Vitamin E differentially regulates the expression of peroxiredoxin-1 and -6 in alveolar type II cells

Free Radical Biology & Medicine 38 (2005) 1401 – 1408 www.elsevier.com/locate/freeradbiomed

Original Contribution

Vitamin E differentially regulates the expression of peroxiredoxin-1 and -6 in alveolar type II cells Angelika Tfllea, Michael Schlameb, Nico Charliera, Florian Guthmanna, Bernd Rqstowa,T b

a Klinik fu¨r Neonatologie, Universita¨tsmedizin–Berlin, Charite´ Campus Mitte, D-10098 Berlin, Germany Department of Anesthesiology, New York University School of Medicine, 550 First Avenue, New York, NY 10016, USA

Received 1 October 2004; revised 21 January 2005; accepted 2 February 2005 Available online 3 March 2005

Abstract Vitamin E is the primary lipophilic antioxidant in mammals. Lack of vitamin E may lead to an increase of cytotoxic phospholipidperoxidation products (PL-Ox). However, we could previously show that alimentary vitamin E-depletion in rats did not change the concentrations of dienes, hydroperoxides, and platelet-activating factor-related oxidation products in alveolar type II cells (TII cells). We hypothesized that vitamin E deficiency increases the activity of enzymes involved in the degradation of PL-Ox. Degradation of PL-Ox may be catalyzed by phospholipase A2, PAF-acetylhydrolase, or peroxiredoxins (Prx’s). Alimentary vitamin E deficiency in rats increased the expression of Prx-1 at the mRNA and protein levels and the formation of Prx-SO3, but it did not change the expression of Prx-6 or the activity of phospholipase A2 and PAF-acetylhydrolase in TII cells. H2O2-induced oxidative stress in isolated TII cells activated protein kinase Ca (PKCa) and increased the expression of Prx-1 and Prx-6. Inhibition of PKCa in isolated TII cells by long-time incubation with PMA inhibited PKCa and Prx-1 but not Prx-6. We concluded that the expression of Prx-1 and -6 is selectively regulated in TII cells; PKCa regulates the expression of Prx-1 but not Prx-6. Prx-6 expression may be closely linked to lipid peroxidation. D 2005 Elsevier Inc. All rights reserved. Keywords: Vitamin E; Peroxiredoxins; PKC; Lipid peroxidation; Alveolar type II cells; Lung; Free radicals

Vitamin E belongs to the endogenous cellular defense system against oxidative stress [1]. Vitamin E deficiency frequently induces oxidative stress and lipid peroxidation in different cells and tissues, indicating a disruption of the dynamic balance between oxidants and the endogenous defense system [2–5]. Oxidative stress is a very important factor in the development of acute lung injury. Acute lung injury may occur in response to oxidative air pollutants or during hyperoxic ventilation and may also occur in response to the abrupt change in oxygen tension during the transition from prenatal to postnatal life. Premature neonates tolerate this change poorly and are at high risk of developing acute lung injury [6,7]. In addition to having immature lungs, these infants also exhibit a relative

T Corresponding author. Fax: 0049 (30) 450 516911. E-mail address: [email protected] (B. Rqstow). 0891-5849/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.freeradbiomed.2005.02.001

vitamin E deficiency, compared to mature newborns and adults [8,9]. It has been suggested that this vitamin E deficiency contributes to acute and chronic lung injury and other neonatal disorders [10]. To date, our knowledge about the role of vitamin E in oxidative lung injury is still fragmentary. Previously, we described the effects of alimentary vitamin E deficiency in rats on different aspects of the metabolism in alveolar type II cells (TII cells), an important epithelial cell of the lung. We showed that in vivo depletion of vitamin E caused an increased expression of heat shock proteins HSP32 and HSP70 [11], immunological dysregulation [12], apoptotic sensitization [13], and a reduction of surfactant lipid biosynthesis [14]. Lipid peroxidation in response to vitamin E depletion has so far not been investigated in TII cells. Phospholipid (PL) peroxidation damages cell membranes and is involved in oxidative cell injury [15,16]. The

1402

A. To¨lle et al. / Free Radical Biology & Medicine 38 (2005) 1401–1408

concentration of PL-peroxidation products (PL-Ox) in cellular membranes is balanced by sufficient amounts of membrane-bound lipophilic antioxidants like vitamin E or by the two-step repair mechanism of oxidized PL. This classic concept involves the action of two enzymes: phospholipase A2 (PLA2) catalyzes the excision of oxidized fatty acids, followed by reacylation forming a new intact PL species. Peroxiredoxins (Prx’s) represent a new family of antioxidant enzymes which are able to reduce toxic PLhydroperoxides to nontoxic hydroxy derivatives [17–19]. Therefore, it would be plausible to expect Prx’s to be increased in response to the depletion of lipophilic antioxidants, as in alimentary vitamin E deficiency. The family of Prx’s consists of six isoforms [18] and comparison of the frequency of the individual isoforms in 22 bovine tissues showed that all six Prx’s are expressed in all tissues but to very different extents. Prx-1 and -6 are the most abundant isoforms in the lung [20]. The increase of the Prx-1 expression at the mRNA and protein levels in response to oxygen in newborns suggests that this enzyme may help to protect the lung from excessive oxidative stress during the transition from prenatal to postnatal life [21,22]. Prx-6 is also up-regulated after birth [23,24]. An overexpression of this Prx-6 in a lung-derived cell line protects against membrane damage mediated by PL peroxidation [25]. The active-site cysteine of Prx’s is selectively oxidized during catalysis, whereby oxidation of at least Prx-1, -2, and -3 seems to be reversible [26–29]. Overoxidation yielding Prx-SO3 in vivo is a sensitive indicator of oxidative exposure of cells [28,29]. The aim of the present work is to investigate whether lipid peroxidation is increased in TII cells of rats in response to alimentary vitamin E deficiency and whether phospholipase A2 and platelet-activating factor (PAF)-acetyl hydrolase activity or the expression of Prx-1 and -6 is increased under these conditions.

Materials and methods Materials The diets used were obtained from Altromin (Lage, Germany). The vitamin E-depleted diet contained less than 2 mg a-tocopherol per kilogram; the vitamin Eenriched diet contained 400 mg RRR-a-tocopherol (Sigma, Taufkirchen, Germany) per kilogram. Phorbol12-myristate-13 acetate (PMA) was from Calbiochem– Novabiochem (Bad Soden, Germany). l-3-Phosphatidylcholine-1-palmitoyl-2-[1-14C]oleoyl (sp act 52.2 mCi/ mmol) was purchased from Amersham Biosciences Europe (Freiburg, Germany) and hexadecyl-2-acetyl[3H]-sn-glycerol-3-phosphatidylcholine (sp act 7.10 Ci/ mmol) was from DuPont NEN (Boston, MA, USA). All

other chemicals of the highest purity grade were obtained from Merck (Darmstadt, Germany). Feeding regimen Wistar rats (body mass 80 to 90 g) received the control diet or vitamin E-depleted diet ad libitum for 5 weeks. Thereafter, some vitamin E-depleted rats received the vitamin E-enriched diet ad libitum for 3 days. Preparation of alveolar type II cells TII cells were isolated using the elastase method as described by Dobbs et al. [30]. Viability was controlled by trypan blue staining and purity by Harris type hematoxylin staining of the isolated TII cells. Viability and purity ranged from 90 to 95% and 87 to 93%, respectively. Freshly isolated TII cells were suspended in Dulbecco’s minimal essential medium (DMEM; Gibco BRL, Life Technologies, Paisley, Scotland) and aliquots were shock-frozen in liquid N2 and stored at 808C. Primary culture of TII cells Freshly isolated TII cells were suspended in DMEM containing 10% fetal calf serum (Gibco BRL), and H2O2 (Aldrich, Germany; final concentration 500 AM) was added. The cells were cultured in the presence of H2O2 for 8 h at 378C on cell culture dishes (Gibco BRL). Cells were scraped off and washed twice with DMEM and once with PBS and were thereafter used for membrane preparation and lysis. Lysis of TII cells and membrane preparation were performed as outlined in previous communications [31,32]. Determination of conjugated dienes and lipid hydroperoxides (LOOH) Conjugated dienes were determined in lipid extracts according to the procedure described by Fuhrman et al. [33]. TII cell homogenates were extracted with hexane: isopropanol (3:2; v/v). The upper hexane phase was evaporated to dryness in a stream of N2 and redissolved in 1 ml of hexane, and the content of conjugated dienes was detected spectrophotometrically at 234 nm against a hexane blank. The extinction E 234 was calculated per milligram of cell protein. Lipid hydroperoxides were determined using a commercial kit (Lipid Peroxidation Assay Kit II; Calbiochem, Merck) according to the instructions of the manufacturer. The assay is based on the oxidation of ferrous ions to ferric ions by hydroperoxides under acidic conditions. The ferric ions bind with xylenol orange to form a stable complex which can be measured at 560 nm. The concentration of hydroperoxides is calculated from the absorbance and the hydroperoxide apparent molar extinction coefficient 4.31  104 M 1 cm 1.

A. To¨lle et al. / Free Radical Biology & Medicine 38 (2005) 1401–1408

Determination of PAF-related compounds Oxidative degradation of polyunsaturated fatty acyl residues in phosphatidylcholine (PC) results in the formation of PCs containing short-chain alkyls, aldehydes, or carbonic acids. The determination of these PAF-related compounds was carried out as described previously [34,35]. The method involves lipid extraction, chromatographic enrichment of PCs with short acyl chains, derivatization with 9-(chloromethyl)anthracene, solid-phase extraction of the derivatives, and reversed-phase HPLC with fluorescence detection. The fragmented PCs were quantified by their fluorescence yield relative to the internal standard 1-palmitoyl-2-suberoyl-PC [35]. Phospholipase A2 assay 1-Palmitoyl-2-[1-14Coleoyl-PC (2.5 ACi) in dimethyl sulfoxide (DMSO) was added to TII cell homogenate and incubated in buffer (75 mM Tris base, 5 mM CaCl2, pH 8.5, or 40 mM acetate buffer, 5 mM EDTA, pH 4.0) for 60 min. The radioactive fatty acid that split off was extracted by the addition of Dole reagent [36]. The extracted radioactivity was measured in a scintillation counter (Wallac 1410; Pharmacia, Uppsala, Sweden). The specific radioactivity of the substrate was the basis for the calculation of the phospholipase A2 activity in picomoles of fatty acid split off per milligram of cell protein in 60 min. PAF-acetylhydrolase assay PAF-acetylhydrolase degrades PAF-related compounds; the activity was determined as previously described [37]. [3H]PAF in 1% Tween 20 was added as substrate to TII cell homogenate in buffer (0.5 M Hepes, 5 mM EGTA, pH 7.2) and incubated at 378C for 30 min. Thereafter, chloroform: methanol (4:1; v/v) and 10 mM Tris–HCl, 5 mM EDTA, pH 7.5, were added to the incubation mixture and carefully mixed. The radioactivity of the upper phase and the specific radioactivity of the substrate were used for the calculation of the PAF-acetylhydrolase activity in nanomoles of acetate split off per106 cells in 60 min. Western blot analysis The protein concentrations of protein kinase Ca (PKCa) in the cellular membrane fractions, Prx-1 and -6, and oxidized Prx’s (Prx-SO3) in lysates of TII cells were estimated by SDS–PAGE with subsequent Western blot analysis using specific antibodies for the determination of the individual proteins as previously described [38,11, 12,39]. PKCa was identified using rabbit anti PKCa antiserum (Calbiochem, La Jolla, CA, USA); for the identification of Prx-1 and -6 and for Prx-SO3 we used specific polyclonal antibodies from rabbit (LabFrontier, Seoul, South Korea). The determination of actin using

1403

mouse monoclonal anti-h-actin clone AC-15 (Sigma) on the blots was carried out as loading control. Peroxidaseconjugated goat anti-rabbit IgG and goat anti mouse IgG were from Pierce (Bonn, Germany) and were used as secondary antibodies. Reverse transcriptase and real-time quantitative PCR Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Samples were further treated with DNase I (DNA-free; Ambion, Austin, TX, USA) to avoid any DNA contamination. Quality of RNA was assessed by formaldehyde agarose gel electrophoresis. Reverse transcription was performed with 0.5 Ag RNA added to the reaction mix containing AmpliTaq Gold DNA polymerase, RNase inhibitor, AmpliTaq DNA polymerase, and random hexamers (Applied Biosystems, Foster City, CA, USA). Negative reverse transcriptase (RT) (no enzyme) and no-template (no RNA) controls were also included. The RT thermal cycle was 10 min at 258C, 60 min at 378C, and 5 min at 958C. For real-time PCR, Prx-1 and -6 were detected using SYBR Green. Primers are shown in Table 1. Primers were purchased from Metabion (Martinsried, Germany). Primers were designed with Primerdesigner (Applied Biosystems). The correct product size was then confirmed by electrophoresis. The PCR mixture (25 Al total volume) consisted of 0.3 AM each primer, 2 reaction buffer (dNTP, HotGoldstar DNA polymerase, uracil-N-glycosylase, 5 nM MgCl2), SYBR Green, and 1 Al of template. Amplification and detection were performed using Taqman (Applied Biosystems) with the following cycle profile: 2 min at 508C, 10 min at 958C, and 40 cycles of 15 s at 958C + 1 min at 608C. Analysis of real-time PCR results The mRNA of three animals was pooled. All results were normalized to h-actin, which is expressed constitutively in all tissues. Quantification was performed by determining the threshold cycle (C T). C T is proportional to the amplified starting copy number of cDNA (or RNA). All reactions were performed in triplicate and controlled by a no-template

Table 1 Primers used for quantitative PCR Gene of interest

Forward and reverse primer

Prx 1

TGTGGATTCTCACTTCTGTCATCTG TGCGCTTGGGATCTGATACC AGCTGCAGTTCCGTAGAAAGATT TTGGTGCCATTTCCATTTAATG GGGAAATCGTGCGTGACATT GCGGCAGTGGCCATCTC

Prx 6 h-Actin

All primers are written 5V to 3V and were purchased from Metabion (Martinsried, Germany).

1404

A. To¨lle et al. / Free Radical Biology & Medicine 38 (2005) 1401–1408

reaction. The quantity of mRNA was calculated by normalizing the C T of genes of interest to the C T of the housekeeping protein h-actin of the same RNA probe. The difference between C T of control and that of vitamin E deficiency or vitamin E refeeding (DDC T) was used to calculate the increase of mRNA as 2DDCT. Inhibition of PKCa TII cells were incubated in the presence of PMA (final concentration 10 AM) solubilized in DMSO (final concentration 0.01%, v/v) for 18 h at 378C [39]. Thereafter PKCa was determined by Western blot analysis in the membrane protein fraction isolated as previously described in detail [40]. Prx-1 and -6 expression was measured by Western blot analysis of TII cell lysates. Other methods Vitamin E and its oxidation product vitamin E quinone were determined by HPLC of hexane extracts from TII cells according Catignani and Bieri [41]. Total protein was determined with Bradford’s reagent (Sigma). Statistic analysis

shown to document that the feeding regime caused differences in the vitamin E contents in TII cells also in the present experiments. Freshly isolated TII cells were used for all experiments. The cellular vitamin E level did not affect formation of PL-Ox or the activity of phospholipase A2 and PAF-acetylhydrolase We expected that the reduction of cellular vitamin E by a factor of 10 would lead to an elevation in PL-Ox in TII cells. The concentrations of various lipid oxidation products, including conjugated dienes, LOOH, PAF-related compounds, and malondialdehyde did not change significantly (Table 2). One possible reason for this unexpected finding may be that PL-Ox are unstable and were lost during TII cell isolation and purification. Another reason might be that enzyme activities that participate in the degradation of PLOx are increased concomitantly. However, we did not find any significant alteration in different types of phospholipase A2 activities in TII cells (Ca2+-dependent alkaline PLA2, Ca2+-independent acidic PLA2, and PAF-acetylhydrolase; see Table 2). Effects of cellular vitamin E content on the expression of Prx’s in TII cells

Significance of differences between means of control and means of vitamin E depletion or between means of control and means of vitamin E refeeding were assessed by Student’s t test.

Results Vitamin E content in TII cells Alimentary vitamin E deficiency in rats caused a decrease of vitamin E and an increase of vitamin E quinone in isolated TII cells (Table 2). These results replicate the results of previous investigations [11–14,39]; the data were

Because Prx’s are also able to detoxify PL-hydroperoxides, we hypothesized that members of this enzyme family may compensate for vitamin E deficiency in our model. In agreement with this assumption, the expression of Prx-1 increased in response to vitamin E depletion in rats at both the protein and the mRNA level in TII cells. Refeeding of vitamin E to vitamin E-depleted rats reversed the overexpression of Prx-1, suggesting a tight relationship between vitamin E level and Prx-1 activity (Fig. 1). In contrast, the expression of Prx-6 was not significantly affected by the cellular vitamin E concentration (Fig. 2). Fig. 3 shows that the formation of Prx-SO3, a by-product of Prx activity, increased in response to the decrease of the

Table 2 Effects of vitamin E on various parameter classes in TII cells TII cells isolated from Vitamin E (pg  106 cells 1) Vitamin E quinone (ng  106 cells 1) % of vitamin E + quinone Conjugate dienes (E 234  mg 1 cell protein) Lipid hydroperoxides (ng  mg 1 cell protein) PAF-related compounds (pmol  106 cells 1) Phospholipase A2 (Ca2+; pH 8.5) (pmol  mg 1 cell protein  60 min 1) Phospholipase A2 (EDTA; pH 4.0) (pmol  mg 1 cell protein  60 min 1) PAF acetylhydrolase (nmol  106 cells 1  60 min 1)

Control rats

Vitamin E-depleted rats

Vitamin E-refed rats

74 F 12 12 F 6 14 0.090 F 0.001 0.39 F 0.03 8.8 F 0.7 116 F 9

6F4 4F2 40 0.078 F 0.011 0.40 F 0.16 8.5 F 0.1 110 F 25

296 F 86 20 F 6 6 0.100 F 0.013 0.50 F 0.08 8.7 F 1.0 115 F 3

232 F 18

228 F 31

263 F 46

1.02 F 0.10

0.96 F 0.11

1.06 F 0.53

A. To¨lle et al. / Free Radical Biology & Medicine 38 (2005) 1401–1408

Fig. 1. Effects of vitamin E on the expression of Prx-1 at the mRNA and protein levels in TII cells. (A) Western blot analysis of Prx-1 and h-actin. hActin was determined as a loading control. (B) Expression of Prx-1 protein was normalized to that of h-actin. The ratio of Prx-1 to h-actin of control was 1. mRNA was estimated from the cycles in the Taqman analysis as 2DDCT; control was 1 (see Materials and methods). Values of n = 3 experiments are given as means F standard deviation. Asterisk indicates a significant difference compared to control (p b 0.05).

1405

Fig. 3. Effects of vitamin E on the expression of Prx-SO3 in TII cells. (A) Western blot analysis of Prx-SO3 and actin. h-Actin was determined as loading control. (B) Expression of Prx-SO3 was normalized to that of h-actin. The ratio of Prx-SO3 to h-actin of control was 1. Values of n = 3 experiments are given as means F standard deviation.

previously described [39]. Thereafter, the expression of Prx1 and -6 was measured (Fig. 4). Inhibition of PKCa decreased the expression of Prx-1, whereas the expression of Prx-6 did not change (Fig. 4).

vitamin E content in TII cells. Again, refeeding of vitamin E reversed this effect on Prx-SO3 concentration. PKCa regulates the expression of Prx-1 but not of Prx-6 Vitamin E-dependent modulation of PKCa is so far the only known nonantioxidant property of vitamin E in TII cells [12]. We inhibited PKCa in isolated TII cells by longtime incubation (18 h) in the presence of 10 AM PMA as

Fig. 2. Effects of vitamin E on the expression of Prx-6 at the mRNA and protein levels in TII cells. Details are as described for Fig. 1.

Fig. 4. Effects of long-time incubation (18 h) of TII cells with 10 AM PMA on the expression of PKCa, Prx-1, and -6 in TII cells. (A) Western blot analysis of PKCa, Prx-1, and -6. (B) Expression of PKCa, Prx-1, and -6 protein was normalized to that of h-actin. The ratio of control was 1. Values of n = 3 experiments are given as means F standard deviation. Asterisk indicates a significant difference compared to control (p b 0.05).

1406

A. To¨lle et al. / Free Radical Biology & Medicine 38 (2005) 1401–1408

H2O2-induced stress activates PKCa and increases the expression of Prx-1 and Prx-6 of TII cells It is a moot point whether alimentary vitamin E deficiency in rats caused an increase of PL-Ox in TII cells, which was lost thereafter during cell isolation and purification, or whether a compensatory increase in Prx-1 immediately degraded the PL-Ox formed in vivo. Culture of cells in the presence of H2O2 for 8 h exhibits oxidative stress in TII cells. We found a doubling of the LOOH concentration 5 min after H2O2 exposure in TII cells. After 8 h incubation, however, the LOOH concentration showed no difference compared to control. PKCa showed, in response to H2O2 treatment of isolated TII cells for 8 h, a small (1.5 F 0.3 in relation to control = 1) but significant activation, and the expression of Prx-1 and Prx-6 increased (13.3 F 5.4 and 1.5 F 0.2 in relation to control = 1; Fig. 5). The activation of PKCa was rather small but it has to be taken into account that H2O2 added to, or generated in [42], the cell medium is completely degraded in the first 60 min of incubation. Also the stimulatory effect of paraquat-generated H2O2 on the PKC activity in human lung cells (WI-38) [43] occurs within minutes and might be subsequently decreased in the course of further incubation.

Discussion Alimentary vitamin E deficiency in rats caused a decrease of vitamin E concentration in TII cells by 90% compared to control. However, the reduction of this important lipophilic antioxidant did not induce an increase

Fig. 5. Effects of hydrogen peroxide on the expression of Prx-SO3 in TII cells. Details are as described for Fig. 4.

of PL-Ox in freshly isolated TII cells. This result indicates that either vitamin E depletion in vivo caused no significant lipid peroxidation in TII cells or in vivo formed PL-Ox were lost during the time it took to isolate and purify the TII cells. The latter assumption has not been investigated so far but it has been shown that after oxidative stress in vivo, PL-Ox were stable enough to be found in blood plasma [44,45], epithelial lining fluid [46,47], and lung tissue [48,49]. In isolated TII cells, H2O2-generated PL-Ox were eliminated within 8 h. However, it seems to be also a plausible interpretation that a compensatory increase of Prx-1 balanced the enrichment of PL-Ox in TII cells by the immediate conversion of the highly reactive PL-hydroperoxides to less reactive hydroxy derivatives. Interestingly, the Prx-6 expression did not change significantly in response to vitamin E content in TII cells. In contrast, Fisher and his group showed that Prx-6 expression increased in response to oxidative stress caused by hyperoxia, H2O2, or paraquat in both whole lung and a rat lung epithelial cell line (L2 cells) [50]. Although the definitive reason for this discrepancy is not clear, it might be assumed that alimentary vitamin E depletion in rats causes in TII cells—if anything—less of an oxidative stress than hyperoxia, H2O2, or paraquat. Treatment of isolated TII cells with H2O2 increased lipid peroxidation and expression of Prx-6, Prx-1, and activated PKCa. Together with the results of the vitamin E feeding experiments, these findings suggest that alimentary vitamin E deficiency in rats did not induce oxidative stress reflected by lipid peroxidation in TII cells. The higher level of Prx-SO3, normally seen as a sensitive indicator of oxidative exposure, may merely be the result of the increase in total Prx protein concentration in our experiments. In addition to its property as a radical scavenger, vitamin E exhibits nonantioxidative properties. Vitamin E modulates the activity of PKCa in TII cells [12] and various other cell types [51,52]. Inhibition of PKC inhibits the oxygenmediated increase of Prx-1 mRNA in A549 cells [21], indicating that the modulation of PKCs may be involved in the regulation of Prx’s in the lung. Furthermore, protein phosphorylation was shown to be one of the factors that affect Prx activity [24,12] and in parallel the expression of Prx-1 but not Prx-6. H2O2 induced lipid peroxidation and activated PKCa of TII cells in primary culture [43]. Consequentially, we found an increased expression not only of Prx-6 but also of Prx-1. In summary, we conclude that activation of PKCa mediates a reversible increase of the Prx-1 expression in TII cells isolated from vitamin E-depleted rats, whereas lipid peroxidation did not increase under these conditions. Therefore, the vitamin E-induced increase of Prx-1 expression is not directly coupled to a higher cellular content of PL-Ox. In contrast to Prx-1, the elevation of Prx-6 expression seems to be closely linked to increased lipid peroxidation and might represent a powerful mechanism protecting TII cells against accumulation of cytotoxic

A. To¨lle et al. / Free Radical Biology & Medicine 38 (2005) 1401–1408

amounts of PL-Ox. Therefore the missing increase of Prx-6 expression in response to vitamin E depletion is another argument corroborating the assumption that alimentary vitamin E depletion in rats does not increase lipid peroxidation in TII cells. The differentially regulated expression of Prx-1 and Prx-6 in TII cells may be seen as an indication that the individual members of the peroxiredoxin family have different metabolic function or show a graded activation in response to the extent of the oxidant load; Prx-1 expression already reacts very sensitively at marginal oxidative exposure without increased lipid peroxidation, but with activation of PKCa, whereas Prx-6 expression reacts to severe oxidative exposure accompanied by lipid peroxidation independent from the modulation of PKCa.

References [1] Chow, C. K. Vitamin E and oxidative stress. Free Radic. Biol. Med. 11:215 – 232; 1991. [2] Mazor, D.; Brill, G.; Shorer, Z.; Moses, S.; Meyerstein, N. Oxidative damage in red blood cells of vitamin E deficient patients. Clin. Chim. Acta 265:131 – 137; 1997. [3] Shvedova, A. A.; Kisin, E. R.; Murray, A. R.; Kommineni, C.; Castranova, V.; Mason, R. P.; Kadiiska, M. B.; Gunther, M. R. Antioxidant balance and free radical generation in vitamin E-deficient mice after dermal exposure to cumene hydroperoxide. Chem. Res. Toxicol. 15:1451 – 1459; 2002. [4] Rafique, R.; Schapira, A. H.; Coper, J. M. Mitochondrial respiratory chain dysfunction in ageing; influence of vitamin E deficiency. Free Radic. Res. 38:157 – 165; 2004. [5] Frey, B.; Haupt, R.; Alms, S.; Holzmann, G.; Konig, T.; Kern, H.; Kox, W.; Rustow, B.; Schlame, M. Increase in fragmented phosphatidylcholine in blood plasma by oxidative stress. J. Lipid Res. 41:1145 – 1153; 2000. [6] Horbar, J. D.; Badger, G. J.; Carpenter, J. H.; Fanaroff, A. A.; Kilpatrick, S.; LaCorte, M.; Phibbs, R.; Soll, R. F. Trends in mortality and morbidity for very low birth weight infants, 1991–1999. Pediatrics 110:143 – 151; 2002. [7] Saugstad, O. D. Mechanisms of tissue injury by oxygen radicals: implications for neonatal disease. Acta Paediatr. 85:1 – 4; 1996. [8] Chan, D. K.; Lim, M. S.; Choo, S. H.; Tan, I. K. Vitamin E status of infants at birth. J. Perinat. Med. 27:395 – 398; 1999. [9] Farrell, P. M. Vitamin E deficiency in premature infants. J. Pediatr. 95:869 – 872; 1979. [10] Falciglia, H. S.; Johnson, J. R.; Sullivan, J.; Hall, C. F.; Miller, J. D.; Riechmann, G. C.; Falciglia, G. A. Role of antioxidant nutrients and lipid peroxidation in premature infants with respiratory distress syndrome and bronchopulmonary dysplasia. Am. J. Perinatol. 20:97 – 107; 2003. [11] Topbas, O. F.; Jehle, R.; Sinha, P.; Rustow, B. An electrophoretic study of vitamin E status and expression of heat shock proteins in alveolar type II and liver cells. Electrophoresis 21:3552 – 3557; 2000. [12] Sabat, R.; Kolleck, I.; Witt, W.; Volk, H.; Sinha, P.; Rustow, B. Immunological dysregulation of lung cells in response to vitamin E deficiency. Free Radic. Biol. Med. 30:1145 – 1153; 2001. [13] Sinha, P.; Kolleck, I.; Volk, H. D.; Schlame, M.; Rustow, B. Vitamin E deficiency sensitizes alveolar type II cells for apoptosis. Biochim. Biophys. Acta 1583:91 – 98; 2002. [14] Guthmann, F.; Kolleck, I.; Schachtrup, C.; Schlame, M.; Spener, F.; Rustow, B. Vitamin E deficiency reduces surfactant lipid biosynthesis in alveolar type II cells. Free Radic. Biol. Med. 34:663 – 673; 2003.

1407

[15] Spiteller, G. Are lipid peroxidation processes induced by changes in the cell wall structure and how are these processes connected with diseases? Med. Hypotheses 60:69 – 83; 2003. [16] Bailey, D. M.; Kleger, G. R.; Holzgraefe, M.; Ballmer, P. E.; Bartsch, P. Pathophysiological significance of peroxidative stress, neuronal damage, and membrane permeability in acute mountain sickness. J. Appl. Physiol. 96:1459 – 1463; 2004. [17] Fisher, A. B.; Dodia, C.; Manevich, Y.; Chen, J. W.; Feinstein, S. I. Phospholipid hydroperoxides are substrates for non-selenium glutathione peroxidase. J. Biol. Chem. 274:21326 – 21334; 1999. [18] Wood, Z. A.; Schroder, E.; Robin, H. J.; Poole, L. B. Structure, mechanism and regulation of peroxiredoxins. Trends Biochem. Sci. 28:32 – 40; 2003. [19] Hofmann, B.; Hecht, H. J.; Flohe, L. Peroxiredoxins. Biol. Chem 383:347 – 364; 2002. [20] Leyens, G.; Donnay, I.; Knoops, B. Cloning of bovine peroxiredoxins— gene expression in bovine tissues and amino acid sequence comparison with rat, mouse and primate peroxiredoxins. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 136:943 – 955; 2003. [21] Das, K. C.; Pahl, P. M.; Guo, X. L.; White, C. W. Induction of peroxiredoxin gene expression by oxygen in lungs of newborn primates. Am. J. Respir. Cell Mol. Biol. 25:226 – 232; 2001. [22] Kim, H. S.; Kang, S. W.; Rhee, S. G.; Clerch, L. B. Rat lung peroxiredoxins I and II are differentially regulated during development and by hyperoxia. Am. J. Physiol. Lung Cell Mol. Physiol. 280:L1212 – L1217; 2001. [23] Fujii, T.; Fujii, J.; Taniguchi, N. Augmented expression of peroxiredoxin VI in rat lung and kidney after birth implies an antioxidative role. Eur. J. Biochem. 268:218 – 225; 2001. [24] Kim, H. S.; Pak, J. H.; Gonzales, L. W.; Feinstein, S. I.; Fisher, A. B. Regulation of 1-Cys peroxiredoxin expression in lung epithelial cells. Am. J. Respir. Cell Mol. Biol. 27:227 – 233; 2002. [25] Manevich, Y.; Sweitzer, T.; Pak, J. H.; Feinstein, S. I.; Muzykantov, V.; Fisher, A. B. 1-Cys peroxiredoxin overexpression protects cells against phospholipid peroxidation-mediated membrane damage. Proc. Natl. Acad. Sci. USA 99:11599 – 11604; 2002. [26] Woo, H. A.; Kang, S. W.; Kim, H. K.; Yang, K. S.; Chae, H. Z.; Rhee, S. G. Reversible oxidation of the active site cysteine of peroxiredoxins to cysteine sulfinic acid: immunoblot detection with antibodies specific for the hyperoxidized cysteine-containing sequence. J. Biol. Chem. 278:47361 – 47364; 2003. [27] Woo, H. A.; Chae, H. Z.; Hwang, S. C.; Yang, K. S.; Kang, S. W.; Kim, K.; Rhee, S. G. Reversing the inactivation of peroxiredoxins caused by cysteine sulfinic acid formation. Science 300:653 – 656; 2003. [28] Wagner, E.; Luche, S.; Penna, L.; Chevallet, M.; van Dorsselaer, A.; Leize-Wagner, E.; Rabilloud, T. A method for detection of overoxidation of cysteines: peroxiredoxins are oxidized in vivo at the active-site cysteine during oxidative stress. Biochem. J. 366:777 – 785; 2002. [29] Chevallet, M.; Wagner, E.; Luche, S.; van Dorsselaer, A.; LeizeWagner, E.; Rabilloud, T. Regeneration of peroxiredoxins during recovery after oxidative stress: only some overoxidized peroxiredoxins can be reduced during recovery after oxidative stress. J. Biol. Chem. 278:37146 – 37153; 2003. [30] Dobbs, L. G.; Gonzalez, R.; Williams, M. C. An improved method for isolating type II cells in high yield and purity. Am. Rev. Respir. Dis. 134:141 – 145; 1986. [31] Kolleck, I.; Schlame, M.; Fechner, H.; Looman, A. C.; Wissel, H.; Rustow, B. HDL is the major source of vitamin E for type II pneumocytes. Free Radic. Biol. Med. 27:882 – 890; 1999. [32] Witt, W.; Kolleck, I.; Rustow, B. Identification of high density lipoprotein-binding proteins, including a glycosyl phosphatidylinositol-anchored membrane dipeptidase, in rat lung and type II pneumocytes. Am. J. Respir. Cell Mol. Biol. 22:739 – 746; 2000. [33] Fuhrman, B.; Oiknine, J.; Aviram, M. Iron induces lipid peroxidation in cultured macrophages, increases their ability to oxida-

1408

[34]

[35]

[36] [37]

[38]

[39]

[40]

[41]

[42]

[43]

A. To¨lle et al. / Free Radical Biology & Medicine 38 (2005) 1401–1408 tively modify LDL, and affects their secretory properties. Atherosclerosis 111:65 – 78; 1994. Schlame, M.; Haupt, R.; Wiswedel, I.; Kox, W. J.; Rustow, B. Identification of short-chain oxidized phosphatidylcholine in human plasma. J. Lipid Res. 37:2608 – 2615; 1996. Frey, B.; Haupt, R.; Alms, S.; Holzmann, G.; Konig, T.; Kern, H.; Kox, W.; Rustow, B.; Schlame, M. Increase in fragmented phosphatidylcholine in blood plasma by oxidative stress. J. Lipid Res. 41:1145 – 1153; 2000. Dole, V. P.; Meinertz, H. Microdetermination of long-chain fatty acids in plasma and tissues. J. Biol. Chem. 235:2595 – 2599; 1960. Schlame, M.; Schmid, A. B.; Haupt, R.; Rustow, B.; Kox, W. J. Study of platelet-activating factor acetylhydrolase in the perioperative period of patients undergoing cardiac surgery. Shock 9:313 – 319; 1998. Witt, W.; Kolleck, I.; Rustow, B. Identification of high density lipoprotein-binding proteins, including a glycosyl phosphatidylinositol-anchored membrane dipeptidase, in rat lung and type II pneumocytes. Am. J. Respir. Cell Mol. Biol. 22:739 – 746; 2000. Kolleck, I.; Wissel, H.; Guthmann, F.; Schlame, M.; Sinha, P.; Rustow, B. HDL-holoparticle uptake by alveolar type II cells: effect of vitamin E status. Am. J. Respir. Cell Mol. Biol. 27:57 – 63; 2002. Witt, W.; Kolleck, I.; Fechner, H.; Sinha, P.; Rustow, B. Regulation by vitamin E of the scavenger receptor BI in rat liver and HepG2 cells. J. Lipid Res. 41:2009 – 2016; 2000. Catignani, G. L.; Bieri, J. G. Simultaneous determination of retinol and alpha-tocopherol in serum or plasma by liquid chromatography. Clin. Chem. 29:708 – 712; 1983. Engstrom, P. C.; Easterling, L.; Baker, R. R.; Matalon, S. Mechanisms of extracellular hydrogen peroxide clearance by alveolar type II pneumocytes. J. Appl. Physiol. 69:2078 – 2084; 1990. Kuo, M. L.; Lee, K. C.; Lin, J. K.; Huang, T. S. Pronounced activation of protein kinase C, ornithine decarboxylase and c-jun proto-oncogene

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51] [52]

by paraquat-generated active oxygen species in WI-38 human lung cells. Biochim. Biophys. Acta 1268:229 – 236; 1995. Ban, R.; Takitani, K.; Kim, H. S.; Murata, T.; Morinobu, T.; Ogihara, T.; Tamai, H. alpha-Tocopherol transfer protein expression in rat liver exposed to hyperoxia. Free Radic. Res. 36:933 – 938; 2002. Jehle, R.; Schlame, M.; Buttner, C.; Frey, B.; Sinha, P.; Rustow, B. Platelet-activating factor (PAF)-acetylhydrolase and PAF-like compounds in the lung: effects of hyperoxia. Biochim. Biophys. Acta 1532:60 – 66; 2001. Fleming, I. N.; Elliott, C. M.; Collard, J. G.; Exton, J. H. Lysophosphatidic acid induces threonine phosphorylation of Tiam1 in Swiss 3T3 fibroblasts via activation of protein kinase C. J. Biol. Chem. 272:33105 – 33110; 1997. Bouhafs, R. K.; Jarstrand, C.; Robertson, B. Lipid peroxidation of lung surfactant in experimental neonatal group B streptococcal pneumonia. Lung 182:61 – 72; 2004. Sener, G.; Sehirli, A. O.; Ayanoglu-Dulger, G. Melatonin protects against mercury(II)-induced oxidative tissue damage in rats. Pharmacol. Toxicol. 93:290 – 296; 2003. LaNoue, J. L.; Iglesias, J. L.; Rogers, T. E.; Kim, L. T.; Meng, Y.; Myers, S. I.; Turnage, R. H. Alveolar macrophage response to remote organ injury. Shock 9:261 – 265; 1998. Kim, H. S.; Manevich, Y.; Feinstein, S. I.; Pak, J. H.; Ho, Y. S.; Fisher, A. B. Induction of 1-Cys peroxiredoxin expression by oxidative stress in lung epithelial cells. Am. J. Physiol. Lung Cell Mol. Physiol. 285:L363 – L369; 2003. Ricciarelli, R.; Zingg, J. M.; Azzi, A. Vitamin E: protective role of a Janus molecule. FASEB J. 15:2314 – 2325; 2001. Tasinato, A.; Boscoboinik, D.; Bartoli, G. M.; Maroni, P.; Azzi, A. d-alpha-Tocopherol inhibition of vascular smooth muscle cell proliferation occurs at physiological concentrations, correlates with protein kinase C inhibition, and is independent of its antioxidant properties. Proc. Natl. Acad. Sci. USA 92:12190 – 12194; 1995.