Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns

Cryobiology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Cryobiology journal homepage: www.elsevier.com/locate/ycryo

Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns q J.F.W. Sprícigo a, K. Morais b, A.R. Ferreira c, G.M. Machado a, A.C.M. Gomes b, R. Rumpf d, M.M. Franco b, M.A.N. Dode a,b,⇑ a

School of Agriculture and Veterinary Medicine, University of Brasilia, Brasília, DF, Brazil Embrapa Genetic Resources and Biotechnology, Laboratory of Animal Reproduction, Brasília, DF, Brazil c School of Veterinary Medicine, University of São Paulo State, Botucatu, SP, Brazil d Geneal, Animal Reproduction Inc., Uberaba, MG, Brazil b

a r t i c l e

i n f o

Article history: Received 19 March 2014 Accepted 28 July 2014 Available online xxxx Keywords: Bovine Vitrification Gene expression Ultrastructure

a b s t r a c t This study aimed to investigate the functional, morphological and molecular patterns of bovine oocytes vitrified at different times during in vitro maturation (IVM). Four groups of oocytes were used: non-vitrified control oocytes (CG), oocytes vitrified at 0 h (V0), oocytes vitrified after 8 h of IVM (V8) and oocytes vitrified after 22 h of IVM (V22). After vitrification, the oocytes were warmed and then returned to the incubator to complete a total of 24 h of IVM. To evaluate the effect of vitrification, the nuclear maturation and fertilization rates were assessed by lacmoid staining and ultrastructural electron microscopy. The cleavage and blastocyst rates were evaluated at D2, D7 and D8. The expression levels of CASP3, TP53, HDAC2, SUV39H1 and DNMT1 were investigated by RT-qPCR. The nuclear maturation, oocyte fertilization, cleavage and blastocyst rates were higher (P < 0.05) in the CG group (80%; 81.3%; 88.5%; and 35.8%) than in the V0 (44%; 44.6%; 22.7%; and 2.6%), V8 (50%; 63%; 21.5%; and 2.2%) and V22 (55.5%; 66.9%; 24.1%; and 4.6%) groups. Ultrastructural analysis revealed significant damage within the cytoplasm of all vitrified groups, but more severe degeneration was observed in the V22 group. The gene expression profiles were not affected by vitrification (P > 0.05). In conclusion, cytoplasm degeneration seems to be the most severe form of damage caused by vitrification. The use of the Cryotop method for vitrification severely reduces bovine oocyte viability regardless of whether it is performed at GV, GVBD or MII stage. Ó 2014 Elsevier Inc. All rights reserved.

Introduction Successful cryopreservation of the oocyte allows the preservation of the genetic resources of farm and wild animals as well as the preservation of the gametes of women with premature loss of ovarian function. Therefore, the ability to preserve the female gamete is becoming an integral part of assisted reproductive techniques (ARTs), as it has great impact on animal breeding programs and on human assisted conception [11,24,61].

q Statement of funding: The publication payment will be supported by Embrapa-Cenargen and CNPq, project number: 479360/2010-3. ⇑ Corresponding author at: Embrapa Recursos Geneticos e Biotecnologia, Laboratorio de Reproducao Animal, Parque Estacao Biologica W5 Final Norte, 70770-900 Brasilia, DF, Brazil. Fax: +55 61 33403658. E-mail address: [email protected] (M.A.N. Dode).

To date, oocyte cryopreservation is still a very ineffective technique, as the ability of cryopreserved oocytes to achieve later embryonic development is unsatisfactory in most mammals. This high sensitivity of oocytes to cryopreservation can be explained by their unique morphological and functional characteristics, such as the cell size, volume of water in the cytoplasm, cytoskeletal organization, distribution of organelles and stage of chromatin organization [2,19,35,37,38,50,59]. Due to these specific features of oocytes, two of the most important factors that affect the success of oocyte cryopreservation are the methodology used and the oocyte maturational stage [4,27,61]. Oocyte cryopreservation is also associated with molecular damage related to the decrease in the levels of stored mRNA resulting from the degradation or consumption of these molecules [10]. Genes related to the apoptotic pathway, such as CASPASE, FAS-L/ BAX and P-53, can be good candidates for the detection of certain types of cell degradation [13]. Epigenetic

http://dx.doi.org/10.1016/j.cryobiol.2014.07.015 0011-2240/Ó 2014 Elsevier Inc. All rights reserved.

Please cite this article in press as: J.F.W. Sprícigo et al., Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns, Cryobiology (2014), http://dx.doi.org/10.1016/j.cryobiol.2014.07.015

2

J.F.W. Sprícigo et al. / Cryobiology xxx (2014) xxx–xxx

modification of the genome also plays an important role during the maturation period and may provide useful information about the status of the cell. DNMT1, HDAC2 and SUV39H1 are several of the enzymes that control DNA methylation and acetylation [6]. Many approaches have been used to cryopreserve oocytes, but so far, they all cause extensive damage that compromises developmental competence. Classical freezing has been gradually replaced by vitrification methods to avoid chilling injury and ice crystal formation to reduce the associated membrane and organelle damage [46]. However, due to the high concentrations of cryoprotective agents needed for vitrification, oocytes are also exposed to a high level of toxic stress. To overcome this problem, several modifications of the vitrification method have been developed to reduce the solution volume and to increase the cooling rates in an attempt to reduce the medium’s toxicity [57,59]. The medium used for vitrification will allow an oocyte to rapidly pass through a critical temperature zone in the presence of a cryoprotective agent. However, because of the toxicity, a reduction in the amount of medium surrounding the oocyte is important for successful vitrification. The development of the Cryotop system [27] marks an important advance in vitrification. Cryotop is currently the most widely used technique for human oocyte cryopreservation in daily practice [12,43,47,54]. This system has also been used for the vitrification of oocytes from various domestic mammalian species, such as equine, ovine, porcine and bovine [2,7,16,20,23,25,26,35,37,38,42,56,59]. However, the achieved outcomes are still unsatisfactory. The other important factor that affects oocyte preservation is the stage of meiosis at which vitrification is performed. Oocytes undergo transitions in nuclear status during maturation. The properties associated with each meiotic stage include metabolic coupling between the oocytes and the cumulus cells, the permeability of the plasma membrane, the presence or absence of a nuclear membrane, the presence or absence of a spindle and chromosome configuration. Some authors considered immature oocytes less resistant to cryopreservation and more susceptible to chilling injury [5] compared to mature oocytes in metaphase II (MII) [1,31,50], but many specific problems have been described for oocytes at both stages of maturation. The impairment of vitrified GV oocytes could be associated with the premature loss of communication with cumulus cells, which are needed during the first hours of maturation. This loss of communication is caused by a disruption of the gap junctions in response to vitrification [30,61]. Furthermore, cumulus cells may serve as a mechanical barrier, reducing the speed of penetration of the cryoprotective agent. In contrast, cryopreservation of oocytes at the GV stage would avoid damage to the spindle and chromosomes because, at this stage, the microtubular structure of the spindle has not been organized and the genetic material is contained within the nucleus. In contrast, matured oocytes could have a greater ability to withstand vitrification because they have already completed meiosis, avoiding problems with first polar body extrusion, organelle distribution and cumulus cell removal. However, they can also show poor developmental competence, mainly due to meiotic spindle disorganization [17] and the consequent chromosomal dispersion. Vitrification of oocytes after the resumption of meiosis at the time of germinal vesicle break down (GVBD) is an alternative to be considered for improving the overall success. Vitrification of oocytes at an intermediate stage might overcome some of the problems present in GV and MII oocytes, and it may provide enough time for the oocytes to undergo the recovery process. This is the rationale for choosing oocytes at GVBD instead of at immature (GV) and mature (MII) stages to be tested in the present study. Cryopreservation of bovine oocytes at different stages of maturation has been described in a few studies using different protocols

[17,33,36]. However, no reports are currently available on the effect of different meiotic stages at the time of cryopreservation using the Cryotop methodology on the subsequent development of bovine oocytes. In the present study, bovine oocytes at different stages of IVM were cryopreserved using the Cryotop vitrification method, and vitrified immature or maturing oocytes were continuously submitted to IVM culture. Nuclear maturation, ultra structure, gene expression, fertilization rate, and subsequent development of oocytes following vitrification were examined. This information is important not only to determine the best time to cryopreserve oocytes but also to guide the modification of vitrification protocols and methods to improve the efficiency of oocyte conservation. Materials and methods Chemicals and supplies Unless otherwise indicated, chemicals were purchased from Sigma (St. Louis, MO, USA). The Cryotop devices were purchased from Ingámed (Maringá, PR, Brazil). Oocyte recovery and in vitro maturation Ovaries from crossbred cows (Bos indicus x Bos taurus) were collected immediately after slaughter and transported to the laboratory in saline solution (0.9% NaCl) supplemented with penicillin G (100 IU/mL) and streptomycin sulfate (100 g/mL) at 35 °C. Cumulus oocyte complexes (COCs) were aspirated from 3- to 8-mm diameter follicles with an 18-gauge needle and pooled in a 15-mL conical tube. After 10 min, COCs were recovered and selected in a holding medium consisting of HEPES-buffered TCM199 (Gibco BRL, Burlington, ON, Canada) supplemented with 10% FCS. Only COCs with homogenous cytoplasm and at least three layers of cumulus cells were used in the experiments. The selected COCs were washed and transferred in batches of 25–30 to a 200lL drop of maturation medium under silicone oil and incubated for 22 h at 39 °C with 5% CO2 in the air. The maturation medium consisted of TCM –199 (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) (Invitrogen), 0.01 IU/mL of FSH, 0.1 mg/mL of L-glutamine and antibiotic (amicacyn, 0.075 mg/mL). Vitrification and warming Oocyte vitrification was performed as previously described [27] with slight modifications. The holding medium (HM), which was used to handle oocytes during vitrification and warming, was composed of HEPES-buffered TCM-199 (Gibco BRL, Burlington, ON, Canada) supplemented with 20% FCS. For vitrification, the groups were first washed three times in an equilibrium solution composed of 7.5% ethylene glycol and 7.5% dimethylsulfoxide (DMSO) dissolved in HM for a total of 9 min. The oocytes were transferred to a vitrification solution of 15% ethylene glycol, 15% DMSO and 0.5 M sucrose in HM, where they were incubated for 45–60 s. Next, the oocytes were placed into the Cryotop device in sets of 3–5 under a stereomicroscope (Nikon-SMZ 650). Before vitrification, most of the solution transferred with the oocytes was removed from the device, and only a thin layer (<0.1 lL) remained to cover the oocytes. Subsequently, the Cryotop device was immediately submerged into liquid nitrogen. Warming was performed immediately after vitrification by immersing the end of the Cryotop into a drop of HM supplemented with 1 M sucrose that had been pre-warmed at 37 °C for 1 min. The oocytes were transferred to HM supplemented with 0.5 M sucrose for 3 min and finally to

Please cite this article in press as: J.F.W. Sprícigo et al., Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns, Cryobiology (2014), http://dx.doi.org/10.1016/j.cryobiol.2014.07.015

J.F.W. Sprícigo et al. / Cryobiology xxx (2014) xxx–xxx

the original holding medium. Afterwards, the oocytes were placed in the culture dishes to mature or were fixed for evaluation of the maturational stage. Assessment of meiotic progression For meiotic progression evaluation, the oocytes were denuded and fixed for at least 48 h with acetic alcohol (1:3). On the day of the evaluation, the oocytes were placed on a slide, covered with a coverslip and stained with 1% lacmoid in 45% glacial acetic acid. The maturational stage of each oocyte was determined using phase contrast microscopy. Oocytes were classified as follows: immature – did not reach metaphase II; mature – presented a metaphase II plate; abnormal – any chromosomal aberrations (diploid, abnormal metaphase II, multidirectional spindle, chromosomal dispersion); degenerate – presented diffuse or undefined chromatin.

3

Sample collection, RNA extraction and cDNA synthesis Oocytes at different stages of maturation were denuded by repeated pipetting and transferred to microtubes. Then, 4 lL of RNAlater (AmbiomÒ Life Technologies, Carlsbad, CA, USA) was added, and the samples were stored at 20 °C until RNA extraction. Total RNA was isolated from four pools consisting of 20 oocytes from each group using the RNeasy Plus™ kit (Qiagen, Mississauga, Ontario, CA), according to the manufacturer’s instructions. Total RNA was submitted to a reverse-transcription reaction using 200 UI SuperScript III (200 U/lL; Invitrogen™), 0.5 lg of OligoDT12-18 primer (0.5 lg/lL; Invitrogen™), dNTPs (2.0 mM each), 0.1 mM DTT (0.1 mM/lL), 40 UI RNaseOUT Recombinant Ribonuclease Inhibitor (40 U/lL; Invitrogen™) and 1X first strand buffer. The reactions were performed at 65 °C for 5 min, 42 °C for 52 min and, finally, 70 °C for 15 min to inactivate the enzyme. At the end, the cDNA was diluted to a final volume of 40 lL (0.5 oocyte/lL).

In vitro fertilization (IVF) and embryo culture (IVC) Real time PCR (RT-qPCR) Following maturation, COCs (groups of 25–30) were transferred to a 200-lL drop of fertilization medium. For fertilization, frozen semen from a Nellore bull, previously tested in the lab for IVF, was used. Motile spermatozoa were obtained by the Percoll method [32] and were added to droplets containing COCs at a final concentration of 1  106 spermatozoa mL 1. The fertilization medium was TALP [44] supplemented with penicillamine (2 mM), hypotaurine (1 mM), epinephrine (250 mM) and heparin (10 lg/mL 1). The spermatozoa and oocytes were co-incubated for 18 h at 39 °C with 5% CO2 in the air, and the day of in vitro insemination was considered as day 0. After co-incubation, the presumptive zygotes (n = 25–30) were washed and transferred to 200-lL drops of SOFaaci medium [18] supplemented with 2.77 mM myo-inositol and 5% FBS and were cultured at 39 °C with 5% CO2 in the air for 8 days. The embryos were evaluated on Day 2 post-insemination (pi) for cleavage and on Day 6, Day 7 and Day 8 pi for the blastocyst rate. Assessment of the fertilization rate To evaluate the fertilization rate, oocytes were removed from culture at 18 h pi, fixed with acetic acid:alcohol (1:3), and stained with a 1% solution of lacmoid in 45% glacial acetic acid. The oocytes were examined under a phase contrast microscope (Nikon Eclipse E200, 1,000X) and classified as either (a) non fertilized – the presence of female and the absence of male chromatin; (b) fertilized – the presence of female and male chromatin in the cytoplasm, a decondensed sperm head, pronuclei or cleavage; (c) degenerated; or (d) abnormal. Morphological evaluation by transmission electron microscopy (TEM) The morphological evaluation by TEM was performed based on previous work with oocytes and embryos [39,51]. Oocytes vitrified at 0 h, 8 h and 22 h after warming were placed back into the culture dishes to complete the 24 h of maturation. At the end of the maturational period, vitrified and control oocytes were washed in cacodylate buffer at pH 7.0 and fixed in 2.5% glutaraldehyde and sodium cacodylate buffer (0.1 M) for 24 h. Fixed oocytes were washed three times in cacodylate buffer and twice in water and were subsequently post-fixed in 2% osmium tetroxide and 0.2 M cacodylate buffer for 1 h. The samples were then dehydrated by passing them through an ethanol series and embedded in Epon resin. The ultrathin sections (60 lm) were stained with 2% uranyl acetate for 1 h, washed in water and analyzed using a Zeiss 109 transmission electron microscope (Zeiss, Oberkochen, Germany). The characteristics of the cells were observed and compared between the vitrified groups and the control.

The reactions were performed using SYBR Green Rox Plus™ (LGC Biotechnology) to amplify the CASP3, HADAC2 and DNMT1 genes and Fast SYBR Green Master Mix™ (Applied Biosystems) to amplify the SUV39H1 and TP53 genes. When SYBR Green Rox Plus™ was used, the reactions had a final volume of 25 lL, and the conditions for amplification were as follows: 95 °C for 10 min, followed by 50 cycles. For Fast SYBR Green Master Mix™ (Applied Biosystems), the final reaction volume was 10 lL. The reactions were incubated at 95 °C for 20 s, followed by 50 cycles and a standard dissociation curve. The reference gene GAPDH was amplified using both SYBR Green Rox Plus™ and Fast SYBR Green Master Mix. The primer sequences, annealing temperatures, primer concentrations and GenBank number/reference used for each gene are listed in Table 1. The reactions were performed in triplicate for each gene, and the specificity of each RT-qPCR product was determined by melting curve analysis and determination of the product size in agarose gels. The efficiency of primer amplification was >90%. Non-template controls were not amplified or presented a Cq value 10 points higher than the average Cq value of the genes. The expression levels of the target genes were normalized to the expression level of the reference gene GAPDH (glyceraldehyde-3phosphate dehydrogenase), which was expressed at similar levels (Cq values) in all oocyte samples and was stable under the conditions used. The relative expression of each gene was calculated using the DDCt method with efficiency correction [45]. Experimental design Experiment 1: effect of vitrification at different meiotic stages on the nuclear maturation and ultrastructure of bovine oocytes To determine the effect of vitrification on nuclear maturation, a total of 335 oocytes obtained from 3 biological replicates were distributed into four treatments: (1) not vitrified, used as control (CG, n = 80), (2) vitrified immediately after selection (V0, n = 84), (3) vitrified at 8 h (V8, n = 90) of maturation and (4) vitrified at 22 h (V22, n = 81) of maturation. After warming, oocytes from all groups were placed in the incubator to complete 24 h of maturation. At the end of the maturation period, the oocytes were denuded, fixed, stained with lacmoid and evaluated for the nuclear stage. A sample of oocytes from each group (n = 10) was removed to be used in the morphological evaluation by TEM. Experiment 2: evaluation of the fertilization rate and cytoplasmic maturation of vitrified oocytes at different meiotic stages This experiment was designed to determine whether the time during IVM at which vitrification is performed affects the

Please cite this article in press as: J.F.W. Sprícigo et al., Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns, Cryobiology (2014), http://dx.doi.org/10.1016/j.cryobiol.2014.07.015

4

J.F.W. Sprícigo et al. / Cryobiology xxx (2014) xxx–xxx

Table 1 Information for specific primers used for amplification of gene fragments for real time RT-qPCR analysis. Genes

Primer sequences

DNMT1

F: GCG AGA GCG CCT CAG CTA R: AAA CAT GGG TGA TAG GAG GAG AGA F: GGA CTG AAT CCT GCC GCA AAT ACC T R: GGC CAT GAA TCC CAA CTG CAG AAA G F: TTA TTT GAA AAT TTA CGC ATG TT R: TTG CTC CTT TCT TAT GAT CAG TC F: TGAGTGCACCACCATCCACTACAA R: AAACACGCACCTCAAAGCTGTTCC F: AAC AGT CAG TCA GTC AGT TGG GCA R: ACA CAC ACC CGT AGC TGT GAA GAA F: GGC GTG AAC CAC GAG AAG TAT AA R: CCC TCC ACG ATG CCA AAG T

SUV39H1 HDAC2 TP53 CASP3 GAPDH

Amplicon size (bp)

Annealing temperature (°C)

Primer concentration (nM)

GeneBank access number/reference

72

60

300

AY173048.1

307

62

200

NM_001046264.1

229

56

200

NM_001075146.1

143

56

200

NM_174201.2

156

60

300

NM_001077840.1

119

60

150

NM_001034034.2

F = primer forward; R = primer reverse.

fertilization rate and embryonic development after IVF. To determine the fertilization and embryo developmental rates, 471 and 883 oocytes were used and 4 and 7 replicates were performed, respectively. For both evaluations, the oocytes were distributed into four groups as described in experiment 1. Experiment 3: effect of vitrification at different meiotic stages on gene expression in matured oocytes This experiment aimed to evaluate whether vitrification at different times during IVM could alter the expression of genes related to epigenetic control (DNMT1, HDAC2 and SUV39H1) and apoptosis (CASP3 and TP53) in bovine oocytes. Initially, the expression profile of these genes during IVM was determined using four groups of oocytes, which were collected at 0 (0 h), 8 (8 h), 22 (22 h) and 24 (24 h) h of IVM. Subsequently, the effect of vitrification at different maturational stages on gene expression was evaluated. Four groups were used: CG24, non-vitrified control oocytes collected at 24 h of IVM; V0, oocytes vitrified and warmed at 0 h and matured in vitro for 24 h; V8, oocytes vitrified and warmed at 8 h of IVM and cultured for an additional 16 h; and V22, oocytes vitrified and warmed at 22 h of IVM and cultured for an additional 2 h. The oocytes from all four groups were denuded by pipetting before being stored in RNAlater at – 20 °C. A total of 4 pools with 20 oocytes each were formed for each treatment group. Statistical analysis In experiments 1 and 2, the data for nuclear maturation, fertilization and embryo development rates were analyzed by the Chisquared test with a significance level of 5% (P < 0.05). For all the analyses, version 5 of the Prophet statistical package (BBN Systems and Biotechnology, 1997, USA) was used. For the ultrastructural analysis (experiment 1), only a descriptive analysis was performed. Comparison of gene expression among groups was performed using one-way ANOVA or Kruskal Wallis tests, and the means were compared by Tukey, depending on the data distribution. The data were expressed as the mean ± SEM. When the P value was 60.05, the observed difference was considered statistically significant. Results Experiment 1: effect of vitrification at different meiotic stages on the nuclear maturation and ultrastructure of bovine oocytes Nuclear maturation was affected by vitrification regardless of the time during maturation at which it was performed (Table 2). All vitrification treatments (V0, V8 and V22) presented a lower (P < 0.05) percentage of oocytes reaching metaphase II compared with the control. However, no differences (P > 0.05) were observed

among the vitrified groups regarding their ability to reach metaphase II or the percentage of oocytes showing chromatin abnormalities or degeneration. Ultrastructural analysis revealed that most of the analyzed oocytes from each group presented similar features. Fresh oocytes in the control group (CG, n = 10) showed normal structural features, indicated by the integrity and the localization of the cellular structures. The mitochondria were well distributed in the ooplasm. The presence of vesicles with a typical content was noted, and cortical granules were found in the periphery adjacent to the ooplasm (Fig. 1). In the matured oocytes vitrified at GV stage (0 h), a marked reduction in the number of cortical granules at the periphery was observed. The oocytes from this group also showed changes in the cytoplasmic density, the beginning of the vacuolization process and mitochondrial clamping, which implies the onset of degeneration. Analysis of the matured oocytes vitrified at 8 h (V8, n = 10) of maturation revealed more extensive cytoplasmic vacuolization and an irregular shape compared to the V0 group (n = 10). In addition, a lower amount of cortical granules and cellular disorganization were observed, including visible mitochondrial degeneration, as evidenced by the lower number of mitochondria and their localization to the periphery of the ooplasm (Fig. 1). When oocytes vitrified at 22 h (V22, n = 10) were compared with the other groups (V0 and V8), more extensive damage could be noted. The oocytes showed severe vacuolization with an irregular shape throughout the ooplasm, an almost complete lack of cortical granules and drastic mitochondrial degeneration indicating cell death (Fig. 1). Experiment 2: evaluation of the fertilization rate and cytoplasmic maturation of vitrified oocytes at different meiotic stages The results for embryonic development are presented in Table 3. Oocytes subjected to vitrification, regardless of the treatment, showed reduced development (P < 0.05) after in vitro fertilization and culture, presenting lower rates of cleavage and blastocyst formation than oocytes from the control group (Table 3). When the fertilization rates were evaluated, it was observed that oocytes from all groups exposed to vitrification showed lower fertilization rates and higher degeneration rates compared to the control (P < 0.05). Among the vitrified groups, oocytes vitrified at GV stage (V0) had lower (P < 0.05) fertilization rates and higher degeneration rates compared to those vitrified at GVBD (V8) and MII (V22) stage (see Table 4). Experiment 3: effect of vitrification at different meiotic stages on gene expression in matured oocytes Regarding the gene expression patterns during in vitro maturation, no changes in the relative mRNA abundance (P > 0.05) were

Please cite this article in press as: J.F.W. Sprícigo et al., Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns, Cryobiology (2014), http://dx.doi.org/10.1016/j.cryobiol.2014.07.015

5

J.F.W. Sprícigo et al. / Cryobiology xxx (2014) xxx–xxx Table 2 Nuclear maturation at 24 h of culture of bovine oocytes vitrified by Cryotop at different moments during in vitro maturation. Oocyte treatment

n

Control non vitrified Vitrified at 0 h Vitrified at 8 h Vitrified at 22 h

80 84 90 81

Stages of meiosis Immature n (%)

a,b

1 8 5 5

(1.2)a (9.5)b (5.5)a,b (6.1)a,b

Metaphase II n (%) 64 37 45 45

(80)a (44.0)b (50)b (55.5)b

Abnormal n (%)

Degenerate n (%)

9 (11.2)a 22 (26.1)a,b 26 (28.8)b 16 (19.7)a,b

6 (7.5)a 17 (20.2)b 14 (15.5)a,b 15 (18.5)b

Values with different superscripts in the same column are significantly different (P < 0.05).

Fig. 1. Ultrastructure of bovine oocytes fixed at 24 h of in vitro maturation. Fresh control oocytes (control), oocytes vitrified and warmed at 0 h of maturation (V0), oocytes vitrified and warmed at 8 h of maturation (V8) and oocytes vitrified and warmed at 22 h of maturation (V22). Vesicle (VE), Mitochondria (M), Cortical granules (CG), Plasma membrane (PM), Zone pellucid (ZP).

Please cite this article in press as: J.F.W. Sprícigo et al., Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns, Cryobiology (2014), http://dx.doi.org/10.1016/j.cryobiol.2014.07.015

6

J.F.W. Sprícigo et al. / Cryobiology xxx (2014) xxx–xxx

Table 3 Cleavage and blastocyst rates of bovine oocytes vitrified by Cryotop at different moments during in vitro maturation. Oocyte treatment Control non vitrified Vitrified at 0 h Vitrified at 8 h Vitrified at 22 h a,b

n

Cleaved at D2 n (%)

226 224 218 215

200 (88.5) 51 (22.7)b 47 (21.5)b 52 (24.1)b

a

Blastocyst at D7 n (%) 81 (35.8) 6 (2.6)b 4 (1.8)b 9 (4.1)b

a

Blastocyst at D8 n (%) 88 (38.9) 6 (2.6)b 5 (2.2)b 10 (4.6)b

a

Blastocyst at D8 /cleaved n (%) 88 (44.0)a 6 (11.76)b 5 (10.63)b 10 (19.23)b

Values with different superscripts in the same column are significantly different (P < 0.05).

Table 4 Fertilization rate of bovine oocytes vitrified by Cryotop at different moments during in vitro maturation. Oocyte treatment

Control non vitrified Vitrified at 0 h Vitrified at 8 h Vitrified at 22 h a,b,c

n

134 112 119 106

Non fertilized n (%)

15 (11.1)a 10 (8.9)a 15 (12.6)a 8 (7.5)a

Fertilized

Degenerated n (%)

Total n (%)

Polyspermy n (%)

109 (81.3)a 50 (44.6)c 75 (63)b 71 (66.9)b

5 (3.7)a 7 (6.2)a,b 9 (7.5)a,b 13 (12.2)b

10 52 29 27

(7.4)a (46.4)c (24.3)b (25.4)b

Values with different superscripts in the same column are significantly different (P < 0.05).

observed for HDAC2, TP53 or SUV39H1 (Fig. 2). In contrast, DNMT1 and CASP3 presented a different pattern (Fig. 2). For both of these genes, an increase (P < 0.05) in the transcript levels after 22 h of in vitro maturation was noted compared to 0 and 8 h of maturation. However, at 24 h, the transcript levels were similar to those observed at 8 h (Fig. 2). Then, we compared the relative abundance of HDAC2, SUV39H1, DNMT1, TP53 and CASP3 transcripts in oocytes submitted to vitrification at different times during IVM. Oocytes used for the gene expression from all groups were collected when they had completed 24 h of IVM. No differences (P > 0.05) in transcript levels for any of the genes studied were observed among the vitrified groups or between the control and vitrified groups (Fig. 3). Discussion Vitrification is currently considered the most efficient technique for oocyte conservation [8,21,26,48,53]. However, the results obtained until now do not allow its use as a viable tool for female livestock germplasm storage. In the last decades, research has been focused on the improvement of vitrification [27,57] by testing different approaches. Of all the alternatives that have been developed, the Cryotop methodology [27,55,61] has shown the most promising results, and for that reason, this method was chosen for the present study. However, there is no consensus regarding the optimal meiotic stage for oocyte cryopreservation, mainly due to the different devices and solutions used to vitrify oocytes. Thus, we have attempted to determine the best time to cryopreserve bovine oocytes by comparing the efficiency of vitrification at different times during in vitro maturation using the same vitrification protocol. In the first experiment, the ability of bovine oocytes to reach MII after vitrification and warming at different times during in vitro maturation was evaluated. It was very clear that the exposure of oocytes to a vitrification procedure, regardless of the maturational stage, affected oocyte viability and caused a subsequent decrease in nuclear maturation as well as an increase in chromatin abnormalities and degeneration. Considering that oocytes at different stages of meiosis differ with regard to the chromatin configuration, the distribution of organelles and the association with and dependency on the cumulus cells, we expected to detect some differences between the groups. In addition, studies that evaluated the best time for vitrification [17,31,49,61] during IVM had shown that the results changed according to meiotic

stage. In our experiments, we expected that oocytes vitrified at 22 h, presumably having completed the first meiotic division, would show a different response from those vitrified at GV stage. Despite our expectation, from the oocytes vitrified at the end of IVM, only 55% were still in MII stage after warming, and these results are comparable to those obtained with oocytes vitrified at GV and GVBD. This observation is most likely due to intense chromatin degeneration in response to vitrification, even in the MII oocytes. These results suggested that regardless of the time that vitrification was performed, the oocyte was severely affected and presented a high degree of chromatin degeneration and abnormality. This degeneration may be associated with the loss of physiological processes, such as the resumption of meiosis, cytoskeleton organization and plasma membrane composition [9]. However, electron microscopy revealed that the degree of degeneration was different at different vitrification times, beginning with oocytes vitrified at 0 h and intensifying in the other groups. A higher degree of degeneration was detected in oocytes vitrified at 22 h, and these oocytes presented a larger amount of irregularly shaped vacuoles. This degeneration could most likely be caused by the disorganization and disruption of the cytoskeleton, which is well organized during the MII stage [30]. To analyze whether the time during maturation at which vitrification was performed would affect oocyte functionality, the fertilization rate and developmental ability of the oocytes were assessed. Similar to the nuclear maturation results, the maturational stage of the oocytes at the time of vitrification had no effect on the cleavage and blastocyst rates. However, the vitrification process caused a dramatic decrease in embryo development, with blastocyst rates less than 5%. Although Zhou et al. (2010) [61] reported a 10% blastocyst rate when GV oocytes were vitrified using the Cryotop, our results were comparable to the majority of the findings reported in the literature [27,37]. Regarding embryo development, it is important to note that besides the damage that can be detected after maturation and fertilization, other biochemical aspects of the oocyte that would not be detected until later in the development may also have been affected. Of the oocytes that cleaved at 48 h, only 10–20% subsequently reached the blastocyst stage, compared to 44% in the control group. During oocyte maturation, cytoplasmic organelles are subject to remodeling and redistribution, which has been reported to be affected by the vitrification process [39]. The cortical granules seem to be very susceptible to changes due to vitrification [15]. This

Please cite this article in press as: J.F.W. Sprícigo et al., Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns, Cryobiology (2014), http://dx.doi.org/10.1016/j.cryobiol.2014.07.015

J.F.W. Sprícigo et al. / Cryobiology xxx (2014) xxx–xxx

7

Fig. 2. Transcripts levels of DNMT1, HDAC2, SUV39H1, CASP3 and TP53 analyzed by RT-qPCR in oocytes obtained at different times during in vitro maturation (0 h, 8 h, 22 h and 24 h). The data (mean ± SEM) are expressed relative to GAPDH using the DDCt method, and the analysis was performed in triplicate. a,bDifferent letters in the bars indicate statistically significant differences in gene expression, with P < 0.05.

change can cause a failure in the calcium release required to prevent polyspermy, which could cause a reduction in embryonic development [22,38]. In addition, studies have shown that cryopreservation of mouse oocytes can cause zone hardening [28], which can also impair fertilization. Therefore, to ensure that the low cleavage rates were not due to problems in the sperm penetration process, we evaluated the capacity of vitrified oocytes to be fertilized. The results showed that regardless of the maturation stage, vitrification caused a reduction in the fertilization rate compared to the control group. However, it also induced a higher rate of degeneration. These results suggest that the low rates of cleavage were most likely due to cytoplasmic degeneration at the time of fertilization. However, we cannot exclude the possibility that zone hardening resulting from vitrification, as described in humans and mice [28], may also be responsible for the low penetration rate.

Interestingly, despite having a lower fertilization rate, the oocytes vitrified at 0 h presented a similar cleavage rate to those vitrified at 8 and 22 h. Considering these results together, we can assume that cytoplasm degeneration, which would lead to chromatin degeneration, accounted for the majority of the damage caused by vitrification. In addition to the morphological and functional assessments performed in experiments 1 and 2, the expression of genes related to important biological processes in oocytes, such as apoptosis and epigenetic reprogramming, was quantified in experiment 3. Initially, we determined the expression profile of these genes during maturation and then in response to vitrification using the Cryotop method. Of the five studied genes, two exhibited an increase in expression during in vitro maturation and one presented a decrease in

Please cite this article in press as: J.F.W. Sprícigo et al., Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns, Cryobiology (2014), http://dx.doi.org/10.1016/j.cryobiol.2014.07.015

8

J.F.W. Sprícigo et al. / Cryobiology xxx (2014) xxx–xxx

Fig. 3. Transcript levels of DNMT1, HDAC2, SUV39H1, CASP3 and TP53 analyzed by RT-qPCR in bovine oocytes at 24 h of in vitro maturation. The relative expression levels of the genes were compared between oocytes subjected to vitrification at 0 (V0), 8 (V8) and 22 h (V22) of maturation and non-vitrified oocytes (C24). The data (mean ± SEM) are expressed relative to GAPDH using the DDCt method, and the analysis was performed in triplicate.

expression. These results disagree with the well-accepted concept that no transcription takes place in the oocyte after meiosis resumption [52,58]. However, in agreement with our findings, recent studies using bovine oocytes have also revealed increased expression of genes during IVM [34]. These results reinforce the notion that transcription may occur after the resumption of meiosis. We detected an increase in the levels of the DNMT1 transcript at 22 h of IVM. DNMT1 is the enzyme responsible for maintaining methylation and is commonly associated with DNA replication processes, but its presence was also reported during gametogenesis [29]. After fertilization, an extensive demethylation of the genome takes place, except in imprinted genes, which must maintain their methylation pattern. Therefore, we may speculate that this increase in DNMT1 mRNA at the end of IVM is necessary for maintenance of the methylation status of the imprinted genes during the first divisions. In addition to DNMT1, an increase in CASP3

was also observed at 22 h of maturation. Although CASP3 is an enzyme detected in the final stages of apoptosis, its presence does not necessarily indicate activity [41]. The oocyte must be fertilized soon after reaching MII; if fertilization does not occur, apoptosis will occur. Therefore, CASP3 transcripts must be stored for later use. The accepted theory regarding oocyte maturation is that there is no transcription after the resumption meiosis. During this period, the oocyte presents condensed chromatin, forming heterochromatin, resulting in lower transcriptional levels. However, as presented in this study, some genes (CASP3 and DNMT1) were activated even after the resumption of meiosis, which may indicate that the chromatin is still undergoing a compacting process. The relative levels of several transcripts were assessed in vitrified oocytes at different stages of IVM, and no changes in the levels of transcripts for genes involved in apoptosis (CASP3 and TP53) were observed. This finding, although in agreement with previous

Please cite this article in press as: J.F.W. Sprícigo et al., Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns, Cryobiology (2014), http://dx.doi.org/10.1016/j.cryobiol.2014.07.015

J.F.W. Sprícigo et al. / Cryobiology xxx (2014) xxx–xxx

reports [3,10,14], was unexpected considering that we found a high rate of degeneration of oocytes after vitrification. In the cell, the onset of apoptosis is caused by a signal received at the organelle or membrane level, with the subsequent activation of molecules, such as those transcribed by the TP53 gene [40]. Thereafter, other factors that promote cell death, such as CASP3, are also activated. Our results suggested that there may be other pathways responsible for degeneration that could be activated in oocytes after vitrification. Considering that a few studies have shown that vitrification affects epigenetic processes, such as histone acetylation and methylation in mouse and human oocytes [60], we also analyzed the expression of DNMT1 and SUV39H1. Our findings suggested that vitrification does not affect the levels of those transcripts, encoding enzymes involved in epigenetic processes. Conclusions Because the results were similar for all stages of maturation, it was not possible to identify the most appropriate stage to perform vitrification in bovine oocytes. In summary, we have clearly shown that the disruption of cytoplasmic organization is the major defect caused by oocyte vitrification and that changing the stage of maturation does not reduce its deleterious effects. As a result, a drastic decrease in the fertilization, cleavage and blastocyst rates occurs in vitrified bovine oocytes. However, no changes were observed in gene expression, possibly because the molecular features may be less affected than the structural features. Further studies are needed to develop alternatives to decrease the damage and increase the efficiency of bovine oocyte preservation. Acknowledgments The authors thank the Qualimaxima slaughterhouse, BrasiliaDF, Brazil, for providing the ovaries used in the experiment and Regivaldo Vieira de Souza for support in experiment development. References [1] J.L. Albarracin, R. Morato, D. Izquierdo, T. Mogas, Vitrification of calf oocytes: effects of maturation stage and prematuration treatment on the nuclear and cytoskeletal components of oocytes and their subsequent development, Mol. Reprod. Dev. 72 (2005) 239–249. [2] V.M. Anchamparuthy, A. Dhali, W.M. Lott, R.E. Pearson, F.C. Gwazdauskas, Vitrification of bovine oocytes: implications of follicular size and sire on the rates of embryonic development, J. Assist. Reprod. Genet. 26 (2009) 613–619. [3] V.M. Anchamparuthy, R.E. Pearson, F.C. Gwazdauskas, Expression pattern of apoptotic genes in vitrified-thawed bovine oocytes, Reprod. Domest. Anim. = Zuchthygiene 45 (2010) e83–90. [4] A. Arav, S. Yavin, Y. Zeron, D. Natan, I. Dekel, H. Gacitua, New trends in gamete’s cryopreservation, Mol. Cell. Endocrinol. 187 (2002) 77–81. [5] A. Arav, Y. Zeron, S.B. Leslie, E. Behboodi, G.B. Anderson, J.H. Crowe, Phase transition temperature and chilling sensitivity of bovine oocytes, Cryobiology 33 (1996) 589–599. [6] I.R. Bessa, R.C. Nishimura, M.M. Franco, M.A. Dode, Transcription profile of candidate genes for the acquisition of competence during oocyte growth in cattle, Reprod. Domest. Anim. = Zuchthygiene 48 (2013) 781–789. [7] I. Boiso, M. Marti, J. Santalo, M. Ponsa, P.N. Barri, A. Veiga, A confocal microscopy analysis of the spindle and chromosome configurations of human oocytes cryopreserved at the germinal vesicle and metaphase II stage, Hum. Reprod. 17 (2002) 1885–1891. [8] J. Boldt, Current results with slow freezing and vitrification of the human oocyte, Reprod. Biomed. Online 23 (2011) 314–322. [9] F. Brambillasca, M.C. Guglielmo, G. Coticchio, M. Mignini Renzini, M. Dal Canto, R. Fadini, The current challenges to efficient immature oocyte cryopreservation, J. Assist. Reprod. Genet. 30 (2013) 1531–1539. [10] S. Chamayou, G. Bonaventura, C. Alecci, D. Tibullo, F. Di Raimondo, A. Guglielmino, M.L. Barcellona, Consequences of metaphase II oocyte cryopreservation on mRNA content, Cryobiology 62 (2011) 130–134. [11] C.C. Chang, T.A. Elliott, G. Wright, D.B. Shapiro, A.A. Toledo, Z.P. Nagy, Prospective controlled study to evaluate laboratory and clinical outcomes of oocyte vitrification obtained in in vitro fertilization patients aged 30 to 39 years, Fertil. Steril. 99 (2013) 1891–1897.

9

[12] A. Cobo, M. Meseguer, J. Remohi, A. Pellicer, Use of cryo-banked oocytes in an ovum donation programme: a prospective, randomized, controlled, clinical trial, Hum. Reprod. 25 (2010) 2239–2246. [13] B. Ebrahimi, M.R. Valojerdi, P. Eftekhari-Yazdi, H. Baharvand, In vitro maturation, apoptotic gene expression and incidence of numerical chromosomal abnormalities following Cryotop vitrification of sheep cumulus-oocyte complexes, J. Assist. Reprod. Genet. 27 (2010) 239–246. [14] B. Ebrahimi, M.R. Valojerdi, P. Eftekhari-Yazdi, H. Baharvand, A. Farrokhi, IVM and gene expression of sheep cumulus-oocyte complexes following different methods of vitrification, Reprod. Biomed. Online 20 (2010) 26–34. [15] E.M. Ferreira, A.A. Vireque, P.R. Adona, F.V. Meirelles, R.A. Ferriani, P.A. Navarro, Cytoplasmic maturation of bovine oocytes: structural and biochemical modifications and acquisition of developmental competence, Theriogenology 71 (2009) 836–848. [16] J.A. Garcia-Velasco, J. Domingo, A. Cobo, M. Martinez, L. Carmona, A. Pellicer, Five years’ experience using oocyte vitrification to preserve fertility for medical and nonmedical indications, Fertil. Steril. 99 (2013) 1994–1999. [17] S. Hochi, K. Ito, M. Hirabayashi, M. Ueda, K. Kimura, A. Hanada, Effect of nuclear stages during IVM on the survival of vitrified-warmed bovine oocytes, Theriogenology 49 (1998) 787–796. [18] P. Holm, P.J. Booth, M.H. Schmidt, T. Greve, H. Callesen, High bovine blastocyst development in a static in vitro production system using SOFaa medium supplemented with sodium citrate and myo-inositol with or without serumproteins, Theriogenology 52 (1999) 683–700. [19] G. Horvath, G.E. Seidel Jr., Vitrification of bovine oocytes after treatment with cholesterol-loaded methyl-beta-cyclodextrin, Theriogenology 66 (2006) 1026–1033. [20] W. Hu, D. Marchesi, J. Qiao, H.L. Feng, Effect of slow freeze versus vitrification on the oocyte: an animal model, Fertil. Steril. 98 (2012) 752 e3–760 e3. [21] J.Y. Huang, H.Y. Chen, S.L. Tan, R.C. Chian, Effect of choline-supplemented sodium-depleted slow freezing versus vitrification on mouse oocyte meiotic spindles and chromosome abnormalities, Fertil. Steril. 88 (2007) 1093–1100. [22] P. Hyttel, G. Vajta, H. Callesen, Vitrification of bovine oocytes with the open pulled straw method: ultrastructural consequences, Mol. Reprod. Dev. 56 (2000) 80–88. [23] D.H. Kim, H.S. Park, S.W. Kim, I.S. Hwang, B.C. Yang, G.S. Im, H.J. Chung, H.W. Seong, S.J. Moon, B.S. Yang, Vitrification of immature bovine oocytes by the microdrop method, J. Reprod. Dev. 53 (2007) 843–851. [24] J. Konc, K. Kanyo, R. Kriston, B. Somoskoi, S. Cseh, Cryopreservation of embryos and oocytes in human assisted reproduction, BioMed Res. Int. 2014 (2014) 307268. [25] M. Kuwayama, Highly efficient vitrification for cryopreservation of human oocytes and embryos: the Cryotop method, Theriogenology 67 (2007) 73–80. [26] M. Kuwayama, G. Vajta, S. Ieda, O. Kato, Comparison of open and closed methods for vitrification of human embryos and the elimination of potential contamination, Reprod. Biomed. Online 11 (2005) 608–614. [27] M. Kuwayama, G. Vajta, O. Kato, S.P. Leibo, Highly efficient vitrification method for cryopreservation of human oocytes, Reprod. Biomed. Online 11 (2005) 300–308. [28] M.G. Larman, C.B. Sheehan, D.K. Gardner, Calcium-free vitrification reduces cryoprotectant-induced zona pellucida hardening and increases fertilization rates in mouse oocytes, Reproduction 131 (2006) 53–61. [29] V. Lodde, S.C. Modina, F. Franciosi, E. Zuccari, I. Tessaro, A.M. Luciano, Localization of DNA methyltransferase-1 during oocyte differentiation, in vitro maturation and early embryonic development in cow, Eur. J. Histochem. 53 (2009) 199–207. [30] A.M. Luciano, S. Chigioni, V. Lodde, F. Franciosi, G.C. Luvoni, S.C. Modina, Effect of different cryopreservation protocols on cytoskeleton and gap junction mediated communication integrity in feline germinal vesicle stage oocytes, Cryobiology 59 (2009) 90–95. [31] H.S. Luna, I. Ferrari, R. Rumpf, Influence of stage of maturation of bovine oocytes at time of vitrification on the incidence of diploid metaphase II at completion of maturation, Anim. Reprod. Sci. 68 (2001) 23–28. [32] G.M. Machado, J.O. Carvalho, E.S. Filho, E.S. Caixeta, M.M. Franco, R. Rumpf, M.A. Dode, Effect of Percoll volume, duration and force of centrifugation, on in vitro production and sex ratio of bovine embryos, Theriogenology 71 (2009) 1289–1297. [33] V. Magnusson, W.B. Feitosa, M.D. Goissis, C. Yamada, L.M. Tavares, M.E. D’Avila Assumpcao, J.A. Visintin, Bovine oocyte vitrification: effect of ethylene glycol concentrations and meiotic stages, Anim. Reprod. Sci. 106 (2008) 265–273. [34] S. Mamo, F. Carter, P. Lonergan, C.L. Leal, A. Al Naib, P. McGettigan, P. McGettigan, J.P. Mehta, A.C. Evans, T. Fair, Sequential analysis of global gene expression profiles in immature and in vitro matured bovine oocytes: potential molecular markers of oocyte maturation, BMC Genomics 12 (2011) 151. [35] H. Men, Y. Agca, E.S. Critser, J.K. Critser, Beneficial effects of serum supplementation during in vitro production of porcine embryos on their ability to survive cryopreservation by open pulled straw vitrification, Theriogenology 64 (2005) 1340–1349. [36] H. Men, R.L. Monson, J.J. Rutledge, Effect of meiotic stages and maturation protocols on bovine oocyte’s resistance to cryopreservation, Theriogenology 57 (2002) 1095–1103. [37] R. Morato, D. Izquierdo, M.T. Paramio, T. Mogas, Cryotops versus open-pulled straws (OPS) as carriers for the cryopreservation of bovine oocytes: effects on spindle and chromosome configuration and embryo development, Cryobiology 57 (2008) 137–141.

Please cite this article in press as: J.F.W. Sprícigo et al., Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns, Cryobiology (2014), http://dx.doi.org/10.1016/j.cryobiol.2014.07.015

10

J.F.W. Sprícigo et al. / Cryobiology xxx (2014) xxx–xxx

[38] R. Morato, D. Izquierdo, M.T. Paramio, T. Mogas, Embryo development and structural analysis of in vitro matured bovine oocytes vitrified in flexipet denuding pipettes, Theriogenology 70 (2008) 1536–1543. [39] R. Morato, T. Mogas, P. Maddox-Hyttel, Ultrastructure of bovine oocytes exposed to Taxol prior to OPS vitrification, Mol. Reprod. Dev. 75 (2008) 1318–1326. [40] S.H. Murphy, K. Suzuki, M. Downes, G.L. Welch, P. De Jesus, L.J. Miraglia, A.P. Orth, S.K. Chanda, R.M. Evans, I.M. Verma, Tumor suppressor protein (p)53, is a regulator of NF-kappaB repression by the glucocorticoid receptor, Proc. Natl. Acad. Sci. U.S.A. 108 (2011) 17117–17122. [41] L.K. Nutt, S.S. Margolis, M. Jensen, C.E. Herman, W.G. Dunphy, J.C. Rathmell, S. Kornbluth, Metabolic regulation of oocyte cell death through the CaMKIImediated phosphorylation of caspase-2, Cell 123 (2005) 89–103. [42] Y. Panagiotidis, P. Vanderzwalmen, Y. Prapas, E. Kasapi, M. Goudakou, A. Papatheodorou, T. Passadaki, S. Petousis, N. Nikolettos, S. Veletza, N. Prapas, G. Maroulis, Open versus closed vitrification of blastocysts from an oocytedonation programme: a prospective randomized study, Reprod. Biomed. Online 26 (2013) 470–476. [43] L. Parmegiani, G.E. Cognigni, S. Bernardi, S. Cuomo, W. Ciampaglia, F.E. Infante, C. Tabarelli de Fatis, A. Arnone, A.M. Maccarini, M. Filicori, Efficiency of aseptic open vitrification and hermetical cryostorage of human oocytes, Reprod. Biomed. Online 23 (2011) 505–512. [44] J.J. Parrish, A. Krogenaes, J.L. Susko-Parrish, Effect of bovine sperm separation by either swim-up or Percoll method on success of in vitro fertilization and early embryonic development, Theriogenology 44 (1995) 859–869. [45] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [46] W.F. Rall, G.M. Fahy, Ice-free cryopreservation of mouse embryos at 196 degrees C by vitrification, Nature 313 (1985) 573–575. [47] L. Rienzi, S. Romano, L. Albricci, R. Maggiulli, A. Capalbo, E. Baroni, S. Colamaria, F. Sapienza, F. Ubaldi, Embryo development of fresh ‘versus’ vitrified metaphase II oocytes after ICSI: a prospective randomized sibling-oocyte study, Hum. Reprod. 25 (2010) 66–73. [48] J. Saragusty, A. Arav, Current progress in oocyte and embryo cryopreservation by slow freezing and vitrification, Reproduction 141 (2011) 1–19. [49] A. Shahedi, A. Hosseini, M.A. Khalili, M. Norouzian, M. Salehi, A. Piriaei, S.A. Nottola, The effect of vitrification on ultrastructure of human in vitro matured germinal vesicle oocytes, Eur. J. Obstet. Gynecol. Reprod. Biol. 167 (2013) 69–75. [50] A. Shirazi, F. Taheri, H. Nazari, M. Norbakhsh-Nia, E. Ahmadi, B. Heidari, Developmental competence of ovine oocyte following vitrification: effect of

[51]

[52] [53]

[54]

[55]

[56]

[57]

[58]

[59]

[60]

[61]

oocyte developmental stage, cumulus cells, cytoskeleton stabiliser, FBS concentration, and equilibration time, Zygote (2012) 1–9. E. Siqueira Filho, E.S. Caixeta, C. Pribenszky, M. Molnar, A. Horvath, A. Harnos, M.M. Franco, R. Rumpf, Vitrification of bovine blastocysts pretreated with sublethal hydrostatic pressure stress: evaluation of post-thaw in vitro development and gene expression, Reprod. Fertil. Dev. 23 (2011) 585–590. M.A. Sirard, F. Richard, P. Blondin, C. Robert, Contribution of the oocyte to embryo quality, Theriogenology 65 (2006) 126–136. G.D. Smith, P.C. Serafini, J. Fioravanti, I. Yadid, M. Coslovsky, P. Hassun, J.R. Alegretti, E.L. Motta, Prospective randomized comparison of human oocyte cryopreservation with slow-rate freezing or vitrification, Fertil. Steril. 94 (2010) 2088–2095. M. Sole, J. Santalo, M. Boada, E. Clua, I. Rodriguez, F. Martinez, B. Coroleu, P.N. Barri, A. Veiga, How does vitrification affect oocyte viability in oocyte donation cycles? A prospective study to compare outcomes achieved with fresh versus vitrified sibling oocytes, Hum. Reprod. 28 (2013) 2087–2092. J.F. Spricigo, K.S. Morais, B.S. Yang, M.A. Dode, Effect of the exposure to methylbeta-cyclodextrin prior to chilling or vitrification on the viability of bovine immature oocytes, Cryobiology 65 (2012) 319–325. N. Sripunya, T. Somfai, Y. Inaba, T. Nagai, K. Imai, R. Parnpai, A comparison of Cryotop and solid surface vitrification methods for the cryopreservation of in vitro matured bovine oocytes, J. Reprod. Dev. 56 (2010) 176–181. G. Vajta, P. Holm, M. Kuwayama, P.J. Booth, H. Jacobsen, T. Greve, H. Callesen, Open Pulled Straw (OPS) vitrification: a new way to reduce cryoinjuries of bovine ova and embryos, Mol. Reprod. Dev. 51 (1998) 53–58. R. van den Hurk, J. Zhao, Formation of mammalian oocytes and their growth, differentiation and maturation within ovarian follicles, Theriogenology 63 (2005) 1717–1751. A.D. Vieira, A. Mezzalira, D.P. Barbieri, R.C. Lehmkuhl, M.I. Rubin, G. Vajta, Calves born after open pulled straw vitrification of immature bovine oocytes, Cryobiology 45 (2002) 91–94. Z. Yan, M. Delannoy, C. Ling, D. Daee, F. Osman, P.A. Muniandy, X. Shen, A.B. Oostra, H. Du, J. Steltenpool, T. Lin, B. Schuster, C. Decaillet, A. Stasiak, A.Z. Stasiak, S. Stone, M.E. Hoatlin, D. Schindler, C.L. Woodcock, H. Joenje, R. Sen, J.P. de Winter, L. Li, M.M. Seidman, M.C. Whitby, K. Myung, A. Constantinou, W. Wang, A histone-fold complex and FANCM form a conserved DNA-remodeling complex to maintain genome stability, Mol. Cell 37 (2010) 865–878. X.L. Zhou, A. Al Naib, D.W. Sun, P. Lonergan, Bovine oocyte vitrification using the Cryotop method: effect of cumulus cells and vitrification protocol on survival and subsequent development, Cryobiology 61 (2010) 66–72.

Please cite this article in press as: J.F.W. Sprícigo et al., Vitrification of bovine oocytes at different meiotic stages using the Cryotop method: Assessment of morphological, molecular and functional patterns, Cryobiology (2014), http://dx.doi.org/10.1016/j.cryobiol.2014.07.015