- Email: [email protected]
antioxidant enzymes via Nrf2 signaling
International Journal of Biological Macromolecules 74 (2015) 150–154
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac
Wheat bran feruloyl oligosaccharides modulate the phase II detoxifying/antioxidant enzymes via Nrf2 signaling Huijuan Zhang, Jing Wang ∗ , Yingli Liu, Baoguo Sun Beijing Higher Institution Engineering Research Center of Food Additives and Ingredients, Beijing Laboratory for Food Quality and Safety, Beijing Key Laboratory of Flavor Chemistry, Beijing Technology & Business University (BTBU), Beijing 100048, China
a r t i c l e
i n f o
Article history: Received 2 September 2014 Received in revised form 15 November 2014 Accepted 3 December 2014 Available online 24 December 2014 Keywords: Feruloyl oligosaccharides (FOs) Phase II detoxifying/antioxidant enzymes Nrf2
a b s t r a c t The antioxidant activities of wheat bran feruloyl oligosaccharides (FOs) were determined in rats by determining the activities and mRNA expression levels of phase II detoxifying/antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH-Px), and heme oxygenase-1 (HO-1) in rat organs. FOs was given by gavage at doses of 0.25, 0.5, and 0.75 mmol/kg body weight every day for 15 days. Compared with the control group, the activities of SOD, CAT, and GSH-Px in FOs treatment groups significantly (P < 0.05) increased in heart, liver, and kidney. All the FOs treatment also significantly (P < 0.05) increased the glutathione (GSH) contents in heart (28–58%), liver (32–71%), and kidney (31–73%) compared with the control. FOs up regulated the mRNA expression levels of SOD, CAT, and HO-1 in organs. Moreover, the immunoblot analysis revealed increased nuclear factor-E2-related factor (Nrf2) protein expression levels in organs and there were positive correlations between the mRNA expression of phase II detoxifying/antioxidant enzymes and the expressions of Nrf2 protein, which demonstrated FOs treatment could modulate the detoxifying/antioxidant enzymes via Nrf2 signaling. © 2014 Published by Elsevier B.V.
1. Introduction Oxidative stress plays important roles in development of chronic and degenerative conditions such as cancers, cardiovascular diseases, hypertension, neurodegenerative disorders, and arthritis [1]. Ferulic acid, the most abundant member among hydroxycinnamic acids, and its derivatives such as ferulic acid ethyl ester, ferulic acid dehydrodimers, feruloyl glycosides, and curcumin have been revealed potent antioxidant activities in both in vitro and in vivo systems. Ferulic acid could in vitro scavenge free radical against hydroxyl radical, peroxynitrite, and oxidation of low density lipoprotein (LDL) [2–4]. Ferulic acid has been demonstrated to decrease the lipid peroxide after ischaemia–reperfusion (IR) by preventing the elevation of vascular permeability following IR injury in the intestine [5,6]. Balasubashini et al. [7] also reported that ferulic acid could decrease the levels of thiobarbituric acid reactive substances (TBARS), hydroperoxides, and free fatty acids in liver of diabetic rats along with an increase in glutathione (GSH) and
∗ Corresponding author at: School of Food Science and Chemical Engineering, Beijing Technology and Business University, No. 11 Fucheng Road, Haidian District, Beijing 100048, China. Tel.: +86 010 68985378; fax: +86 010 68985378. E-mail address: [email protected] (J. Wang). http://dx.doi.org/10.1016/j.ijbiomac.2014.12.011 0141-8130/© 2014 Published by Elsevier B.V.
antioxidant enzymes content particularly glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), and catalase (CAT). However, ferulic acid, as the most abundant phenolic compound in wheat bran, has extremely low bioaccessibiltiy due to the binding of ferulic acid to cell wall polysaccharides [8]. Feruloyl oligosaccharides (FOs), the ferulic acid ester of oligosaccharides, are produced either by microorganisms in the colon or from cereal bran fermentation [9]. FOs obtained from wheat bran has been demonstrated to effectively protect normal rat erythrocytes against in vitro oxidative damage [10], stimulate the in vitro growth of Bifidobacterium bifidum [11], and increase activities of SOD and GSH-Px in the serum of diabetic rats [9]. Although FOs from wheat bran has been reported to have antioxidant activities in both in vitro and in vivo systems, the mechanisms underlying the antioxidant effects of dietary phytochemicals have only recently begun to be understood. The involvement of specific cellular signaling pathways in the biological actions of phytochemicals is becoming increasingly obvious [12]. As a DNA-binding protein recognizing the antioxidant response element (ARE), nuclear factor-E2-related factor (Nrf2) regulates the expression of several phase II enzyme genes and antioxidants in response to noxious stimuli [12,13]. Therefore, the Nrf2/ARE pathway is one of the most important defensive signaling pathways in animals.
H. Zhang et al. / International Journal of Biological Macromolecules 74 (2015) 150–154
The aim of the present study was to determine effects of wheat bran FOs on the activities and mRNA expression levels of phase II detoxifying/antioxidant enzymes (SOD, CAT, GSH-Px, and HO-1) in rat organs. Moreover, the effect of wheat bran FOs on the Nrf2/ARE pathway was examined. 2. Materials and methods 2.1. Materials Wheat bran FOs were prepared from wheat bran insoluble dietary fiber by Bacillus subtilis xylanase treatments according to the previous study [10]. Sodium ferulate (SF) was purchased from a local medicine store. 2.2. Animals and treatment Male Sprague-Dawley rats (200 ± 10 g; obtained from Beijing Vitalriver Laboratory Animal Co., Ltd., Beijing, China) were used for the experiments. The animals were housed individually in wirebottom cages in a room maintained at 20–22 ◦ C and 60% relative humidity with a 12 h alternating light–dark cycle. Rats were acclimatized for 1 week and fed a ground commercial chow (Beijing Macao Cooperation Feed Co., Ltd., Beijing, China). After acclimation, the rats were randomly divided into seven groups. The control group was fed the standard chow diet and orally administered of distilled water (1.0 g/kg body weight) daily. The other six groups were orally administered with FOs and SF at a dosage of 0.25, 0.5, and 0.75 mmol/kg body weight. Animal care protocols are approved by Beijing University of Chinese Medicine. 2.3. Cytosol preparation Immediately after being removed from each animal, the heart, liver, and kidney were rinsed extensively in cold phosphatebuffered saline (PBS). The tissues were then cut into small pieces using scissors, rinsed twice with cold PBS, and followed by homogenization in ice-cold 50 mmol/L phosphate buffer containing 2 mmol/L ethylene diamine tetraacetie acid (EDTA) on ice. The homogenates were centrifuged at 100,000 × g for 10 min at 4 ◦ C. Cytosol aliquots were collected and preserved at −80 ◦ C for enzymatic assay and Western blotting [14]. 2.4. Antioxidant enzymes assays Total SOD, CAT, and GSH-Px activities were determined using commercially available enzyme assay kits (Nanjing Jiancheng Biocompany, Nanjing, China), and expressed as U/mg sample protein. The cytosolic protein content was quantified by a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) with bovine serum albumin (BSA) as the standard. 2.5. Reduced GSH analysis GSH contents in heart, liver, and kidney were measured using commercially available enzyme assay kits (Nanjing Jiancheng Biocompany, Nanjing, China).
151
Table 1 Primer sequences. Gene
Product size (bp)
Primer
5 primer sequences 3
GAPDH
137
SOD
152
CAT
198
HO-1
190
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
AAGTTCAACGGCACAGTCAAG CCAGTAGACTCCACGACATACTCA GATGAAGAGAGGCATGTTGGA AAGTCATCTTGTTTCTCGTGGA AGGTGCGGACATTCTATACGA CATTCTTAGGCTTCTGGGAGTT CTTCCCGAGCATCGACAAC TGAGGGACTCTGGTCTTTGTGT
diluted cDNA (1:10) was used in each real time-PCR with SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) and appropriate primers. An ABI7500 FAST instrument (Applied Biosystems, Foster City, CA, USA) was used to perform the PCR. The cycle conditions were as follows: 2 min at 95 ◦ C followed by 40 cycles of incubation at 95 ◦ C for 10 s, then 60 ◦ C for 40 s, and 72 ◦ C for 30 s. PCR reactions were followed by dissociation curve analysis [15]. The results were analyzed using the software provided with the Mx3000P QPCR system. Differences in mRNA expression were calculated using the CT method [16]. The sequences of the primers are shown in Table 1. 2.7. Western blotting The cytosolic fraction (supernatant) proteins from heart, liver, and kidney were measured using a Bio-Rad protein assay (BioRad, Hercules, CA, USA) with BSA as the standard. Electrophoresis was carried out using SDS-PAGE. After electrophoresis, proteins on the gel were electrotransferred onto an immobile membrane (PVDF; Millipore) with transfer buffer composed of 25 mmol/L Tris–HCl (pH 8.9), 192 mmol/L glycine, and 20% methanol. The membrane was then washed with Tris-buffered saline (10 mmol/L Tris, 150 mmol/L NaCl) containing 0.05% Tween 20 (TBST) and blocked in TBST containing 5% nonfat dried milk. The membrane was further incubated overnight at 48 ◦ C with specific antibodies such as Nrf2 (1:200) and -actin (1:500). After hybridization with primary antibodies, the membrane was washed three times with TBST, incubated with horseradish peroxidase-labeled secondary antibody for 45 min at room temperature, and then washed three times with TBST. Final detection was performed with enhanced chemiluminescence Western blotting reagents (GE Healthcare BioSciences, Pittsburgh, PA, USA) [13]. 2.8. Statistical analysis All data were expressed as means ± SE. Differences among groups were determined by one-way ANOVA analysis of variance using the Minitab 15 statistical program (Minitab Inc., State College, PA, USA). Pearson correlation coefficients were calculated for investigating relationships of lipid metabolism with the expression of hepatic genes and determined by the SPSS16.0 statistical program (IBM Inc., New York, NY, USA). Significance was defined at the 95% confidence level. 3. Results and discussion
2.6. Real-time PCR Total RNA from hearts, livers, and kidneys was extracted using TRIzol plus RNA purification kit (Invitrogen, Life Technologies, Carlsbad, CA, USA), quantified spectrophotometrically, checked for quality by gel electrophoresis, and used to synthesize cDNA using the GeneAmp RNA PCR kit (Applied Biosystems, FOster City, CA, USA) per the manufacturer’s protocol. Approximately 1 L of
Our previous study has demonstrated that covalently FOs significantly increased the levels of SOD, CAT and GSH-Px (56.7%, 24.4%, and 23.0%, respectively) in rat plasma [8]. In order to further demonstrate the antioxidant activities of FOs, phase II detoxifying/antioxidant enzymes (SOD, CAT, and GSH-Px) activities, GSH contents, mRNA levels of antioxidant enzymes, and expressions of Nrf2 protein in rat organs were analyzed in this study.
152
H. Zhang et al. / International Journal of Biological Macromolecules 74 (2015) 150–154
Table 2 Effects of wheat bran feruloyl oligosaccharides (FOs) and sodium ferulate (SF) on body weight and tissue weight of rats. Amount (mg/kg day) Control
Body weight (g)
Heart weight (g)
Liver weight (g)
Kidney (g)
314.6 ± 9.0
1.0 ± 0.1
14.0 ± 0.7
2.3 ± 0.2
SF
0.25 0.5 0.75
314.9 ± 18.6 305.5 ± 20.1 310.4 ± 9.4
1.0 ± 0.1 1.0 ± 0.1 1.0 ± 0.1
13.5 ± 1.0 13.0 ± 0.9 13.5 ± 0.6
2.3 ± 0.1 2.2 ± 0.2 2.3 ± 0.1
FOs
0.25 0.5 0.75
322.1 ± 14.9 321.7 ± 14.5 309.5 ± 17.3
1.1 ± 0.1 1.0 ± 0.0 1.0 ± 0.1
14.1 ± 1.0 14.1 ± 0.9 12.8* ± 1.3
2.3 ± 0.1 2.3 ± 0.2 2.3 ± 0.2
Data presented as means ± SE. * Indicates significant difference at P < 0.05.
3.1. Effects of FOs and SF on body and organ weights
(r = 0.916, P < 0.01) and kidney (r = 0.783, P < 0.05) while there was also a positive correlation (r = 0.901, P < 0.01) of the CAT activity in liver and kidney. SOD converts superoxide radicals to molecular oxygen and H2 O2 , and CAT decomposes H2 O2 to molecular oxygen and water [17]. In this study, the SOD activity positively correlated with the CAT activity in heart (r = 0.871, P < 0.05), liver (r = 0.957, P < 0.01), and kidney (r = 0.84, P < 0.05), which demonstrated that FOs could increased the activities of SOD and CAT simultaneously. GSH-Px reduces lipid hydroperoxides to their corresponding alcohols, and free hydrogen peroxide to water. The GSH-Px activities in heart, liver, and kidney increased with the increasing doses of SF and FOs and significantly (P < 0.05) increased compared with the control group. The rats in FOsH diet group had highest GSH-Px activities of heart, liver, and kidney. The GSH-Px activity in heart positively correlated with that in liver (r = 0.958, P < 0.05) and kidney (r = 0.905, P < 0.01) while there was also a positive correlation (r = 0.884, P < 0.01) of the GSH-Px activity in liver and kidney. Ou et al. [18] reported that FOs increased the activities of SOD and GSHPx in liver and testes of diabetic rats compared with SF and vitamin C, which might be due to the inhibition of lipid peroxidation and the scavenging of free radicals to restore antioxidant enzymes.
Table 2 shows the body weight, heart weight, liver weight, and kidney weight of rats in each group. Compared with the control group, there were no significant (P > 0.05) differences of body weight, liver weight, and kidney weight among all the diet groups. However, the liver weight of rats in the high dose FOs (FOsH) diet group significantly (P < 0.05) decreased 8.6% compared with the control group. All rats remained in good health throughout the experimental period. 3.2. Levels of antioxidant enzymes in rat organs Oxidative stress has been implicated in the pathogenesis of atherosclerosis. During the course of evolution, the living organisms have developed a fine defense network system against oxidative stress, in which various enzymes, protein, and small molecules with different functions play an important protective role against oxidative stress in vivo [8]. SOD, CAT, and GSH-Px are the primary antioxidant enzymes minimizing the oxygen radical cascade and removing cytotoxic peroxides in amammalian systems. The antioxidant enzymes (SOD, CAT, and GSH-Px) activities in rat heart, liver, and kidney were analyzed (Table 3). The SOD activities in heart, liver, and kidney increased with the increasing doses of SF and FOs. All SF and FOs treatment significantly (P < 0.05) increased SOD activities compared with the control group. For liver and kidney, the rats in the FOsH diet group had the highest SOD activity while the highest SOD activity in heart was obtained in the high does SF (SFH) diet group. The SOD activity in heart positively correlated with that in liver (r = 0.83, P < 0.05) and kidney (r = 0.958, P < 0.01) while there was also a positive correlation (r = 0.896, P < 0.01) of the SOD activity in liver and kidney. Compared with the control group, the CAT activities in heart and liver significantly (P < 0.05) increased in treatment diet groups. The CAT activity in heart was positively correlated with that in liver
3.3. GSH content GSH, a major antioxidant that helps eliminate peroxides and other oxidants, reduces damage and promotes better survival under conditions of oxidative stress [19]. The GSH contents in heart, liver, and kidney increased with the increasing doses of SF and FOs (Table 4). The GSH contents in liver and kidney were highest in the FOsH diet group while the rats in the SFH diet group had the highest heart GSH content. The GSH content in heart positively correlated with that in liver (r = 0.930, P < 0.01) and kidney (r = 0.882, P < 0.01) while there was also a positive correlation (r = 0.953, P < 0.01) between the GSH content in liver and kidney. Lycopene has been reported to induce the hepatic GSH antioxidant system [20].
Table 3 Effects of wheat bran feruloyl oligosaccharides (FOs) and sodium ferulate (SF) on phase II detoxifying and antioxidant enzymes in heart, liver, and kidney. Control
SF 0.25
SF 0.5
SF 0.75
FOs 0.25
FOs 0.5
SOD (U/mg protein) 131c ± 19.3 Heart 293d ± 11.2 Liver 396e ± 18.8 Kidney
150bc ± 12 319c ± 28.6 432d ± 7.1
153bc ± 29.7 349b ± 6.9 471c ± 21.3
186a ± 35.9 362b ± 13.5 593a ± 36.1
157bc ± 27.6 325c ± 20.1 484c ± 27.6
CAT (U/mg protein) 631d ± 72.3 Heart 6217d ± 635.9 Liver 7291b ± 605 Kidney
807c ± 33.1 7251c ± 402.1 8684b ± 471
1065b ± 57.7 7655bc ± 838.8 10533a ± 1110.1
1213ab ± 234.6 8504ab ± 730.7 11149a ± 2511.3
1160ab ± 224 7452c ± 731.5 8223b ± 764.6
1233ab ± 179.6 8852a ± 1148.1 10776a ± 1018.1
1333bc ± 107.9 609bc ± 12.7 628dc ± 5.9
1434ab ± 208.6 621b ± 7.4 637c ± 18.0
1360b ± 118.1 595 ± 3.6 613d ± 9.8
1460ab ± 186.1 611b ± 6 703b ± 8.8
GSH-Px (U/mg protein) Heart 1106d ± 125.8 549e ± 7.2 Liver 554e ± 26.8 Kidney
1195dc ± 96.5 579d ± 10.4 611d ± 9.4
Data presented as means ± SE. Different letters indicate significant difference at P < 0.05.
171ab ± 9.5 393a ± 4.1 554b ± 20
FOs 0.75 173a ± 10.5 403a ± 15.7 594a ± 34.3 1328a ± 78.8 8701a ± 1312.6 10590a ± 1780.9 1545a ± 100 645.5a ± 30.2 736.8a ± 24.7
H. Zhang et al. / International Journal of Biological Macromolecules 74 (2015) 150–154 Table 4 Effects of wheat bran feruloyl oligosaccharides (FOs) and sodium ferulate (SF) on glutathione (GSH) contents in heart, liver, and kidney. GSH Content (mg/g protein) Heart
Liver
Control
Kidney
4.6 ± 0.7
d
2.2 ± 0.1
13.0 ± 0.7e
d
SF
0.25 0.5 0.75
5.1 ± 0.5c 7.3 ± 0.8ab 8.0 ± 0.9a
2.7 ± 0.1c 3.3 ± 0.2b 3.5 ± 0.2b
15.0 ± 1.3d 17.3 ± 1.1c 21.4 ± 1.3a
FOs
0.25 0.5 0.75
5.9 ± 0.5c 7.2 ± 0.5b 7.3 ± 0.3ab
2.9 ± 0.1c 3.4 ± 0.5b 3.8 ± 0.2a
17.0 ± 1.0c 18.6 ± 1.4b 22.5 ± 1.0a
6 Heart Relative SOD mRNA Expression
Amount (mg/kg day)
153
Data presented as means ± SE. Different letters indicate significant difference at P < 0.05.
Liver
Kidney
5 4 3 2 1 0 SFH
Control
3.4. Gene expression of antioxidant enzymes
3.5. Protein expression of Nrf2 An immunoblotting analysis was performed to further examine whether Nrf2 expression was modulated by FOs (Fig. 2). The total levels of Nrf2 protein expression in liver, kidney, and heart were modulated simultaneously by SFH and FOsH treatment. Compared with the SFH treatment group, the Nrf2 protein expression levels in heart, liver, and kidney increased 11%, 32%, and 61%, respectively, in the FOsH treatment group. As the phase II detoxifying/antioxidant enzymes, the mRNA expression levels of SOD, CAT, and HO-1 positively correlated with the Nrf2 protein expression levels in heart (r = 0.982, P = 0.06, r = 0.819, P = 0.195, and r = 0.986, P < 0.05), liver (r = 0.986, P < 0.05, r = 0.996, P < 0.05, and r = 0.946, P = 0.11), and kidney (r = 0.914, P = 0.133, r = 0.655, P = 0.273, and r = 0.989, P < 0.05). These observations suggested that an accumulation of Nrf2 protein might contribute to the induction of ARE-mediated antioxidant gene expression after the FOs treatment. Yeh et al. [13] have
(a) 20
Heart
Liver
Kidney
Realtive CAT mRNA Expression
18 16 14 12 10 8 6 4 2 0 Control
SFH Different Groups
FosH
(b) 3
Relative HO-1 mRNA Expreesion
The mRNA expression of antioxidant enzymes in liver modulated simultaneously by phenolic acids has been reported [13]. Therefore, the mRNA expression levels of SOD and CAT in heart, liver, and kidney were determined by real-time PCR (Fig. 1a and b). Real-time PCR was limited to comparison of the diets of SFH and FOsH to the control due to resource constraints. Compared with the control group, the mRNA level of SOD was 4.8-fold higher in heart, 1.3–2.3-fold higher in liver, and 1.8–2.8-fold higher in kidney. The expression levels of SOD in liver and kidney in the FOsH diet group were 1.8- and 1.5-fold higher relative to the SFH diet group. The activities of SOD in heart, liver, and kidney positively correlated with the mRNA expression levels of SOD in the organs, respectively (r = 0.978, P = 0.134, r = 0.898, P = 0.145, and r = 0.835, P = 0.186). Compared with the control group, the mRNA levels of CAT in heart, liver, and kidney were 5.9–19-fold, 2.8–5.1-fold, and 3.3–3.7fold higher, respectively. The expression levels of CAT in heart, liver, and kidney in the FOsH diet group were 3.2-, 1.8-, and 1.1-fold higher relative to the SFH diet group. The activities of CAT in heart, liver, and kidney positively correlated with the mRNA expression levels of CAT in the organs, respectively (r = 0.811, P = 0.199, r = 0.873, P = 0.162, and r = 0.96, P = 0.09). Heme oxygenase-1 (HO-1), a stress-responsive enzyme, is responsible for the breakdown of heme to biliverdin, free iron, and carbon monoxide to confer vascular protection against abnormal proliferation [21,22]. HO-1 is also another important phase II detoxifying/antioxidant enzyme. Compared with the control group, the mRNA level of HO-1 was 2.9-fold higher in heart, 1.0–1.9-fold higher in liver, and 1.1–1.4-fold higher in kidney (Fig. 1c). The expression levels of HO-1 in liver and kidney in the FOsH diet group were 1.9- and 1.3-fold higher relative to the SFH diet group.
FosH
Different Groups
Heart Liver Kidney
2.5 2 1.5 1 0.5 0 Control
SFH
FosH
Different Groups
(c) Fig. 1. The mRNA expression levels of phase II detoxifying/antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), and heme oxygenase-1 (HO-1) in male rats treated by high dose of sodium ferulate (SFH) and high dose of feruloyl oligosaccharides (FOsH) for 15 days. Each mRNA was normalized to ribosomal protein GAPDH and was expressed relative to the control level.
154
H. Zhang et al. / International Journal of Biological Macromolecules 74 (2015) 150–154
A Control
SFH
FosH
Control SFH
Liver
FosH
Control
Kidney
SFH
FosH
Heart
B
Nrf2 protein level (fold of control)
2.5
Heart
Liver
Kidney
2
1.5
1
0.5
0 Control
SFH
FosH
Different Groups Fig. 2. Expressions of nuclear factor-E2-related factor (Nrf2) protein in heart, liver, and kidney of male rats treated by high dose of sodium ferulate (SFH) and high dose of feruloyl oligosaccharides (FOsH) for 15 days. The upper part of the figure indicates an original blot (A); the lower part represents the results of densitometric analyses (B).
reported that phenolic acid mediated antioxidant enzyme genes by increasing the level of Nrf2 protein expression. One study reported that the major constituent of green tea, epigallocatechin-3-gallate (EGCG), up-regulated the HO-1 expression by activation of the Nrf2/ARE pathway in endothelial cell, conferring resistance against H2 O2 -induced cell death [23]. Curcumin could also induced the HO1 expression by activating the Nrf2/ARE pathway both in vitro [24] and in vivo [25]. The modulation of phase II detoxifying/antioxidant enzymes (SOD, CAT, GSH-Px, and HO-1), CSH contents, and Nrf2/ARE signaling of wheat bran FOs were investigated. The results showed that FOs increased the activities of SOD, CAT, and GSH-Px, mRNA expression levels of SOD, CAT, and HO-1, and the expressions of Nrf2 protein in rat heart, liver, and kidney. Moreover, there were positive correlations between the mRNA expression levels of ARE-mediated expression of phase II detoxifying/antioxidant enzymes and the expressions of Nrf2 protein, which demonstrated modulation of the Nrf2/ARE pathway may play a key role in antioxidant activities of FOs. Acknowledgements This work was supported by National Natural Science Foundation of China (No. 31271976), National “Twelfth Five-Year” Plan for Science & Technology (2012BAD34B05), and the Importation and Development of High-Caliber Talents Project of Beijing Municipal Institutions (Nos. CIT&TCD20130309 and IDHT20130506). References [1] F. Shahidi, A. Chandrasekara, Phytochem. Rev. 9 (2010) 147–170.
[2] J. Kanski, M. Aksenova, A. Stoyanova, D.A. Butterfield, J. Nutr. Biochem. 13 (2002) 273–281. [3] H. Kikuzaki, M. Hisamoto, K. Hirose, K. Akiyama, H. Taniguchi, J. Agric. Food Chem. 50 (2002) 2161–2168. [4] H. Yu, J. Hong, D. Wu, Effect of sodium ferulate on proliferation of rabbit aortic smooth muscle cells induced by oxidized LDL, Zhongguo Zhong Yao Za Zhi 24 (1999) 365–366. [5] S. Itagaki, T. Kurokawa, C. Nakata, Y. Saito, S. Oikawa, M. Kobayashi, T.I.I. Hirano, Food Chem. 114 (2009) 466–471. [6] Y. Sato, S. Itagaki, T. Kurokawa, J. Ogura, M. Kobayashi, T. Hirano, M. Sugawara, K. Iseki, Int. J. Pharm. 403 (2011) 136–138. [7] M.S. Balasubashini, R. Rukkumani, P. Viswanathan, V.P. Menon, Phytother. Res. 18 (2004) 310–314. [8] J. Wang, B.G. Sun, Y.P. Cao, C.T. Wang, Food Chem. 123 (2010) 472–476. [9] S. Ou, K.C. Kwok, J. Sci. Food Agric. 84 (2004) 1261–1269. [10] X.P. Yuan, J. Wang, H.Y. Yao, Food Chem. 90 (2005) 759–764. [11] J. Wang, B.G. Sun, Y.P. Cao, Y. Tian, Food Chem. 112 (2009) 350–353. [12] T.G. Son, S. Camandola, M.P. Mattson, Neuromol. Med. 10 (2008) 236–246. [13] C.T. Yeh, G.C. Yen, J. Nutr. 136 (2006) 11–15. [14] C.T. Yeh, G.C. Yen, J. Nutr. Biochem. 17 (2006) 561–569. [15] H. Zhang, G.E. Bartley, H. Zhang, W. Jing, C.K. Fagerquist, F. Zhong, W. Yokoyama, J. Agric. Food Chem. 61 (2013) 8389–8395. [16] K.J. Livak, T.D. Schmittgen, Methods (San Diego, Calif.) (2001) 402–408. [17] J. Fang, T. Seki, H. Maeda, Adv. Drug Deliv. Rev. 61 (2009) 290–302. [18] S.Y. Ou, G.M. Jackson, X. Jiao, J. Chen, J.Z. Wu, X.S. Huang, J. Agric. Food Chem. 55 (2007) 3191–3195. [19] D.A. Dickinson, D.R. Moellering, K.E. Iles, R.P. Patel, A.L. Levonen, A. Wigley, V.M. Darley-Usmar, H.J. Forman, Biol. Chem. 384 (2003) 527–537. [20] A. Hekimoglu, Z. Kurcer, F. Aral, F. Baba, E. Sahna, A. Atessahin, Lycopene, an antioxidant carotenoid, attenuates testicular injury caused by ischemia/reperfusion in rats, Tohoku J. Exp. Med. 218 (2009) 141–147. [21] W. Durante, J. Cell Physiol. 195 (2003) 373–382. [22] M.D. Maines, P.E.M. Gibbs, Biochem. Biophys. Res. Commun. 338 (2005) 568–577. [23] C.C. Wu, M.C. Hsu, C.W. Hsieh, J.B. Lin, P.H. Lai, B.S. Wung, Life Sci. 78 (2006) 2889–2897. [24] H.O. Pae, G.S. Jeong, S.O. Jeong, H.S. Kim, S.A. Kim, Y.C. Kim, S.J. Yoo, H.D. Kim, H.T. Chung, Exp. Mol. Med. 39 (2007) 267–277. [25] E.O. Farombi, S. Shrotriya, H.K. Na, S.H. Kim, Y.J. Surh, Food Chem. Toxicol. 46 (2008) 1279–1287.
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac
Wheat bran feruloyl oligosaccharides modulate the phase II detoxifying/antioxidant enzymes via Nrf2 signaling Huijuan Zhang, Jing Wang ∗ , Yingli Liu, Baoguo Sun Beijing Higher Institution Engineering Research Center of Food Additives and Ingredients, Beijing Laboratory for Food Quality and Safety, Beijing Key Laboratory of Flavor Chemistry, Beijing Technology & Business University (BTBU), Beijing 100048, China
a r t i c l e
i n f o
Article history: Received 2 September 2014 Received in revised form 15 November 2014 Accepted 3 December 2014 Available online 24 December 2014 Keywords: Feruloyl oligosaccharides (FOs) Phase II detoxifying/antioxidant enzymes Nrf2
a b s t r a c t The antioxidant activities of wheat bran feruloyl oligosaccharides (FOs) were determined in rats by determining the activities and mRNA expression levels of phase II detoxifying/antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH-Px), and heme oxygenase-1 (HO-1) in rat organs. FOs was given by gavage at doses of 0.25, 0.5, and 0.75 mmol/kg body weight every day for 15 days. Compared with the control group, the activities of SOD, CAT, and GSH-Px in FOs treatment groups significantly (P < 0.05) increased in heart, liver, and kidney. All the FOs treatment also significantly (P < 0.05) increased the glutathione (GSH) contents in heart (28–58%), liver (32–71%), and kidney (31–73%) compared with the control. FOs up regulated the mRNA expression levels of SOD, CAT, and HO-1 in organs. Moreover, the immunoblot analysis revealed increased nuclear factor-E2-related factor (Nrf2) protein expression levels in organs and there were positive correlations between the mRNA expression of phase II detoxifying/antioxidant enzymes and the expressions of Nrf2 protein, which demonstrated FOs treatment could modulate the detoxifying/antioxidant enzymes via Nrf2 signaling. © 2014 Published by Elsevier B.V.
1. Introduction Oxidative stress plays important roles in development of chronic and degenerative conditions such as cancers, cardiovascular diseases, hypertension, neurodegenerative disorders, and arthritis [1]. Ferulic acid, the most abundant member among hydroxycinnamic acids, and its derivatives such as ferulic acid ethyl ester, ferulic acid dehydrodimers, feruloyl glycosides, and curcumin have been revealed potent antioxidant activities in both in vitro and in vivo systems. Ferulic acid could in vitro scavenge free radical against hydroxyl radical, peroxynitrite, and oxidation of low density lipoprotein (LDL) [2–4]. Ferulic acid has been demonstrated to decrease the lipid peroxide after ischaemia–reperfusion (IR) by preventing the elevation of vascular permeability following IR injury in the intestine [5,6]. Balasubashini et al. [7] also reported that ferulic acid could decrease the levels of thiobarbituric acid reactive substances (TBARS), hydroperoxides, and free fatty acids in liver of diabetic rats along with an increase in glutathione (GSH) and
∗ Corresponding author at: School of Food Science and Chemical Engineering, Beijing Technology and Business University, No. 11 Fucheng Road, Haidian District, Beijing 100048, China. Tel.: +86 010 68985378; fax: +86 010 68985378. E-mail address: [email protected] (J. Wang). http://dx.doi.org/10.1016/j.ijbiomac.2014.12.011 0141-8130/© 2014 Published by Elsevier B.V.
antioxidant enzymes content particularly glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), and catalase (CAT). However, ferulic acid, as the most abundant phenolic compound in wheat bran, has extremely low bioaccessibiltiy due to the binding of ferulic acid to cell wall polysaccharides [8]. Feruloyl oligosaccharides (FOs), the ferulic acid ester of oligosaccharides, are produced either by microorganisms in the colon or from cereal bran fermentation [9]. FOs obtained from wheat bran has been demonstrated to effectively protect normal rat erythrocytes against in vitro oxidative damage [10], stimulate the in vitro growth of Bifidobacterium bifidum [11], and increase activities of SOD and GSH-Px in the serum of diabetic rats [9]. Although FOs from wheat bran has been reported to have antioxidant activities in both in vitro and in vivo systems, the mechanisms underlying the antioxidant effects of dietary phytochemicals have only recently begun to be understood. The involvement of specific cellular signaling pathways in the biological actions of phytochemicals is becoming increasingly obvious [12]. As a DNA-binding protein recognizing the antioxidant response element (ARE), nuclear factor-E2-related factor (Nrf2) regulates the expression of several phase II enzyme genes and antioxidants in response to noxious stimuli [12,13]. Therefore, the Nrf2/ARE pathway is one of the most important defensive signaling pathways in animals.
H. Zhang et al. / International Journal of Biological Macromolecules 74 (2015) 150–154
The aim of the present study was to determine effects of wheat bran FOs on the activities and mRNA expression levels of phase II detoxifying/antioxidant enzymes (SOD, CAT, GSH-Px, and HO-1) in rat organs. Moreover, the effect of wheat bran FOs on the Nrf2/ARE pathway was examined. 2. Materials and methods 2.1. Materials Wheat bran FOs were prepared from wheat bran insoluble dietary fiber by Bacillus subtilis xylanase treatments according to the previous study [10]. Sodium ferulate (SF) was purchased from a local medicine store. 2.2. Animals and treatment Male Sprague-Dawley rats (200 ± 10 g; obtained from Beijing Vitalriver Laboratory Animal Co., Ltd., Beijing, China) were used for the experiments. The animals were housed individually in wirebottom cages in a room maintained at 20–22 ◦ C and 60% relative humidity with a 12 h alternating light–dark cycle. Rats were acclimatized for 1 week and fed a ground commercial chow (Beijing Macao Cooperation Feed Co., Ltd., Beijing, China). After acclimation, the rats were randomly divided into seven groups. The control group was fed the standard chow diet and orally administered of distilled water (1.0 g/kg body weight) daily. The other six groups were orally administered with FOs and SF at a dosage of 0.25, 0.5, and 0.75 mmol/kg body weight. Animal care protocols are approved by Beijing University of Chinese Medicine. 2.3. Cytosol preparation Immediately after being removed from each animal, the heart, liver, and kidney were rinsed extensively in cold phosphatebuffered saline (PBS). The tissues were then cut into small pieces using scissors, rinsed twice with cold PBS, and followed by homogenization in ice-cold 50 mmol/L phosphate buffer containing 2 mmol/L ethylene diamine tetraacetie acid (EDTA) on ice. The homogenates were centrifuged at 100,000 × g for 10 min at 4 ◦ C. Cytosol aliquots were collected and preserved at −80 ◦ C for enzymatic assay and Western blotting [14]. 2.4. Antioxidant enzymes assays Total SOD, CAT, and GSH-Px activities were determined using commercially available enzyme assay kits (Nanjing Jiancheng Biocompany, Nanjing, China), and expressed as U/mg sample protein. The cytosolic protein content was quantified by a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) with bovine serum albumin (BSA) as the standard. 2.5. Reduced GSH analysis GSH contents in heart, liver, and kidney were measured using commercially available enzyme assay kits (Nanjing Jiancheng Biocompany, Nanjing, China).
151
Table 1 Primer sequences. Gene
Product size (bp)
Primer
5 primer sequences 3
GAPDH
137
SOD
152
CAT
198
HO-1
190
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
AAGTTCAACGGCACAGTCAAG CCAGTAGACTCCACGACATACTCA GATGAAGAGAGGCATGTTGGA AAGTCATCTTGTTTCTCGTGGA AGGTGCGGACATTCTATACGA CATTCTTAGGCTTCTGGGAGTT CTTCCCGAGCATCGACAAC TGAGGGACTCTGGTCTTTGTGT
diluted cDNA (1:10) was used in each real time-PCR with SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) and appropriate primers. An ABI7500 FAST instrument (Applied Biosystems, Foster City, CA, USA) was used to perform the PCR. The cycle conditions were as follows: 2 min at 95 ◦ C followed by 40 cycles of incubation at 95 ◦ C for 10 s, then 60 ◦ C for 40 s, and 72 ◦ C for 30 s. PCR reactions were followed by dissociation curve analysis [15]. The results were analyzed using the software provided with the Mx3000P QPCR system. Differences in mRNA expression were calculated using the CT method [16]. The sequences of the primers are shown in Table 1. 2.7. Western blotting The cytosolic fraction (supernatant) proteins from heart, liver, and kidney were measured using a Bio-Rad protein assay (BioRad, Hercules, CA, USA) with BSA as the standard. Electrophoresis was carried out using SDS-PAGE. After electrophoresis, proteins on the gel were electrotransferred onto an immobile membrane (PVDF; Millipore) with transfer buffer composed of 25 mmol/L Tris–HCl (pH 8.9), 192 mmol/L glycine, and 20% methanol. The membrane was then washed with Tris-buffered saline (10 mmol/L Tris, 150 mmol/L NaCl) containing 0.05% Tween 20 (TBST) and blocked in TBST containing 5% nonfat dried milk. The membrane was further incubated overnight at 48 ◦ C with specific antibodies such as Nrf2 (1:200) and -actin (1:500). After hybridization with primary antibodies, the membrane was washed three times with TBST, incubated with horseradish peroxidase-labeled secondary antibody for 45 min at room temperature, and then washed three times with TBST. Final detection was performed with enhanced chemiluminescence Western blotting reagents (GE Healthcare BioSciences, Pittsburgh, PA, USA) [13]. 2.8. Statistical analysis All data were expressed as means ± SE. Differences among groups were determined by one-way ANOVA analysis of variance using the Minitab 15 statistical program (Minitab Inc., State College, PA, USA). Pearson correlation coefficients were calculated for investigating relationships of lipid metabolism with the expression of hepatic genes and determined by the SPSS16.0 statistical program (IBM Inc., New York, NY, USA). Significance was defined at the 95% confidence level. 3. Results and discussion
2.6. Real-time PCR Total RNA from hearts, livers, and kidneys was extracted using TRIzol plus RNA purification kit (Invitrogen, Life Technologies, Carlsbad, CA, USA), quantified spectrophotometrically, checked for quality by gel electrophoresis, and used to synthesize cDNA using the GeneAmp RNA PCR kit (Applied Biosystems, FOster City, CA, USA) per the manufacturer’s protocol. Approximately 1 L of
Our previous study has demonstrated that covalently FOs significantly increased the levels of SOD, CAT and GSH-Px (56.7%, 24.4%, and 23.0%, respectively) in rat plasma [8]. In order to further demonstrate the antioxidant activities of FOs, phase II detoxifying/antioxidant enzymes (SOD, CAT, and GSH-Px) activities, GSH contents, mRNA levels of antioxidant enzymes, and expressions of Nrf2 protein in rat organs were analyzed in this study.
152
H. Zhang et al. / International Journal of Biological Macromolecules 74 (2015) 150–154
Table 2 Effects of wheat bran feruloyl oligosaccharides (FOs) and sodium ferulate (SF) on body weight and tissue weight of rats. Amount (mg/kg day) Control
Body weight (g)
Heart weight (g)
Liver weight (g)
Kidney (g)
314.6 ± 9.0
1.0 ± 0.1
14.0 ± 0.7
2.3 ± 0.2
SF
0.25 0.5 0.75
314.9 ± 18.6 305.5 ± 20.1 310.4 ± 9.4
1.0 ± 0.1 1.0 ± 0.1 1.0 ± 0.1
13.5 ± 1.0 13.0 ± 0.9 13.5 ± 0.6
2.3 ± 0.1 2.2 ± 0.2 2.3 ± 0.1
FOs
0.25 0.5 0.75
322.1 ± 14.9 321.7 ± 14.5 309.5 ± 17.3
1.1 ± 0.1 1.0 ± 0.0 1.0 ± 0.1
14.1 ± 1.0 14.1 ± 0.9 12.8* ± 1.3
2.3 ± 0.1 2.3 ± 0.2 2.3 ± 0.2
Data presented as means ± SE. * Indicates significant difference at P < 0.05.
3.1. Effects of FOs and SF on body and organ weights
(r = 0.916, P < 0.01) and kidney (r = 0.783, P < 0.05) while there was also a positive correlation (r = 0.901, P < 0.01) of the CAT activity in liver and kidney. SOD converts superoxide radicals to molecular oxygen and H2 O2 , and CAT decomposes H2 O2 to molecular oxygen and water [17]. In this study, the SOD activity positively correlated with the CAT activity in heart (r = 0.871, P < 0.05), liver (r = 0.957, P < 0.01), and kidney (r = 0.84, P < 0.05), which demonstrated that FOs could increased the activities of SOD and CAT simultaneously. GSH-Px reduces lipid hydroperoxides to their corresponding alcohols, and free hydrogen peroxide to water. The GSH-Px activities in heart, liver, and kidney increased with the increasing doses of SF and FOs and significantly (P < 0.05) increased compared with the control group. The rats in FOsH diet group had highest GSH-Px activities of heart, liver, and kidney. The GSH-Px activity in heart positively correlated with that in liver (r = 0.958, P < 0.05) and kidney (r = 0.905, P < 0.01) while there was also a positive correlation (r = 0.884, P < 0.01) of the GSH-Px activity in liver and kidney. Ou et al. [18] reported that FOs increased the activities of SOD and GSHPx in liver and testes of diabetic rats compared with SF and vitamin C, which might be due to the inhibition of lipid peroxidation and the scavenging of free radicals to restore antioxidant enzymes.
Table 2 shows the body weight, heart weight, liver weight, and kidney weight of rats in each group. Compared with the control group, there were no significant (P > 0.05) differences of body weight, liver weight, and kidney weight among all the diet groups. However, the liver weight of rats in the high dose FOs (FOsH) diet group significantly (P < 0.05) decreased 8.6% compared with the control group. All rats remained in good health throughout the experimental period. 3.2. Levels of antioxidant enzymes in rat organs Oxidative stress has been implicated in the pathogenesis of atherosclerosis. During the course of evolution, the living organisms have developed a fine defense network system against oxidative stress, in which various enzymes, protein, and small molecules with different functions play an important protective role against oxidative stress in vivo [8]. SOD, CAT, and GSH-Px are the primary antioxidant enzymes minimizing the oxygen radical cascade and removing cytotoxic peroxides in amammalian systems. The antioxidant enzymes (SOD, CAT, and GSH-Px) activities in rat heart, liver, and kidney were analyzed (Table 3). The SOD activities in heart, liver, and kidney increased with the increasing doses of SF and FOs. All SF and FOs treatment significantly (P < 0.05) increased SOD activities compared with the control group. For liver and kidney, the rats in the FOsH diet group had the highest SOD activity while the highest SOD activity in heart was obtained in the high does SF (SFH) diet group. The SOD activity in heart positively correlated with that in liver (r = 0.83, P < 0.05) and kidney (r = 0.958, P < 0.01) while there was also a positive correlation (r = 0.896, P < 0.01) of the SOD activity in liver and kidney. Compared with the control group, the CAT activities in heart and liver significantly (P < 0.05) increased in treatment diet groups. The CAT activity in heart was positively correlated with that in liver
3.3. GSH content GSH, a major antioxidant that helps eliminate peroxides and other oxidants, reduces damage and promotes better survival under conditions of oxidative stress [19]. The GSH contents in heart, liver, and kidney increased with the increasing doses of SF and FOs (Table 4). The GSH contents in liver and kidney were highest in the FOsH diet group while the rats in the SFH diet group had the highest heart GSH content. The GSH content in heart positively correlated with that in liver (r = 0.930, P < 0.01) and kidney (r = 0.882, P < 0.01) while there was also a positive correlation (r = 0.953, P < 0.01) between the GSH content in liver and kidney. Lycopene has been reported to induce the hepatic GSH antioxidant system [20].
Table 3 Effects of wheat bran feruloyl oligosaccharides (FOs) and sodium ferulate (SF) on phase II detoxifying and antioxidant enzymes in heart, liver, and kidney. Control
SF 0.25
SF 0.5
SF 0.75
FOs 0.25
FOs 0.5
SOD (U/mg protein) 131c ± 19.3 Heart 293d ± 11.2 Liver 396e ± 18.8 Kidney
150bc ± 12 319c ± 28.6 432d ± 7.1
153bc ± 29.7 349b ± 6.9 471c ± 21.3
186a ± 35.9 362b ± 13.5 593a ± 36.1
157bc ± 27.6 325c ± 20.1 484c ± 27.6
CAT (U/mg protein) 631d ± 72.3 Heart 6217d ± 635.9 Liver 7291b ± 605 Kidney
807c ± 33.1 7251c ± 402.1 8684b ± 471
1065b ± 57.7 7655bc ± 838.8 10533a ± 1110.1
1213ab ± 234.6 8504ab ± 730.7 11149a ± 2511.3
1160ab ± 224 7452c ± 731.5 8223b ± 764.6
1233ab ± 179.6 8852a ± 1148.1 10776a ± 1018.1
1333bc ± 107.9 609bc ± 12.7 628dc ± 5.9
1434ab ± 208.6 621b ± 7.4 637c ± 18.0
1360b ± 118.1 595 ± 3.6 613d ± 9.8
1460ab ± 186.1 611b ± 6 703b ± 8.8
GSH-Px (U/mg protein) Heart 1106d ± 125.8 549e ± 7.2 Liver 554e ± 26.8 Kidney
1195dc ± 96.5 579d ± 10.4 611d ± 9.4
Data presented as means ± SE. Different letters indicate significant difference at P < 0.05.
171ab ± 9.5 393a ± 4.1 554b ± 20
FOs 0.75 173a ± 10.5 403a ± 15.7 594a ± 34.3 1328a ± 78.8 8701a ± 1312.6 10590a ± 1780.9 1545a ± 100 645.5a ± 30.2 736.8a ± 24.7
H. Zhang et al. / International Journal of Biological Macromolecules 74 (2015) 150–154 Table 4 Effects of wheat bran feruloyl oligosaccharides (FOs) and sodium ferulate (SF) on glutathione (GSH) contents in heart, liver, and kidney. GSH Content (mg/g protein) Heart
Liver
Control
Kidney
4.6 ± 0.7
d
2.2 ± 0.1
13.0 ± 0.7e
d
SF
0.25 0.5 0.75
5.1 ± 0.5c 7.3 ± 0.8ab 8.0 ± 0.9a
2.7 ± 0.1c 3.3 ± 0.2b 3.5 ± 0.2b
15.0 ± 1.3d 17.3 ± 1.1c 21.4 ± 1.3a
FOs
0.25 0.5 0.75
5.9 ± 0.5c 7.2 ± 0.5b 7.3 ± 0.3ab
2.9 ± 0.1c 3.4 ± 0.5b 3.8 ± 0.2a
17.0 ± 1.0c 18.6 ± 1.4b 22.5 ± 1.0a
6 Heart Relative SOD mRNA Expression
Amount (mg/kg day)
153
Data presented as means ± SE. Different letters indicate significant difference at P < 0.05.
Liver
Kidney
5 4 3 2 1 0 SFH
Control
3.4. Gene expression of antioxidant enzymes
3.5. Protein expression of Nrf2 An immunoblotting analysis was performed to further examine whether Nrf2 expression was modulated by FOs (Fig. 2). The total levels of Nrf2 protein expression in liver, kidney, and heart were modulated simultaneously by SFH and FOsH treatment. Compared with the SFH treatment group, the Nrf2 protein expression levels in heart, liver, and kidney increased 11%, 32%, and 61%, respectively, in the FOsH treatment group. As the phase II detoxifying/antioxidant enzymes, the mRNA expression levels of SOD, CAT, and HO-1 positively correlated with the Nrf2 protein expression levels in heart (r = 0.982, P = 0.06, r = 0.819, P = 0.195, and r = 0.986, P < 0.05), liver (r = 0.986, P < 0.05, r = 0.996, P < 0.05, and r = 0.946, P = 0.11), and kidney (r = 0.914, P = 0.133, r = 0.655, P = 0.273, and r = 0.989, P < 0.05). These observations suggested that an accumulation of Nrf2 protein might contribute to the induction of ARE-mediated antioxidant gene expression after the FOs treatment. Yeh et al. [13] have
(a) 20
Heart
Liver
Kidney
Realtive CAT mRNA Expression
18 16 14 12 10 8 6 4 2 0 Control
SFH Different Groups
FosH
(b) 3
Relative HO-1 mRNA Expreesion
The mRNA expression of antioxidant enzymes in liver modulated simultaneously by phenolic acids has been reported [13]. Therefore, the mRNA expression levels of SOD and CAT in heart, liver, and kidney were determined by real-time PCR (Fig. 1a and b). Real-time PCR was limited to comparison of the diets of SFH and FOsH to the control due to resource constraints. Compared with the control group, the mRNA level of SOD was 4.8-fold higher in heart, 1.3–2.3-fold higher in liver, and 1.8–2.8-fold higher in kidney. The expression levels of SOD in liver and kidney in the FOsH diet group were 1.8- and 1.5-fold higher relative to the SFH diet group. The activities of SOD in heart, liver, and kidney positively correlated with the mRNA expression levels of SOD in the organs, respectively (r = 0.978, P = 0.134, r = 0.898, P = 0.145, and r = 0.835, P = 0.186). Compared with the control group, the mRNA levels of CAT in heart, liver, and kidney were 5.9–19-fold, 2.8–5.1-fold, and 3.3–3.7fold higher, respectively. The expression levels of CAT in heart, liver, and kidney in the FOsH diet group were 3.2-, 1.8-, and 1.1-fold higher relative to the SFH diet group. The activities of CAT in heart, liver, and kidney positively correlated with the mRNA expression levels of CAT in the organs, respectively (r = 0.811, P = 0.199, r = 0.873, P = 0.162, and r = 0.96, P = 0.09). Heme oxygenase-1 (HO-1), a stress-responsive enzyme, is responsible for the breakdown of heme to biliverdin, free iron, and carbon monoxide to confer vascular protection against abnormal proliferation [21,22]. HO-1 is also another important phase II detoxifying/antioxidant enzyme. Compared with the control group, the mRNA level of HO-1 was 2.9-fold higher in heart, 1.0–1.9-fold higher in liver, and 1.1–1.4-fold higher in kidney (Fig. 1c). The expression levels of HO-1 in liver and kidney in the FOsH diet group were 1.9- and 1.3-fold higher relative to the SFH diet group.
FosH
Different Groups
Heart Liver Kidney
2.5 2 1.5 1 0.5 0 Control
SFH
FosH
Different Groups
(c) Fig. 1. The mRNA expression levels of phase II detoxifying/antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), and heme oxygenase-1 (HO-1) in male rats treated by high dose of sodium ferulate (SFH) and high dose of feruloyl oligosaccharides (FOsH) for 15 days. Each mRNA was normalized to ribosomal protein GAPDH and was expressed relative to the control level.
154
H. Zhang et al. / International Journal of Biological Macromolecules 74 (2015) 150–154
A Control
SFH
FosH
Control SFH
Liver
FosH
Control
Kidney
SFH
FosH
Heart
B
Nrf2 protein level (fold of control)
2.5
Heart
Liver
Kidney
2
1.5
1
0.5
0 Control
SFH
FosH
Different Groups Fig. 2. Expressions of nuclear factor-E2-related factor (Nrf2) protein in heart, liver, and kidney of male rats treated by high dose of sodium ferulate (SFH) and high dose of feruloyl oligosaccharides (FOsH) for 15 days. The upper part of the figure indicates an original blot (A); the lower part represents the results of densitometric analyses (B).
reported that phenolic acid mediated antioxidant enzyme genes by increasing the level of Nrf2 protein expression. One study reported that the major constituent of green tea, epigallocatechin-3-gallate (EGCG), up-regulated the HO-1 expression by activation of the Nrf2/ARE pathway in endothelial cell, conferring resistance against H2 O2 -induced cell death [23]. Curcumin could also induced the HO1 expression by activating the Nrf2/ARE pathway both in vitro [24] and in vivo [25]. The modulation of phase II detoxifying/antioxidant enzymes (SOD, CAT, GSH-Px, and HO-1), CSH contents, and Nrf2/ARE signaling of wheat bran FOs were investigated. The results showed that FOs increased the activities of SOD, CAT, and GSH-Px, mRNA expression levels of SOD, CAT, and HO-1, and the expressions of Nrf2 protein in rat heart, liver, and kidney. Moreover, there were positive correlations between the mRNA expression levels of ARE-mediated expression of phase II detoxifying/antioxidant enzymes and the expressions of Nrf2 protein, which demonstrated modulation of the Nrf2/ARE pathway may play a key role in antioxidant activities of FOs. Acknowledgements This work was supported by National Natural Science Foundation of China (No. 31271976), National “Twelfth Five-Year” Plan for Science & Technology (2012BAD34B05), and the Importation and Development of High-Caliber Talents Project of Beijing Municipal Institutions (Nos. CIT&TCD20130309 and IDHT20130506). References [1] F. Shahidi, A. Chandrasekara, Phytochem. Rev. 9 (2010) 147–170.
[2] J. Kanski, M. Aksenova, A. Stoyanova, D.A. Butterfield, J. Nutr. Biochem. 13 (2002) 273–281. [3] H. Kikuzaki, M. Hisamoto, K. Hirose, K. Akiyama, H. Taniguchi, J. Agric. Food Chem. 50 (2002) 2161–2168. [4] H. Yu, J. Hong, D. Wu, Effect of sodium ferulate on proliferation of rabbit aortic smooth muscle cells induced by oxidized LDL, Zhongguo Zhong Yao Za Zhi 24 (1999) 365–366. [5] S. Itagaki, T. Kurokawa, C. Nakata, Y. Saito, S. Oikawa, M. Kobayashi, T.I.I. Hirano, Food Chem. 114 (2009) 466–471. [6] Y. Sato, S. Itagaki, T. Kurokawa, J. Ogura, M. Kobayashi, T. Hirano, M. Sugawara, K. Iseki, Int. J. Pharm. 403 (2011) 136–138. [7] M.S. Balasubashini, R. Rukkumani, P. Viswanathan, V.P. Menon, Phytother. Res. 18 (2004) 310–314. [8] J. Wang, B.G. Sun, Y.P. Cao, C.T. Wang, Food Chem. 123 (2010) 472–476. [9] S. Ou, K.C. Kwok, J. Sci. Food Agric. 84 (2004) 1261–1269. [10] X.P. Yuan, J. Wang, H.Y. Yao, Food Chem. 90 (2005) 759–764. [11] J. Wang, B.G. Sun, Y.P. Cao, Y. Tian, Food Chem. 112 (2009) 350–353. [12] T.G. Son, S. Camandola, M.P. Mattson, Neuromol. Med. 10 (2008) 236–246. [13] C.T. Yeh, G.C. Yen, J. Nutr. 136 (2006) 11–15. [14] C.T. Yeh, G.C. Yen, J. Nutr. Biochem. 17 (2006) 561–569. [15] H. Zhang, G.E. Bartley, H. Zhang, W. Jing, C.K. Fagerquist, F. Zhong, W. Yokoyama, J. Agric. Food Chem. 61 (2013) 8389–8395. [16] K.J. Livak, T.D. Schmittgen, Methods (San Diego, Calif.) (2001) 402–408. [17] J. Fang, T. Seki, H. Maeda, Adv. Drug Deliv. Rev. 61 (2009) 290–302. [18] S.Y. Ou, G.M. Jackson, X. Jiao, J. Chen, J.Z. Wu, X.S. Huang, J. Agric. Food Chem. 55 (2007) 3191–3195. [19] D.A. Dickinson, D.R. Moellering, K.E. Iles, R.P. Patel, A.L. Levonen, A. Wigley, V.M. Darley-Usmar, H.J. Forman, Biol. Chem. 384 (2003) 527–537. [20] A. Hekimoglu, Z. Kurcer, F. Aral, F. Baba, E. Sahna, A. Atessahin, Lycopene, an antioxidant carotenoid, attenuates testicular injury caused by ischemia/reperfusion in rats, Tohoku J. Exp. Med. 218 (2009) 141–147. [21] W. Durante, J. Cell Physiol. 195 (2003) 373–382. [22] M.D. Maines, P.E.M. Gibbs, Biochem. Biophys. Res. Commun. 338 (2005) 568–577. [23] C.C. Wu, M.C. Hsu, C.W. Hsieh, J.B. Lin, P.H. Lai, B.S. Wung, Life Sci. 78 (2006) 2889–2897. [24] H.O. Pae, G.S. Jeong, S.O. Jeong, H.S. Kim, S.A. Kim, Y.C. Kim, S.J. Yoo, H.D. Kim, H.T. Chung, Exp. Mol. Med. 39 (2007) 267–277. [25] E.O. Farombi, S. Shrotriya, H.K. Na, S.H. Kim, Y.J. Surh, Food Chem. Toxicol. 46 (2008) 1279–1287.