Vitamin D receptor interactions with the murine osteopontin response element

ft. Steroid Biochem. Molec. Biol. Vol. 59, No. 5/6, pp. 377-388, 1996 Copyright © 1996 Elsevier Science Ltd. All rights reserved Printed in Great Britain PII: 80960-0760(96)00127-6 0960-0760/96 $15.00 + 0.00

Pergamon

V i t a m i n D Receptor Interactions with the Murine Osteopontin Response Element N i c h o l a s J. K o s z e w s k i , 1. T i m o t h y

A . R e i n h a r d t 2 a n d R o n a l d L. H o r s t 2

'University of Kentucky Medical Center, Department of Internal Medicine, Division of Nephrology, Bone and Mineral Metabolism, 800 Rose Street, Lexington, K Y 40536-0084, U.S.A. and 2United States Department of Agriculture, Agricultural Research Service, National Animal Disease Center, Metabolic Diseases and Immunology Research Unit, Ames, IA 50010-0070, U.S.A.

The nature of the DNA binding interactions of the human vitamin D receptor (hVDR) with the m u r i n e o s t e o p o n t i n v i t a m i n D r e s p o n s e e l e m e n t ( m O P V D R E ) was e x a m i n e d . B o t h r e c o m b i n a n t h V D R a n d h u m a n r e t i n o i d X r e c e p t o r ~ (hRXR~) p r o t e i n s w e r e o b t a i n e d f r o m b a c u l o v i r u s - i n f e c t e d Sf9 i n s e c t cells. M i x i n g e x t r a c t s o f t h e two r e c o m b i n a n t p r o t e i n s r e s u l t e d in t h e s t r o n g , specific f o r m a r i o n o f a s l o w e r m i g r a t i n g c o m p l e x in t h e e l e c t r o p h o r e t i c m o b i l i t y shift assay. C r u d e e x t r a c t s o f t h e e x p r e s s e d h V D R a l o n e w e r e also c a p a b l e o f b i n d i n g w i t h h i g h a f f i n i t y to t h e m O P s e q u e n c e , a n d this b i n d i n g was e n h a n c e d in t h e p r e s e n c e o f 1 , 2 5 - d i h y d r o x y v i t a m l n D3 (1,25-(OH)eD3). C o m p e t i t i o n e x p e r i m e n t s c o n f i r m e d t h e s p e c i f i c i t y o f this i n t e r a c t i o n a n d r e v e a l e d t h a t t h e h u m a n o s t e o c a l c i n V D R E was a p o o r c o m p e t i t o r f o r this b i n d i n g . E t h y l a r i o n i n t e r f e r e n c e f o o t p r i n t a n a l y s e s o f hVDR/hRXR/~ a n d h V D R c o m p l e x e s r e v e a l e d o n l y s u b t l e d i f f e r e n c e s in h o w t h e s e two d i f f e r e n t VDR-containing complexes interacted with the mOP VDRE. The footprints displayed contact points in b o t h h a l v e s o f t h e d i r e c t r e p e a t f o r m a t , c o n f i r m i n g t h e d i m e r i c a n d m a j o r g r o o v e i n t e r a c t i o n s o f both types of complexes. DNA affinity chromatography of labelled hVDR extracts revealed a peak e l u t i n g at ca. 290 n~M KCI t h a t was c a p a b l e o f r e b i n d i n g to t h e m O P s e q u e n c e in gel shift e x p e r i m e n t s . U l t r a v i o l e t (UV) l i g h t - c r o s s l i n k i n g e x p e r i m e n t s o f h V D R e x t r a c t s a l o n e to r a d i o l a b e l i e d D N A w e r e c o n s i s t e n t w i t h t h e e x i s t e n c e o f a h o m o d i m e r i c h V D R i n t e r a c t i o n . A d d i t i o n a l l y , t h e s e experiments confirmed the direct interaction of a hVDR/hRXRff heterodimer when mixed extracts w e r e u t i l i z e d . F r o m t h e s e r e s u l t s we i n f e r t h a t h o m o d i m e r s o f t h e h V D R w h i c h r e s p o n d w i t h e n h a n c e d D N A b i n d i n g to p a r t i c u l a r v i t a m i n D r e s p o n s e e l e m e n t s w h e n e x p o s e d to 1 , 2 5 - ( O H ) e D 3 are possible. This may be of functional significance when RXR proteins are limiting or RXR ligand is p r e s e n t w i t h i n a cell. C o p y r i g h t © 1996 E l s e v i e r S c i e n c e L t d .

J. Steroid Biochem. Mol,ec. Biol., Vol. 59, No. 5/6, pp. 377-388, 1996

INTRODUCTION T h e steroid hormone: receptor superfamily can be characterized by c o m m o n Zn-coordinated D N A binding motifs either in the N-terminus or mid-molecule region of a receptor and large C-terminal domains where binding of the specific lipophile occurs (for reviews, see Refs. [1-13]). T h e ability of these receptors to bind with high affinity to discrete sequences of DNA, termed hormone response elements, and alter transcriptional events within a cell in response to hormone binding is a central tenet of this family of pro*Correspondence to N. J. Koszewski. Tel: +1 606 323 6502; Fax: +1 606 323 1020. Received 15 Mar. 1996; accepted 20 Jun. 1996.

teins. T h e vitamin D, thyroid, retinoic acid, and retinoid X receptors constitute a subfamily characterized by their non-classical steroid ligands and a propensity to form heterodimers in addition to homodimers when binding to DNA. Their hormone response elements more closely resemble direct hexanucleotide repeats with variable numbers of intervening base pairs (bp). A n u m b e r of vitamin D response elements (VDREs) have been identified that induce both positive and negative transcriptional responses to the hormone [4-12]. These elements have been characterized as direct repeats, nominally described as the sequence G G G T C A , separated by three intervening nucleotides. T h e individual VDREs, however, are marked by pronounced D N A sequence heterogeneity 377

N.J. Koszewski et al.

378

both between themselves as well as between half sites within the same element. In addition, a n u m b e r of reports have described VDREs resembling inverted palindromes, or intervening nucleotides greater than 3 bp [13-15]. This diversity may reflect an array of graded transcriptional responses produced by the vitamin, or the complexity of other factors that interact with the hormone-receptor complex. Examination of the D N A binding characteristics of highly purified V D R revealed the necessity of a nuclear extract to promote high-affinity interactions with the h u m a n and rat osteocalcin response elements [16-18]. Subsequent work has demonstrated that the RXR family of proteins may substitute for a nuclear extract to promote VDR D N A binding as a heterodimeric complex in vitro [19-22], and that these receptors are present in V D R complexes obtained from in vivo sources [22, 23]. However, recent reports have shown that the V D R is capable of interacting with the m O P VDRE, a perfect repeat of the 5' G G T T C A sequence, or similarly derived elements as a homodimer [24-27]. A model has emerged that involves VDR binding to the m O P sequence as a homodimer in the absence of hormone [26]. Subsequent binding by this receptor complex to the hormonal form of the vitamin, 1,25-(OH)2D3, has a destabilizing effect, which in turn lends itself to promoting formation of a heterodimeric complex with RXR. An interest in the diversity of the known VDRE binding sites prompted the inclusion of the m O P sequence in ongoing studies examining the D N A binding specificity of VDR/RXR complexes. In this report, the interactions of recombinant h V D R with the m O P sequence are presented that confirm the binding capability of the h V D R to the m O P sequence as a homodimer, but indicate that this binding is enhanced by the presence of hormone.

MATERIALS AND METHODS

Oligonucleotides and plasmids T h e m O P VDRE (bold letters) was constructed by annealing 35-bp oligonucleotides possessing B a m H I and XbaI compatible ends with the following sequence of the top strand: 5' CTAGATCGGGTAGGGTTCACGAGGTTCACT C G A C G . T h e annealed fragment was subsequently subcloned into the BamHI/XbaI site of p G E M l l z f plasmid (Promega, Madison, WI) to generate p M O P l l . T h e h O C V D R E was constructed by annealing 38-bp oligonucleotides possessing B a m H I and XbaI compatible ends with the following sequence of the top strand: 5' CTAGATTGGTGACTCAC CGGGTGAACGGGG G C A T T G C G . T h e annealed fragment was subcloned into p G E M 1 1 z f as above to yield p H O C l l . T h e insertion of the cloned D N A fragments was con-

firmed by dideoxynucleotide sequencing. T h e AP-1 and ERE competitor DNAs were generated by annealing 24-bp oligonucleotides of the follow sequences for the top strands: AP- 1, 5' A A T F C G C q - ~ F G A T G A G T C A G C C G G A ; ERE 5' GATCCCTGGTCAGCGTGACCGGAG. All oligonucleotides were synthesized by the University of Kentucky Macromolecular Structure Analysis Facility.

Preparation of recombinant h VDR and hRXRfl protein Recombinant hVDR and hRXRfl-containing extracts were prepared from baculovirus-infected Sf9 insect cells. Briefly, a BamHI/XbaI fragment containing the coding region of the h V D R was subcloned into pVL1392 to create pVLhVDR. An EcoRI/PstI fragment encompassing the coding region of hRXRfl was subcloned into pVL1393 to create pVLhRXRfl. Separate transfections of Sf9 insect cells were initiated using these recombinant vectors in combination with the linearized Baculogold virus according to the manufacturer's protocol (PharMingen, San Diego, CA, U.S.A.). T h r e e rounds of viral amplification were carried out in each case to generate high-titer viral stocks for production of recombinant proteins. For protein production, 1 ml of either viral stock was added to 3 x 107 Sf9 insect cells (multiplicity of infection > 10) and infection allowed to proceed for variable times (48 h was standard). T h e cells were scraped free and collected at 600 x g for 10 rain at room temperature. T h e supernatant was discarded and the cells were washed once in ice-cold phosphate-buffered saline (PBS) and collected as before at 4°C. T h e cell pellets were resuspended in six volumes of buffer (20 m M Tris (pH 7.5), 1 m M E D T A , 2 m M D T T , 350 m M KC1, 10 m M NaF, 100 # M Na3VO4, 0.1 m M leupeptin and 10% glycerol) and homogenized on ice with three ca. 10-s bursts using a mechanically driven teflon pestle fitted for a microfuge tube. T h e extracts remained on ice for 15 min with occasional mixing and then were clarified by centrifugation at 30,000 x g for 6 0 m i n at 4°C. T h e cytosols were snap-frozen and stored at - 7 0 ° C prior to use.

Hormone binding assay and Western blotting Approximately 0 . 5 # g of cytosolic protein were added to 1 2 x 7 5 m m borosilicate glass tubes in 0 . 5 m l of buffer ( p H 7 . 6 ) containing 1 0 m M Tris HCi, 0.3 M KCI, 5 m M D T T , 0.05% bovine gamma globulin, 0.1% gelatin and 0.35% polyvinyl alcohol (MN 13,000-23,000). Competitive binding assays were performed using increasing concentrations of unlabelled ligand (0.048-1600 nM) in the presence of a fixed concentration of (26,27-3H, 80 Ci/mmol)-l,25(OH)2D3 (0.12 nM). Non-specific binding was measured in the presence of 3.8 n M unlabelled 1,25(OH)2D3. T h e mixture was incubated for 1 h at 25°C. T h e ICso was calculated from the radioligand binding assay data.

VDR Binding to Murine Osteopontin VDRE For Western blotting the protein samples were separated on 10% gels according to the method of Laemmli [28]. T he proteins were transferred onto PVDF membranes and blocked for 30 min at 4°C with 1% non-fat dry milk in PBS/0.5% Tween 20. Incubation with the 9A7~ monoclonal antibody for VDR (1:10,000 dilution) was continued in the same buffer overnight with gentle agitation. The blot had three 10-min washes with PBSFFween and was then incubated with horseradish peroxidase-linked rabbit anti-rat antibody (1:10,000 dilution). Following three washes as above the blotted proteins were revealed by chemiluminescent detection (Amersham, Arlington Heights, IL, U.S.A.).

Electrophoretic mobility shift assay DNA probes were generated by endlabelling linearized and CIP-treated plasmids, pMOP11 or pHOC11, with polynucleotide kinase and 7-32p-ATP (5000 Ci/mmol; Amersham, Bucks., U.K.). Linearization and fragment excision were accomplished with the combination of EcoRI and HindIII restriction enzymes to yield 74-bp (mOP) and 77-bp (hOC) radiolabelled probes. Typically, 1015,000 cpm of probe ([ca. 3-5 fmol) were mixed with the recombinant proteins for the gel mobility shift assay. Cytosols of recombinant hVDR or hRXR/~ were diluted (1:50 dilution was standard) in ice-cold K T E D G buffer ( 4 0 0 m M KCI, 2 0 m M Tris (pH 7.5), 1 mM EDTA, 2 m M D T F and 10% glycerol) prior to use. Samples were kept cold and 1± 2 #1 of diluted extract(s) were used in a 20 #1 final volume (VDR concentration ca. 1-2 nM) in a buffer that included 100 m M KC1, 2 0 m M Tris (pH 7.5), 1.5 mM EDTA, 2 m M D T T , 5% glycerol, 0.5% CHAPS [29, 30], 1 0 m M NaF, 100#M Na3VO4, 0.5-1.0/~g dIdC and 100 nM 1,25-(OH)2D3. Following incubation on ice for 15 min the radiolabelled probe was added and incubation continued for 1 h. The samples were then applied to cooled, pre-run 5% polyacrylamide gels (29:1) in 0.5x T BE buffer and electrophoresed at 14 V/cm for 3 h. Gels were transferred, dried and autoradiography performed. The 9A7~ anti-VDR monoclonal antibody was allowed to incubate with the gel shift samples for 1 h at 4°C prior to probe addition. The same protocol was followed for the inclusion of RXR~ and RXRfl polyclonal antisera (SC Biotech, Santa Cruz, CA, U.S.A.).

Ethylation interferenceflgotprinting The ethylation interference footprints were obtained as previously described [31]. Briefly, 32p-endlabelled DNA probes in 5 0 r a M sodium cacodylate buffer (pH 8.0) were treated with ethylnitrosourea-saturated ethanol for 20 min at: 55°C. Following precipitation with sodium acetate/ethanol and reprecipitation (3x), the pellets were washed with 70% ethanol, dried and

379

resuspended in water. Ethylated probes were then used in the gel mobility shift assay as above, except the amounts of probe were increased to 10-15 fmol. Following electrophoresis the wet gels were exposed to X-ray film overnight at 4°C. Acrylamide sections corresponding to bound and free DNA were excised and the DNA was recovered by electrochemical elution and precipitation. Cleavage of the modified DNA was accomplished by treating with 100 m M NaOH/0.1 m M E D T A in 10 m M phosphate buffer at 95°C for 30 rain followed by neutralization with 3 M sodium acetate (pH 5.2) and precipitation with ethanol. Following recovery of the precipitates, the samples were electrophoresed through 8% sequencing gels, dried and autoradiography performed.

DNA affinity chromatography Oligonucleotides of the mOP VDRE (see above) were annealed and linked to CNBr-activated Sepharose 4B according to the manufacturer's protocol (Pharmacia LKB, Piscataway, NJ, U.S.A.). The column was washed with K T E D G - 1 0 0 buffer (100 m M KC1) containing 50 pM leupeptin, 100 #M sodium vanadate, and 10 m M sodium fluoride (LVF). An aliquot (100#1) of hVDR cytosol was labelled with 3H-1,25(OH)2D3 in the presence of a 100-fold excess of cold steroid in a K T E D G - 1 0 0 buffer containing LVF as above in addition to final concentrations of 0.5% CHAPS and 5 #g/ml dIdC. The sample was incubated on ice for 1 h, gently mixed with the mOP-Sepharose for 30 min, poured into a column and fraction collection (1 ml) initiated. The column was washed with ca. five column volumes of K T E D G - 1 0 0 buffer, 10 column volumes of K T E D G 220, followed by a gradient from 220 to 1 M KC1. Column eluent was monitored for 3H counts by liquid scintillation counting. Aliquots from the individual fractions were removed for sodium dodecylsulphatepolyacrylamide gel electrophoresis (SDS-PAGE) analysis, gel mobility shift assays and potassium determinations.

UV crosslinking The oligonucleotide of the top strand of the mOP VDRE (see above) was end-labelled with 7-32p-ATP and T 4 polynucleotide kinase and annealed to its complementary strand. This double-stranded DNA fragment was then included in incubations as described above for the mobility shift assays. In an analogous fashion the bottom strand was radiolabelled and annealed to its complement. Samples contained either recombinant hVDR extract alone or in combination with hRXR/~ extract. The sample tubes were maintained on ice and irradiated for variable times at a wavelength of 300 nm (11,000 #W/cm2). Following irradiation the crosslinked materials were mixed with 2x SD S-PA G E loading buffer and denatured at 95°C for 5 min. The samples were then loaded onto 10%

380

N.J. Koszewski

A

et al.

B 48

96

WT

100 80 60 40 20

0.01

O.I

I

I

I

I (Jill)

I0 100 Lg Sterol (rig)

Fig. 1. Western blot and h o r m o n e binding assay o f r e c o m b i n a n t h V D R . A. St9 cells were infected with r e c o m binant h V D R baculovirus or with wild-type baculovirus (WT) and cells were harvested and cytosols p r e p a r e d at the indicated t i m e points. Increasing v o l u m e s of m a t e r i a l were a n a l y s e d b y W e s t e r n blotting with the 9A7T a n t i - V D R m o n o c l o n a l antibody. B e c a u s e of the a m o u n t o f h V D R p r o d u c e d at 48 h it w a s n e c e s s a r y to dilute these extracts 1:10 and then load the s a m e v o l u m e s relative to the undiluted extracts o b t a i n e d at the 96 h t i m e point. B. H o r m o n e binding a s s a y of h V D R s h o w i n g c o m p e t i t i o n for binding with unlabelled 1,25-(OH)2D3 (m) or 25-(OH)D3 (0).

SDS gels and proteins separated as above. Following electrophoresis the gels were fixed, dried and autoradiography performed. RESULTS T o study the D N A binding properties of the h V D R the receptor was overexpressed in Sf9 insect ceils with a recombinant baculovirus. A time-course for protein expression revealed that 48 h was the optimal time for harvesting infected cells (Fig. 1). Western blot analysis identified a single band at approximately 4 9 50 kDa on blots when probed with the 9A7y m o n o clonal anti-VDR antibody [32], consistent with the size of the native protein [33, 34]. Estimates of h V D R expression indicated that the receptor was present as 3 - 5 % of total protein when examined by Coomassie blue staining of S D S - P A G E gels (data not shown). Also presented in Fig. 1 are the relative affinities of the recombinant receptor for 1,25-(OH)2D3 and 25(OH)D3 in the radioreceptor binding assay. F r o m these data the concentration required to produce a 50% inhibition of binding (ICso) for 1,25-(OH)2D3 was determined to be 0.38 nM. T h e 25-OHD3, however, was approximately 200-fold less competitive than 1,25-(OH)2D3 with an ICso of 80 nM, a difference that is in agreement with earlier studies using

both the native and recombinant forms of the receptor [33-35]. Expression of hRXR/~ was also achieved in Sf9 cells with 48 h of infection again being the optimal time for protein production. Western blot analysis revealed a protein migrating at ca. 68 kDa, and estimates of protein production by S D S - P A G E and Coomassie blue staining indicated the protein was present as 13% of total protein (data not shown). T h e binding properties of the recombinant receptor with 9-cis retinoic acid were examined in detail and are being reported elsewhere [36]. We next examined the D N A binding properties of the recombinant receptors with the murine osteopontin VDRE. As seen in Fig. 2, addition of equal volumes of diluted whole cell extracts of expressed h V D R and hRXRfl resulted in the retardation of a single, prominent band. Preincubation with 9A7y anti-VDR monoclonal antibody or an anti-RXRp polyclonal antibody resulted in strong attenuation of this bound band, indicating that both proteins were present in this complex. However, incubation with the anti-RXR/~ antibody, whereas inhibiting formation of the slower migrating complex, resulted in the appearance of a new, faster migrating band. When the same amount of diluted h V D R extract used to produce the heterodimer complex was incubated alone in

VDR Binding to Murine Osteopontin VDRE

381

7 8 9 10 11 12

123456

!ii~/~!i!i~i!~ii~!i~ii~!~i!~i~i~i!~i~i~:i~!~!i~i~i~:~i~i~:i~i~ii~i?

ii~iiiii!i !iiiiiiiiiiii!iiiiiiiiiiii!i!iiiiiiiiiiiiiiiiii!i!iii!iiiiiiiiii!iiiiiiiii!i!!iiii i~i~i~i!~i~ii~i!~iJ~i~i~i~i~i~i~!i~i!~!!i!i~i~i~i~i!~i~i~!i~i~:~i~!~i~i~i~i B-Ht B-Hm

iiiiiiiiiiii!iiiii!i!iiii!ii!iiiii!iiiiiii!! i iiiiiiiiii!iiiiiiiiiiii!iiiiii! ~i~!i!~i!!!iii~!~!ii~ii~i~i~i!i~i~i~i!~iii~i~i~i~ii~ii!~i~i~iiii!iii!iiiii!

Fig. 2. Electrophoretic m o b i l i t y shift a s s a y s o f h V D R a n d h R X R f l e x t r a c t s w i t h t h e m O P V D R E . S h i f t a s s a y s h o w i n g the position of the b o u n d h e t e r o d i m e r i c ( B - H t ) , b o u n d h o m o d i m e r i c ( B - H m ) a n d free (F) c o m p l e x e s . Lanes 1-6 u t i l i z e d m i x e d e x t r a c t s o f h V D R a n d h R X R f l . L a n e 1 w a s c o n t r o l b i n d i n g ; l a n e 2 w a s p r e - i n c u b a t i o n w i t h t h e 9A7~ a n t i - V D R r a t m o n o c l o n a l a n t i b o d y ; l a n e 3 i n c l u d e d p r e - i n c u b a t i o n w i t h n o n - s p e c i f i c r a t serum; lanes 4 a n d 5 were p r e - i n c u b a t i o n s w i t h a n t i - R X R f l a n d a n t i - R X R c t p o l y c l o n a l rabbit sera; l a n e 6 w a s c o m p e tition w i t h a 200-fold e x c e s s o f u n l a b e l l e d m O P oligo probe. Lanes 7-12 were analogous to lanes 1-6 except extracts o f h V D R were u s e d exclusively. In all c a s e s 1,25-(OI-]DeD 3 w a s a d d to 100 n M f i n a l concentration.

the presence of h o r m o n e with the osteopontin probe, it resulted in the appearance of a strong complex migrating at this same position (Fig. 2, lane 7). T h e hRXRfl extract alone or cytosols from mock-infected Sf9 cells failed to produce a retarded complex with the m O P p r o b e (data not shown). T h e identity and specificity of h V D R in this novel complex was confirmed by incubation with the 9A7~ monoclonal antibody and competition with unlabelled m O P probe. R X R polyclonal antibodies for the ~t and fl isoforms failed to supershift or to inhibit the formation of this novel complex. T o determine further the specificity of this interaction, competition experiments with unlabelled D N A elements were initiated. Incubation with excess annealed oligonucleotides encompassing a consensus AP-1 binding site or the perfect estrogen response ele m e n t (ERE) from the chicken vitellogenin II gene had no effect on the interaction of the h V D R extract with the osteopontin probe (Fig. 3A). Furthermore, competition with the V D R E from the h u m a n osteocalcin gene, known to bind the V D R as a heterodimer with high affinity [6, 17], was only partly effective at the higher concentration in competing for binding by this complex. In contrast, the same a m o u n t of osteocalcin competitor was able to compete completely for binding by the heterodimer to the osteopontin probe (Fig. 3B). Direct interaction with radiolabelled osteocalcin probe resulted in the formation of a weak, dif-

fuse band with only the most concentrated sample of the recombinant h V D R extract tested, suggesting at least a 10-100-fold lower binding avidity to this D N A sequence (Fig. 3C). In view of the model put forth recently describing the destabilizing effect of h o r m o n e addition to purified h V D R h o m o d i m e r s in their interaction with the osteopontin sequence [27], we sought to test the binding of the baculovirus-derived recombinant h V D R extract in the absence or presence of hormone. All of the previous experiments had been done in the presence of 1,25-(OH)2D3, which m a y have been exerting a repressive effect on the observed D N A binding. T o address this concern, dilutions of the recombinant h V D R extract were incubated with the osteopontin probe in either the absence of added horm o n e or with a fixed a m o u n t of 1,25-(OH)2D 3 (100 nM). Binding was observed in the absence of h o r m o n e at even the most dilute concentration tested; however, there was a strong e n h a n c e m e n t (eight-fold) of D N A binding by the presence of h o r m o n e at this dilution (Fig. 3D). T h e h o r m o n e effect was less pronounced (ca. three-fold at the 0.1 #1 point) as the concentration of h V D R increased in conjunction with a corresponding increase in overall D N A binding, until both conditions resulted in the saturation of the probe. Ethylation interference footprint experiments were undertaken to ascertain and contrast the interactions

382

N . J . Koszewski et al.

A

AP-I

ERE

B

OC

OC

(" 2O0 20 200 20 200 20

ERE

C 200 2OO

B-Ht B-Hm

C ~tl .01

+1,25D 3

.I

I

D

-1,25D 3

~tl.ol

.I

t

+1,25D 3 .0t

.t

t

Fig. 3. Competition experiments and hormone dependence for DNA binding. A. Competition with unlabelled competitor DNAs for binding to the m O P VDRE by hVDR extracts in the presence of 100 nM hormone. Fold excess of competitor DNA indicated above each lane: C, control; AP-1, consensus AP-1 binding site; ERE, chicken vitellogenin II perfect ERE; OC, human osteocalcin VDRE. B. Competition with unlabelled competitor DNAs for binding to the mOP VDRE by hVDR/hRXRfl heterodimeric complexes formed by mixed extracts and 100 nM 1,25-(OH)eD3. C. Binding to the hOC VDRE in the presence of hormone (100 nM) using the indicated amounts of hVDR extract in a 20/d binding reaction. D. Similar to (C) except the mOP VDRE is used and the analysis is done in the absence and presence (100 nM) of hormone. of the h V D R / h R X R f l h e t e r o d i m e r c o m p l e x with those p r o d u c e d with the r e c o m b i n a n t h V D R extracts alone. T h i s type o f interference will identify c o n t a c t s to the p h o s p h a t e b a c k b o n e as well as g u a n i n e residues [31, 37]. T h e h e t e r o d i m e r c o m p l e x p r o d u c e d a f o o t p r i n t over b o t h halves of the direct repeat s e q u e n c e , i n d i c a tive o f d i m e r b i n d i n g (Fig. 4). S t r o n g i n t e r f e r e n c e was observed with the m o d i f i e d 5' p G p G p p h o s p h a t e s a n d g u a n i n e s of the u p p e r s t r a n d in b o t h halves of the direct repeat, a l t h o u g h subtle differences in the

extent o f i n t e r f e r e n c e were observed b e t w e e n each of the e l e m e n t h a l f sites. O n the opposite s t r a n d , the c o n t a c t p o i n t s were c e n t e r e d over the 5' p T p G p s e q u e n c e . T h e observed 5' stagger of c o n t a c t p o i n t s is c o n s i s t e n t with m a j o r groove i n t e r a c t i o n s for b o t h of the h e t e r o d i m e r i c p a r t n e r s [31, 38]. T h e footprints displayed b y the h V D R c o m p l e x were a l m o s t identical to those seen for the h V D R / h R X R f l h e t e r o d i m e r , c o n f i r m i n g the d i m e r i c a n d m a j o r groove i n t e r a c t i o n s for this complex.

383

VDR Binding to Murine Osteopontin VDRE

,.,.,

,.,.,

GGTTCACGAGGTTCA

e~

Fig. 4. Ethylation interference footprints o f c o m p l e x e s isolated from gel shifts using m i x e d extracts (Het) and h V D R extracts alone ( H o m ) . Electrophoretic gel mobility shift assay was used to separate bound (B) and free (F) c o m p l e x e s using ethylated 32P-labelled probes. The D N A probes were recovered, hydrolyzed with N a O H and the cleaved fragments electrophoresed through 8% sequencing gels and dried, followed by autoradiography. Areas o f interference are indicated by arrows for phosphate contacts and closed circles for guanine residues to the side o f the sequence. Control hydrolysis (C) o f ethylated probe is indicated. T o investigate m o r e closely the interactions of the hVDR-containing insect cytosols, the extracts were radiolabelled with tritiated h o r m o n e and applied to a m O P oligo-linked Sepharose column. Following extensive washing, a gradient from 220 m M to 1 M KC1 revealed a tritiated peak eluting at ca. 290 m M KC1 (Fig. 5A), a slightly lower salt concentration than that observed for the heterodimer with hRXRfl (330 m M , data not shown). Peak fractions were then assessed for D N A binding to the m O P V D R E in the gel mobility shift assay (Fig. 5B). Bound material was once again evident that corresponded with the previously observed b a n d seen with crude extracts. S D S P A G E analysis and silver staining of a peak fraction revealed a specific protein at ca. 4 9 - 5 0 (Fig. 5C, b a n d no. 1), coincident with a b a n d revealed by Western blotting with the 9A77 monoclonal a n t i - V D R antibody (data not shown). T h e only other notable observation was evidence of proteins at ca. 45 kDa and 26 kDa, whose elution paralleled that observed for the h V D R complex. A series of UV-crosslinking experiments were pursued to define the proteins in direct contact with the D N A further. Thirty-five base-pair oligonucleotides of either strand of the m O P sequence were 32p-endla-

belled and annealed to its c o m p l e m e n t a r y unlabelled strand.

This

hVDR

extract

DNA alone

was then

incubated

or in combination

with the with

an

hRXRfl extract to generate a heterodimeric complex. T h e samples were crosslinked for variable amounts of time and the products analysed by S D S - P A G E and autoradiography. As seen in Fig. 6A, use of the recombinant h V D R alone resulted in the crosslink of a single species with a relative molecular weight consistent with coupling of the h V D R protein to the radiolabelled 35-bp oligonucleotide of the top strand. In a similar fashion, mixed extracts resulted in the appearance of two radiolabelled proteins corresponding to both the h V D R and hRXRfl (Fig. 6B), substantiating that both proteins are in direct contact with D N A [19]. Specificity for either the h o m o d i m e r (Fig. 6C, opposite strand radiolabelled) or the heterodimer (data not shown) was confirmed by c o m p e tition with unlabelled m O P and E R E elements, providing additional evidence that the h V D R was capable of interacting with the m O P sequence specifically as a homodimer.

384

N.J. Koszewski et al.

A

C

B Peak fractions

1800

500

1600

450

1400

400

r.12oo

350

"~1000

300 250

800

200

600

150

400

100

200

50

0

I

L

1

0

G e l shift f r a c t i o n s Fig. 5. D N A affinity chromatography and S D S - P A G E analysis of peak fractions. A. Elution profile of 3Hlabelled proteins from m O P V D R E affinity column. Aliquots were removed for liquid scintillation counting and determination o f potassium concentration by flame photometry. B. S a m p l e s from the peak fractions were removed and analysed for their ability to rebind to the m O P V D R E in the gel shift assay. The designation of the peak fractions corresponds to those denoted in (A) above. Control binding by a cytosollc extract o f h V D R infected Sf9 cells is indicated. C. A sample from a peak fraction was denatured in Laemrnli buffer, and electrophoresed through a 10% denaturing S D S gel, fixed and silver-stained. B a n d 1 corresponds to the h V D R as determined by Western blots of the s a m e fraction (not shown). The 45 kDa and 26 kDa proteins are designated as numbers 2 and 3. DISCUSSION

Data in the present report demonstrate that the recombinant h V D R derived from baculovirus infection of Sf9 ceils is capable of binding to the murine osteopontin V D R E in the absence of an added accessory factor. Furthermore, this interaction is consistent with a V D R h o m o d i m e r binding to this element, but that this interaction is enhanced by 1,25-(OH)2D3. Production of recombinant h u m a n and rat V D R in Sf9 insect cells by baculovirus infection has been reported previously [33, 39]. In both cases the addition of a nuclear extract was necessary to observe high-affinity binding by the V D R with the osteocalcin V D R E s in the electrophoretic gel mobility shift assay. Recent work indicated that the R X R family of proteins can function in the capacity of a nuclear factor to restore high-affinity D N A binding by the V D R [19-22]. T h e results reported here are consistent with those earlier observations. T h e recombinant h V D R is of the correct molecular weight as determined by Western blotting and is capable of binding 1,25(OH)2D3 with high affinity and specificity. T h e addition of recombinant hRXRfl also resulted in the specific formation of a heterodimer complex that b o u n d avidly to the m O P V D R E sequence. However,

extracts of recombinant h V D R alone were also capable of binding to the m O P sequence in the mobility shift assay at the same concentrations used in promoting heterodimer formation with hRXRfl. This novel complex, migrating independent of the position of the heterodimer, interacted with the 9A77 m o n o clonal anti-VDR antibody and exhibited specificity as judged by cold competition with the m O P V D R E and unrelated specific D N A binding sites. T h e h V D R expressed and purified from Escherichia coli binds as a h o m o d i m e r to the m O P sequence with high affinity in the absence of hormone, but is destabilized by the addition of 1,25-(OH)2D3 [27]. However, a modest h o r m o n e - d e p e n d e n t increase in the dimerization of immobilized rat V D R with in vitro translated V D R in the absence of D N A has been observed [40]. In contrast, it has been reported that V D R binding and activation of the m O P V D R E in SL-3 cells occurs in an R X R - d e p e n d e n t m a n n e r [14]. Our results using extracts of receptor produced in Sf9 cells indicated that h o r m o n e enhanced binding by a h o m o d i m e r to the osteopontin element. Whether this reflects inherent differences in the expression systems chosen, or the inclusion of additional proteins in the Sf9 extracts that serve to stabilize a h o r m o n e - b o u n d

VDR Binding to Murine Osteopontin VDRE

A

Time

B

5 15 50

385

C

5 15 50

C

E

(rain)

82 K 64 K

ii!i

64 K ~

iiii!!!!~iiiii!ill! iii

Fig. 6. U V c r o s s l i n k o f r e c o m b i n a n t e x t r a c t s w i t h m O P V D R E . A. T o p s t r a n d w a s r a d i o l a b e l l e d , a n n e a l e d to its c o m p l e m e n t a n d c r o s s H n k e d to h V D R e x t r a c t s f o r t h e i n d i c a t e d t i m e s . S a m p l e s w e r e d e n a t u r e d a n d l o a d e d o n t o a 10% d e n a t u r i n g gel f o r a n a l y s i s . T h e gels w e r e t h e n fixed, d r i e d , f o l l o w e d b y a u t o r a d i o g r a p h y . B. S a m e as i n (A) e x c e p t m i x e d e x t r a c t s o f h V D R a n d h R X R b w e r e u t i l i z e d . C . T h e l o w e r s t r a n d w a s r a d i o l a b e l l e d , a n n e a l e d to its c o m p l e m e n t a n d c r o s s l i n k e d to h V D R e x t r a c t s f o r 50 m i n . S y m b o l s a r e C, c o n t r o l ; m O P , 200fold e x c e s s o f u n l a b e l l e d m O P c o m p e t i t o r w a s a d d e d ; E R E , 200-fold e x c e s s o f u n l a b e l l e d E R E c o m p e t i t o r w a s added.

h o m o d i m e r is unclear. M o r e recent work has d e m o n strated the ability of a heterodimeric V D R complex to interact with other factors, including T F I I B [41, 42]. Protein modifications in the Sf9 cells in the course of viral expression of the V D R m a y have resulted in a pool of receptors altered in such a way as to now be capable of binding as a h o m o d i m e r . Alternatively, protein bands at ca. 4 5 k D a and 2 6 k D a were observed eluting with the h V D R from the m O P affinity column. T h e identity of these proteins remains to be determined, but their presence was also observed when eluting a heterodimeric complex from the affinity column as well (.data not shown). T h e relative inability of the h O C V D R E to compete effectively, together with the p o o r binding exhibited by the h V D R extracts for this sequence in the m o b i lity shift assay, are consistent with earlier observations [16, 17, 19]. In addition, the observed selectivity in binding to the m O P sequence, by comparison to the noted weak binding to the h O C V D R E and other tested sequences (data not shown), would also argue against a general nuclear accessory factor similar to the R X R proteins being present in the Sf9 cells. T h e D N A sequence selectivity exhibited by an h V D R h o m o d i m e r , as oppo,;ed to the efficient binding exhibited by the heterodimer to b o t h sequences, m a y be attributed to differences in b o t h halves of the respective response elements. As recently pointed out, a thy-

midine at position three of a half site appears to be critical for high-affinity binding by the h V D R h o m o dimer [25, 26] (unpublished observations N. J. K.). Binding by the V D R as part of a heterodimer m a y still occur to the h O C element, either with a p r e s u m ably lower affinity for the V D R [26], or by altering the D N A binding interactions of the V D R as part of a heterodimeric complex [24, 43]. T h e interference footprint generated by the h V D R extract to the m O P V D R E confirmed the dimeric nature of the interaction, and ruled out possible binding by a m o n o m e r . In addition, it clearly delineated the contact points for b o t h the h o m o d i m e r i c and heterodimeric complexes to the 15-bp sequence. T h a t the footprints for the hetero- and h o m o d i m e r i c c o m plexes resemble each other so closely m a y be a reflection of the amino acid conservation that exists in the D N A binding domains of these two proteins, in particular, the recognition helices. T h e data from the interference footprints, however, merely identifed the modified D N A positions that precluded protein binding, but not the strength of the respective interactions. Within this context it is noteworthy that elution of the h o m o d i m e r i c h V D R complex from the m O P D N A affinity column required a slightly lower concentration of salt than the heterodimer formed with h R X R ~ (290 m M vs 330 m M ) , suggesting a lower binding affinity by the h o m o d i m e r . Although the footprint

386

N . J . Koszewski et al.

d a t a i m p l i e d similar b i n d i n g b y b o t h c o m p l e x e s to t h e m O P V D R E , t h e tightness o f the i n t e r a c t i o n as d e t e r m i n e d b y p e a k salt e l u t i o n is e n h a n c e d for the h e t e r o d i m e r . W h e t h e r this reflects differences in D N A b i n d i n g i n t e r a c t i o n s n o t r e v e a l e d b y the f o o t p r i n t i n g e x p e r i m e n t s o r a d e s t a b i l i z i n g effect o f salt o n p r o tein-protein contacts within the hVDR homodimer r e m a i n s to b e d e t e r m i n e d . I n a d d i t i o n , b i n d i n g to the affinity c o l u m n o c c u r s to a single i s o l a t e d e l e m e n t a n d m o r e r e c e n t d a t a p r o v i d e e v i d e n c e for c o o p e r a t i v e b i n d i n g b y V D R h o m o d i m e r s to a D N A f r a g m e n t p o s s e s s i n g two s p a c e d m O P e l e m e n t s [43]. Besides cooperative interactions between homodimers, that s t u d y also d e m o n s t r a t e d t h a t t h e V D R h o m o d i m e r c o u l d c o o p e r a t e w i t h s e l e c t e d o t h e r factors b i n d i n g to t h e i r D N A e l e m e n t s . B e c a u s e m o s t m a m m a l i a n genes are r e g u l a t e d b y a c o m p l e x a r r a y o f basal a n d i n d u c e d t r a n s c r i p t i o n factors, these types o f c o o p e r a t i v e forces m a y p r o v i d e a d d i t i o n a l s t a b i l i z a t i o n to D N A b i n d i n g by VDR homodimers. Mixing equal volumes of recombinant hVDR and h R X R f l extracts, albeit an excess o f h V D R , gave a l m o s t exclusively a h e t e r o d i m e r i c c o m p l e x in t h e m o b i l i t y shift assay. Yet, w h e n the a n t i - R X R f l p o l y clonal sera was a d d e d to p r e v e n t b i n d i n g b y t h e h e t e r o d i m e r c o m p l e x , a new, faster m i g r a t i n g c o m p l e x was o b s e r v e d t h a t c o i n c i d e d w i t h t h e b i n d i n g p a t t e r n r e v e a l e d b y sole use o f t h e h V D R - c o n t a i n i n g extracts. T h i s c o u l d p r e s u m a b l y arise f r o m e i t h e r the R X R antisera inhibiting heterodimer formation, thus creating a larger p o o l o f h V D R h o m o d i m e r s , o r t h e effective r e m o v a l o f t h e h e t e r o d i m e r c o m p l e x f r o m c o m p e t i n g for D N A b i n d i n g sites with the r e m a i n i n g excess h V D R p r e s e n t t h e n able to b i n d . T h i s suggests t h a t if t h e i n t r a c e l l u l a r c o n c e n t r a t i o n o f the V D R o u t strips t h e availability o f an a c c e s s o r y factor, a p o p u lation of liganded homodimers m a y arise to p o t e n t i a l l y c o m p e t e for s o m e types o f D N A b i n d i n g sites. H o w m i g h t t h e results o f t h e p r e s e n t s t u d y b e inc o r p o r a t e d into the c u r r e n t state o f V D R i n t e r a c t i o n s with its h o r m o n e r e s p o n s e e l e m e n t s ? T h e d a t a p r e s e n t e d h e r e suggest t h a t d e p e n d i n g o n t h e s e q u e n c e o f t h e D N A r e s p o n s e e l e m e n t t h e r e are m u l t i p l e p a t h ways available to t h e l i g a n d e d V D R . F o r b i n d i n g to s e q u e n c e s o f t h e m O P class, t h e available e v i d e n c e w o u l d i n d i c a t e t h a t the p r e f e r r e d p a t h w a y following h o r m o n e a d d i t i o n is f o r m a t i o n o f a h e t e r o d i m e r w i t h R X R [25, 27], u l t i m a t e l y l e a d i n g to a l t e r e d t r a n s c r i p t i o n a l r e s p o n s e s . T h i s p a t h w a y m a y b e v i e w e d as o p erative given sufficient c o n c e n t r a t i o n s o f R X R in t h e cell, o r t h a t a l i g a n d s u c h as 9-cis r e t i n o i c acid for t h e R X R p r o t e i n s is n o t p r e s e n t to destabilize the V D R / R X R h e t e r o d i m e r c o m p l e x [22, 27]. T h e R X R f a m i l y o f p r o t e i n s is k n o w n to h e t e r o d i m e r i z e w i t h a n u m b e r o f t r a n s c r i p t i o n factors in a d d i t i o n to f o r m i n g active h o m o d i m e r i c c o m p l e x e s [20, 21, 30, 44, 45]. S h o u l d t h e available i n t r a c e l l u l a r c o n c e n t r a t i o n s o f the R X R s

be limiting, o r a l i g a n d such as 9-cis r e t i n o i c a c i d b e present, then the formation of VDR homodimers c o u l d b e p r o m o t e d . T h e t r a n s c r i p t i o n a l r e s p o n s e to 1 , 2 5 - ( O H ) 2 D 3 for s e l e c t e d genes w o u l d t h u s b e d r i ven b y the relative intraceUular c o n c e n t r a t i o n s o f V D R , the R X R f a m i l y o f p r o t e i n s a n d b o t h ligands; w h i c h c a n b e v i e w e d as an a d d i t i o n a l m e a n s o f finet u n i n g t h e cellular r e s p o n s e to the h o r m o n e . O u r d a t a i n d i c a t e d t h a t the l i g a n d e d V D R h o m o d i m e r can i n t e r a c t in a specific fashion w i t h the m O P V D R E . H o w e v e r , it r e m a i n s to b e d e t e r m i n e d if this c o m p l e x is c a p a b l e o f d i r e c t l y r e g u l a t i n g t r a n s c r i p t i o n a l activity, either positively o r negatively, t h r o u g h its i n t e r a c t i o n s w i t h this o r o t h e r s i m i l a r h o r m o n e response elements. Notwithstanding a recent report [40], it w o u l d a p p e a r t h a t the f o r m a t i o n o f h o m o d i m e r i c V D R c o m p l e x e s is largely l i m i t e d in the a b s e n c e o f a n a p p r o p r i a t e D N A s e q u e n c e [17, 27], w h i c h m a y also i n f l u e n c e its ability to m o d u l a t e t r a n s c r i p t i o n a l p r o c e s s e s b y p r o t e i n - p r o t e i n c o n t a c t s as o b s e r v e d for o t h e r m e m b e r s o f t h e s t e r o i d r e c e p t o r s u p e r f a m i l y [ 4 6 - 4 8 ] . T h e r e f o r e , it r e m a i n s to b e seen if an h o m o d i m e r i c c o m p l e x is a viable t r a n s c r i p t i o n a l e n t i t y w i t h i n a cell. C u r r e n t efforts are u n d e r w a y to a d d r e s s t h o s e c o n c e r n s a n d d e t e r m i n e if the results p r e s e n t e d h e r e c a n b e e x t e n d e d to the w i l d - t y p e r e c e p t o r s i s o l a t e d f r o m sources t h a t are k n o w n targets for t h e h o r m o n e . Acknowledgements--This study was supported, in part, by NIH

grant DK47883, the University of Kentucky Medical Research Fund (N. J. K.) and Dialysis Clinic Incorporated (1'4. J. K.). The authors would like to thank Holli D. Sullivan and Derrel A. Hoy for excellent technical assistance. They would also like to thank Dr J. W. Pike for the 9A77 monoclonal antibody, Dr L. P. Freedman for the hVDR cDNA, Dr D. Noonan for the hRXRfl cDNA, and Drs S. Amold; C. Langub; and H. H. Malluche for their critical review of this manuscript.

REFERENCES

1. Beato M.: Gene regulation by steroid hormones. Cell 56 (1989) 335-344. 2. Evans R. M.: The steroid and thyroid hormone receptor superfamily. Science 240 (1988) 889-895. 3. Yamamoto K. R.: Steroid regulated transcription of specific gene and gene networks. Annu. Rev. Genet. 19 (1985) 209252. 4. Kemer S. A., Scott R. A. and Pike J. W.: Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D3. Proc. Natn. Acad. Sci. U.S.A. 86 (1989) 4455-4459. 5. Noda M., Vogel R. L., Craig A. M., Prahl J., DeLuca H. D. Denhardt D. T.: Identification of a DNA sequence responsible for binding of the 1,25-dihydroxyvitamin D3 receptor and 1,25-dihydroxyvitamin D3 enhancement of mouse secreted phosphoprotein l(Spp-1 or osteopontin) gene expression. Proc. Natn. Acad. Sci. U.S.A. 87 (1990) 9995-9999. 6. Ozono K., Liao J., Kemer S. A., Scott R. A. and Pike J. W.: The vitamin D-responsive element in the human osteocalcin gene. 57. Biol. Chem. 265 (1990) 21881-21888. 7. Terpening C. M., Hanssler C. A., Jurutka P. R. W., Galligan M. A., Komm B. S. and Haussler M. R.: The vitamin D-responsive element in the rat bone glaprotein gene is an imperfect direct repeat that cooperates with other cis-elements in

V D R Binding to M u r i n e O s t e o p o n t i n V D R E

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

1,25-dihydroxyvitamin D3-mediated transcriptional activation. Molec. Endocr. 5 (3 (1991) 373-385. Umesono K., Murakami K. K., Thompson C. C. and Evans R.: Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65 (1991) 1255-1266. Zierold C., Darwish H. M. and DeLuca H. F.: Two vitamin D response elements function in the rat 1,25-dihydroxyvitamin D 24-hydroxylase promoter. J. Biol. Chem. 270 (4 (1995) 16751678. Liu S. M., Koszewski N., Lapuz M., Malluche H. H., Olivera A. and Russell J.: Characterization of a response element in the 5'-flanking region of the avian (chicken) PTH gene that mediates negative regulation of gene transcription by 1,25-dihydroxyvitamin D3 and binds the vitamin D3 receptor. Molec. Endocr. 10 (1996) 206-215. DeMay M. B., Kiernan M. S., DeLuca H. F. and Kronenberg H. M.: Characterization of 1,25-dihydroxyvitamin D3 receptor interactions with target sequences in the rat osteocalcin gene. Molec. Endocr. 6 (1992) 557-562. DeMay M. B., KJernan M. S., DeLuca H. F. and Kronenberg H. M.: Sequences in the human parathyroid hormone gene that bind the 1,25-dihydroxyvitamin D3 receptor and mediates transcriptional repression in response to 1,25dihydroxyvitamin D3. Proc. N a m . Acad. Sci. U.S.A. 89 (1992) 8097-8101. Gill R. K. and Christakos S.: Identification of sequence elements in mouse calbindin-D28k gene that confer 1,25-dihydroxyvitamin D3- and butyrate-inducible responses. Proc. N a m . Aead. Sci. U.S.A. 90 (1993) 2984-2988. Carlberg C., Bendik I., Wyss A., Meier E., Eturzenbecker L. J., Grippo J. F. and Hunziker W.: Two nuclear signalling pathways for vitamin D. Nature 361 (1993) 657-660. Schrader M., Nayeri S., Kahlen J.-P., Muller K. M. and Carlberg C.: Natural vitamin D3 response elements formed by inverted palindromes: polarity-directed ligand sensitivity of vitamin D3 receptor-retinoid X receptor heterodimermediated transactivation. Molec. Cell. Biol. 15 (3 (1995) 1154-1161. Liao J., Ozono K., Sone T., McDonnell D. P. and Pike J. W.: Vitamin D receptor interaction with specific DNA requires a nuclear protein and 1,25-dihydroxyvitamin D3. Proc. Nam. Acad. Sci. U.S.A. 87 (11990) 9751-9755. Sone T., Kemer S. and Pike J. W.: Vitamin D receptor interaction with specific DNA. J. Biol. Chem. 266 (1991) 2329623305. Ross T. K., Moss V E., Prahl J. M. and DeLuca H. F.: A nuclear protein essential for binding of rat 1,25-dihydroxyvitamin D3 receptor to its response elements, laroc. Nam. Acad. Sci. U.S.A. 89 (1992) 256-260. Sone T., Ozono K. and Pike J. W.: A 55-kilodalton accessory factor facilitates vitamin D receptor DNA binding. Molec. Endocr. 5 (1991) 1578-1586. Yu V. C., Delsert C., Andersen B., Holloway J. M., Devary O. V., Naar A. M., Kim S. Y., Bontin J.-M., Glass C. K. and Rosenfeld M. G.: RXRfl: a coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell 67 (1991) 1251-126,5. Kliewer S. A., Umesono K., Mangelsdorf D. J. and Evans R. M.: Retinoid X recepl:or interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature 355 (1992) 446-449. MacDonald P. N., Dowd D. R., Nakajima S., Galligan M. A., Reeder M. C., Haus,;er C. A., Ozato K. and Haussler M. R.: Retinoid X receptors stimulate and 9-cis retinoic acid inhibits 1,25-dihydroxyvitamin D3-activated expression of the rat osteocalcin gene. A4olec. Cell. Biol. 13 (1993) 5907-5917. Munder M., Herzherg I. M., Zierold C., Moss V. E., Hanson K., Clagett-Dame M and DeLuca H. F.: Identification of the porcine intestinal accessory factor that enables DNA sequence recognition by vitanfin D receptor. Proc. Narn. Acad. Sci. U.S.A. 92 (1995) 2795-2799. Towers T. L., Luisi B. F., Asianov A. and Freedman L. P.: DNA target selectivity by the vitamin D3 receptor: mechanism of dimer binding to an asymmetric repeat element. Proc. Nam. Acad. Sci. U.S.A. 90 (1993) 6310-6314.

387

25. Nishikawa J.-I., Kitaura M., Matsumoto M., Imagawa M. and Nishihara T.: Differences and similarities of DNA sequence recognized by VDR homodimer and VDR/RXR heterodimer. Nucl. Acids Res. 22 (1994) 2902-2907. 26. Freedman L. P., Arce V. and Fernandez R. P.: DNA sequences that act as high affinity targets for the vitamin D3 receptor in the absence of the retinoid X receptor. Molec. Endocr. 8 (1994) 265-273. 27. Cheskis B. and Freedman L. P.: Ligand modulates the conversion of DNA-bound vitamin D3 receptor (VDR) homodimers into VDR-retinoid X receptor heterodimers. Molec. Cell. Biol. 14 (1994) 3329-3338. 28. Laemmli U. K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 (1970) 680-685. 29. Hassanain H. H., Dai W. and Gupta S. L.: Enhanced gel moblity shift assay for DNA-binding factors. Analyt. Biochem. 213 (1993) 162-167. 30. Allegretto E. A., McClurg M. R., Lazarchik S. B., Clem D. L., Kerner S. A., Elgort M. G., Boehm M. F. and White S. K.et al.: Transactivation properties of retinoic and retinoid X receptors in mammalian cells and yeast, ft. Biol. Chem. 268 (1993) 26625-26633. 31. Koszewski N. J. and Notides A. C.: Phosphate-sensitive binding of the estrogen receptor to its response elements. Molec. Endocr. 5 (8 (1991) 1129-1136. 32. Pike J. W.: Monoclonal antibodies to chick intestinal receptors for 1,25-dihydroxyvitamin D3. ft. Biol. Chem. 259 (1984) 1167-1173. 33. MacDonald P. N., Haussler A. C., Terpening C. M., Galligan M. A., Reeder M. C., Whitfield G. K. and Haussler M. R.: Baculovirus-mediated expression of the human vitamin D receptor, ft. Biol. Chem. 266 (1991) 18808-18813. 34. Baker A. R., Mcdonnell D. P., Hughs M., Crisp T. M., Mangelsdorf D. J., Haussler M. R., Pike J. W., Shine J. and O'Malley B. W.: Cloning and expression of full-length cDNA encoding human vitamin D receptors. Proc. N a m . Acad. Sci. U.S.A. 85 (1988) 3294-3298. 35. Reinhardt T. A., Horst R. L., Littledike E. T. and Beitz D. C.: 1,25-dihydroxyvitamin D3 receptor in bovine thymus gland. Biochem. Biophys. Res. Commun. 106 (1982) 10121028. 36. Horst R. L., Reinhardt T. A., Goff J. P., Koszewski N. J. and Napoli J. L.: 9,13-Di-cis-retinoic acid is the major circulating geometric isomer of retinoic acid in the periparturient period. Arch. Biochem. Biophys. 322 (1995) 235-239. 37. Siebenlist U. and Gilbert W.: Contacts between Escherichia coli R_NA polymerase and an early promoter of phage T7. Proc. N a m . Acad. Sci. U.S.A. 77 (1980) 122-126. 38. Gartenberg M. R., Ampe C., Steitz T. A. and Crothers D. M.: Molecular characterization of the GCN4-DNA complex. Proc. Nam. Acad. Sci. U.S.A. 83 (1990) 6034-6038. 39. Ross T. K.~ Prahl J. M. and DeLuca H. F.: Overproduction of rat 1,25-dihydroxyvitamin D3 receptor in insect cells using the baculovirus expression system. Proc. Nam. Acad. Sci. U.S.A. 88 (1991) 6555-6559. 40. Nishikawa J.-I., Kitaura M., Imagawa M. and Nishihara T.: Vitamin D receptor contains multiple dimerization interfaces that are functionally different. Nucl. Acids Res. 23 (4 (1995) 606-611. 41. Blanco J. C. G., Wang I.-M.~ Tsai S. Y., O'Malley B. W., Jurutka P. W., Haussler M. R. and Ozato K.: Transcription factor TFIIB and the vitamin D receptor cooperatively activate ligand-dependent transcription. Proc. Nam. Acad. Sci. U.S.A. 92 (1995) 1535-1539. 42. MacDonald P. N., Sherman D. R., Dowd D. R. Jr and DeLisle R. K.: The vitamin D receptor interacts with general transcription factor IIB. _7. Biol. Chem. 270 (9 (1995) 47484752. 43. Liu M. and Freedman L. P.: Transcriptional synergism between the vitamin D3 receptor and other nonreceptor transcription factors. Molec. Endocr. 8 (12 (1994) 1593-1604. 44. Mader S., Chen J.-Y., Chen Z . . C h , White J., Chambon P. Gronemeyer H.: The patterns of RAR, RXR, and TR homoand heterodimers to direct repeats dictated by the binding specificities of the DNA binding domains. E M B O J. 12 (1993) 5029-5041.

388

N. J. Koszewski et al.

45. Zhang T.-K., Lehmann J., Hoffmann B., Dawson M. I., Cameron J., Graupner B., Hermann T., Tran P. and Pfahl M.: Homodimer formation of retinoid receptor induced by 9-cis retinoic acid. Nature 358 (1992) 587-591. 46. Gaub M.-P., Bellard M., Scheuer I., Chambon P. and Sassone-Corsi P.: Activation of the ovalbumin gene by the estrogen receptor involves the Fos-Jun complex. Cell 63 (1990) 1267-1276.

47. Schule R., Rangarajan P., Kliewer S., Ransome L. J., Bolado J., Yang N., Verma I. M. and Evans R. M.: Functional antagonism between oncoprotein c-Jun and the glucocorticoid receptor. Cell 62 (1990) 1217-1226. 48. Schule R., Rangarajan P., Yang N., Kliewer S., Ransome L. J., Bolado J., Verma I. M. and Evans R. M.: Retinoic acid is a negative regulator of AP-1 responsive genes. Proc. Natn. Acad. Sci. U.S.A. 88 (1991) 6092-6096.