding domain, YFP‐EEA.1sh protein was coexpressed with CFP‐Rab5 in Cos‐1 cells. Both proteins were colocalized in endosomes, and positive FRETC signals were detected indicative of the interaction of Rab5 and EEA.1sh fusion proteins (Fig. 3A). On the other hand, the H1372Y mutant of YFP‐ EEA.1sh was not targeted to endosomes, confirming that YFP‐EEA.1sh is targeted to endosomal membranes by a mechanism similar to that of full‐length EEA.1 protein (data not shown). No FRETC was observed between CFP‐Rab4 and YFP‐EEA.1sh proteins, although these proteins were partially colocalized in endosomes (Fig. 3A). These experiments

[11]

visualizing of Rab5 using FRET microscopy

129

FIG. 3. Specificity of YFP‐EEA.1sh sensors for Rab5. (A) CFP‐Rab5 was coexpressed with YFP‐EEA.lsh in Cos‐l cells. CFP‐Rab4 was coexpressed with YFP‐EEA.1sh in Cos‐1 cells. YFP, CFP, and FRET images were acquired from living cells at room temperature. FRETC images were calculated as described and presented in a pseudocolor mode. Mean Ed values measured for individual endosomes of the presented cell are shown next to the corresponding image. Intensity bars are presented in arbitrary linear units of fluorescence intensity. Bar ¼ 10
m. (B) Gallery of high magnification images shows individual endosomes or tethered endosomes in cells coexpressing CFP‐Rab5 and YFP‐EEA.1sh. FRETC images are presented as pseudocolor intensity‐modulated images (FRETC/CFP). Bar ¼ 2
m. A.l.u.f. i. is arbitrary linear units of fluorescence intensity.

validated the use of EEA.1sh as a sensor of Rab5‐GTP in endosomes of living cells. However, YFP‐EEA.1sh has a limited utility as a sensor of GTP‐bound Rab5. The strong targeting signal of the FYVE domain directs this fragment to endosomes independently of Rab5 activity (Galperin et al., 2003).

130

GTPases regulating membrane targeting and fusion

[11]

Interestingly, FRETC signals were condensed in the clusters or ‘‘Rab5/ EEA.1 microdomains’’ of the endosomal membrane (Fig. 3B), which is consistent with a subcompartmental organization of Rab5/EEA.1 complexes in endosomes proposed earlier (de Renzis et al., 2002). To present Rab5 microdomains, we have used pseudocolor intensity modulated images (FRETC/CFP). The CFP channel was used as a saturation channel to emphasize regions of microdomains. In these images CFP values are used as a threshold, and as a result, data higher than CFP values are displayed at full saturation, whereas data values below the low threshold are displayed with no saturation (i.e., black). Comment. Choice of cDNA fragment used for sensor generation can greatly affect the results of FRET analysis. During this study we found that lack of FRETC signals was not always indicative of the absence of protein–protein interaction. For instance, when YFP was fused to the amino‐terminus of R5BD (YFP‐R5BD, Fig. 1A), this protein was recruited to endosomes in a Rab5‐dependent manner and to an extent similar to that observed for R5BD‐YFP (Galperin et al., 2003). However, we did not detect positive FRETC signals despite colocalization of YFP‐R5BD with either CFP‐Rab5 or CFP‐Rab5(Q79L) in endosomes. It is possible that the amino‐terminus CFP of Rab5 is in close proximity to the carboxyl‐ but not the amino‐terminus of Rabaptin5 within the Rab5–Rabaptin5 complex. A similar result was obtained when the YFP‐EEA.1ln (Fig. 1A) construct was used as a potential sensor for Rab5 GTP binding. YFP‐EEA.1ln was targeted to endosomes even more efficiently than YFP‐EEA.1sh (data not shown). However, coexpression of CFP‐Rab5 and YFP‐EEA.1 did not result in positive FRETC signals. In this case, the reason for the absence of FRETC could be the long distance between YFP‐CFP fluorochromes. Detection of a Three‐Protein Complex in Endosomes The results of conventional 2‐FRET analysis demonstrated the assembly of endosomal ‘‘Rab5 microdomains’’ in living cells. More recently we began using three‐chromophore FRET (3‐FRET) assay for further analysis of protein interactions participating in these domains. To this end, mRFP‐ Rab5, CFP‐Rab5, and YFP‐EEA.1sh were coexpressed in the same cells, and the 6‐filter 3‐FRET method was implemented to obtain three FRETC images as described (Galperin et al., 2004). As shown in Fig. 4A, all three proteins were highly colocalized in endosomes, often concentrated in confined clusters and sites of endosomal tethering. FRET Measurements and Calculations. For 3‐FRET, images were acquired sequentially through FRET(cy) (excitation 436/10 nm, emission

[11]

visualizing of Rab5 using FRET microscopy

131

FIG. 4. 3‐FRET microscopy analysis of Rab5 microdomains in single endosomes of living cells. (A) mRFP‐Rab5, YFP‐EEA1.sh, and CFP‐Rab5 were coexpressed in Cos‐1 cells, the cells were treated with nocodazole for 15 min, and six images were acquired as described in the text. FRETC images are presented in a pseudocolor mode. Insets show an enlargement of the outlined regions of the images. Mean Ed values measured for individual endosomes of the presented cell are shown below the corresponding image inset. Bar ¼ 10
m. (B) Three FRETC images in RGB color format obtained in 3‐FRET experiments (FRETCCY is green, FRETCYR is red, and FRETCCR is blue) were merged. ‘‘White’’ designates the overlap of red, blue, and green. The arbitrary fluorescence intensities of FRETC signals across two endosomes were plotted. FRETCCR is plotted on the right axes. SP is the starting point and EP is the end point. A.l.u.f.i. is arbitrary linear units of fluorescence intensity.

535/30 nm), FRET(cr) (excitation 436/10 nm, emission 630/60 nm), FRET (yr) (excitation 492/18 nm, emission 630/60 nm), CFP (excitation 436/10 nm, emission 465/30 nm), YFP (excitation 492/18 nm, emission 535/30 nm), and mRFP (excitation 580/20 nm, emission 630/60 nm) filter channels.

132

GTPases regulating membrane targeting and fusion

[11]

A dichroic mirror #86006 (Chroma, Inc.) was used. Images were acquired under the same conditions as for the two‐chromophore FRET described above. Backgrounds were subtracted from raw images prior to carrying out FRET calculations. FRETC was calculated for each of the three two‐chromophore FRET pairs in the presence of three fluorescent proteins on a pixel‐by‐pixel basis for the entire image as described for two‐chromophore FRET above, using the formula shown below as modified from Eq. (1): FRET C ¼ Ff

Df ðFd=DdÞ

Af ðFa=AaÞ

Tf ðFt=TtÞ

ð1mÞ

where Tf is a third fluorochrome and Ft/Tt is the cross‐bleed coefficient for the third fluorochrome (fraction of the third fluorochrome passing through the FRET channel). We found that Ft/Tt is <0.5% for all combinations of fluorochromes and assumed these values to be zero. The cross‐bleed coefficients through the FRET(yc) channel were 0.90 and 0.02 for CFP and YFP fluorescence respectively; 0.065 and 0.11 for YFP and mRFP fluorescence, respectively through the FRET(yr) channel; and 0.065 and 0.005 for CFP and mRFP fluorescence, respectively, through the FRET(cr) channel. No significant bleedthrough (<0.5%) among the CFP, YFP, and mRFP filter channels was observed, so these cross‐bleeds were considered effectively zero. Images were inspected for the shift of fluorescence compartments during image acquisition and discarded if such shifts occurred. The apparent FRET efficiency Ed was calculated using Eq. (2). The values of G(cy) ¼ 3.099, G(cr) ¼ 1.290, and G(yr) ¼ 0.416 were calculated for CFP–YFP, CFP–mRFP, and YFP–mRFP donor–acceptor pairs, respectively, as described by Gordon et al. (1998). Ed was calculated using regional analysis, as was described for two‐chromophore FRET analysis. As shown in Fig. 4A, FRETC images and Ed values were indicative of the energy transfer between YFP‐EEA.1sh and mRFP‐Rab5, CFP‐Rab5 and YFP‐EEA.1sh, and CFP‐Rab5 and mRFP‐Rab5. Merging three FRETC images of the individual endosomes produced similar distribution of FRETC signals for three FRET pairs across the endosomes, which is consistent with the presence of three‐protein complexes (Fig. 4B). Data in Fig. 4 demonstrate the detection of three‐protein complexes in early endosomes of living cells. Colocalization of Rab5 and EEA.1sh proteins and maximal FRETC signals were often concentrated in microdomains within the endosomes, which likely correspond to ‘‘Rab5 microdomains.’’ Although detection of FRET between two Rab5 proteins was somewhat surprising, this observation suggested that endosome‐associated Rab5 is capable of homodimerization or oligomerization. In fact, the potential of homodimerization of Rab5 in its GTP‐bound conformation has been

[11]

visualizing of Rab5 using FRET microscopy

133

previously demonstrated in in vitro experiments (Daitoku et al., 2001). Hence, our data demonstrate that FRET‐based sensors can be utilized for detection of the Rab5 protein complex and for analysis of the molecular architecture of this complex. Conclusion The method described in this chapter for visualization of Rab5 activity by fluorescent sensors using sensitized FRET microscopy is straightforward. The main advantage of genetically encoded fluorescent sensors for Rab5 activity is the detection of a GTP‐bound form of Rab5 in living cells. FRET‐based sensors can be useful for visualization of the cellular localization of the active Rab5 form and for elucidating the spatial–temporal relationship between Rab5 and its effectors during membrane trafficking in the living cells as well as during signaling processes. Furthermore, similar sensors can be designed to detect activity of other Rabs in living cells.

Acknowledgments This work was supported by grants from National Cancer Institute, National Institute of Drug Abuse (A.S.), and American Cancer Society (A.S. and E.G.), and a postdoctoral fellowship from the American Heart Association (to E.G.).

References Berney, C., and Danuser, G. (2003). FRET or no FRET: A quantitative comparison. Biophys. J. 84, 3992–4010. Campbell, R. E., Tour, O., Palmer, A. E., Steinbach, P. A., Baird, G. S., Zacharias, D. A., and Tsien, R. Y. (2002). A monomeric red fluorescent protein. Proc. Natl. Acad. Sci. USA 99, 7877–7882. Christoforidis, S., and Zerial, M. (2000). Purification and identification of novel Rab effectors using affinity chromatography. Methods 20, 403–410. Daitoku, H., Isida, J., Fujiwara, K., Nakajima, T., and Fukamizu, A. (2001). Dimerization of small GTPase Rab5. Int. J. Mol. Med. 8, 397–404. de Renzis, S., Sonnichsen, B., and Zerial, M. (2002). Divalent Rab effectors regulate the subcompartmental organization and sorting of early endosomes. Nat. Cell. Biol. 4, 124–133. Galperin, E., and Sorkin, A. (2003). Visualization of Rab5 activity in living cells by FRET microscopy and influence of plasma‐membrane‐targeted Rab5 on clathrin‐dependent endocytosis. J. Cell. Sci. 116, 4799–4810.

134

GTPases regulating membrane targeting and fusion

[11]

Galperin, E., Verkhusha, V. V., and Sorkin, A. (2004). Three‐chromophore FRET microscopy to analyze multiprotein interactions in living cells. Nat. Methods 1, 209–217. Gaullier, J. M., Simonsen, A., D’Arrigo, A., Bremnes, B., Stenmark, H., and Aasland, R. (1998). FYVE fingers bind PtdIns(3)P. Nature 394, 432–433. Gordon, G. W., Berry, G., Liang, X. H., Levine, B., and Herman, B. (1998). Quantitative fluorescence resonance energy transfer measurements using fluorescence microscopy. Biophys. J. 74, 2702–2713. Horiuchi, H., Lippe, R., McBride, H. M., Rubino, M., Woodman, P., Stenmark, H., Rybin, V., Wilm, M., Ashman, K., Mann, M., and Zerial, M. (1997). A novel Rab5 GDP/GTP exchange factor complexed to Rabaptin‐5 links nucleotide exchange to effector recruitment and function. Cell 90, 1149–1159. Kutateladze, T., and Overduin, M. (2001). Structural mechanism of endosome docking by the FYVE domain. Science 291, 1793–1796. Lawe, D. C., Patki, V., Heller‐Harrison, R., Lambright, D., and Corvera, S. (2000). The FYVE domain of early endosome antigen 1 is required for both phosphatidylinositol 3‐phosphate and Rab5 binding. Critical role of this dual interaction for endosomal localization. J. Biol. Chem. 275, 3699–3705. Lippe, R., Horiuchi, H., Runge, A., and Zerial, M. (2001). Expression, purification, and characterization of Rab5 effector complex, rabaptin‐5/rabex‐5. Methods Enzymol. 329, 132–145. Nielsen, E., Christoforidis, S., Uttenweiler‐Joseph, S., Miaczynska, M., Dewitte, F., Wilm, M., Hoflack, B., and Zerial, M. (2000). Rabenosyn‐5, a novel Rab5 effector, is complexed with hVPS45 and recruited to endosomes through a FYVE finger domain. J. Cell. Biol. 151, 601–612. Stenmark, H., and Olkkonen, V. M. (2001). The Rab GTPase family. Genome Biol. 2, review S3007.. Stenmark, H., Parton, R. G., Steele‐Mortimer, O., Lutcke, A., Gruenberg, J., and Zerial, M. (1994). Inhibition of rab5 GTPase activity stimulates membrane fusion in endocytosis. EMBO J. 13, 1287–1296. Szymkiewicz, I., Shupliakov, O., and Dikic, I. (2004). Cargo‐ and compartment‐selective endocytic scaffold proteins. Biochem. J. 383, 1–11. Vitale, G., Rybin, V., Christoforidis, S., Thomqvist, P., McCaffrey, M., Stenmark, H., and Zerial, M. (1998). Distinct Rab‐binding domains mediate the interaction of Rabaptin‐5 with GTP‐bound Rab4 and Rab5. EMBO J. 17, 1941–1951. Wouters, F. S., Bastiaens, P. I., Wirtz, K. W., and Jovin, T. M. (1998). FRET microscopy demonstrates molecular association of non‐specific lipid transfer protein (nsL‐TP) with fatty acid oxidation enzymes in peroxisomes. EMBO J. 17, 7179–7189. Zerial, M., and McBride, H. (2001). Rab proteins as membrane organizers. Nat. Rev. Mol. Cell. Biol. 2, 107–117.