- Email: [email protected]
Wheat straw: An inefficient substrate for rapid natural lignocellulosic composting
Accepted Manuscript Short communication Wheat straw: an inefficient substrate for rapid natural lignocellulosic composting Lili Zhang, Yangyang Jia, Xiaomei Zhang, Xihong Feng, Jinjuan Wu, Lushan Wang, Guanjun Chen PII: DOI: Reference:
S0960-8524(16)30289-9 http://dx.doi.org/10.1016/j.biortech.2016.03.004 BITE 16193
To appear in:
Bioresource Technology
Received Date: Revised Date: Accepted Date:
20 January 2016 29 February 2016 1 March 2016
Please cite this article as: Zhang, L., Jia, Y., Zhang, X., Feng, X., Wu, J., Wang, L., Chen, G., Wheat straw: an inefficient substrate for rapid natural lignocellulosic composting, Bioresource Technology (2016), doi: http:// dx.doi.org/10.1016/j.biortech.2016.03.004
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Wheat straw: an inefficient substrate for rapid natural lignocellulosic composting Lili Zhang a, Yangyang Jia a, Xiaomei Zhang a, Xihong Feng b, Jinjuan Wu b, Lushan Wang a, Guanjun Chen a * a
State Key Laboratory of Microbial Technology, Shandong University, Jinan, China.
b
Lu Qing Seed Co. Ltd., Jinan, China
*Corresponding Author: Professor Guanjun Chen Address:
State Key Laboratory of Microbial Technology Shandong University 27 Shandanan Road Jinan 250100 China
Tel: +86-531-88366202 Fax: +86-531-88565610 E-mail: [email protected]
Abstract Composting is a promising method for the management of agricultural wastes. However, results for wheat straw composts with different carbon-to-nitrogen ratios revealed that wheat straw was only partly degraded after composting for 25 days, with hemicellulose and cellulose content decreasing by 14% and 33%, respectively. No significant changes in community structure were found after composting according to 454-pyrosequencing. Bacterial communities were represented by Proteobacteria and Bacteroidetes throughout the composting process, including relatively high abundances of pathogenic microbes such as Pseudomonas and Flexibacter, suggesting that innocent treatment of the composts had not been achieved. Besides, the significant lignocellulose degrader Thermomyces was not the exclusively dominant fungus with relative abundance only accounting for 19% of fungal communities. These results indicated that comparing with maize straw, wheat straw was an inefficient substrate for rapid natural lignocellulose-based composting, which might be due to the recalcitrance of wheat straw.
Keywords: Wheat straw compost; Microbial diversity; Pyrosequencing; Thermomyces; Innocent treatment;
1.
Introduction Composting is an important method for achieving high efficiency
biotransformation of agricultural wastes (Hargreaves et al., 2007; Ming et al., 2015; Tuomela et al., 2000). As an environmentally friendly technology, the primary goals of composting are the innocent treatment of substrates and resource utilization, mainly depending on fermentation by microbial communities selected under conditions of high temperature (Bernal et al., 2009; Tuomela et al., 2000). The composting process is driven by the activities of the microbial communities; thus, by adjusting the composting conditions, the composting efficiency can be significantly improved (PETIOT C. & GUARDIA A., 2013; Wilson, 2011). In addition, species succession occurs among the microbial communities during the composting process, and the high temperature resulting from lignocellulose degradation significantly inhibit the growth and spread of pathogenic microbes (de Gannes et al., 2013; Zhang et al., 2015). Maize straw has previously been shown by integrated meta-omics to be an excellent substrate for natural composts (Zhang et al., 2016). As a common resource in agricultural wastes, wheat straw is the second largest biomass feedstock in the world (Talebnia et al., 2010). Therefore wheat straw is a great potential feedstock for the rapid composting. Here, the question was whether wheat straw could also be efficiently managed by the composting method. Hence, the aim of this study was to track the dynamic changes in the composition of microbial communities in rapid natural wheat straw composts using an integrated meta-omics approach.
2. Materials and methods 2.1 Composting process and sampling Composting was performed as described by Zhang et al. (2015) with some modifications. Briefly, fresh wheat straw, which was shredded to fragments with length of ~10 cm and supplemented with urea fertilizer to adjust the carbon-to-nitrogen (C/N) ratio to ~35, was used for composting. A compost that only contained wheat straw with a C/N ratio over 55 was the control. Both composts were placed in piles (length, 10 m; width, 1.5 m; height, 1 m) at Luqing Seed Co., Ltd., located in Jinan city, Shandong Province, China (36°40′N–117°00′E), and the composting process lasted for 25 days from July 9, 2011. After 2 consecutive years of studying wheat straw composts, the compost experiments from the second year were chosen for further analysis. The samples used in this study were taken from a depth of ~30 cm in the composts, and each sample was a mixture of three parallel samples from different sampling sites. During the first 15 days, samples were taken beginning on day 3 and at 3-day intervals; on days 20 and 25 samples were also collected. Seven samples taken from the urea compost are referred to as 3e–25e, with the number corresponding to the sampling day. Three samples collected from the control compost are referred to as 3c, 12c and 25c. All ten samples were stored at –20 °C until use. Measurements of the temperature, water content, pH, electrical conductivity (EC) and lignocellulose content were performed exactly as described by Zhang et al. (2016). 2.2 DNA extraction, pyrosequencing and bioinformatic analyses
DNA was extracted from the compost samples with the PowerSoil® DNA Isolation Kit (MO-BIO Laboratories, Carlsbad, CA, USA) according to the manufacturer’s instructions. Triplicate extractions were conducted with each extraction using 0.25 g of compost material. The representative DNA sample was the mixture of these three extractions. A NanoDrop ® ND-1000 Spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA) was used to determine the DNA concentration at 260 nm. The DNA was stored at 4 °C for short-term use, or at –80 °C until needed. 16S rRNA genes were amplified from the extracted DNA using primers 27F (5′AGAGTTTGATCCTGGCTCAG -3′) and 533R (5′-TTACCGCGGCTGCTGGCAC-3′ ), while the amplifications of 18S rRNA genes were performed with primers 3NDF （5′- GGCAAGTCTGGTGCCAG -3′）and V4_euk_R （5′- ACGGTATCT(AG)ATC(AG)TCTTCG -3′）. The PCR conditions for 16S rRNA amplification were as follows: 95 °C for 5 min, then 30 cycles of 95 °C for 30 s, 51 °C for 30 s and 72 °C for 2 min, ending with 72 °C for 10 min. The amplification of 18S rRNA genes was similarly performed, except the annealing temperature was 55 °C. The amplicons were sequenced using the Roche GS FLX+ system with equimolar concentrations. The data quality was controlled by A Quantitative Insights Into Microbial Ecology (QIIME) pipeline, including length-based filtering and read-quality filtering. The bioinformatic analysis was performed as described by Zhang et al. (2016). The sequencing data reported here were deposited in the NCBI Sequence Read Archive under accession number PRJNA307303.
3. Results and discussion 3.1 Physicochemical properties of the compost samples The detected temperatures of the composts were all below 60 °C throughout the process (Fig. 1). Higher temperatures were detected in the urea compost than in the control compost, indicating that the C/N ratio can improve the microbial activities, although the two composts displayed similar trends in temperature changes over time. Distinct from the changes in temperature, the moisture contents continuously decreased over time, from an initial value of 72% to final values of 42% and 36% for the urea and control composts, respectively. Generally speaking, the pH values indicated that both composts were mostly maintained in an alkaline environment, while the EC values rose substantially during the composting process. These results showed the correctness of the wheat straw compost as was expected (López-González et al., 2013). Measurements of the lignocellulose content revealed that, after a composting process that lasted for 25 days, only a small portion of the lignocellulose in the wheat straw, mainly that in the leaves, was depolymerized, with just 14% and 33% of hemicellulose and cellulose degraded, respectively (Fig. 1 and Fig. S1). The degradation degrees of lignocellulose were lower than those in maize straw compost under the same composting conditions, in which 26% and 37% of hemicellulose and cellulose were degraded, respectively (Zhang et al., 2015). The reason why hemicellulose and cellulose content increased in the later-stage of composting might be that the part of leaves in wheat straw was obviously degraded, while the remaining stems were more difficult to be degraded (Zhang et al., 2014). This indicated that the
wheat straw compost was inefficient in lignocellulose degradation. 3.2 Number of sequences obtained For the metagenomic libraries constructed by pyrosequencing, the number of filtered sequences, OTUs and Chao 1 index are listed in Table 1. Overall, a total of 12,706 16S rRNA sequences and 19,218 18S rRNA sequences were obtained. The coverage of the fungal libraries was over 98% according to the Chao 1 index and rarefaction curve, while the bacterial libraries had a lower coverage that also reached 90% (Table 1 and Fig. S2), indicating the possibility of further analysis of these reads. The overall bacterial and fungal OTU numbers detected were 2458 and 1097 at similarities of 97%, respectively. In comparison, in the maize straw compost, higher bacterial OTUs and lower fungal OTUs were detected (Zhang et al., 2015), which shows the impact of different substrates on the microbial communities. 3.3 Bacterial community composition Overall, 17 bacterial phyla were detected in the compost samples, and Proteobacteria, Bacteroidetes, Actinobacteria and Firmicutes were the dominant phyla (Fig. 2A). Proteobacteria was the most dominant phylum with a abundance of 37% and was negligibly affected by compost type or time. Bacteroidetes and Firmicutes were more abundant in the early stages of the urea compost, and their abundances peaked at 52% and 13% on day 3, respectively. In the control compost a low abundance of Bacteroidetes and high abundance of Firmicutes were detected. The abundance of Actinobacteria increased by 12% and 16% over time in the urea compost and control compost, respectively. However, these results were inconsistent
with previous studies, in which Actinobacteria and Firmicutes were considered to be the dominant phyla in composts (López-González et al., 2015; Zhang et al., 2015), revealing that there was no species succession within the compost communities. At the genus level, the high diversity and low abundances of the dominant bacterial communities also showed that the bacteria in the composts were not significantly selected or enriched during the composting process (Fig. 3, A). Genera affiliated with the phyla Proteobacteria and Bacteroidetes were the dominant members of bacterial communities over time in both composts, including the plant and animal pathogens Pseudomonas and Flexibacter etc. These results suggested the insufficiency of the innocent treatment in these compost systems (Mouriño et al., 2008). The genus Thermopolyspora, belonging to Actinobacteria, has been widely identified as a dominant lignocellulose degrader in composts (Zhang et al., 2015). Its low abundance in this study revealed that such representatives of lignocellulose degrading bacteria had not been enriched after wheat straw composting, which was supported by the low enzymatic activities detected. 3.4 Fungal community composition Ascomycota was the most dominant phylum of the fungal community, accounting for 59% of all reads (Fig. 2B). Ascomycota has been widely identified as the dominant phylum in compost fungal communities before (Adrian et al., 2014; Zhang et al., 2015; Zhang et al., 2016). In this study, Ascomycota was also determined to be the most dominant fungus in both composts. However, compared with the maize straw compost, in which nearly 90% of all reads were assigned to Ascomycota, a lower abundance of
Ascomycota was detected here, indicating that the dominant fungal microbes were less enriched when wheat straw was used as the substrate. At the genus level, Thermomyces belonging to the Ascomycota phylum was the dominant microbe, and its abundance constantly rose from 5% to 25% over time in the urea compost (Fig. 3B). In contrast, Thermomyces in the control compost was more abundant at the beginning of the compost, with a proportion of 52% on day 3. The high abundance of this genus in the control compost (52%) indicated that it could become the dominant microbe when the composting started under conditions of a high C/N ratio, which was proved in our previous studies (Zhang et al., 2015). These results indicated that the usual dominant lignocellulose degrading communities had not developed during the composting process, and that lignocellulose was only partly degraded, while the main objective of rapid natural composting was to perform the innocent treatment of agricultural wastes in a fast and cost-effective way. The results of enzymatic assays also showed that enzymatic activity was nearly undetectable, and the protein content was too low to conduct metaproteomic analysis (data not shown). As a monocotyledonous plant, the accessibility of wheat straw to external enzymes is primarily limited by the waxy layer covering the leaves and the heterogenetic structure of the lignocellulose (Motte et al., 2015). In conclusion, because of the high biomass recalcitrance of wheat straw and the subsequent insufficient innocent treatment of composts, wheat straw was a less efficient substrate for rapid natural lignocellulosic composting when compared with maize straw.
4.
Conclusions Wheat straw was only partly degraded at the end of the composting process,
leading to the formation of a relatively low temperature environment (< 60°C). In addition, the metagenomic analysis revealed that those microbial communities that normally dominate lignocellulose degradation were not enriched after composting. However, pathogenic microbes represented by Proteobacteria and Bacteroidetes remained within the composts, indicating insufficient innocent treatment during wheat straw composting. Together, these results suggest that comparing with maize straw, wheat straw is an inefficient substrate for rapid natural composting. Besides, metagenomic methods were successfully used to assess the degree of innocent treatment of the composts.
Acknowledgments This work was supported by grants from the Major National Science and Technology Projects (Grant Number: 2013ZX10004217), the Fundamental Research Funds of Shandong University (Grant Number: 2015YQ004) and the Natural Science Foundation of Shandong Province (Grant Number: ZR2013CM038).
References 1.
Adrian, L.F., Urooj, Z., Alan, H., Thomas, B., Graeme, F., Robson, G.D. 2014. Fungal succession in an in-vessel composting system characterized using 454 pyrosequencing. FEMS Microbiol. Ecol. 88(2), 296-308.
2.
Bernal, M.P., Alburquerque, J.A., Moral, R. 2009. Composting of animal manures and chemical criteria for compost maturity assessment. A review. Bioresour. Technol. 100(22), 5444-5453.
3.
de Gannes, V., Eudoxie, G., Hickey, W.J. 2013. Prokaryotic successions and diversity in composts as revealed by 454-pyrosequencing. Bioresour. Technol. 133, 573-580.
4.
Hargreaves, J.C., Adl, M.S., Warman, P.R. 2007. A review of the use of composted municipal solid waste in agriculture. Agr. Ecosyst. Environ. 123(s 1–3), 1–14.
5.
López-González, J., Suárez-Estrella, F., Vargas-García, M., López, M., Jurado, M., Moreno, J. 2015. Dynamics of bacterial microbiota during lignocellulosic waste composting: Studies upon its structure, functionality and biodiversity. Bioresour. Technol. 175, 406-416.
6.
López-González, J.A., López, M.J., Vargas-García, M.C., Suárez-Estrella, F., Jurado, M., Moreno, J. 2013. Tracking organic matter and microbiota dynamics during the stages of lignocellulosic waste composting. Bioresour. Technol. 146(0), 574-584.
7.
Ming, C., Xu, P., Zeng, G., Yang, C., Huang, D., Zhang, J. 2015. Bioremediation of soils contaminated with polycyclic aromatic hydrocarbons, petroleum, pesticides, chlorophenols and heavy metals by composting: Applications, microbes and future research needs. Biotechnol Adv. 33(1), 745-755.
8.
Motte, J.C., Watteau, F., Escudié, R., Steyer, J.P., Bernet, N., Delgenes, J.P., Dumas, C. 2015. Dynamic observation of the biodegradation of lignocellulosic tissue under solid-state anaerobic conditions. Bioresour. Technol. 191, 322-326.
9.
Mouriño, J.L.P., Vinatea, L., Buglione-Neto, C., Ramirez, C.T., Vieira, F.N., Pedrotti, F., Martins, M.L., Derner, R.B., Aguilar, M., Beltrame, E. 2008. Characterization and experimental infection of Flexibacter maritimus (Wakabayashi et al. 1986) in hatcheries of post-larvae of Litopenaeus vannamei Boone, 1931. Braz. J Biol. 68(1), 173-177.
10. Petiot C., Guardia A., D. 2013. Composting in a Laboratory Reactor: A Review. Compost. Sci. Util. 12(1), 69-79. 11. Talebnia, F., Karakashev, D., Angelidaki, I. 2010. Production of bioethanol from wheat straw: An overview on pretreatment, hydrolysis and fermentation. Bioresour. Technol. 101(13), 4744–4753. 12. Tuomela, M., Vikman, M., Hatakka, A., Itävaara, M. 2000. Biodegradation of lignin in a compost environment: a review. Bioresour. Technol. 72(2), 169-183. 13. Wilson, D.B. 2011. Microbial diversity of cellulose hydrolysis. Bioresour. Technol. 14(3), 259-263. 14. Zhang, H., Fangel, J.U., Willats, W.G.T., Selig, M.J., Lindedam, J., Jørgensen, H., Felby, C. 2014. Assessment of leaf/stem ratio in wheat straw feedstock and impact on enzymatic conversion. GCB Bioenergy. 6(1), 90–96. 15. Zhang, L., Ma, H., Zhang, H., Xun, L., Chen, G., Wang, L. 2015. Thermomyces lanuginosus is the dominant fungus in maize straw composts. Bioresour. Technol. 197, 266-275.
16. Zhang, L., Zhang, H., Wang, Z., Chen, G., Wang, L. 2016. Dynamic changes of the dominant functioning microbial community in the compost of a 90-m3 aerobic solid state fermentor revealed by integrated meta-omics. Bioresour. Technol. 203, 1-10.
Figure Captions Fig. 1. Compost physicochemical properties. A–D represent the changes in temperature, moisture content, pH and EC value over time, respectively; E shows the lignocellulose contents of samples from the urea compost. Urea, urea compost; Control, control compost.
Fig. 2. Phylum level composition of bacterial (A) and fungal (B) communities in composts.
Fig. 3. Heat map of the compositions of dominant genera of the bacterial (A) and fungal (B) communities. Genera with ≥ 1% abundance in the total library are listed. The colour intensity is associated with the abundance of the genus in each sample.
Table 1 List of the sample origin and characteristics of amplicon libraries. Bacteri
Sequenc
a
es OTUs Chao1
Fungi
Sequenc es OTUs Chao1
3e
6e
9e
12e
15e
20e
25e
3c
12c
25c
101 3 182 288
108 2 253 318
109 3 237 339
189 2 268 346
152 9 266 377
193 4 275 347
171 5 299 364
721 238 304
961 226 297
766 214 277
209 5 121 133
154 8 101 122
186 4 134 155
214 1 110 129
197 5 93 121
191 2 118 174
205 9 124 175
199 0 98 152
193 7 91 109
169 7 107 129
Total 1270 6 2458
1921 8 1097
Highlights
Wheat straw was an inefficient substrate for rapid natural composting
Relative low temperature in composts did not support community succession
Metagenomic method can assess the degree of innocent treatment of composts
Innocent treatment in wheat straw compost was less effective and required more time
S0960-8524(16)30289-9 http://dx.doi.org/10.1016/j.biortech.2016.03.004 BITE 16193
To appear in:
Bioresource Technology
Received Date: Revised Date: Accepted Date:
20 January 2016 29 February 2016 1 March 2016
Please cite this article as: Zhang, L., Jia, Y., Zhang, X., Feng, X., Wu, J., Wang, L., Chen, G., Wheat straw: an inefficient substrate for rapid natural lignocellulosic composting, Bioresource Technology (2016), doi: http:// dx.doi.org/10.1016/j.biortech.2016.03.004
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Wheat straw: an inefficient substrate for rapid natural lignocellulosic composting Lili Zhang a, Yangyang Jia a, Xiaomei Zhang a, Xihong Feng b, Jinjuan Wu b, Lushan Wang a, Guanjun Chen a * a
State Key Laboratory of Microbial Technology, Shandong University, Jinan, China.
b
Lu Qing Seed Co. Ltd., Jinan, China
*Corresponding Author: Professor Guanjun Chen Address:
State Key Laboratory of Microbial Technology Shandong University 27 Shandanan Road Jinan 250100 China
Tel: +86-531-88366202 Fax: +86-531-88565610 E-mail: [email protected]
Abstract Composting is a promising method for the management of agricultural wastes. However, results for wheat straw composts with different carbon-to-nitrogen ratios revealed that wheat straw was only partly degraded after composting for 25 days, with hemicellulose and cellulose content decreasing by 14% and 33%, respectively. No significant changes in community structure were found after composting according to 454-pyrosequencing. Bacterial communities were represented by Proteobacteria and Bacteroidetes throughout the composting process, including relatively high abundances of pathogenic microbes such as Pseudomonas and Flexibacter, suggesting that innocent treatment of the composts had not been achieved. Besides, the significant lignocellulose degrader Thermomyces was not the exclusively dominant fungus with relative abundance only accounting for 19% of fungal communities. These results indicated that comparing with maize straw, wheat straw was an inefficient substrate for rapid natural lignocellulose-based composting, which might be due to the recalcitrance of wheat straw.
Keywords: Wheat straw compost; Microbial diversity; Pyrosequencing; Thermomyces; Innocent treatment;
1.
Introduction Composting is an important method for achieving high efficiency
biotransformation of agricultural wastes (Hargreaves et al., 2007; Ming et al., 2015; Tuomela et al., 2000). As an environmentally friendly technology, the primary goals of composting are the innocent treatment of substrates and resource utilization, mainly depending on fermentation by microbial communities selected under conditions of high temperature (Bernal et al., 2009; Tuomela et al., 2000). The composting process is driven by the activities of the microbial communities; thus, by adjusting the composting conditions, the composting efficiency can be significantly improved (PETIOT C. & GUARDIA A., 2013; Wilson, 2011). In addition, species succession occurs among the microbial communities during the composting process, and the high temperature resulting from lignocellulose degradation significantly inhibit the growth and spread of pathogenic microbes (de Gannes et al., 2013; Zhang et al., 2015). Maize straw has previously been shown by integrated meta-omics to be an excellent substrate for natural composts (Zhang et al., 2016). As a common resource in agricultural wastes, wheat straw is the second largest biomass feedstock in the world (Talebnia et al., 2010). Therefore wheat straw is a great potential feedstock for the rapid composting. Here, the question was whether wheat straw could also be efficiently managed by the composting method. Hence, the aim of this study was to track the dynamic changes in the composition of microbial communities in rapid natural wheat straw composts using an integrated meta-omics approach.
2. Materials and methods 2.1 Composting process and sampling Composting was performed as described by Zhang et al. (2015) with some modifications. Briefly, fresh wheat straw, which was shredded to fragments with length of ~10 cm and supplemented with urea fertilizer to adjust the carbon-to-nitrogen (C/N) ratio to ~35, was used for composting. A compost that only contained wheat straw with a C/N ratio over 55 was the control. Both composts were placed in piles (length, 10 m; width, 1.5 m; height, 1 m) at Luqing Seed Co., Ltd., located in Jinan city, Shandong Province, China (36°40′N–117°00′E), and the composting process lasted for 25 days from July 9, 2011. After 2 consecutive years of studying wheat straw composts, the compost experiments from the second year were chosen for further analysis. The samples used in this study were taken from a depth of ~30 cm in the composts, and each sample was a mixture of three parallel samples from different sampling sites. During the first 15 days, samples were taken beginning on day 3 and at 3-day intervals; on days 20 and 25 samples were also collected. Seven samples taken from the urea compost are referred to as 3e–25e, with the number corresponding to the sampling day. Three samples collected from the control compost are referred to as 3c, 12c and 25c. All ten samples were stored at –20 °C until use. Measurements of the temperature, water content, pH, electrical conductivity (EC) and lignocellulose content were performed exactly as described by Zhang et al. (2016). 2.2 DNA extraction, pyrosequencing and bioinformatic analyses
DNA was extracted from the compost samples with the PowerSoil® DNA Isolation Kit (MO-BIO Laboratories, Carlsbad, CA, USA) according to the manufacturer’s instructions. Triplicate extractions were conducted with each extraction using 0.25 g of compost material. The representative DNA sample was the mixture of these three extractions. A NanoDrop ® ND-1000 Spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA) was used to determine the DNA concentration at 260 nm. The DNA was stored at 4 °C for short-term use, or at –80 °C until needed. 16S rRNA genes were amplified from the extracted DNA using primers 27F (5′AGAGTTTGATCCTGGCTCAG -3′) and 533R (5′-TTACCGCGGCTGCTGGCAC-3′ ), while the amplifications of 18S rRNA genes were performed with primers 3NDF （5′- GGCAAGTCTGGTGCCAG -3′）and V4_euk_R （5′- ACGGTATCT(AG)ATC(AG)TCTTCG -3′）. The PCR conditions for 16S rRNA amplification were as follows: 95 °C for 5 min, then 30 cycles of 95 °C for 30 s, 51 °C for 30 s and 72 °C for 2 min, ending with 72 °C for 10 min. The amplification of 18S rRNA genes was similarly performed, except the annealing temperature was 55 °C. The amplicons were sequenced using the Roche GS FLX+ system with equimolar concentrations. The data quality was controlled by A Quantitative Insights Into Microbial Ecology (QIIME) pipeline, including length-based filtering and read-quality filtering. The bioinformatic analysis was performed as described by Zhang et al. (2016). The sequencing data reported here were deposited in the NCBI Sequence Read Archive under accession number PRJNA307303.
3. Results and discussion 3.1 Physicochemical properties of the compost samples The detected temperatures of the composts were all below 60 °C throughout the process (Fig. 1). Higher temperatures were detected in the urea compost than in the control compost, indicating that the C/N ratio can improve the microbial activities, although the two composts displayed similar trends in temperature changes over time. Distinct from the changes in temperature, the moisture contents continuously decreased over time, from an initial value of 72% to final values of 42% and 36% for the urea and control composts, respectively. Generally speaking, the pH values indicated that both composts were mostly maintained in an alkaline environment, while the EC values rose substantially during the composting process. These results showed the correctness of the wheat straw compost as was expected (López-González et al., 2013). Measurements of the lignocellulose content revealed that, after a composting process that lasted for 25 days, only a small portion of the lignocellulose in the wheat straw, mainly that in the leaves, was depolymerized, with just 14% and 33% of hemicellulose and cellulose degraded, respectively (Fig. 1 and Fig. S1). The degradation degrees of lignocellulose were lower than those in maize straw compost under the same composting conditions, in which 26% and 37% of hemicellulose and cellulose were degraded, respectively (Zhang et al., 2015). The reason why hemicellulose and cellulose content increased in the later-stage of composting might be that the part of leaves in wheat straw was obviously degraded, while the remaining stems were more difficult to be degraded (Zhang et al., 2014). This indicated that the
wheat straw compost was inefficient in lignocellulose degradation. 3.2 Number of sequences obtained For the metagenomic libraries constructed by pyrosequencing, the number of filtered sequences, OTUs and Chao 1 index are listed in Table 1. Overall, a total of 12,706 16S rRNA sequences and 19,218 18S rRNA sequences were obtained. The coverage of the fungal libraries was over 98% according to the Chao 1 index and rarefaction curve, while the bacterial libraries had a lower coverage that also reached 90% (Table 1 and Fig. S2), indicating the possibility of further analysis of these reads. The overall bacterial and fungal OTU numbers detected were 2458 and 1097 at similarities of 97%, respectively. In comparison, in the maize straw compost, higher bacterial OTUs and lower fungal OTUs were detected (Zhang et al., 2015), which shows the impact of different substrates on the microbial communities. 3.3 Bacterial community composition Overall, 17 bacterial phyla were detected in the compost samples, and Proteobacteria, Bacteroidetes, Actinobacteria and Firmicutes were the dominant phyla (Fig. 2A). Proteobacteria was the most dominant phylum with a abundance of 37% and was negligibly affected by compost type or time. Bacteroidetes and Firmicutes were more abundant in the early stages of the urea compost, and their abundances peaked at 52% and 13% on day 3, respectively. In the control compost a low abundance of Bacteroidetes and high abundance of Firmicutes were detected. The abundance of Actinobacteria increased by 12% and 16% over time in the urea compost and control compost, respectively. However, these results were inconsistent
with previous studies, in which Actinobacteria and Firmicutes were considered to be the dominant phyla in composts (López-González et al., 2015; Zhang et al., 2015), revealing that there was no species succession within the compost communities. At the genus level, the high diversity and low abundances of the dominant bacterial communities also showed that the bacteria in the composts were not significantly selected or enriched during the composting process (Fig. 3, A). Genera affiliated with the phyla Proteobacteria and Bacteroidetes were the dominant members of bacterial communities over time in both composts, including the plant and animal pathogens Pseudomonas and Flexibacter etc. These results suggested the insufficiency of the innocent treatment in these compost systems (Mouriño et al., 2008). The genus Thermopolyspora, belonging to Actinobacteria, has been widely identified as a dominant lignocellulose degrader in composts (Zhang et al., 2015). Its low abundance in this study revealed that such representatives of lignocellulose degrading bacteria had not been enriched after wheat straw composting, which was supported by the low enzymatic activities detected. 3.4 Fungal community composition Ascomycota was the most dominant phylum of the fungal community, accounting for 59% of all reads (Fig. 2B). Ascomycota has been widely identified as the dominant phylum in compost fungal communities before (Adrian et al., 2014; Zhang et al., 2015; Zhang et al., 2016). In this study, Ascomycota was also determined to be the most dominant fungus in both composts. However, compared with the maize straw compost, in which nearly 90% of all reads were assigned to Ascomycota, a lower abundance of
Ascomycota was detected here, indicating that the dominant fungal microbes were less enriched when wheat straw was used as the substrate. At the genus level, Thermomyces belonging to the Ascomycota phylum was the dominant microbe, and its abundance constantly rose from 5% to 25% over time in the urea compost (Fig. 3B). In contrast, Thermomyces in the control compost was more abundant at the beginning of the compost, with a proportion of 52% on day 3. The high abundance of this genus in the control compost (52%) indicated that it could become the dominant microbe when the composting started under conditions of a high C/N ratio, which was proved in our previous studies (Zhang et al., 2015). These results indicated that the usual dominant lignocellulose degrading communities had not developed during the composting process, and that lignocellulose was only partly degraded, while the main objective of rapid natural composting was to perform the innocent treatment of agricultural wastes in a fast and cost-effective way. The results of enzymatic assays also showed that enzymatic activity was nearly undetectable, and the protein content was too low to conduct metaproteomic analysis (data not shown). As a monocotyledonous plant, the accessibility of wheat straw to external enzymes is primarily limited by the waxy layer covering the leaves and the heterogenetic structure of the lignocellulose (Motte et al., 2015). In conclusion, because of the high biomass recalcitrance of wheat straw and the subsequent insufficient innocent treatment of composts, wheat straw was a less efficient substrate for rapid natural lignocellulosic composting when compared with maize straw.
4.
Conclusions Wheat straw was only partly degraded at the end of the composting process,
leading to the formation of a relatively low temperature environment (< 60°C). In addition, the metagenomic analysis revealed that those microbial communities that normally dominate lignocellulose degradation were not enriched after composting. However, pathogenic microbes represented by Proteobacteria and Bacteroidetes remained within the composts, indicating insufficient innocent treatment during wheat straw composting. Together, these results suggest that comparing with maize straw, wheat straw is an inefficient substrate for rapid natural composting. Besides, metagenomic methods were successfully used to assess the degree of innocent treatment of the composts.
Acknowledgments This work was supported by grants from the Major National Science and Technology Projects (Grant Number: 2013ZX10004217), the Fundamental Research Funds of Shandong University (Grant Number: 2015YQ004) and the Natural Science Foundation of Shandong Province (Grant Number: ZR2013CM038).
References 1.
Adrian, L.F., Urooj, Z., Alan, H., Thomas, B., Graeme, F., Robson, G.D. 2014. Fungal succession in an in-vessel composting system characterized using 454 pyrosequencing. FEMS Microbiol. Ecol. 88(2), 296-308.
2.
Bernal, M.P., Alburquerque, J.A., Moral, R. 2009. Composting of animal manures and chemical criteria for compost maturity assessment. A review. Bioresour. Technol. 100(22), 5444-5453.
3.
de Gannes, V., Eudoxie, G., Hickey, W.J. 2013. Prokaryotic successions and diversity in composts as revealed by 454-pyrosequencing. Bioresour. Technol. 133, 573-580.
4.
Hargreaves, J.C., Adl, M.S., Warman, P.R. 2007. A review of the use of composted municipal solid waste in agriculture. Agr. Ecosyst. Environ. 123(s 1–3), 1–14.
5.
López-González, J., Suárez-Estrella, F., Vargas-García, M., López, M., Jurado, M., Moreno, J. 2015. Dynamics of bacterial microbiota during lignocellulosic waste composting: Studies upon its structure, functionality and biodiversity. Bioresour. Technol. 175, 406-416.
6.
López-González, J.A., López, M.J., Vargas-García, M.C., Suárez-Estrella, F., Jurado, M., Moreno, J. 2013. Tracking organic matter and microbiota dynamics during the stages of lignocellulosic waste composting. Bioresour. Technol. 146(0), 574-584.
7.
Ming, C., Xu, P., Zeng, G., Yang, C., Huang, D., Zhang, J. 2015. Bioremediation of soils contaminated with polycyclic aromatic hydrocarbons, petroleum, pesticides, chlorophenols and heavy metals by composting: Applications, microbes and future research needs. Biotechnol Adv. 33(1), 745-755.
8.
Motte, J.C., Watteau, F., Escudié, R., Steyer, J.P., Bernet, N., Delgenes, J.P., Dumas, C. 2015. Dynamic observation of the biodegradation of lignocellulosic tissue under solid-state anaerobic conditions. Bioresour. Technol. 191, 322-326.
9.
Mouriño, J.L.P., Vinatea, L., Buglione-Neto, C., Ramirez, C.T., Vieira, F.N., Pedrotti, F., Martins, M.L., Derner, R.B., Aguilar, M., Beltrame, E. 2008. Characterization and experimental infection of Flexibacter maritimus (Wakabayashi et al. 1986) in hatcheries of post-larvae of Litopenaeus vannamei Boone, 1931. Braz. J Biol. 68(1), 173-177.
10. Petiot C., Guardia A., D. 2013. Composting in a Laboratory Reactor: A Review. Compost. Sci. Util. 12(1), 69-79. 11. Talebnia, F., Karakashev, D., Angelidaki, I. 2010. Production of bioethanol from wheat straw: An overview on pretreatment, hydrolysis and fermentation. Bioresour. Technol. 101(13), 4744–4753. 12. Tuomela, M., Vikman, M., Hatakka, A., Itävaara, M. 2000. Biodegradation of lignin in a compost environment: a review. Bioresour. Technol. 72(2), 169-183. 13. Wilson, D.B. 2011. Microbial diversity of cellulose hydrolysis. Bioresour. Technol. 14(3), 259-263. 14. Zhang, H., Fangel, J.U., Willats, W.G.T., Selig, M.J., Lindedam, J., Jørgensen, H., Felby, C. 2014. Assessment of leaf/stem ratio in wheat straw feedstock and impact on enzymatic conversion. GCB Bioenergy. 6(1), 90–96. 15. Zhang, L., Ma, H., Zhang, H., Xun, L., Chen, G., Wang, L. 2015. Thermomyces lanuginosus is the dominant fungus in maize straw composts. Bioresour. Technol. 197, 266-275.
16. Zhang, L., Zhang, H., Wang, Z., Chen, G., Wang, L. 2016. Dynamic changes of the dominant functioning microbial community in the compost of a 90-m3 aerobic solid state fermentor revealed by integrated meta-omics. Bioresour. Technol. 203, 1-10.
Figure Captions Fig. 1. Compost physicochemical properties. A–D represent the changes in temperature, moisture content, pH and EC value over time, respectively; E shows the lignocellulose contents of samples from the urea compost. Urea, urea compost; Control, control compost.
Fig. 2. Phylum level composition of bacterial (A) and fungal (B) communities in composts.
Fig. 3. Heat map of the compositions of dominant genera of the bacterial (A) and fungal (B) communities. Genera with ≥ 1% abundance in the total library are listed. The colour intensity is associated with the abundance of the genus in each sample.
Table 1 List of the sample origin and characteristics of amplicon libraries. Bacteri
Sequenc
a
es OTUs Chao1
Fungi
Sequenc es OTUs Chao1
3e
6e
9e
12e
15e
20e
25e
3c
12c
25c
101 3 182 288
108 2 253 318
109 3 237 339
189 2 268 346
152 9 266 377
193 4 275 347
171 5 299 364
721 238 304
961 226 297
766 214 277
209 5 121 133
154 8 101 122
186 4 134 155
214 1 110 129
197 5 93 121
191 2 118 174
205 9 124 175
199 0 98 152
193 7 91 109
169 7 107 129
Total 1270 6 2458
1921 8 1097
Highlights
Wheat straw was an inefficient substrate for rapid natural composting
Relative low temperature in composts did not support community succession
Metagenomic method can assess the degree of innocent treatment of composts
Innocent treatment in wheat straw compost was less effective and required more time