Waterborne exposure to microcystin-LR alters thyroid hormone levels, iodothyronine deiodinase activities, and gene transcriptions in juvenile zebrafish (Danio rerio)

Chemosphere 241 (2020) 125037

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Waterborne exposure to microcystin-LR alters thyroid hormone levels, iodothyronine deiodinase activities, and gene transcriptions in juvenile zebrafish (Danio rerio) Qing Hu a, Zidong Liu b, Yu Gao a, Dan Jia a, Rong Tang c, Li Li c, Dapeng Li c, * a b c

Faculty of Animal Science and Technology, Plateau Aquacultural College, Yunnan Agricultural University, Yunnan, 650201, China Wuhan Fisheries Technology Extension and Instruction Center, Wuhan, 430012, China College of Fisheries, Hubei Provincial Engineering Laboratory for Pond Aquaculture, Huazhong Agricultural University, Wuhan, 430070, China

h i g h l i g h t s
MC-LR exposure significantly decreased the T4 and T3 levels in juvenile zebrafish.
MC-LR could alter gene transcription and IDs activities in the HPT axis.
A compensatory mechanism can be triggered to maintain TH homeostasis in juvenile zebrafish.

a r t i c l e i n f o

a b s t r a c t

Article history: Received 28 July 2019 Received in revised form 30 September 2019 Accepted 1 October 2019 Available online 3 October 2019

This study investigated the effects of microcystin (MC) on the regulation of thyroid hormone (TH) metabolism in juvenile zebrafish exposed to MC-LR. The results showed that acute MC-LR exposure at concentrations ranging from 50 mg/L to 400 mg/L led to significant reductions in thyroxine (T4) and triiodothyronine (T3) levels in juvenile zebrafish. The transcription levels of genes involved in TH synthesis, such as corticotropin-releasing hormone (crh), thyroid-stimulating hormone (tsh), thyroid peroxidase (tpo) and transthyretin (ttr), were significantly decreased followed by an increase after MC-LR exposure. Transcription of the TH nuclear receptors (tr-a and tr-b) was significantly reduced during the exposure period. Moreover, the activities of iodothyronine deiodinase type I (ID1) and iodothyronine deiodinase type II (ID2) showed initially decreased and then increased trend, while the activity of iodothyronine deiodinase type III (ID3) significantly decreased during MC-LR exposure. In addition, the effect of MC-LR on deiodinase activities and T4 contents were important causes of the decreased T3 at the early exposure stage. These results indicated that acute MC-LR exposure significantly interfered with the transcription of genes related to TH synthesis, transport and metabolism, and affected normal function of the thyroid which leads to decrease of T4 and T3 in juvenile zebrafish. Therefore, the thyroid function is susceptible to interference by MC-LR, and it may cause adverse effects on the growth and development of juvenile zebrafish. © 2019 Published by Elsevier Ltd.

Handling Editor: David Volz Keywords: MC-LR Thyroid hormone levels Iodothyronine deiodinase activities Gene transcriptions Juvenile zebrafish

1. Introduction The enhancement of eutrophication in superficial freshwater bodies is due to an increase in the human population and the consequent intensification of agricultural and industrial activities in addition to deficient water management. Cyanobacterial blooms are caused by eutrophication processes and specific environmental

* Corresponding author. E-mail address: [email protected] (D. Li). https://doi.org/10.1016/j.chemosphere.2019.125037 0045-6535/© 2019 Published by Elsevier Ltd.

conditions. These blooms are regarded as a serious global public health and environmental issue worldwide (Jiang et al., 2011). Microcystins (MCs), which are cyanotoxins, are a potentially hazardous consequence of cyanobacterial blooms. To date, almost 80 structural isoforms of MCs have been identified and the most common and toxic isoform is microcystin-LR (MC-LR) (Dietrich and Hoeger, 2005). Fish are exposed to toxins during feeding and breathing, and increased fish mortality has been reported where toxic cyanobacterial blooms occurred (Malbrouck and Kestemont, 2006). A previous study revealed that embryonic development,

2

Q. Hu et al. / Chemosphere 241 (2020) 125037

larval growth and development, and adult reproduction and behavior can be negatively affected by MCs (Zhang et al., 2008). In recent years, studies have confirmed that MCs can affect endocrine systems by significantly reducing the levels of thyroid hormone (TH), altering gene transcriptions related to the hypothalamuspituitary-interrenal axis, and disturbing thyroid function (Li et al., 2009; Rogers et al., 2011; Yan et al., 2012). However, the mechanisms underlying MC-LR-induced endocrine toxicity have not yet been clarified. Thyroid function is determined by iodide uptake, TH synthesis and transport, tissue-specific TH deiodination and THs binding to TH hormone nuclear receptors (trs) (Yen and Chin, 1994). In fish, THs consisting of T3 and T4 play major roles in a variety of physiological activities including development, growth and metabolism (Power et al., 2000). The corticotropin-releasing hormone (crh) appears to be more potent in stimulating thyroid-stimulating hormone (tsh) secretion, and regulating the synthesis of THs (Groef et al., 2006). Thyroid peroxidase (tpo), is a crucial enzyme in the formation of T4, and the specific TH transport protein transthyretin (ttr) also plays a pivotal role in TH metabolism (Liu et al., 2015b). T4 is synthesized and secreted by thyroid follicles (Liu et al., 2011). In fish, T4 is exclusively synthesized by the thyroid and has few direct actions. However, as the biologically active form of the hormone, T3 is derived from catalytic deiodination of T4 in peripheral tissues via deiodinases (IDs). Three types of deiodinase have been investigated in fish, including iodothyronine deiodinase type I (ID1), iodothyronine deiodinase type II (ID2) and iodothyronine deiodinase type III (ID3) (Orozco and Valverde, 2005). These enzymes have different catalytic properties and characteristics of outer ring-deiodination or inner ring-deiodination. T3, the most biologically active form of thyroid hormone, is produced by T4 through outer ring-deiodination. However, T4 is degraded into reverse triiodothyronine (rT3) or diiodothyronine (T2) by inner ring-deiodination, and then inactivated by metabolism and excreted. ID1 and ID2 serve the activating or outer ringdeiodinating pathway by converting T4 to T3 (Orozco and Valverde, 2005), which is primarily catalyzed by ID2 (Liu et al., 2011). T4 and T3 are converted to inactive rT3 and T2, respectively, by the inner ring-deiodinating pathway via ID3. Many researchers have confirmed that environmental pollutants can interfere with TH metabolism processes, such as the synthesis and transport of THs, or changing the activity of IDs (Yu et al., 2010; Yan et al., 2012). Modification of IDs activity is normally used as a sensitive biomarker of thyroid disruption in fish when exposed to environmental pollutants (Picard-Aitken et al., 2007; Scholz and Mayer, 2008). Knockdown of ID3 in both embryonic and early larval development in zebrafish indicated that ID3 is essential for normal embryonic and early larval development (Heijlen et al., 2014). An investigation in striped parrotfish (Scarus iseri) demonstrated that thyroidal status influences relative transcription of dio2 and dio3 in the liver, but not dio1 (Johnson and Lema, 2011). Our previous research suggested that MC-LR can alter the transcription of deiodinase-related genes and IDs activities in grass carp (Ctenopharyngodon idella) liver cell lines (Liu et al., 2015c). A significant decline in T3 level associated with a decrease in ID2 activity in male zebrafish was observed at 21 d after MC-LR exposure (Liu et al., 2016). However, acute toxicity experiments are necessary to systematically and completely demonstrate the physiological state of the fish after exposure to MC-LR. Therefore, we hypothesized that MC-LR may disrupt the transcription of genes involved in THs metabolism, the levels of THs, and the activities of deiodinases in liver, which then affect the development and normal physiological function in fish. In this experiment, juvenile zebrafish were selected to determine the thyroid disruption mechanism of acute MC-LR exposure by

measuring THs content, deiodinase activities, and a series of genes transcription involved in THs synthesis, transport, and metabolism. 2. Materials and methods 2.1. Chemicals and fish MC-LR (purity 95%) was provided by Enzo Life Sciences (Lausen, Switzerland). All other chemicals used in this study were analytical grade. Healthy 1-month-old juvenile zebrafish used in this study were purchased from the Institute of Hydrobiology, Chinese Academy of Sciences in Wuhan, China. The body length of juvenile zebrafish was 1.735 ± 0.161 cm. The body weight of the zebrafish was 0.047 ± 0.014 g. 2.2. Experimental design MC-LR was dissolved in dimethyl sulfoxide (DMSO, SigmaAldrich, St. Louis, MO, USA) as stock solutions. The stock solution was diluted with dechlorinated tap water to prepare different exposure concentrations of MC-LR (0, 50, 100, 200 and 400 mg/L). The final concentration of DMSO in aquarium water in the control and treatment groups was 0.001% (v/v). The juvenile zebrafish were acclimatized in tanks containing dechlorinated tap water at a constant temperature (25 ± 1  C) under a 14 h light/10 h dark photoperiod for 15 d before exposure. During experimental exposure, the fish were randomly distributed into 15 glass tanks (20 fish/tank, three parallel were included for each treatment) and exposed to MC-LR for 0 h, 24 h, 48 h, 72 h and 96 h, respectively. One third of the exposure solution in each tank was replaced every day, and newly prepared MC-LR solution at the same concentration was added at the same time. A commercial ELISA kit, purchased from J & Q Environmental Technologies Co., Ltd., was used to monitor the MC-LR concentration in the tanks to maintain the concentration close to the target doses. The fish were not fed during the whole experiment, and less than 10% mortality was observed in each tank. Juvenile zebrafish from the control and treatment tanks were anesthetized with tricaine methanesulfonate (MS222, SigmaAldrich), and sampled at 0 h, 24 h, 48 h, 72 h and 96 h. Four whole fish from each tank were mixed and preserved at 80  C for IDs activities assays, THs measurement, and gene transcriptions determination. All experiments were carried out with approval from the Institutional Animal Care and Use Committee (IACUC) of Huazhong Agricultural University (Wuhan, China), and were performed in accordance with the International Guiding Principles for Biomedical Research Involving Animals as promulgated by the Society for the Study of Reproduction. 2.3. Thyroid hormone measurement The whole-body concentrations of T4 and T3 were measured using commercial ELISA kits purchased from Beijing North Institute of Biotechnology, China. The method was described in our previous studies (Liu et al., 2015b, 2016). The ELISAs for T4 and T3 in the zebrafish samples were validated by demonstrating parallelism between a series of diluted and spiked samples in relation to the standard curve. The whole juvenile zebrafish was homogenized according to the weight volume ratio of 1:9 to PBS by a tissue homogenizer (Qiagen, Germany). The structures in the samples were disrupted by intermittent sonic oscillation for 10 min on ice using an Ultrasonic Cell Disruptor (Sonics & Materials, Newtown, CT, USA), and samples were vortexed for 10 min. The samples were then centrifuged at 5000g for 10 min at 4  C. The supernatants were collected for THs measurement. The assay sensitivities of T4

Q. Hu et al. / Chemosphere 241 (2020) 125037

and T3 were 10 ng/mL and 0.25 ng/mL, respectively. 2.4. Gene transcription 2.4.1. RNA extraction and reverse transcription Total RNA was extracted from the whole juvenile zebrafish using RNAiso Plus (TakaRa, Dalian, China). The quality of the extracted RNA was examined using a NanoDrop 2000c UVV spectrophotometer (Thermo Scientific, Waltham, MA, USA) by calculating the ratio of absorbance at 260 and 280 nm. The integrity of the RNA was visualized by electrophoresis on a 1% agarose gel. The removal of genomic DNA and the reverse transcription reaction were performed using the PrimeScript® RT reagent kit with gDNA Eraser (TaKaRa, Dalian, China) following the manufacturer's instructions. 2.4.2. Real-time PCR The primer sequences of THs metabolism-related genes are listed in Table 1. The glyceraldehyde-phosphate dehydrogenase

Iodothyronine deiodinase activity ¼

3

The activity of ID1 was determined by incubating 200 mL homogenate at 37  C for 120 min with 50,000 cpm of 125I-rT3, 0.1 mM unlabeled rT3, and 15 mM DTT in 200 mL 0.01 M PBS (pH 7.0). The activity of ID2 was measured by incubating 200 mL homogenate at 37  C for 120 min with 50,000 cpm of 125I-T4, 1 nM unlabeled T4, and 30 mM DTT in 200 mL 0.01 M PBS (pH 7.0). The activity of ID3 was measured by incubating 200 mL homogenate at 37  C for 120 min with 150,000 cpm of 125I-T3, 1 nM unlabeled T3, and 30 mM DTT in 200 mL 0.01 M PBS (pH 7.0). The above reactions were stopped by the successive addition of 200 mL 5% (w/v) bovine serum albumin (Sigma-Aldrich) and 400 mL 10% (w/v) trichloroacetic acid at 4  C. Each mixture was then centrifuged at 3500g for 30 min. The supernatant radioactivity was detected using a GC-911 gcounter (Zhong Jia, Tian Jin, China). PBS (0.01 M) was used instead of the homogenate as the blank control, and the procedures were performed as described above. The activities of IDs were calculated using the following formula:

½SCc ðcpmÞ  SA ðfmol=cpmÞ  1000 ½homognarate volume ðmLÞ  protein content ðmg=mLÞ  incubation time ðminÞ

(gapdh) gene was served as the housekeeping gene. The 25 mL PCR volume contained 2 mL cDNA template, 1 mL of each 10 mM primer, 12.5 mL of SYBR Premix Ex Taq II (2) (Takara, Dalian, China), and double-distilled water to a final volume of 25 mL. The protocol was: pre-heat at 95  C for 30 s followed by 35 cycles of 95  C for 5 s, 55  C for 30 s, 72  C for 30 s. The fluorescence released from the dye which was monitored by Rotor-Gene Q (QIAGEN, Germany). All samples were analyzed in triplicate. The specificity of each pair of primers was verified via the only peak of the melt curve. The relative mRNA transcription level of each gene was calculated using the 2-△△Ct method (Livak and Schmittgen, 2001). 2.5. Iodothyronine deiodinase activity assays The whole body of juvenile zebrafish was homogenized in buffer solution (0.01 M PBS, 1 mM DTT, 2 mM EDTA, pH 7.0) and centrifuged at 12,000g for 20 min at 4  C. The protein content in the supernatant was determined using the Bradford Protein Assay (BioRad, Hercules, CA, USA). The activities of IDs in the supernatants were measured as previously described (Hotz et al., 1996; Geyten et al., 1998).

where SCc is the sample count minus the blank count and SA is total moles of TH (rT3, T4, or T3) in the incubation solution divided by the total counts. Therefore, the units of iodothyronine deiodinase activity were expressed as fmol I released/mg protein per min. 2.6. Statistical analysis All data were expressed as the mean ± standard deviation (SD). Data analyses were performed using SPSS 16.0 software (IBM, USA). The differences between the control group and each treatment group were evaluated by one-way analysis of variance (ANOVA) followed by the least significant difference (LSD) test where differences were found. A value of p < 0.05 was considered statistically significant. A value of p < 0.01 was considered statistically very significant. 3. Results 3.1. Whole body thyroid hormone levels Significant effects on the contents of T4 and T3 in juvenile

Table 1 Sequences of primer for real-time PCR. Gene name

Sequence of primer (5’/30 )

Genbank No.

gapdh (glyceraldehyde-phosphate dehydrogenase)

F: CTGGTGACCCGTGCTGCTT R: TTTGCCGCCTTCTGCCTTA F: TTCGGGAAGTAACCACAAGC R: CTGCACTCTATTCGCCTTCC F: GCAGATCCTCACTTCACCTACC R: GCACAGGTTTGGAGCATCTCA F: GCGCTTGGAACACAGTATCA R: CTTCAGCACCAAACCCAAAT F: CGGGTGGAGTTTGACACTTT R: GCTCAGAAGGAGAGCCAGTG F: CTATGAACAGCACATCCGACAAG R: CACACCACACACGGCTCATC F: TGGGAGATGATACGGGTTGT R: ATAGGTGCCGATCCAATGTC

NM_001115114

crh (corticotropin-releasing hormone) tsh (thyroid-stimulating hormone) tpo (thyroid peroxidase) ttr (transthyretin) tr-a (thyroid receptor a) tr-b (thyroid receptor b)

NM_001007379 AY135147 EU267076 BC081488 NM_131396 NM_131340

4

Q. Hu et al. / Chemosphere 241 (2020) 125037

Fig. 1. Contents of (A) thyroxine (T4) and (B) triiodothyronine (T3) in juvenile zebrafish upon the exposure of MC-LR. The values were expressed as mean ± SD (n ¼ 3). * indicated significant differences at p < 0.05 between the treatment groups and the control group. ** indicated significant differences at p < 0.01 between the treatment groups and the control group.

zebrafish were observed upon acute MC-LR exposure. After 24 h and 48 h exposure, the level of T4 in all exposed groups was significantly lower than that in the control group. While, after 72 h and 96 h exposure to MC-LR, the content of T4 was significantly decreased in the 100 mg/L, 200 mg/L and 400 mg/L groups (Fig. 1A). After 24 h, 48 h, and 72 h exposure, the level of T3 in all exposed groups decreased significantly. After 96 h exposure, the content of T3 in the 400 mg/L group recovered to the control level, while T3 in the other exposed groups was still significantly decreased (Fig. 1 B). 3.2. Gene transcriptions profile Acute MC-LR exposure had a significant effect on the transcription of thyroid-associated genes in juvenile zebrafish. After 24 h and 48 h exposure, the transcription of crh decreased significantly in all treatment groups. At 72 h, the transcription of crh was still significantly decreased in the 50 mg/L, 100 mg/L and 200 mg/L exposed groups, while a significant increase was detected in the 400 mg/L exposed group. While, after 96 h exposure, the transcription of crh increased significantly in the 200 mg/L and 400 mg/L groups, respectively. However, the significant decrease of crh has been detected in 100 mg/L group (Fig. 2A). After 24 h exposure to MC-LR, the transcription of tsh was significantly decreased in all groups. At 48 h, the transcription of tsh showed an increasing trend. After 72 h, the transcription of tsh increased significantly in the 100 mg/L, 200 mg/L and 400 mg/L groups. A significant increase in tsh transcription occurred in the 50 mg/L, 100 mg/L and 200 mg/L groups after 96 h exposure (Fig. 2B). The transcription of tpo was significantly decreased in each exposed group after 24 h exposure. After 48 h, the transcription of tpo was increased to the control level in each MC-LR exposed group. After 72 h exposure, the transcription of tpo began to decrease significantly in the 400 mg/L group. However, the level of tpo showed different trends in different exposed groups at 96 h. In the 50 mg/L group, the transcription of tpo increased significantly, while in the 200 mg/L and 400 mg/L groups, the transcription of tpo significantly declined (Fig. 2C). The ttr was significantly decreased in the 400 mg/L group after exposure to MC-LR for 24 h. A significant decrease in ttr was observed in all exposed groups at 48 h. The transcription of ttr increased significantly in the 100 mg/L, 200 mg/L and 400 mg/L

groups, while a significant decrease in ttr was detected in the 50 mg/ L group at 72 h. After 96 h exposure, the ttr transcription level was significantly decreased in the 200 mg/L and 400 mg/L groups, respectively (Fig. 2D). Similar trends in tr-a and tr-b transcription were found in all exposure groups, and the down-regulation of tr-a was more significant than that of tr-b. After 24 h exposure, tr-a and tr-b significantly decreased in all exposure groups. After 48 h and 72 h exposure, tr-a transcription decreased significantly in all exposed groups, and a significant decrease in tr-b transcription was only detected in the 100 mg/L, 200 mg/L and 400 mg/L exposed groups. A significant decrease in tr-a transcription was still observed after 96 h, while the transcription of tr-b was significantly decreased only in the 200 mg/L and 400 mg/L exposed groups (Fig. 2E and F).

3.3. Iodothyronine deiodinase activities The activities of three IDs in juvenile zebrafish were significantly affected upon acute MC-LR exposure. With prolonged exposure time, the activity of ID1 and ID2 initially decreased, and then significantly increased. The activity of ID1 was significantly decreased after 24 h exposure at the concentrations of 200 mg/L and 400 mg/L. After 48 h exposure, the activity of ID1 significantly decreased only at the concentration of 400 mg/L. However, after 72 h exposure, the activity of ID1 increased significantly in all exposure groups. Similarly, the activity of ID1 significantly increased at the concentrations of 100 mg/L, 200 mg/L, and 400 mg/L after 96 h exposure (Fig. 3A). The activity of ID2 significantly decreased in the 400 mg/L group at 24 h. However, the activity of ID2 significantly decreased in all exposed groups after 48 h. After 72 h exposure, the activity of ID2 increased significantly in the 400 mg/L group, and then returned to the control level at 96 h. A significant increase in ID2 activity occurred in the 50 mg/L, 100 mg/L, and 200 mg/L groups after 96 h, but not in the 400 mg/L group (Fig. 3B). There was no significant change in the activity of ID3 in all exposed groups after 24 h. However, a significant decrease in ID3 was observed after 48 h exposure to 200 mg/L and 400 mg/L MC-LR. With further exposure to MC-LR, the activity of ID3 was significantly reduced in all exposed groups after 72 h and 96 h (Fig. 3C).

Q. Hu et al. / Chemosphere 241 (2020) 125037 Fig. 2. Relative gene transcription of (A) corticotropin-releasing hormone (crh), (B) thyroid-stimulating hormone (tsh), (C) thyroid peroxidase (tpo), (D) transthyretin (ttr), (E) thyroid receptor-a (tr-a) and (F) thyroid receptor-b (tr-b) in juvenile zebrafish upon the exposure of MC-LR. The values were expressed as mean ± SD (n ¼ 3). * indicated significant differences at p < 0.05 between the treatment groups and the control group. ** indicated significant differences at p < 0.01 between the treatment groups and the control group.

5

Q. Hu et al. / Chemosphere 241 (2020) 125037 Fig. 3. Activity of (A) iodothyronine deiodinase type I (ID1), (B) iodothyronine deiodinase type II (ID2) and (C) iodothyronine deiodinase type III (ID3) in juvenile zebrafish upon the exposure of MC-LR. The values were expressed as mean ± SD (n ¼ 3). * indicated significant differences at p < 0.05 between the treatment groups and the control group. ** indicated significant differences at p < 0.01 between the treatment groups and the control group.

6

4. Discussion Significant effects on THs levels in juvenile zebrafish were observed after acute exposure to MC-LR. The levels of T4 and T3 were significantly reduced and significant interference of crh, tsh, tpo, ttr, tr-a, and tr-b genes were also observed by MC-LR exposure. In addition, activities of the three IDs were significantly altered after the exposure to MC-LR. In conclusion, these results indicated that MC-LR interfered with various processes of TH synthesis, transport and metabolism, and resulted in the changes in TH levels. It has been well studied that zebrafish THs level can be influenced by MC-LR. In a previous study, adult zebrafish exposed to environmentally relevant concentrations of MC-LR for 45 d showed reduced T4 but not T3 levels in females, while the T4 and T3 levels were unchanged in males (Cheng et al., 2017). While, another study showed unchanged of T4 levels in adult zebrafish (Liu et al., 2016). Subacute environmentally relevant concentrations of MC-LR exposure significantly increased the whole body content of T4 but decreased whole body T3 content in juvenile zebrafish (Liu et al., 2015b). However, some previous studies demonstrated that exposure to higher concentrations of 500 mg/L (Yan et al., 2012) and 3000 mg/L (Xie et al., 2015) of MCs significantly both reduced T4 and T3 levels in zebrafish larvae. Similarly, juvenile Chinese rare minnows (Gobiocypris rarus) exposed to 500 mg/L MC-LR also showed significant decreases in whole body T4 and T3 contents (Liu et al., 2015a). In the present study, acute MC-LR exposure caused a significant decrease in the levels of T4 and T3 in juvenile zebrafish. These results showed that MC-LR had different effects on fish TH secretion varying with development stages and exposure concentrations. Our results also together with previous studies showed that high concentration of MC-LR could lead to significant reduce of THs levels in juvenile fish. T4 is exclusively synthesized by the thyroid in fish, and its synthesis and secretion are regulated by Tsh, which is secreted by the pituitary. In non-mammalians, Crh appears to be a potent stimulator of hypophyseal Tsh secretion, and may be a common regulator of the thyroid axis (Groef et al., 2006). As the key regulators of the thyroid axis, the modulation of Crh and Tsh transcription are crucial to T4 levels. Therefore, the transcription of crh and tsh are generally used as indicators of disruption effects on thyroid function upon the exposure to environmental pollutants (Yu et al., 2010). In previous studies, MCs have also been reported to alter gene transcription of crh and tsh (Yan et al., 2012; Liu et al., 2015b, 2016; Xie et al., 2015; Chen et al., 2018). In juvenile zebrafish, subacute exposure to environmentally relevant concentrations of MC-LR resulted in significantly increasing of crh and tsh (Liu et al., 2015b). In adult zebrafish, significantly decreasing of crh transcription was observed upon the subacute exposure to MC-LR, while tsh transcription appeared to be a dynamic process as the transcription firstly decreased and then increased with continued exposure (Liu et al., 2016). Moreover, the mRNA level of crh was depressed significantly in male adult zebrafish, while tshb was markedly down-regulated in female adult zebrafish when exposed to MC-LR for 45 d (Cheng et al., 2017). In the present study, the transcription of crh and tsh both showed initially decreased and then increased with prolonged exposure time. These differences in responses might be due to variants of concentrations, different developmental stages of zebrafish, and/or durations of exposure. However, the changes in crh and tsh mRNA levels could be attributed to negative feedback from the hypothalamus and pituitary due to alternations levels of T3 and T4 contents (Yoshiura et al., 1999; Zhang et al., 2013). Previous studies reported that a significant reduction in T4 was accompanied by a significant increase in the transcription of crh and tsh after

Q. Hu et al. / Chemosphere 241 (2020) 125037

exposure to decabromodiphenyl ether (BDE-209, DE-71), MC-LR, hexaconazole and tebuconazole in zebrafish (Yu et al., 2010, 2013; Chen et al., 2012; Yan et al., 2012). Therefore, our study revealed that significantly reduced T4 initiated a negative feedback regulation mechanism, which stimulated the transcription of crh and tsh, and then increased the synthesis and secretion of T4 through various pathways to maintain the stability of T4 content. Tpo is an important enzyme located at the apical membrane, which catalyzes the oxidation of iodide to an iodinating species and forms iodotyosines and iodothyronines (Dunn and Dunn, 2001). The transcription of Tpo was found to be stimulated by BDE-47 both in Manila clam (Ruditapes philippinarum) (Song et al., 2016) and zebrafish larvae (Chan and Chan, 2012). Furthermore, the upregulation of tpo transcription after exposure to environmentally relevant concentrations of MC-LR could be a possible mechanism for the increased levels of T4 in juvenile zebrafish (Liu et al., 2015b). In contrast, the transcription of tpo significantly decreased after 24 h MC-LR exposure in this study. With longer exposure time, the transcription of tpo in the low concentration group increased after 96 h. However, the tpo still showed a decrease trend in the high concentration group. Tpo plays a very important role in the synthesis of THs and decreased Tpo may affect the synthesis of T4 (Dunn and Dunn, 2001). It was demonstrated that the MC-LRinduced tpo transcription reduction was also an important reason for the decrease in T4. The transcription of tpo can be up-regulated by tsh, and the increase in tpo could be a possible reason for the increased levels of T4 (Naderi et al., 2014). Thus, in the low concentration exposed group (50 mg/L), up-regulation of the tsh led to a significant increase in tpo, which in turn led to a gradual increase in T4 levels and recovery to the control level. However, a strong interference effect was observed following exposure to high concentrations of MC-LR, which led to significant reduction of tpo in the high concentration group after 72 h exposure. Although the fish will also produce a corresponding feedback regulation mechanism, it is generally difficult to restore to a normal physiological state. As the major transporter of TH in fish, Ttr plays a key role in balancing the peripheral THs content and regulating the supply of THs in various tissues (Power et al., 2000). Previous studies discovered that the decreases in TTR were coincident with the reduction in THs (Yu et al., 2010, 2013; He et al., 2012). Subacute MC-LR exposure significantly increased the ttr levels in juvenile zebrafish, which was coincident with the elevation in T4, but the reduction in T3 (Liu et al., 2015b). In the liver of female zebrafish, the transcription of ttr showed a notable up-regulation in a dosedependent manner, while obvious reduce in that of males for 45 d exposure to MC-LR (Cheng et al., 2017). Moreover, the dynamic ttr transcription in adult zebrafish suggested a feedback regulation following the exposure of MC-LR (Liu et al., 2016). In the present study, a significant decrease in ttr was induced by acute MC-LR exposure, which may result in a decrease in Ttr bounding to free TH. It led to an increase in free TH in vivo and the rate of TH clearance, and then caused a decrease in TH level. After 72 h exposure, the transcription of ttr increased significantly, but a significant decrease was observed after 96 h. It was demonstrated that the transient increase in ttr may be the body's regulatory response to the reduction in TH. However, exposure to high concentrations of MC-LR caused a severe imbalance in the fish, which in turn led to a significant reduction in ttr. TH is secreted by the thyroid gland and most of its biological effects are mediated by TH receptors (TRs), which then exert a series of physiological actions (Marchand et al., 2001; Yen et al., 2006; Liu and Chan, 2010). TRs are members of a large superfamily of nuclear receptors which act as ligand-dependent transcription factors, including TR-a and TR-b (Yang et al., 2007). In a previous study, the transcription of tr-a and tr-b in juvenile zebrafish was

7

significantly reduced after MC-LR exposure, which was consistent with the influence of MC-LR on tr-a and tr-b transcription (Yan et al., 2012). The abnormal transcription of trs in adult zebrafish caused by MC-LR may lead to disruption of the thyroid endocrine system (Liu et al., 2016). Moreover, the mRNA levels of tr-a were also significantly down-regulated in all the MC-LR exposure groups in juvenile Chinese rare minnows (Liu et al., 2015a). Similarly, significant reduction of trs was showed in this study. In addition, TRs can activate or repress downstream gene transcription depending on the combination of THs and TRs (Wu and Koenig, 2000), which may in turn affect the level of THs. Therefore, the decrease in tr-a and tr-b caused by MC-LR exposure may be an important cause of the decreased THs. In addition to the significant decrease in T4, MC-LR exposure also caused a significant decrease in T3. In fish, T3 is catalyzed by the ID in peripheral enzymatic monodeiodination of T4 (Geyten et al., 1998). Therefore, the decline of T3 in plasma was mostly induced by a drop in thyroidal T4 production and secretion, and/or changes in peripheral TH metabolism (Li et al., 2009). In fish, outer ring deiodination from T4 to T3 is catalyzed by ID1 and ID2, while ID3 converts T4 and T3 to biologically inactive rT3 and T2, respectively (Orozco et al., 2000). In larval zebrafish, the dio1 mRNA transcription significantly increased, while dio2 decreased after exposed to MC-LR (Yan et al., 2012). In contrast, a significant decrease in ID1 and ID2 activities were observed in the high concentration of MCLR exposure group in juvenile Chinese rare minnows (Liu et al., 2015a). The activities of ID1 and ID2 decreased at 24 h and 48 h after MC-LR exposure in our study. As ID1 and ID2 are responsible for converting T4 to T3, the reduction in the activity of these IDs could affect the conversion of T4 to T3, which caused a reduction in T3 (Liu et al., 2015b). Similarly, the decrease in ID2 activity may be an important factor in the decline of T3 levels in adult zebrafish (Liu et al., 2016). Moreover, it was shown that the activities of ID1 and ID2 were only significantly reduced at 200 mg/L or 400 mg/L MC-LR after 24 h exposure, while T3 was significantly decreased in all exposed groups. Although the reduction in T3 can be induced by decreased ID1 and ID2 activity, the reduction in T3 in juvenile zebrafish may have been mainly due to the decrease in T4 in this study. However, the activities of ID1 and ID2 began to increase significantly from 72 h. In order to restore the level of T3, the conversion of T4 to T3 was elevated by increasing the activity of the outer ring deiodinase. After that, the level of T3 recovered to the control level in the 400 mg/L group at 96 h. Due to the increase in T3 at 400 mg/L MC-LR, feedback regulation was no longer stimulated, and the activity of ID2 returned to the control level in 400 mg/L group at 96 h. It was also demonstrated that ID2, with higher enzymatic efficiency than ID1, played a more important role in the changes of T3 content in vivo. In addition, our results showed that the activity of ID3 decreased significantly after 48 h. ID3 activity in the liver of both male and female zebrafish significantly decreased following MC-LR treatment (Liu et al., 2016). These results illustrated that the negative feedback regulation mechanism was initiated by the reduction in T3 in vivo, which caused the decrease in ID3 and the increase in ID2, may serve as a compensatory mechanism to maintain T3 homeostasis (Li et al., 2011; Liu et al., 2016). The reduction in TH levels was blocked by decreased degradation of TH. In summary, THs syntheses were affected in juvenile zebrafish following the acute exposure to MC-LR. Moreover, the decrease of outer ring deiodinase activity and T4 contents in vivo caused by MCLR seems to play an important role in the decrease of T3 at the early exposure stage. Similarly, MC-LR exposure affected the transcription of a series of downstream genes involved in TH synthesis and metabolism, which then also affected T3 levels. In addition, this study showed that a negative feedback regulatory response was stimulated because of the significant reductions in T4 and T3 after

8

Q. Hu et al. / Chemosphere 241 (2020) 125037

continual exposure, which resulted in a significant increase in TH synthesis-associated genes and outer ring deiodinase activities. Hence, the increased activities of outer ring deiodinases, especially ID2, led to increase the conversion of T4 to T3, which resulted in the increase of T3 in the 400 mg/L exposed group after 96 h exposure. These results indicated that fish can trigger a compensatory mechanism to maintain TH homeostasis after continual acute exposure to MC-LR. Declaration of competing interest No conflict of interest exits in the submission of this manuscript. All authors of this paper have read and approved the final version submitted. The contents of this manuscript were original research that has not been published previously, and not under consideration for publication elsewhere. Acknowledgement This work was supported by the Earmarked Fund for China Agriculture Research System (CARS-45), National Natural Science Foundation of China (project number: 31670521), the Fundamental Research Funds for the Central Universities (2662015PY119), and National Natural Science Foundation of China (project number: 31602141). References Chan, W.K., Chan, K.M., 2012. Disruption of the hypothalamic-pituitary-thyroid axis in zebrafish embryoelarvae following waterborne exposure to BDE-47, TBBPA and BPA. Aquat. Toxicol. 108, 106e111. Chen, L., Wang, Y., Giesy, J.P., Chen, F., Shi, T., Chen, J., Xie, P., 2018. Microcystin-LR affects the hypothalamic-pituitary-inter-renal (HPI) axis in early life stages (embryos and larvae) of zebrafish. Environ. Pollut. 241, 540e548. Chen, Q., Yu, L., Yang, L., Zhou, B., 2012. Bioconcentration and metabolism of decabromodiphenyl ether (BDE-209) result in thyroid endocrine disruption in zebrafish larvae. Aquat. Toxicol. 110, 141e148. Cheng, H., Yan, W., Wu, Q., Liu, C., Gong, X., Hung, T.C., Li, G., 2017. Parental exposure to microcystin-LR induced thyroid endocrine disruption in zebrafish offspring, a transgenerational toxicity. Environ. Pollut. 230, 981e988. Dietrich, D., Hoeger, S., 2005. Guidance values for microcystins in water and cyanobacterial supplement products (blue-green algal supplements): a reasonable or misguided approach? Toxicol. Appl. Pharmacol. 203, 273e289. Dunn, J.T., Dunn, A.D., 2001. Update on intrathyroidal iodine metabolism. Thyroid 11, 407e414. Geyten, S.V.D., Mol, K.A., Pluymers, W., Kühn, E.R., Darras, V.M., Darras, V.M., 1998. Changes in plasma T3 during fasting/refeeding in tilapia (Oreochromis niloticus) are mainly regulated through changes in hepatic type II iodothyronine deiodinase. Fish Physiol. Biochem. 19, 135e143. Groef, B.D., Geyten, S.V.D., Darras, V.M., Kühn, E.R., 2006. Role of corticotropinreleasing hormone as a thyrotropin-releasing factor in non-mammalian vertebrates. Gen. Comp. Endocrinol. 146, 62e68. He, C., Zuo, Z., Shi, X., Sun, L., Wang, C., 2012. Pyrene exposure influences the thyroid development of Sebastiscus marmoratus embryos. Aquat. Toxicol. 124e125, 28e33. Heijlen, M., Houbrechts, A.M., Bagci, E., Van Herck, S.L.J., Kersseboom, S., Esguerra, C.V., Blust, R., Visser, T.J., Knapen, D., Darras, V.M., 2014. Knockdown of type 3 iodothyronine deiodinase severely perturbs both embryonic and early larval development in zebrafish. Endocrinology 155, 1547e1559. , M.R., 1996. A method for the Hotz, C.S., Belonje, B., Fitzpatrick, D.W., L'Abbe determination of type I iodothyronine deiodinase activity in liver and kidney 125 using I-labelled reverse triiodothyronine as a substrate. Clin. Biochem. 29, 451e456. Jiang, J., Gu, X., Song, R., Zhang, Q., Geng, J., Wang, X., Yang, L., 2011. Time-dependent oxidative stress and histopathological changes in Cyprinus carpio L. exposed to microcystin-LR. Ecotoxicology 20, 1000e1009. Johnson, K.M., Lema, S.C., 2011. Tissue-specific thyroid hormone regulation of gene transcripts encoding iodothyronine deiodinases and thyroid hormone receptors in striped parrotfish (Scarus iseri). Gen. Comp. Endocrinol. 172, 505e517. Li, D., Xie, P., Zhang, X., Li, D., Xie, P., Zhang, X., 2009. Changes in plasma thyroid hormones and cortisol levels in crucian carp (Carassius auratus) exposed to the extracted microcystins. Chemosphere 74, 13e18. Li, W., Zha, J., Yang, L., Li, Z., Wang, Z., 2011. Regulation of thyroid hormone related genes mRNA expression by exogenous T3 in larvae and adult Chinese rare minnow (Gobiocypris rarus). Environ. Toxicol. Pharmacol. 31, 189e197. Liu, Y., Wang, J., Fang, X., Zhang, H., Dai, J., 2011. The thyroid-disrupting effects of

long-term perfluorononanoate exposure on zebrafish (Danio rerio). Ecotoxicology 20, 47e55. Liu, Y.W., Chan, W.K., 2010. Thyroid hormones are important for embryonic to larval transitory phase in zebrafish. Differentiation 70, 36e45. Liu, Z., Li, D., Wang, Y., Guo, W., Gao, Y., Tang, R., 2015a. Waterborne exposure to microcystin-LR causes thyroid hormone metabolism disturbances in juvenile Chinese rare minnow (Gobiocypris rarus). Environ. Toxicol. Chem. 34, 2033e2040. Liu, Z., Tang, R., Li, D., Hu, Q., Wang, Y., 2015b. Subacute microcystin-LR exposure alters the metabolism of thyroid hormones in juvenile zebrafish (Danio Rerio). Toxins (Basel) 7, 337e352. Liu, Z., Tang, R., Yin, X., Tong, N., Li, D., 2015c. Microcystin-LR alters the gene transcription and activities of iodothyronine deiodinases in the hepatic cells of grass carp (Ctenopharyngodon Idella). J. Biochem. Mol. Toxicol. 29, 305e310. Liu, Z., Li, D., Hu, Q., Tang, R., Li, L., 2016. Effects of exposure to microcystin-LR at environmentally relevant concentrations on the metabolism of thyroid hormones in adult zebrafish (Danio rerio). Toxicon 124, 15e25. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DD Ct method. Methods 25, 402e408. Malbrouck, C., Kestemont, P., 2006. Effects of microcystins on fish. Environ. Toxicol. Chem. 25, 72e86. Marchand, O., Safi, R., Escriva, H., Van Rompaey, E., Prunet, P., Laudet, V., 2001. Molecular cloning and characterization of thyroid hormone receptors in teleost fish. J. Mol. Endocrinol. 26, 51e65. Naderi, M., Mousavi, S.M., Safahieh, A., Ghatrami, E.R., Zargham, D., 2014. Effects of 4-nonylphenol on balance of steroid and thyroid hormones in sexually immature male yellowfin seabream (Acanthopagrus latus). Environ. Toxicol. 29, 459e465. Orozco, A., Linser, P., Valverde, C., 2000. Kinetic characterization of outer-ring deiodinase activity (ORD) in the liver, gill and retina of the killifish Fundulus heteroclitus. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 126, 283e290. Orozco, A., Valverde, R.C., 2005. Thyroid hormone deiodination in fish. Thyroid 15, 799e813. Picard-Aitken, M., Fournier, H., Pariseau, R., Marcogliese, D.J., Cyr, D.G., 2007. Thyroid disruption in walleye (Sander vitreus) exposed to environmental contaminants: cloning and use of iodothyronine deiodinases as molecular biomarkers. Aquat. Toxicol. 83, 200e211. Power, D.M., Elias, N.P., Richardson, S.J., Mendes, J., Soares, C.M., Santos, C.R., 2000. Evolution of the thyroid hormone-binding protein, transthyretin. Gen. Comp. Endocrinol. 119, 241e255. Rogers, E.D., Henry, T.B., Twiner, M.J., Gouffon, J.S., McPherson, J.T., Boyer, G.L., Sayler, G.S., Wilhelm, S.W., 2011. Global gene expression profiling in larval zebrafish exposed to microcystin-LR and microcystis reveals endocrine disrupting effects of Cyanobacteria. Environ. Sci. Technol. 45, 1962e1969. Scholz, S., Mayer, I., 2008. Molecular biomarkers of endocrine disruption in small model fish. Mol. Cell. Endocrinol. 293, 57e70. Song, Y., Miao, J., Pan, L., Wang, X., 2016. Exposure to2,20 ,4,40 -tetrabromodiphenyl ether (BDE-47) alters thyroid hormone levels and thyroid hormone-regulated gene transcription in manila clam Ruditapes philippinarum. Chemosphere 152, 10e16. Wu, Y., Koenig, R.J., 2000. Gene regulation by thyroid hormone. Trends Endocrinol. Metab. 11, 207e211. Xie, L., Yan, W., Li, J., Yu, L., Wang, J., Li, G., Chen, N., Steinman, A.D., 2015. Microcystin-RR exposure results in growth impairment by disrupting thyroid endocrine in zebrafish larvae. Aquat. Toxicol. 164, 16e22. Yan, W., Zhou, Y., Yang, J., Li, S., Hu, D., Wang, J., Chen, J., Li, G., 2012. Waterborne exposure to microcystin-LR alters thyroid hormone levels and gene transcription in the hypothalamic-pituitary-thyroid axis in zebrafish larvae. Chemosphere 87, 1301e1307. Yang, X., Xie, J., Wu, T., Yue, G., Chen, J., Zhao, R., 2007. Hepatic and muscle expression of thyroid hormone receptors in association with body and muscle growth in large yellow croaker, Pseudosciaena crocea (Richardson). Gen. Comp. Endocrinol. 151, 163e171. Yen, P.M., Ando, S., Feng, X., Liu, Y., Maruvada, P., Xia, X.M., 2006. Thyroid hormone action at the cellular, genomic and target gene levels. Mol. Cell. Endocrinol. 246, 121e127. Yen, P.M., Chin, W.W., 1994. Molecular mechanisms of dominant negative activity by nuclear hormone receptors. Mol. Endocrinol. 8, 1450e1454. Yoshiura, Y., Sohn, Y.C., Munakata, A., Kobayashi, M., Aida, K., 1999. Molecular cloning of the cDNA encoding the b subunit of thyrotropin and regulation of its gene expression by thyroid hormones in the goldfish, Carassius auratus. Fish Physiol. Biochem. 21, 201e210. Yu, L., Chen, M., Liu, Y., Gui, W., Zhu, G., 2013. Thyroid endocrine disruption in zebrafish larvae following exposure to hexaconazole and tebuconazole. Aquat. Toxicol. 138e139, 35e42. Yu, L., Deng, J., Shi, X., Liu, C., Yu, K., Zhou, B., 2010. Exposure to DE-71 alters thyroid hormone levels and gene transcription in the hypothalamic-pituitary-thyroid axis of zebrafish larvae. Aquat. Toxicol. 97, 226e233. Zhang, X., Xie, P., Wang, W., Li, D., Li, L., Tang, R., Lei, H., Shi, Z., 2008. Dosedependent effects of extracted microcystins on embryonic development, larval growth and histopathological changes of southern catfish (Silurus meridionalis). Toxicon 51, 449e456. Zhang, X.N., Tian, H., Wang, W., Ru, S.G., 2013. Exposure to monocrotophos pesticide causes disruption of the hypothalamic-pituitary-thyroid axis in adult male goldfish (Carassius auratus). Gen. Comp. Endocrinol. 193, 158e166.