VZV gB Endocytosis and Golgi Localization Are Mediated by YXXφ Motifs in Its Cytoplasmic Domain

Virology 285, 42–49 (2001) doi:10.1006/viro.2001.0930, available online at http://www.idealibrary.com on

VZV gB Endocytosis and Golgi Localization Are Mediated by YXX␾ Motifs in Its Cytoplasmic Domain Thomas C. Heineman 1 and Susan L. Hall Division of Infectious Diseases and Immunology, St. Louis University School of Medicine, St. Louis, Missouri 63110-0250 Received February 12, 2001; returned to author for revision March 8, 2001; accepted March 28, 2001 The cytoplasmic domains of many membrane proteins contain sorting signals that mediate their endocytosis from the plasma membrane. VZV gB contains three consensus internalization motifs within its cytoplasmic domain: YMTL (aa 818–821), YSRV (aa 857–860), and LL (aa 841–842). To determine whether VZV gB is internalized from the plasma membrane, and whether these motifs are required for its endocytosis, we compared the internalization of native gB to that of gB containing mutations in each of the predicted internalization motifs. VZV gB present on the surface of transfected cells associated with clathrin and was efficiently internalized to the Golgi apparatus within 60 min at 37°C. VZV gB containing the mutation Y857 failed to be internalized, while gB-Y818A was internalized but did not accumulate in the Golgi. These data indicate that the internalization of VZV gB, and its subsequent localization to the Golgi, is mediated by two tyrosine-based sequence motifs in its cytoplasmic domain. © 2001 Academic Press Key Words: VZV; glycoprotein B; endocytosis; YXX␾ motif; cytoplasmic domain; viral egress.

1998; Heineman et al., 2000), and the cytoplamsic domain of gB contains specific sequences that mediate its transport from the endoplasmic reticulum (ER) to the Golgi (Heineman et al., 2000). However, gB is also found in the plasma membrane of VZV-infected cells (Grose et al., 1984; Heineman, 2000) suggesting that it may be recycled from the plasma membrane to the Golgi. Many virus-encoded glycoproteins are internalized from the plasma membrane to the Golgi in a process that is mediated by specific signal sequences within their cytoplasmic domains (reviewed in Kirchhausen et al., 1997). The best-characterized endocytosis signals are the YXX␾ motif (where Y is tyrosine, X is any amino acid, and ␾ is any bulky hydrophobic amino acid) and the LL (dileucine) motif. Sequence motifs of these types mediate the internalization of several herpesvirus membrane proteins including VZV gE and gI (Olson and Grose, 1997, 1998) and pseudorabies virus (PRV) gE and Us9 (Tirabassi and Enquist, 1999; Brideau et al., 1999). Human cytomegalovirus (HCMV) gB and PRV gB are also internalized from the plasma membrane (Radsak et al., 1996; Tirabassi and Enquist, 1998; Nixdorf et al., 2000), HCMV gB by an acidic cluster in its cytoplasmic domain (Tugizov et al., 1999), and PRV gB by a cytoplasmic domain signal that has not yet been defined (Nixdorf et al., 2000). VZV gB contains multiple potential endocytosis signal sequences in its cytoplasmic domain. These include two YXX␾ motifs [YSRV (aa 857–863) and YMTL (aa 818–829)] and a dileucine motif [LL (aa 841–842)]. To determine whether VZV gB is internalized from the plasma membrane, and whether its internalization is mediated by one or more of these sequence motifs, we introduced spe-

INTRODUCTION Varicella–zoster virus (VZV) is classified as an alphaherpesvirus based on its growth characteristics and its ability to become latent in the nervous system of the host (Roizman, 1990). However, unlike other alphaherpesviruses such as herpes simplex virus types 1 and 2 (HSV-1 and -2), VZV induces syncytia and is highly cell-associated when grown in cultured cells, suggesting that its cellular egress pathway differs significantly from that of the other alphaherpesviruses. All known herpesviruses encode a homolog of glycoprotein B (gB) (Pereira, 1994). The alphaherpesvirus homologs of gB are essential for virus replication and appear to be multifunctional proteins. During viral entry, gB in the virion envelope participates in the fusion of the virion and plasma membranes (Cai et al., 1988; Rauh and Mettenleiter, 1991; Spear, 1993; Pereira, 1994), and during viral egress gB plays a direct role in the cell-to-cell spread of virus (Peeters et al., 1992; Baghian et al., 1993; Pereira, 1994). VZV gB contains 868 amino acids (aa) and is a type 1 membrane protein consisting of a large ectodomain, a hydrophobic transmembrane region, and a cytoplasmic domain. The cytoplasmic domain of VZV gB is predicted to contain 125 aa making it by far the longest cytoplasmic domain of any VZV membrane protein (Davison and Scott, 1986). VZV gB has been shown to accumulate in the Golgi of infected cells (Wang et al., 1

To whom correspondence and reprint requests should be addressed at 3635 Vista Avenue, FDT-8N, St. Louis, MO 63110-0250. Fax: (314) 771-3816. E-mail: [email protected]. 0042-6822/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

42

INTERNALIZATION OF VZV gB

43

FIG. 1. Time course of VZV gB internalization. VZV gB was expressed in MeWo cells, and internalization was allowed to proceed for 0, 15, 30, and 60 min. VZV gB was detected using anti-gB mAbs and visualized by confocal microscopy. At the 60-min time point, cells were also stained with WGA conjugated to TRITC (60-WGA) as a marker for the Golgi.

cific mutations into each of these motifs and assessed the impact of these changes on the internalization of gB. RESULTS VZV gB endocytosis and the time course of its accumulation in the Golgi To determine whether gB accumulates in the Golgi by means of endocytosis from the plasma membrane, and to establish the time course by which this occurs, we expressed native gB in MeWo cells by transfection using the vaccinia-T7 system. After incubation with anti-gB mAbs at 4°C, the cells were placed at 37°C for 0, 15, 30, or 60 min to allow the internalization of gB. The cells were then fixed, permeabilized, and incubated with fluorescein-conjugated secondary antibodies. The intracellular location of gB at each time point was visualized by laser-scanning confocal microscopy. In transfected cells kept at 4°C (Fig. 1, 0 min), gB was found exclusively in the plasma membrane indicating that no internalization had occurred. By 15 min of incubation at 37°C, gB appeared redistributed into discreet patches within the plasma membrane. By 30 min, gB was largely internalized and was distributed diffusely within the cytoplasm. By 60 min at 37°C, gB was present almost exclusively in a wellcircumscribed intracellular compartment consistent with the Golgi. To confirm that this structure was the Golgi, the cells incubated for 60 min at 37°C were costained with TRITC-conjugated wheat germ agglutinin, a lectin that binds to complex oligosaccharides that are present in high abundance in the Golgi (Campadelli et al., 1993;

Gershon et al., 1994; Heineman et al., 2000). TRITC–WGA colocalized with gB in these cells (Fig. 1, 60-WGA) confirming that gB had accumulated within the Golgi. These data show that gB is internalized from the plasma membrane to the Golgi and that internalization proceeds in a stepwise fashion that is complete within 60 min at 37°C. Construction and expression of mutated forms of VZV gB The 125-aa cytoplasmic domain of VZV gB contains two regions that conform to consensus YXX␾ endocytosis motifs, YMTL (aa 818–821) and YSRV (aa 857–861), and a single dileucine motif, LL (aa 841–842; Fig. 2), that may also function as an endocytosis signal. Previous work has demonstrated that the tyrosine in YXX␾ motifs is required for their function as endocytosis signals (Jadot et al., 1992; Thomas and Roth, 1994). Therefore, to determine if either of the VZV gB YXX␾ motifs is required for gB internalization, we produced gB expression cassettes in which the predicted YXX␾ endocytosis motifs were inactivated by changing the first codon from Y to A. Similarly, a gB expression cassette was constructed in which the dileucine motif was replaced with HA (Fig. 2). To confirm that the mutated forms of gB were expressed at similar levels to each other and to that of native gB, we expressed native gB or gB containing the mutated cytoplasmic domain motifs in MeWo cells. VZV gB was immunoprecipitated using anti-VZV gB mAbs and resolved by SDS–PAGE under nonreducing conditions. As a negative control, mock-transfected MeWo cells were also

44

HEINEMAN AND HALL

FIG. 2. VZV gB cytoplasmic domain. The top line depicts the 125-aa cytoplasmic domain of VZV gB (aa 744 to aa 868), and the locations of YXX␾ and LL motifs are shown. The amino acid number for the first residue of each motif is shown at the top. The bottom three lines depict the cytoplasmic domains of the mutated forms of gB used in this study. The altered amino acids are shown in bold.

labeled and incubated with anti-VZV gB mAbs. The mutated forms of gB were each expressed at levels similar to that of native gB (Fig. 3). The different molecular weight species present on this gel presumably represent different glycosylation states of gB as previously observed (Montalvo and Grose, 1987) and are similar for native gB and all of the mutated forms. The internalization of gB requires specific sequence motifs To determine whether either of the YXX␾ motifs or the LL motif in the gB cytoplasmic domain contributes to gB internalization and localization, gB containing the inactivating mutations in each of these motifs, as described above, was expressed in MeWo cells by transfection using the vaccinia-T7 method. After incubation with anti-gB mAbs at 4°C, the transfected cells were placed at 37°C for 0 or 60 min. Following fixation, permeabiliztion, and incubation with fluorescein-conjugated secondary antibodies, localization of gB was monitored by confocal microscopy. As expected, no internalization of native gB or any of the mutated forms of gB occurred in cells kept at 4°C (Fig. 4, 0 min) as evidenced by the presence of gB exclusively in the plasma membrane of these cells. Consistent with the results of the time-course experiment (Fig. 3), incubation of the cells at 37°C for 60 min resulted in the accumulation of native gB in an intracellular com-

partment determined to be the Golgi (Fig. 4, 60 min) based on its costaining with WGA–TRITC (Fig. 4, 60 min ⫹ WGA; note that all the cells were stained by WGA–TRITC, whereas only a fraction of the cells expressed gB). However, VZV gB in which the tyrosines in either of the cytoplasmic domain YXX␾ motifs were mutated exhibited abnormal gB localization. VZV gB-Y818A in which YMTL (aa 818–821) was changed to AMTL was clearly internalized, but rather than localizing to the Golgi, gB-Y818A was found diffusely distributed throughout the cytoplasm (Fig. 4). The same diffuse cytoplasmic distribution of gB-Y818A remained unchanged after 2 h at 37°C (data not shown) indicating that this defect interrupted the transport of gB to the Golgi rather than merely delaying it. An even greater transport defect was observed for gB-Y857A, in which YSRV (aa 857–861) was changed to ASRV. VZV gB containing this mutation remained almost entirely in the plasma membrane indicating the nearly complete absence of internalization. Alteration of the gB cytoplasmic domain dileucine motif from LL to HA (Fig. 4, LL841-842HA) had much less impact on internalization than either of the YXX␾ mutations; gBLL841-842HA was internalized and localized to the Golgi similarly to native gB. These data indicate that the cytoplasmic domain YXX␾ motif, YSRV (aa 857–861), is required for gB internalization. The other YXX␾ motif in the cytoplasmic domain of gB, YMTL (aa 818–821), while not required for internalization, is necessary for the Golgi localization of gB. By contrast, the dileucine motif plays no discernible role in gB internalization or localization. VZV gB associates with clathrin during internalization

FIG. 3. In vitro expression of the native and mutated forms of VZV gB. Native gB (wt) or gB containing mutations in its predicted internalization motifs (Y857A, Y818A, LL841-842HA) was transfected into MeWo cells. gB was immunoprecipitated and resolved by nonreducing SDS–PAGE on an 8% gel. Immunoprecipitation from mock-transfected cells (⫺) is also shown.

YXX␾ motifs typically direct the endocytosis of membrane proteins within clathrin-coated vesicles derived from clathrin-coated pits formed at the cell surface. To determine whether VZV gB is internalized by this mechanism, we expressed native gB or gB containing mutations in its YXX␾ motifs in cultured cells. Internalization was allowed to occur for 60 min as described above, and then the cells were costained for both gB (using mouse monoclonal antibodies) and clathrin (using rabbit polyclonal antibodies) (Olson and Grose, 1997). Clathrin was present in all cells as evidenced by the red cytoplasmic

INTERNALIZATION OF VZV gB

45

FIG. 4. Internalization of VZV gB containing mutations in consensus cytoplasmic domain transport motifs. Native gB or gB containing mutations Y818A, Y857A or LL842-842AA were expressed in MeWo cells. Internalization was allowed to proceed for 0 or 60 min at 37°C. gB was detected using anti-gB mAbs and visualized by confocal microscopy. Cells transfected with native gB were also stained with WGA–TRITC after 60 min at 37°C (60 min ⫹ WGA) as a marker for the Golgi. The arrow marks the Golgi in the cell also expressing VZV gB.

staining, whereas gB was seen only in the small fraction of cells that were transfected (Fig. 5). Following internalization, native gB colocalized with clathrin, most notably in a perinuclear structure consistent with the Golgi, represented by the yellow area in the merged images (Fig. 5). Similarly, gB-Y818A appeared to be associated with clathrin, although, as shown above (Fig. 4), it did not localize to the Golgi. VZV gB-Y857A was not internalized and did not colocalize with clathrin. These data suggest that gB is endocytosed in clatherin-coated pits and that the YXX␾ motif YSRV (aa 857–860) is necessary for this process.

DISCUSSION VZV gB has previously been shown to accumulate in the Golgi apparatus of both infected and transfected cells. In this study, we show that the Golgi localization of gB occurs, at least in part, through the endocytosis of gB from the plasma membrane. We also show that both YXX␾ motifs within the cytoplasmic domain of VZV gB play a role in directing gB from the plasma membrane to the Golgi. The YXX␾ motif YSRV (aa 857–861) is required for the endocytosis of gB as disruption of this motif completely abolishes gB internalization. The second

46

HEINEMAN AND HALL

FIG. 5. Colocalization of gB with clathrin during internalization. Native gB or gB containing mutations Y818A or Y857A were expressed in MeWo cells, and internalization was allowed to proceed for 60 min at 37°C. Transfected cells were costained for gB (anti-gB) and clathrin (anti-clatherin), and their intracellular distributions were visualized by laser-scanning confocal microscopy. Merged images for each of the double-stained fields are shown to demonstrate areas where gB and clatherin colocalize.

YXX␾ motif in the cytoplasmic domain of gB, YMTL (aa 818–821), is not required for gB internalization, but is required for the normal transport of gB to the Golgi. YXX␾ motifs in the cytoplasmic domains of membrane proteins typically mediate endocytosis through clathrin-coated pits. In our studies, gB colocalized with clathrin during internalization suggesting that this mechanism accounts for VZV gB endocytosis. The endocytosis of native gB required at least 30 min, somewhat longer than was observed for VZV gE (Olson and Grose, 1997), although this disparity may have resulted from the different cell types used in these experiments. Additional mutagenesis studies showed that a third potential consensus internalization motif within the cytoplasmic domain of gB, LL (aa 841–842), is not required for either gB internalization or Golgi localization. Our data, however, do not exclude the possibility that this motif is involved in the intracellular trafficking of gB. Subsets of both tyrosine- and dileucine-based signals direct the sorting of proteins to lysozymes, endosomes, or other compartments (Kirchhausen et al., 1997) and

thus would not be identified by the endocytosis assay employed in this study. Moreover, some dileucine-based signals are recognized only as part of larger secondary structures (Pond et al., 1995), which may not exist in the cytoplasmic domain of VZV gB. The trans-Golgi network has been suggested as a site of final herpesvirus envelopment (Whealy et al., 1991; Gershon et al., 1994). It has further been postulated that viral envelopment is mediated by interactions between the cytoplasmic domains of viral glycoproteins present within the trans-Golgi with viral tegument proteins, which in turn bind to unenveloped cytoplasmic capsids (Gershon et al., 1994). The observation that VZV gB accumulates within the Golgi, coupled with the fact that it has the most extensive cytoplasmic domain of any VZV membrane protein, raises the possibility that gB may participate in this process. Regardless of its role in viral egress, however, gB must be transported efficiently to the site of final envelopment as it is abundantly present in the virion envelope (Grose et al., 1984). Our data, demonstrating the well-regulated transport of gB to the Golgi through

INTERNALIZATION OF VZV gB

specific cytoplasmic domain signal sequences, are consistent with the hypothesis that the final envelopment of VZV occurs within the Golgi. Studies on PRV gB have suggested that the internalization viral glycoproteins may also help viruses evade the host immune response. Polyclonal antibodies against PRV gB and gD induce the internalization of these glycoproteins as well as the cointernalization of other plasma membrane proteins including MHC class I (Favoreel et al., 2000). It is not known whether this phenomenon results in enhanced viral survival in vivo. Regardless, our data demonstrate that VZV gB is internalized in the absence of antibody binding, suggesting a role for gB endocytosis other than immune evasion. The accumulation of VZV gB within the Golgi parallels the localization of other herpesvirus glycoproteins including the gB homologs of HCMV and PRV (Radsak et al., 1996; Tugizov et al., 1999; Nixdorf et al., 2000). Our data, however, do not suggest that the pathway taken by VZV gB as it transits from the plasma membrane to the Golgi is necessarily identical to that of other herpesvirus gB homologs. Of particular significance, the gB homologs encoded by many alpha- and betaherpesviruses, such as HSV-1 and -2, PRV and HCMV, contain a Cterminal acidic cluster in their cytoplasmic domains, a feature which is absent from VZV gB. Such domains frequently participate in the intracellular trafficking of a variety of cellular and viral glycoproteins, typically through their interaction with the cellular protein PACS-1 (Wan et al., 1998). The internalization of HCMV gB, in particular, requires its cytoplasmic domain acidic cluster (Tugizov et al., 1999). The absence of an acidic domain therefore makes it unlikely that PACS-1 contributes to the transport of VZV gB and suggests that the postinternalization pathway taken by VZV gB as it transits to the Golgi differs from that of certain other closely related herpesvirus gB homologs. This, in turn, could result in differing intracellular distributions of VZV gB compared to that of gB homologs containing acidic domains and may impact on the site of final envelopment. VZV is highly cellassociated in cultured cells indicating that its egress pathway differs from that of many other herpesviruses including HSV-1 and -2, HCMV and PRV. Differences in VZV gB transport based on its lack of an acidic domain offer one possible explanation for its characteristic growth properties. In addition to the post-Golgi transport signals identified in this report, the cytoplasmic domain of VZV gB has been shown to contain specific ER-to-Golgi transport signals (Heineman et al., 2000). Therefore, the intracellular transport of VZV gB is carefully orchestrated within infected cells further reinforcing the importance of this glycoprotein in viral egress.

47

MATERIALS AND METHODS Cell culture and virus propagation MeWo cells, an immortalized human melanoma cell line, were grown in Eagle’s minimum essential medium (EMEM) containing 10% fetal bovine serum (FBS, BioWhittaker) and GASP (2 mM L-glutamine, chlorotetracycline, penicillin, streptomycin; Quality Biological). Recombinant vaccinia virus vTF7-3 (Moss et al., 1990) was obtained from the American Type Culture Collection, and viral stocks were prepared and titered in BSC-40 African green monkey kidney cells that were also grown in EMEM containing 10% fetal bovine serum and GASP. Immune reagents and intracellular markers Anti-VZV gB monoclonal antibodies (mAbs) were purchased from Biodesign International (catalog No. C05102M). Teramethylrhodamine isothiocyanate (TRITC)conjugated wheat germ agglutinin (WGA) was purchased from EY Laboratories. Rabbit anti-clathrin polyclonal antibodies were purchased from Research Diagnostics, Inc. Goat anti-mouse IgG conjugated with fluorescein isothiocyanate (FITC) and TRITC-conjugated goat antirabbit IgG were purchased from Sigma. Plasmid construction and site-directed mutagenesis of VZV gB An 8131-bp PmeI/SpeI fragment of VZV strain Oka [consensus nucleotides 53,875 to 62,007 (12)] containing the VZV gB coding sequence (nucleotides 57,008 to 59,611) was cloned into pNEB193 (New England Biolabs) in which the SmaI site had been replaced with a SpeI linker. The 8148-bp fragment resulting from HindIII/SpeI digestion of this plasmid (8131-bp VZV DNA fragment and 17 bp from the pNEB polylinker) was cloned into pBluescript-SK ⫹ (Stratagene) at the corresponding restriction sites such that the gB coding sequence was downstream of the T7 promoter to yield pBS-8131. A 2329-bp DNA fragment between the T7 promoter and the gB start codon was eliminated by digesting pBS-8131 with StuI and HindIII followed by recircularization to yield pBS5802. All VZV gB mutations used in this study were derived from pBS-5802 by site-directed mutagenesis using the Bio-Rad Muta-Gene Phagemid in vitro mutagenesis kit, which employs the Kunkel method (Kunkel, 1985). The uracil-containing single-stranded DNA was isolated from Escherichia coli CJ236 after superinfection of M13KO7 helper phage (Promega). To generate truncated forms of VZV gB, oligonucleotides were designed to substitute an alanine codon for tyrosine in the YXX␾ motifs or a histidine for leucine in the dileucine motif. The mutagenic oligonucleotides used in this study (purchased from Genosys) were ATGATTAAAGCTATGACGTTA (Y818A), CCGAGGAGCCTCCCGTG (Y857A), and ACTAGCGC-

48

HEINEMAN AND HALL

CCATGCAACTTCACGT (LL841-842HA). Each mutation was confirmed by sequencing the relevant region of the VZV gB gene using the dideoxy-chain termination method (Sanger et al., 1977). In vitro expression of VZV gB VZV gB was expressed in vitro using the vaccinia-T7 expression system (Fuerst, 1986). Briefly, DNA for transfection was column purified (Qiagen) and transfected using lipofectin (Gibco-BRL). Cells at 75–90% confluence were infected with vaccinia vTF7-3 at a multiplicity of infection of 10 and then transfected using 7 ␮g of DNA and 12 ␮l of lipofectin in 10-cm 2 wells or 3.5 ␮l DNA and 6 ␮l lipofectin in 1.2-cm 2 wells. Cells were incubated at 37°C, 5% CO 2 for 16 h prior to radiolabeling or antibody staining for immunofluorescence. Radiolabeling and immunoprecipitation of proteins Metabolic labeling was performed at 37°C in 5% CO 2. Transfected cells were incubated for 1 h in EMEM lacking cysteine and methionine and then incubated in cys ⫺, met ⫺ EMEM containing 125 ␮Ci/ml [ 35S]Translabel (ICN) for 4 h. Labeled cells were washed extensively in phosphate-buffered saline (PBS) at 4°C and lysed in PBS containing 1% Triton X-100, 0.5% deoxycholate, and 0.1% sodium dodecyl sulfate (SDS). VZV gB was immunoprecipitated by incubating the cell lysates with anti-VZV gB mAbs overnight at 4°C followed by incubation with Staphylococcus protein G (Pharmacia–Biotech) for 1 h at 4°C. After washing, precipitated proteins were eluted in sample buffer containing 2% SDS (Bio-Rad) and resolved by SDS–polyacrylamide gel electrophoresis (PAGE) on 8% nonreducing gels. The gels were dried, and the labeled immunoprecipitated proteins were visualized by autoradiography. Endocytosis assay The endocytosis assay was performed, with minor modifications, as previously described (Olsen and Grose, 1997). Briefly, MeWo cells were grown on glass coverslips in 12 dishes (1.2 cc 2/well) and transfected with the pBS-5802-derived constructs described above. Following transfection, the cells were incubated with antiVZV gB mAb (1:250) for 1 h at 4°C. The transfected cells were washed with cold PBS and then incubated with medium containing 10% FBS at 37°C. At given times during the 37 °C incubation (0, 15, 30, or 60 min), the cells were fixed and permeabilized in 4% paraformaldehyde containing 0.2% Triton X-100. The fixed cells were blocked by incubation with PBS containing 1% goat serum (Sigma) for 1 h at room temperature and then incubated for 1 h at room temperature with goat anti-mouse IgG–FITC diluted 1:1000 in PBS containing 1% goat serum. When Golgi visualization was desired, WGA–TRITC at a final concentration of 5 ␮g/ml was incubated with

the fixed cells for 20 min concurrent with the secondary antibody incubation. Following incubation with the secondary antibodies, the cells were washed in PBS and then viewed with a Bio-Rad MRC 1024 laser-scanning confocal microscope. Clatherin colocalization assay MeWo cells were grown on glass coverslips and transfected as described above. After incubation with medium at 37°C for various intervals, the cells were fixed, permeabilized, and then incubated concurrently with rabbit anti-clathrin polyclonal antibodies (diluted 1:200 in PBS) and anti-VZV gB monoclonal antibodies (diluted 1:250 in PBS) at 4°C for 1 h. The cells were washed with PBS, incubated with TRITC-conjugated goat anti-rabbit IgG and FITC-conjugated goat anti-mouse IgG, both diluted 1:1000 in PBS, and then viewed by laser-scanning confocal microscopy. ACKNOWLEDGMENT Excellent technical assistance was provided by Nancy Krudwig.

REFERENCES Baghian, A., Huang, A., Newman, S., Jayachandra, S., and Kousoulas, K. G. (1993). Truncation of the carboxy-terminal 28 amino acids of glycoprotein B specified by herpes simples virus type 1 mutant amb1511–7 causes extensive cell fusion. J. Virol. 67, 2396–2401. Brideau, A. D., del Rio, T., Wolffe, E. J., and Enquist, L. W. (1999). Intracellular trafficking and localization of the pseudorabies virus Us9 type II envelope protein to host and viral membranes. J. Virol. 73, 4372–4384. Cai, W., Gu, B., and Person, S. (1988). Role of glycoprotein B of herpes simplex virus type 1 in viral entry and cell fusion. J. Virol. 62, 2596– 2604. Campadelli, G., Brandimarti, R., Di Lazzaro, C., Ward, P. L., and Roizman, B. (1993). Fragmentation and dispersal of Golgi proteins and redistribution of glycoproteins and glycolipids processed through the Golgi apparatus after infection with herpes simplex virus 1. Proc. Natl. Acad. Sci. USA 90, 2798–2802. Davison, A. J., and Scott, J. (1986). The complete DNA sequence of varicella–zoster virus. J. Gen. Virol. 67, 1759–1816. Favoreel, H. W., Nouwynck, H. J., Van Oostveldt, P., and Pensaert, M. B. (2000). Role of anti-gB and -gD antibodies in antibody-induced endocytosis of viral and cellular cell surface glycoproteins expressed on pseudorabies virus-infected monocytes. Virology 267, 151–158, doi:10.1006/viro.1999.0132. Gershon, A. A., Sherman, D. L., Zhu, Z., Gabel, C. A., Ambron, R. T., and Gershon, M. D. (1994). Intracellular transport of newly synthesized varicella–zoster virus: Final envelopment in the trans-Golgi network. J. Virol. 68, 6372–6390. Grose, C., Edwards, D. P., Weigle, K. A., Friedrichs, W. E., and McGuire, W. L. (1984). Varicella–zoster virus-specific gp140: A highly immunogenic and disulfide-linked structural glycoprotein. Virology 132, 138– 146. Heinaman, T. H., Krudwig, N., and Hall, S. L. (2000). Cytoplasmic domain signal sequences that mediate transport of varicella–zoster virus gB from the endoplasmic reticulum to the Golgi. J. Virol. 74, 9421–9430. Jadot, M., Canfield, W. M., Gregory, W., and Kornfeld, S. (1992). Characterization of the signal for rapid internalization of the bovine mannose

INTERNALIZATION OF VZV gB 6-phosphate/insulin-like growth factor-II receptor. J. Biol. Chem. 267, 11069–11077. Kirchhausen, T., Bonifacino, J. S., and Riezman, H. (1997). Linking cargo to vesicle formation: Receptor tail interactions with coat proteins. Curr. Opin. Cell Biol. 9, 488–495. Kunkel, T. A. (1985). Rapid and efficient site-directed mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82, 488–492. Montalvo, E. A., and Grose, C. (1987). Assembly and processing of the disulfide-linked varicella–zoster virus glycoprotein gpII(140). J. Virol. 61, 2877–2884. Moss, B., Elroy-Stein, O., Mizukami, T., Alexander, W. A., and Fuerst, T. R. (1990). Product review. New mammalian expression vectors. Nature 348, 91–92. Nixdorf, R., Klupp, B. G., Karger, A., and Mettenleiter, T. C. (2000). Effects of truncation on the carboxy terminus of pseudorabiesvirus glycoprotein B on infectivity. J. Virol. 74, 7137–7145. Olson, J. K., and Grose, C. (1997). Endocytosis and recycling of varicella–zoster virus Fc receptor glycoprotein gE: Internalization mediated by a YXXL motif in the cytoplasmic tail. J. Virol. 71, 4042–4054. Olson, J. K., and Grose, C. (1998). Complex formation facilitates endocytosis of the varicella–zoster virus gE:gI Fc receptor. J. Virol. 72, 1542–1551. Peeters, B., De Wind, N., Hooisma, M., Wagenaar, F., Gielkens, A., and Moormann, R. (1992). Pseudorabies virus envelope glycoproteins gp50 and gII are essential for virus penetration, but only gII is involved in membrane fusion. J. Virol. 66, 894–905. Pereira, L. (1994). Function of glycoprotein B homologues of the family herpesviridae. Infect. Agents Dis. 3, 9–28. Pond, L., Kuhn, L. A., Teyton, L., Schutze, M., Tainer, J. A, Jackson, M. R., and Peterson, P. A. (1995). A role for acidic residues in di-leucine motif-based targeting to the endocytic pathway. J. Biol. Chem. 270, 19989–19997. Radsak, K., Eickmann, M., Mockenhaupt, T., Bogner, E., Kern, H., EisHubinger, A., and Reschke, M. (1996). Retrieval of human cytomegalovirus glycoprotein B from the infected cell surface for virus envelopment. Arch. Virol. 141, 557–572.

49

Rauh, L., and Mettenleiter, T. C. (1991). Pseudorabies virus glycoprotein gII and gp50 are essential for virus penetration. J. Virol. 65, 5348– 5356. Roizman, B. (1990). Herpesviridae: A brief introduction. In “Fields Virology,” 2nd ed., pp. 1787–1793. Raven Press, Ltd. New York, NY. Sanger, R., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463– 5467. Spear, P. G. (1993). Entry of alphaherpesviruses into cells. Semin. Virol. 4, 167–180. Thomas, D. C., and Roth, M. G. (1994). The basolateral targeting signal in the cytoplasmic domain of glycoprotein G from vesicular stomatitis virus resembles a variety of intracellular targeting motifs related by primary sequence but having diverse targeting activities. J. Biol. Chem. 269, 15732–15739. Tirabassi, R. S., and Enquist, L. W. (1998). Role of envelope protein gE endocytosis in the pseudorabies virus life cycle. J. Virol. 72, 4571– 4579. Tirabassi, R. S., and Enquist, L. W. (1999). Mutation of the YXXL endocytosis motif in the cytoplasmic tail of pseudorabies virus gE. J. Virol. 73, 2717–2728. Tugizov, S., Maidji, E., Xiao, J., and Pereira, L. (1999). An acidic cluster in the cytosolic domain of human cytomegalovirus glycoprotein B is a signal for endocytosis from the plasma membrane. J. Virol. 73, 8677–8688. Wan, L., Molloy, S. S., Thomas, L., Liu, G., Xiang, Y., Rybak, S. L., and Thomas, G. (1998). PACS-1 defines a novel gene family of cytosolic sorting proteins required for trans-Golgi network localization. Cell 94, 205–216. Wang, Z., Gershon, M. D., Lungu, O., Panagiotidis, C. A., Zhu, Z., Hao, Y., and Gershon, A. A. (1998). Intracellular transport of varicella–zoster glycoproteins. J. Infect. Dis. 178(Suppl. 1), S7–S12. Whealy, M. E., Card, J. P., Meade, R. P., Robbins, A. K., and Enquist, L. W. (1991). Effect of brefeldin A on alphaherpesvirus membrane protein glycosylation and virus egress. J. Virol. 6, 1066–1081.