- Email: [email protected]
Whole exome sequencing identified two homozygous ALMS1 mutations in an Iranian family with Alström syndrome
Journal Pre-proofs Short communication Whole Exome Sequencing identified two homozygous ALMS1 Mutations in an Iranian Family with Alström Syndrome Shahram Torkamandi, Somaye Rezaei, Reza Mirfakhraei, Masomeh Askari, Samira Piltan, Milad Gholami PII: DOI: Reference:
S0378-1119(19)30887-X https://doi.org/10.1016/j.gene.2019.144228 GENE 144228
To appear in:
Gene Gene
Received Date: Revised Date: Accepted Date:
23 July 2019 22 October 2019 23 October 2019
Please cite this article as: S. Torkamandi, S. Rezaei, R. Mirfakhraei, M. Askari, S. Piltan, M. Gholami, Whole Exome Sequencing identified two homozygous ALMS1 Mutations in an Iranian Family with Alström Syndrome, Gene Gene (2019), doi: https://doi.org/10.1016/j.gene.2019.144228
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Elsevier B.V. All rights reserved.
Whole Exome Sequencing identified two homozygous ALMS1 Mutations in an Iranian Family with Alström Syndrome Shahram Torkamandia, Somaye Rezaeib, Reza Mirfakhraeic, Masomeh Askarid, Samira Piltanc, Milad Gholamie,*[email protected] aDepartment
of Medical Genetics and Immunology, Faculty of Medicine, Urmia University of Medical Sciences,
Urmia, Iran bDepartment
of Neurology, Imam Khomeini Hospital, Urmia University of Medical Sciences, Urmia, Iran
cDepartment
of Medical Genetics, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
dDepartment
of Genetics at Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran eDepartment
of Biochemistry and Genetics, School of Medicine, Arak University of Medical Sciences, Arak, Iran
*Corresponding author.
Highlights Alström syndrome is an extremely rare ciliopathy WES is very useful in the accurate and early diagnosis of diseases with gradually emerging symptoms Different mutation profiles of ALMS1 may be lead to clinical heterogeneity
Abstract Alström syndrome (AS) is a rare monogenic multi-system ciliopathy disorder with cardinal features, including cone-rod dystrophy, sensory neural hearing loss, metabolic dysfunctions and multiple organ failure caused by bi-allelic mutations in a centrosomal basal body protein-coding gene known as ALMS1. This study aimed to identify pathogenic mutations in a consanguineous Iranian family with AS. Nextgeneration sequencing was performed on the genomic DNA obtained from a 12 years old girl with AS. According to the bioinformatics analysis, computational modelling and segregation of variants, we identified two homozygous mutations close together in exon 8 of ALMS1 in the patient, including c.7262 G>T and c.7303-7305delAG. The clinically normal parents were heterozygous for both mutations. These mutations have a very rare frequency and only reported in the heterozygous state in the public genomic databases. Overall, due to the large size of the ALMS1 gene and clinical similarity with other ciliopathies and genetic disorders, whole exome sequencing can be useful for the identification of pathogenic mutations and the improvement of AS clinical management.
Abbreviations: ALMS1, Alstrom Syndrome Protein 1; AS, Alström syndrome; SNHL, bilateral sensorineural hearing loss; BBS, Bardet-Biedl Syndrome; LCA, Leber Congenital Amaurosis; WES, whole exome sequencing; gDNA, Genomic DNA; BWA, Burrows-Wheeler Aligner; MAF, minor allele frequency; PCR, polymerase chain reaction; OCT, optical coherence tomography; HC, head circumference; LVEF, left ventricular ejection fraction; CADD, Combined Annotation Dependent Depletion scores; Ile, isoleucine; Ser, Serine; T2DM, type 2 diabetes mellitus; GLUT4, glucose transporter 4
Keywords: Alström syndrome, Whole exome sequencing, ALMS1, Iran
Introduction Alström syndrome (AS) (ALMS; OMIM# 203800) as an autosomal recessive inherited ciliopathy disease, is extremely rare with a prevalence of less than 1 to 10 per million in the population (Marshall, Maffei, Collin, & Naggert, 2011). Patients are characterized by multisystem clinical symptoms. Early-onset progressive cone-rod retinal degeneration with secondary nystagmus, photophobia, and visual impairment which leads to blindness up to first 15 months of life, is a cardinal observed in affected individuals. They also have more major features, including truncal obesity, insulin resistance, type 2 diabetes mellitus,
bilateral sensorineural hearing loss (SNHL), pulmonary disease, renal disease, dilated or restrictive cardiomyopathy and multiple organ failure (Brofferio et al., 2017; Purvis et al., 2010; Richard B Paisey, 2019). However, the diagnosis of AS can be a challenging task due to its rarity, its gradual emergence of cardinal symptoms and its similarity with other ciliopathy and genetic disorders, such as Bardet-Biedl Syndrome (BBS), idiopathic cardiomyopathy, Leber Congenital Amaurosis (LCA) and some inherited mitochondrial dysfunctions (Dyer, Wilson, Small, & Pai, 1994; Katagiri et al., 2013). AS results from biallelic homozygous or compound heterozygous mutations mostly in the hot-spot exons 8, 10 and 16 in the ALMS1 gene located at chromosome 2p13.1 containing 23 exons (Marshall et al., 2015). ALMS1 protein is ubiquitously expressed and localized to the cytoplasm, cytoskeleton, microtubule organization center, centrosome and basal bodies of ciliated cells of tissues such as photoreceptor, endocrine and central nervous system (Hearn, 2019). The deepen understanding of ALMS1 in the pathogenesis of AS disease is still be elucidated even though its function in the formation and maintenance of cilia, cell cycle regulation, endosomal trafficking, cell differentiation, and extracellular production has been known (Marshall et al., 2015). Recent years with the advent of next-generation sequencing, remarkable progress has been achieved in the field of medical genetics, and here we used whole exome sequencing (WES) to report the molecular finding in an Iranian family with AS. Methods Editorial Policies and Ethical Considerations The patient was a 12-year-old girl, and her parents were immediate cousins (Fig.1.A). Informed consent was obtained from the parents. This study was approved by the Ethics Committee of the Arak University of Medical Sciences, Arak, Iran (IR.ARAKMU.REC.1398.070). Whole- exome sequencing and bioinformatics analysis Genomic DNA (gDNA) from the proband and her parents was extracted from peripheral blood samples using salting out method. The quality and concentration of gDNA were assessed with the NanoDrop 1000
(NanoDrop; Thermo Fisher Scientific, Inc., Wilimington, DE, USA). One µg of gDNA from proband was sheared, and exome capture was carried out using SureSelectXT2 V6 Exome. The enriched libraries were sequenced by paired-end read on the Illumina HiSeq2000 platform using TruSeq v3 chemistry. Read files (Fastq) were generated from the sequencing platform via the manufacturer's proprietary software. The Fastq file was trimmed to remove the adaptor, and low quality reads and were aligned to human reference genome hg19 using Burrows-Wheeler Aligner (BWA). Duplicate reads were marked using Picard version 1.107. Additional BAM file manipulations were completed using Samtools 0.1.18. SNP and indel variants were called by the GATK Unified Genotyper. The variants were annotated by ANNOVAR and filtered against dbSNP137
(https://www.ncbi.nlm.nih.gov/snp/),
(http://www.internationalgenome.org)
,
ExAC
1000Genome
(http://exac.broadinstitute.org/)
projects ,
gnomAD
(https://gnomad.broadinstitute.org/) and Iranome web database as a local exome variants reference (Akbari MR, 2017). Only low-frequency variants with minor allele frequency (MAF) less than 0.01 were selected for further analysis. Novel and rare variants in the coding or splicing regions were prioritized based on being nonsynonymous, indel and putative splice site. Predicated pathogenicity of the candidate variants were evaluated in silico using predictor tools including SIFT (https://sift.bii.a-star.edu.sg/), Polyphen2 (http://genetics.bwh.harvard.edu/pph2/) and, MutationTaster (http://www.mutationtaster.org/). The homozygous variants were prioritized based on the autosomal recessive inheritance in the subject pedigree. Finally, for variant confirmation and segregation analysis, polymerase chain reaction (PCR) was designed to amplify targeted variants by using primers (F-5’CCCTTGCCCGTTTCAGAGAT3’ and R5’TTACCATGTGCTCGTACCCG-3’). The purified amplicon was sequenced with an automated sequencer (AB3730; Applied Biosystems, Foster City, CA, USA) and sequences were compared against Transcript NM_015120.4 using Sequencher software 5.4.6. In silico prediction of the 3D structure of the affected ALMS1 protein The internal 1,400 out of 4,169 amino-acid flanking the identified mutations of ALMS1 protein (UniProt: Q8TCU4) was used to generate a three dimensional (3D) structural protein. With the based on 5JCS protein
structure in the Protein Data Bank (PDB) from Saccharomyces cerevisiae, the 3D structure was developed by the I-TASSER web server (Yang et al., 2015). PyMol software was used for the inspection and visualization of the 3D protein structure modeling. Moreover, the HOPE project (Venselaar, Te Beek, Kuipers, Hekkelman, & Vriend, 2010) and MetaDome (Wiel, Venselaar, Veltman, Vriend, & Gilissen, 2017) were used to analyze the structural effects and tolerance of point mutation in the ALMS1 protein. Results Clinical description The patient was noticed because of nystagmus and photodysphoria and then progressive decreased visual acuity during the first years of age. At the age of 12 years, optical coherence tomography (OCT) revealed thinned pigmentation and irregularly arrangement of the retina. Cone-rod dystrophy was confirmed with electroretinography, and fundus examination revealed narrowing of retinal vessels and retinal degeneration of both eyes. She was underweight at birth, with a weight of 2790 g (25th centile), head circumference (HC) of 33 cm (25th centile) and height (HT) of 49 cm (50th centile). Hyperphagia and overweight began during the first year of life and resulting in obesity by the age of 4 years. Currently, her weight is 68.3 kg (95th centile), and height is 152 cm (50th centile) with body mass index > 29.5 that fall within overweight/obese range. Progressive bilateral sensorineural hearing loss was beginning at three years old. Also, otitis media was reported in her clinical history at the age of 5 years. Audiometry examination indicated moderate mixed hearing loss at the age of 12 years. Echocardiography indicated dilated cardiomyopathy, diastolic dysfunction, and reduced left ventricular ejection fraction (LVEF) ranges from 33-40 percent at the age of 10 years. Renal ultrasonography showed hyperechogenicity in the medulla. General examination and metabolic evaluation showed acanthosis nigricans, hypertriglyceridemia, hyperlipidemia and, type 2 diabetic mellitus, which she was started on metformin therapy. Identification of two homozygous mutations in ALMS1
Bioinformatics analyses of the WES data identified 432,837 variants filtered based on steps summarized in table1. Given the autosomal recessive inheritance, 79 homozygous variants were prioritized for further investigation. After extensive bioinformatics analysis, two allelic homozygous mutations in the ALMS1 (GenBank: NM_015120.4) were founded in the affected child; including, c.7262 G>T; p.(Ser2421Ile), and c.7303-7305delAG , p.(Glu2435Valfs*7). These variants were confirmed by bi-directional Sanger sequencing, followed by segregation analysis in the pedigree, and were heterozygous in the clinical normal parents (Fig.1. B, C). These mutations have not been reported in the ExAC; however, were described with an extremely rare frequency in the gnomAD (MAF: 4.01e-6). Additionally, according to the Iranome, these mutations were very rare in the Iranian population (MAF: 6.25×10-5; 1 out 1600 alleles). We performed in silico translation analysis for homozygous frameshift mutation using the ExPASy-translate tool. Our results demonstrated that deletion of the AG nucleotides at exon 8 of ALMS1 leads to a frameshift mutation that results in a premature stop-codon downstream of the mutation p.(Glu2435Valfs*7). This mutation was previously reported as a pathogenic variant in the ClinVar database (accession number: VCV000459884). Frameshift and missense variants found in our patient, have high Combined Annotation Dependent Depletion scores (CADD; scores 42 and 31 respectively) and were predicted to be deleterious and damaging by predictive software’s (Polyphen-2, SIFT and Mutation Taster) even though the missense mutation should be consider as a VUS (variant with unknown significance). Both of these positions are highly conserved across several species (Fig.1.D). We obtained a 3D structure of ALMS1 by I-TASSER (Fig2.A). The structural quality was 99.9% coverage, C-Score= -1.39 and TM-Score= 0.54±4.1 Aº within the range of accepted for a significant model with high homology-based structure. The HOPE server with using the UniProt-database and Reprof software reported that p.Ser2421Ile mutation destabilizes the protein local conformation structure. Molecular 3D structure modeling demonstrated that the mutant amino acid (Ile) is bigger and more hydrophobic than wild amino acid (Ser) which can result in loss of hydrogen bond and disturbs the correct folding and function of the nearby putative leucine-zipper motif (Fig2.B, C). Then, the MetaDome web server was used to calculate a
missense-over-synonymous ratio as a tolerance landscape at the position of identified mutations with data from gnomAD and ClinVar. We recognized that p.Ser2421Ile and p.(Glu2435Valfs*7) mutations were located in the intolerant region of ALMS1 protein (Fig 2.D). Discussion In this study, we report the identification of two ALMS1 mutations that cause of AS in an Iranian consanguine family. These mutations were previously reported with extremely rare frequencies in genomic data bases, and only the frameshift mutation was previously reported as a pathogenic variant in an AS patient due to the absent or disrupt protein product in the compound heterozygous state (Marshall, Hinman, et al., 2007). Interestingly, we identified both mutations inherited in Cis; actually, the parents were heterozygous and the affected child was homozygous for both mutations. We have not performed functional studies regarding the observed mutations; therefore, it is hard to predict the effect of more than one mutation on one allele in disease severity even though it has been previously reported third deleterious variants in Turkey ethnicity AS patients (Ozanturk et al., 2015). According to advocated clinical criteria for the identification of AS, in patients with the age of 3-14 years old, they should have two major criteria or one major and three minor criteria to fulfill the diagnostic of AS (Marshall, Beck, Maffei, & Naggert, 2007). Our patient was 12 years old girl and displayed two major criteria (homozygous mutations in ALMS1 and vision problems including nystagmus, photophobia, restricted acuity and, cone dystrophy), she also had some minor criteria (type 2 diabetic mellitus, insulin resistance, obesity, bilateral sensory neural hearing loss and progressive renal failure). However, due to the rarity of AS, delay in onset of some of the cardinal features, inter and intra familial clinical heterogeneity and also, overlapping phenotype with other ciliopathies and genetic disorders particularly Bardet-Biedl Syndrome (BBS), often complicated the universal diagnosis and defined clear genotype-phenotype correlation (Alvarez-Satta, Castro-Sanchez, & Valverde, 2015). Comparing the clinical features of our patient to those from AS studies revealed that the cardinal features of AS, including cone-rod dystrophy, obesity, SNHL, dilated cardiomyopathy, T2DM and skin changes of acanthosis nigricans are consistent with those from previous reports (Casey et al., 2014;
Marshall et al., 2005). On the other hand, some clinical findings were not observed in our patient, including epilepsy, hepatic disease and, cognitive impairment (Marshall et al., 2005; Sanyoura et al., 2014). Interestingly, patients with mutations in exon 8 of ALMS1 have been reported to show normal or delayed/milder renal disease compared with those with mutations in exon 10 and 16, but our patient exhibited progressive renal complication as a major cause of AS morbidity (Katagiri et al., 2013). According to the expression data from Human Protein Atlas, ALMS1 is a widely large expressed protein, even though its expression is context dependent (Uhlen et al., 2015). This protein has several sequence features, including a large extensive tandem repeat, additional low complexity short coiled-coil domains and an ALMS motif located at the C-terminus that has sequence similarity with some of the human proteins. According to a recent study, a relatively small internal region from residues 2,261-2,602; in the mutated region in our patient, and a larger C-terminus region from residues 3,176-4,169 have important roles and essential for ALMS1 protein-protein interaction with the centrosomes and ciliary basal bodies (Knorz et al., 2010). Moreover, the data from functional protein associated networks STRING (https://string-db.org/ ) showed that the most predicted functional partners have important roles in formation and maintenance of centrosome and cilia, intracellular trafficking, controlling cell polarities such as cochlear sensory epithelium and cell signalling including Wnt pathways. We assessed the potential effect of the missense mutation p.(Ser2421Ile) by performing computational modelling. The missense mutation lies within a conserved region (residues 2,261-2,602) and alters a conserved amino acid. Also, in silico translational analysis demonstrated that the frameshift mutation p.(Glu2435Valfs*7) leads to a premature stop codon. This mutation either can initiate degradation of ALMS1 mRNA through nonsense-mediated-decay (NMD) machinery, or if it is expressed, the protein would not have two aforementioned conserved regions. Hence, this homozygous truncated mutation in combination with homozygous missense mutation, result in AS due to the ALMS1 loss of function or lacking of expression. It has been reported that mice with truncating mutation in exon 8 (Alms1foz/foz mouse model of AS) exhibited postnatal loss of primary cilia on hypothalamic neurons involved in satiety regulation (Heydet et al., 2013). Alms1GT/GT mice model of AS with a gene trap in intron 13 and some complementary studies revealed that α-actinin directly has interaction
with ALMS1 and through glucose transporter 4 (GLUT4) trafficking has an important role in glucose hemostasis (Favaretto et al., 2014). The whole exome sequencing of several children’s with mitogenic cardiomyopathy has identified pathogenic variants in ALMS1 (Casey et al., 2014; Long, Evans, & Olson, 2017; Shenje et al., 2014). The knockdown of Alms1 mRNA in the neonatal murine cardiomyocyte cultured cell, activated the Wnt/β-catenin signalling cascade, and increased the number of cardiomyocytes cytokinesis through the cell cycle proliferation (Shenje et al., 2014). Multiple lines of evidence have elucidated the role of ALMS1 in intracellular trafficking and regulation of extracellular matrix interactions. Collin et al. identified several partner proteins, mainly α-actinins isoforms and other proteins associated with endosome recycling and centrosome function, which directly interact with C terminus of murine ALMS1 (Collin et al., 2012). They also identified that Alms1 is required for the correct localization of rhodopsin to the outer nuclear layer (ONL) and Alms1 knockout mice showed modified outer segments of photoreceptors due to defective intracellular trafficking (Collin et al., 2005). Collectively, impaired intracellular transport across the connecting cilium is the cause of progressive retinal degeneration in AS patients. Given these reports, the destructive effect of identified frameshift and missense variants on the function of ALMS1 in this study are consistent with our patient clinical symptoms. In conclusion, by using WES, we identified two homozygous mutations inherited in Cis on each allele of ALMS1 in a child from a consanguineous marriage. We confirmed the pathogenicity of these variants through bioinformatics analysis, computational modeling and segregation in the pedigree. It should be reminded that WES is very useful in the accurate and early diagnosis of diseases with gradually emerging symptoms such as AS, and this is very important for the effective clinical management of patients. Conflict of Interest The authors declare that they have no conflict of interest. Acknowledgement The authors sincerely thank the patient and her parents for participation in the study.
References Akbari MR, F. Z., Beheshtian M, Mohseni M, Poustchi H, Sellars E, Nezhadi H, Amini A, Arzhangi S, Jalalvand K, Jamali P, Davarnia B, Nikuei P, Oladnabi M, Mohammadzadeh A, Zohrehvand E, Shamsi-Gooshki E, Börno S, Timmermann B, Najafipour R, Khorram Khorshid HR, Kahrizi K, Najmabadi H. (2017). Iranome: A human genome variation database of eight major ethnic groups that live in Iran and neighboring countries in the Middle East. Retrieved from: http://www.iranome.ir/ Alvarez-Satta, M., Castro-Sanchez, S., & Valverde, D. (2015). Alstrom syndrome: current perspectives. Appl Clin Genet, 8, 171-179. doi:10.2147/TACG.S56612 Brofferio, A., Sachdev, V., Hannoush, H., Marshall, J. D., Naggert, J. K., Sidenko, S., . . . Gunay-Aygun, M. (2017). Characteristics of cardiomyopathy in Alstrom syndrome: Prospective single-center data on 38 patients. Mol Genet Metab, 121(4), 336-343. doi:10.1016/j.ymgme.2017.05.017 Casey, J., McGettigan, P., Brosnahan, D., Curtis, E., Treacy, E., Ennis, S., & Lynch, S. A. (2014). Atypical Alstrom syndrome with novel ALMS1 mutations precluded by current diagnostic criteria. Eur J Med Genet, 57(2-3), 55-59. doi:10.1016/j.ejmg.2014.01.007 Collin, G. B., Cyr, E., Bronson, R., Marshall, J. D., Gifford, E. J., Hicks, W., . . . Naggert, J. K. (2005). Alms1-disrupted mice recapitulate human Alstrom syndrome. Hum Mol Genet, 14(16), 2323-2333. doi:10.1093/hmg/ddi235 Collin, G. B., Marshall, J. D., King, B. L., Milan, G., Maffei, P., Jagger, D. J., & Naggert, J. K. (2012). The Alstrom syndrome protein, ALMS1, interacts with alpha-actinin and components of the endosome recycling pathway. PLoS One, 7(5), e37925. doi:10.1371/journal.pone.0037925 Dyer, D. S., Wilson, M. E., Small, K. W., & Pai, G. S. (1994). Alstrom syndrome: a case misdiagnosed as Bardet-Biedl syndrome. J Pediatr Ophthalmol Strabismus, 31(4), 272-274. Favaretto, F., Milan, G., Collin, G. B., Marshall, J. D., Stasi, F., Maffei, P., . . . Naggert, J. K. (2014). GLUT4 defects in adipose tissue are early signs of metabolic alterations in Alms1GT/GT, a mouse model for obesity and insulin resistance. PLoS One, 9(10), e109540. doi:10.1371/journal.pone.0109540 Hearn, T. (2019). ALMS1 and Alstrom syndrome: a recessive form of metabolic, neurosensory and cardiac deficits. J Mol Med (Berl), 97(1), 1-17. doi:10.1007/s00109-018-1714-x Heydet, D., Chen, L. X., Larter, C. Z., Inglis, C., Silverman, M. A., Farrell, G. C., & Leroux, M. R. (2013). A truncating mutation of Alms1 reduces the number of hypothalamic neuronal cilia in obese mice. Dev Neurobiol, 73(1), 1-13. doi:10.1002/dneu.22031 Katagiri, S., Yoshitake, K., Akahori, M., Hayashi, T., Furuno, M., Nishino, J., . . . Iwata, T. (2013). Whole-exome sequencing identifies a novel ALMS1 mutation (p.Q2051X) in two Japanese brothers with Alstrom syndrome. Mol Vis, 19, 2393-2406. Knorz, V. J., Spalluto, C., Lessard, M., Purvis, T. L., Adigun, F. F., Collin, G. B., . . . Hearn, T. (2010). Centriolar association of ALMS1 and likely centrosomal functions of the ALMS motif-containing proteins C10orf90 and KIAA1731. Mol Biol Cell, 21(21), 3617-3629. doi:10.1091/mbc.E10-03-0246 Long, P. A., Evans, J. M., & Olson, T. M. (2017). Diagnostic Yield of Whole Exome Sequencing in Pediatric Dilated Cardiomyopathy. J Cardiovasc Dev Dis, 4(3). doi:10.3390/jcdd4030011 Marshall, J. D., Beck, S., Maffei, P., & Naggert, J. K. (2007). Alstrom syndrome. Eur J Hum Genet, 15(12), 1193-1202. doi:10.1038/sj.ejhg.5201933 Marshall, J. D., Bronson, R. T., Collin, G. B., Nordstrom, A. D., Maffei, P., Paisey, R. B., . . . Nishina, P. M. (2005). New Alstrom syndrome phenotypes based on the evaluation of 182 cases. Arch Intern Med, 165(6), 675-683. doi:10.1001/archinte.165.6.675 Marshall, J. D., Hinman, E. G., Collin, G. B., Beck, S., Cerqueira, R., Maffei, P., . . . Naggert, J. K. (2007). Spectrum of ALMS1 variants and evaluation of genotype-phenotype correlations in Alstrom syndrome. Hum Mutat, 28(11), 1114-1123. doi:10.1002/humu.20577 Marshall, J. D., Maffei, P., Collin, G. B., & Naggert, J. K. (2011). Alstrom syndrome: genetics and clinical overview. Curr Genomics, 12(3), 225-235. doi:10.2174/138920211795677912 Marshall, J. D., Muller, J., Collin, G. B., Milan, G., Kingsmore, S. F., Dinwiddie, D., . . . Naggert, J. K. (2015). Alstrom Syndrome: Mutation Spectrum of ALMS1. Hum Mutat, 36(7), 660-668. doi:10.1002/humu.22796
Ozanturk, A., Marshall, J. D., Collin, G. B., Duzenli, S., Marshall, R. P., Candan, S., . . . Ozgul, R. K. (2015). The phenotypic and molecular genetic spectrum of Alstrom syndrome in 44 Turkish kindreds and a literature review of Alstrom syndrome in Turkey. J Hum Genet, 60(1), 1-9. doi:10.1038/jhg.2014.85 Purvis, T. L., Hearn, T., Spalluto, C., Knorz, V. J., Hanley, K. P., Sanchez-Elsner, T., . . . Wilson, D. I. (2010). Transcriptional regulation of the Alstrom syndrome gene ALMS1 by members of the RFX family and Sp1. Gene, 460(1-2), 20-29. doi:10.1016/j.gene.2010.03.015 Richard B Paisey, F., Rick Steeds, Tim Barrett, Denise Williams, Tarekegn Geberhiwot, Meral Gunay-Aygun. (2019). Alström Syndrome. Retrieved from https://www.ncbi.nlm.nih.gov/books/NBK1267/ Sanyoura, M., Woudstra, C., Halaby, G., Baz, P., Senee, V., Guillausseau, P. J., . . . Julier, C. (2014). A novel ALMS1 splice mutation in a non-obese juvenile-onset insulin-dependent syndromic diabetic patient. Eur J Hum Genet, 22(1), 140-143. doi:10.1038/ejhg.2013.87 Shenje, L. T., Andersen, P., Halushka, M. K., Lui, C., Fernandez, L., Collin, G. B., . . . Judge, D. P. (2014). Mutations in Alstrom protein impair terminal differentiation of cardiomyocytes. Nat Commun, 5, 3416. doi:10.1038/ncomms4416 Uhlen, M., Fagerberg, L., Hallstrom, B. M., Lindskog, C., Oksvold, P., Mardinoglu, A., . . . Ponten, F. (2015). Proteomics. Tissue-based map of the human proteome. Science, 347(6220), 1260419. doi:10.1126/science.1260419 Venselaar, H., Te Beek, T. A., Kuipers, R. K., Hekkelman, M. L., & Vriend, G. (2010). Protein structure analysis of mutations causing inheritable diseases. An e-Science approach with life scientist friendly interfaces. BMC Bioinformatics, 11, 548. doi:10.1186/1471-2105-11-548 Wiel, L., Venselaar, H., Veltman, J. A., Vriend, G., & Gilissen, C. (2017). Aggregation of population-based genetic variation over protein domain homologues and its potential use in genetic diagnostics. Hum Mutat, 38(11), 1454-1463. doi:10.1002/humu.23313 Yang, J., Yan, R., Roy, A., Xu, D., Poisson, J., & Zhang, Y. (2015). The I-TASSER Suite: protein structure and function prediction. Nat Methods, 12(1), 7-8. doi:10.1038/nmeth.3213
Fig. 1. A) The family pedigree B) The mutation status of ALMS1 c.7262 G>T and c.7303-7305delAG was confirmed by the Sanger sequencing (Mutation location indicated with dashed line red box) in the Father, Mother and Affected child genomics. The patient was homozygous for c.7262G>T, and c.7303-7305delAG and her parents were in the heterozygous state. C) The location of mutations (in red) in a schematic diagram showing all exons (Gray boxes), introns and UTR of ALMS1, GenBank: NG_011690.1and, the 4169 amino acid protein, GenBank: NP_055935.4. Protein features and motif include polyglutamic acid, poly alanine, serine-rich, large tandem repeat, leucine zipper, and ALMS motif D) Multiple sequence alignment of ALMS1 at the position of identified mutations. The position of mutations indicated with a red triangle. WT: wild type allele, Mut: Mutant allele, C: C-terminus, N: N terminus, fs: frameshift (Color figures can be included in the online version of the Journal) Fig. 2. A) Overall cartoons structure of ALMS1 (1400 amino acid out of 4169) was created with I-TASSER modelling. B, C) The magnified black backgrounds view of the normal and mutated residues at position 2421 of ALMS1 protein are shown as sticks (Serine as normal and Isoleucine as mutant residue). D) A tolerance landscape for ALMS1 was created with MetaDome web server. The mutations located in the
intolerant regions based on a missense-over-synonymous ratio. (Color figures can be included in the online version of the Journal)
Table 1. Filtering strategy for variant detection
Total number of variant
4,32,837
Total number of SNP
366973
Total number of INDEL
65868
Variants remaining on exonic, exonicsplicing and splicing region
22675
SNP variant on exonic, exonicsplicing and splicing region
21910
INDEL variant on exonic, exonicsplicing and splicing region
765
SNP variant remaining after filtering for synonymous
11574
Variants after filtering for 1000 genomes (MAF ≤ 0.01)
1469
Variants after filtering for Exome Variant Server (MAF ≤ 0.01)
701
Novel SNP variant
172
Variant INDEL Novel
56
Number of rare and novel homozygous variant
79
Number of rare and novel heterozygous variant
622
Homozygous SNP variants remaining after excluding benign variants with polyphen2, Sift and mutation taster
5
Homozygous novel INDEL variants
11
S0378-1119(19)30887-X https://doi.org/10.1016/j.gene.2019.144228 GENE 144228
To appear in:
Gene Gene
Received Date: Revised Date: Accepted Date:
23 July 2019 22 October 2019 23 October 2019
Please cite this article as: S. Torkamandi, S. Rezaei, R. Mirfakhraei, M. Askari, S. Piltan, M. Gholami, Whole Exome Sequencing identified two homozygous ALMS1 Mutations in an Iranian Family with Alström Syndrome, Gene Gene (2019), doi: https://doi.org/10.1016/j.gene.2019.144228
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Elsevier B.V. All rights reserved.
Whole Exome Sequencing identified two homozygous ALMS1 Mutations in an Iranian Family with Alström Syndrome Shahram Torkamandia, Somaye Rezaeib, Reza Mirfakhraeic, Masomeh Askarid, Samira Piltanc, Milad Gholamie,*[email protected] aDepartment
of Medical Genetics and Immunology, Faculty of Medicine, Urmia University of Medical Sciences,
Urmia, Iran bDepartment
of Neurology, Imam Khomeini Hospital, Urmia University of Medical Sciences, Urmia, Iran
cDepartment
of Medical Genetics, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
dDepartment
of Genetics at Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran eDepartment
of Biochemistry and Genetics, School of Medicine, Arak University of Medical Sciences, Arak, Iran
*Corresponding author.
Highlights Alström syndrome is an extremely rare ciliopathy WES is very useful in the accurate and early diagnosis of diseases with gradually emerging symptoms Different mutation profiles of ALMS1 may be lead to clinical heterogeneity
Abstract Alström syndrome (AS) is a rare monogenic multi-system ciliopathy disorder with cardinal features, including cone-rod dystrophy, sensory neural hearing loss, metabolic dysfunctions and multiple organ failure caused by bi-allelic mutations in a centrosomal basal body protein-coding gene known as ALMS1. This study aimed to identify pathogenic mutations in a consanguineous Iranian family with AS. Nextgeneration sequencing was performed on the genomic DNA obtained from a 12 years old girl with AS. According to the bioinformatics analysis, computational modelling and segregation of variants, we identified two homozygous mutations close together in exon 8 of ALMS1 in the patient, including c.7262 G>T and c.7303-7305delAG. The clinically normal parents were heterozygous for both mutations. These mutations have a very rare frequency and only reported in the heterozygous state in the public genomic databases. Overall, due to the large size of the ALMS1 gene and clinical similarity with other ciliopathies and genetic disorders, whole exome sequencing can be useful for the identification of pathogenic mutations and the improvement of AS clinical management.
Abbreviations: ALMS1, Alstrom Syndrome Protein 1; AS, Alström syndrome; SNHL, bilateral sensorineural hearing loss; BBS, Bardet-Biedl Syndrome; LCA, Leber Congenital Amaurosis; WES, whole exome sequencing; gDNA, Genomic DNA; BWA, Burrows-Wheeler Aligner; MAF, minor allele frequency; PCR, polymerase chain reaction; OCT, optical coherence tomography; HC, head circumference; LVEF, left ventricular ejection fraction; CADD, Combined Annotation Dependent Depletion scores; Ile, isoleucine; Ser, Serine; T2DM, type 2 diabetes mellitus; GLUT4, glucose transporter 4
Keywords: Alström syndrome, Whole exome sequencing, ALMS1, Iran
Introduction Alström syndrome (AS) (ALMS; OMIM# 203800) as an autosomal recessive inherited ciliopathy disease, is extremely rare with a prevalence of less than 1 to 10 per million in the population (Marshall, Maffei, Collin, & Naggert, 2011). Patients are characterized by multisystem clinical symptoms. Early-onset progressive cone-rod retinal degeneration with secondary nystagmus, photophobia, and visual impairment which leads to blindness up to first 15 months of life, is a cardinal observed in affected individuals. They also have more major features, including truncal obesity, insulin resistance, type 2 diabetes mellitus,
bilateral sensorineural hearing loss (SNHL), pulmonary disease, renal disease, dilated or restrictive cardiomyopathy and multiple organ failure (Brofferio et al., 2017; Purvis et al., 2010; Richard B Paisey, 2019). However, the diagnosis of AS can be a challenging task due to its rarity, its gradual emergence of cardinal symptoms and its similarity with other ciliopathy and genetic disorders, such as Bardet-Biedl Syndrome (BBS), idiopathic cardiomyopathy, Leber Congenital Amaurosis (LCA) and some inherited mitochondrial dysfunctions (Dyer, Wilson, Small, & Pai, 1994; Katagiri et al., 2013). AS results from biallelic homozygous or compound heterozygous mutations mostly in the hot-spot exons 8, 10 and 16 in the ALMS1 gene located at chromosome 2p13.1 containing 23 exons (Marshall et al., 2015). ALMS1 protein is ubiquitously expressed and localized to the cytoplasm, cytoskeleton, microtubule organization center, centrosome and basal bodies of ciliated cells of tissues such as photoreceptor, endocrine and central nervous system (Hearn, 2019). The deepen understanding of ALMS1 in the pathogenesis of AS disease is still be elucidated even though its function in the formation and maintenance of cilia, cell cycle regulation, endosomal trafficking, cell differentiation, and extracellular production has been known (Marshall et al., 2015). Recent years with the advent of next-generation sequencing, remarkable progress has been achieved in the field of medical genetics, and here we used whole exome sequencing (WES) to report the molecular finding in an Iranian family with AS. Methods Editorial Policies and Ethical Considerations The patient was a 12-year-old girl, and her parents were immediate cousins (Fig.1.A). Informed consent was obtained from the parents. This study was approved by the Ethics Committee of the Arak University of Medical Sciences, Arak, Iran (IR.ARAKMU.REC.1398.070). Whole- exome sequencing and bioinformatics analysis Genomic DNA (gDNA) from the proband and her parents was extracted from peripheral blood samples using salting out method. The quality and concentration of gDNA were assessed with the NanoDrop 1000
(NanoDrop; Thermo Fisher Scientific, Inc., Wilimington, DE, USA). One µg of gDNA from proband was sheared, and exome capture was carried out using SureSelectXT2 V6 Exome. The enriched libraries were sequenced by paired-end read on the Illumina HiSeq2000 platform using TruSeq v3 chemistry. Read files (Fastq) were generated from the sequencing platform via the manufacturer's proprietary software. The Fastq file was trimmed to remove the adaptor, and low quality reads and were aligned to human reference genome hg19 using Burrows-Wheeler Aligner (BWA). Duplicate reads were marked using Picard version 1.107. Additional BAM file manipulations were completed using Samtools 0.1.18. SNP and indel variants were called by the GATK Unified Genotyper. The variants were annotated by ANNOVAR and filtered against dbSNP137
(https://www.ncbi.nlm.nih.gov/snp/),
(http://www.internationalgenome.org)
,
ExAC
1000Genome
(http://exac.broadinstitute.org/)
projects ,
gnomAD
(https://gnomad.broadinstitute.org/) and Iranome web database as a local exome variants reference (Akbari MR, 2017). Only low-frequency variants with minor allele frequency (MAF) less than 0.01 were selected for further analysis. Novel and rare variants in the coding or splicing regions were prioritized based on being nonsynonymous, indel and putative splice site. Predicated pathogenicity of the candidate variants were evaluated in silico using predictor tools including SIFT (https://sift.bii.a-star.edu.sg/), Polyphen2 (http://genetics.bwh.harvard.edu/pph2/) and, MutationTaster (http://www.mutationtaster.org/). The homozygous variants were prioritized based on the autosomal recessive inheritance in the subject pedigree. Finally, for variant confirmation and segregation analysis, polymerase chain reaction (PCR) was designed to amplify targeted variants by using primers (F-5’CCCTTGCCCGTTTCAGAGAT3’ and R5’TTACCATGTGCTCGTACCCG-3’). The purified amplicon was sequenced with an automated sequencer (AB3730; Applied Biosystems, Foster City, CA, USA) and sequences were compared against Transcript NM_015120.4 using Sequencher software 5.4.6. In silico prediction of the 3D structure of the affected ALMS1 protein The internal 1,400 out of 4,169 amino-acid flanking the identified mutations of ALMS1 protein (UniProt: Q8TCU4) was used to generate a three dimensional (3D) structural protein. With the based on 5JCS protein
structure in the Protein Data Bank (PDB) from Saccharomyces cerevisiae, the 3D structure was developed by the I-TASSER web server (Yang et al., 2015). PyMol software was used for the inspection and visualization of the 3D protein structure modeling. Moreover, the HOPE project (Venselaar, Te Beek, Kuipers, Hekkelman, & Vriend, 2010) and MetaDome (Wiel, Venselaar, Veltman, Vriend, & Gilissen, 2017) were used to analyze the structural effects and tolerance of point mutation in the ALMS1 protein. Results Clinical description The patient was noticed because of nystagmus and photodysphoria and then progressive decreased visual acuity during the first years of age. At the age of 12 years, optical coherence tomography (OCT) revealed thinned pigmentation and irregularly arrangement of the retina. Cone-rod dystrophy was confirmed with electroretinography, and fundus examination revealed narrowing of retinal vessels and retinal degeneration of both eyes. She was underweight at birth, with a weight of 2790 g (25th centile), head circumference (HC) of 33 cm (25th centile) and height (HT) of 49 cm (50th centile). Hyperphagia and overweight began during the first year of life and resulting in obesity by the age of 4 years. Currently, her weight is 68.3 kg (95th centile), and height is 152 cm (50th centile) with body mass index > 29.5 that fall within overweight/obese range. Progressive bilateral sensorineural hearing loss was beginning at three years old. Also, otitis media was reported in her clinical history at the age of 5 years. Audiometry examination indicated moderate mixed hearing loss at the age of 12 years. Echocardiography indicated dilated cardiomyopathy, diastolic dysfunction, and reduced left ventricular ejection fraction (LVEF) ranges from 33-40 percent at the age of 10 years. Renal ultrasonography showed hyperechogenicity in the medulla. General examination and metabolic evaluation showed acanthosis nigricans, hypertriglyceridemia, hyperlipidemia and, type 2 diabetic mellitus, which she was started on metformin therapy. Identification of two homozygous mutations in ALMS1
Bioinformatics analyses of the WES data identified 432,837 variants filtered based on steps summarized in table1. Given the autosomal recessive inheritance, 79 homozygous variants were prioritized for further investigation. After extensive bioinformatics analysis, two allelic homozygous mutations in the ALMS1 (GenBank: NM_015120.4) were founded in the affected child; including, c.7262 G>T; p.(Ser2421Ile), and c.7303-7305delAG , p.(Glu2435Valfs*7). These variants were confirmed by bi-directional Sanger sequencing, followed by segregation analysis in the pedigree, and were heterozygous in the clinical normal parents (Fig.1. B, C). These mutations have not been reported in the ExAC; however, were described with an extremely rare frequency in the gnomAD (MAF: 4.01e-6). Additionally, according to the Iranome, these mutations were very rare in the Iranian population (MAF: 6.25×10-5; 1 out 1600 alleles). We performed in silico translation analysis for homozygous frameshift mutation using the ExPASy-translate tool. Our results demonstrated that deletion of the AG nucleotides at exon 8 of ALMS1 leads to a frameshift mutation that results in a premature stop-codon downstream of the mutation p.(Glu2435Valfs*7). This mutation was previously reported as a pathogenic variant in the ClinVar database (accession number: VCV000459884). Frameshift and missense variants found in our patient, have high Combined Annotation Dependent Depletion scores (CADD; scores 42 and 31 respectively) and were predicted to be deleterious and damaging by predictive software’s (Polyphen-2, SIFT and Mutation Taster) even though the missense mutation should be consider as a VUS (variant with unknown significance). Both of these positions are highly conserved across several species (Fig.1.D). We obtained a 3D structure of ALMS1 by I-TASSER (Fig2.A). The structural quality was 99.9% coverage, C-Score= -1.39 and TM-Score= 0.54±4.1 Aº within the range of accepted for a significant model with high homology-based structure. The HOPE server with using the UniProt-database and Reprof software reported that p.Ser2421Ile mutation destabilizes the protein local conformation structure. Molecular 3D structure modeling demonstrated that the mutant amino acid (Ile) is bigger and more hydrophobic than wild amino acid (Ser) which can result in loss of hydrogen bond and disturbs the correct folding and function of the nearby putative leucine-zipper motif (Fig2.B, C). Then, the MetaDome web server was used to calculate a
missense-over-synonymous ratio as a tolerance landscape at the position of identified mutations with data from gnomAD and ClinVar. We recognized that p.Ser2421Ile and p.(Glu2435Valfs*7) mutations were located in the intolerant region of ALMS1 protein (Fig 2.D). Discussion In this study, we report the identification of two ALMS1 mutations that cause of AS in an Iranian consanguine family. These mutations were previously reported with extremely rare frequencies in genomic data bases, and only the frameshift mutation was previously reported as a pathogenic variant in an AS patient due to the absent or disrupt protein product in the compound heterozygous state (Marshall, Hinman, et al., 2007). Interestingly, we identified both mutations inherited in Cis; actually, the parents were heterozygous and the affected child was homozygous for both mutations. We have not performed functional studies regarding the observed mutations; therefore, it is hard to predict the effect of more than one mutation on one allele in disease severity even though it has been previously reported third deleterious variants in Turkey ethnicity AS patients (Ozanturk et al., 2015). According to advocated clinical criteria for the identification of AS, in patients with the age of 3-14 years old, they should have two major criteria or one major and three minor criteria to fulfill the diagnostic of AS (Marshall, Beck, Maffei, & Naggert, 2007). Our patient was 12 years old girl and displayed two major criteria (homozygous mutations in ALMS1 and vision problems including nystagmus, photophobia, restricted acuity and, cone dystrophy), she also had some minor criteria (type 2 diabetic mellitus, insulin resistance, obesity, bilateral sensory neural hearing loss and progressive renal failure). However, due to the rarity of AS, delay in onset of some of the cardinal features, inter and intra familial clinical heterogeneity and also, overlapping phenotype with other ciliopathies and genetic disorders particularly Bardet-Biedl Syndrome (BBS), often complicated the universal diagnosis and defined clear genotype-phenotype correlation (Alvarez-Satta, Castro-Sanchez, & Valverde, 2015). Comparing the clinical features of our patient to those from AS studies revealed that the cardinal features of AS, including cone-rod dystrophy, obesity, SNHL, dilated cardiomyopathy, T2DM and skin changes of acanthosis nigricans are consistent with those from previous reports (Casey et al., 2014;
Marshall et al., 2005). On the other hand, some clinical findings were not observed in our patient, including epilepsy, hepatic disease and, cognitive impairment (Marshall et al., 2005; Sanyoura et al., 2014). Interestingly, patients with mutations in exon 8 of ALMS1 have been reported to show normal or delayed/milder renal disease compared with those with mutations in exon 10 and 16, but our patient exhibited progressive renal complication as a major cause of AS morbidity (Katagiri et al., 2013). According to the expression data from Human Protein Atlas, ALMS1 is a widely large expressed protein, even though its expression is context dependent (Uhlen et al., 2015). This protein has several sequence features, including a large extensive tandem repeat, additional low complexity short coiled-coil domains and an ALMS motif located at the C-terminus that has sequence similarity with some of the human proteins. According to a recent study, a relatively small internal region from residues 2,261-2,602; in the mutated region in our patient, and a larger C-terminus region from residues 3,176-4,169 have important roles and essential for ALMS1 protein-protein interaction with the centrosomes and ciliary basal bodies (Knorz et al., 2010). Moreover, the data from functional protein associated networks STRING (https://string-db.org/ ) showed that the most predicted functional partners have important roles in formation and maintenance of centrosome and cilia, intracellular trafficking, controlling cell polarities such as cochlear sensory epithelium and cell signalling including Wnt pathways. We assessed the potential effect of the missense mutation p.(Ser2421Ile) by performing computational modelling. The missense mutation lies within a conserved region (residues 2,261-2,602) and alters a conserved amino acid. Also, in silico translational analysis demonstrated that the frameshift mutation p.(Glu2435Valfs*7) leads to a premature stop codon. This mutation either can initiate degradation of ALMS1 mRNA through nonsense-mediated-decay (NMD) machinery, or if it is expressed, the protein would not have two aforementioned conserved regions. Hence, this homozygous truncated mutation in combination with homozygous missense mutation, result in AS due to the ALMS1 loss of function or lacking of expression. It has been reported that mice with truncating mutation in exon 8 (Alms1foz/foz mouse model of AS) exhibited postnatal loss of primary cilia on hypothalamic neurons involved in satiety regulation (Heydet et al., 2013). Alms1GT/GT mice model of AS with a gene trap in intron 13 and some complementary studies revealed that α-actinin directly has interaction
with ALMS1 and through glucose transporter 4 (GLUT4) trafficking has an important role in glucose hemostasis (Favaretto et al., 2014). The whole exome sequencing of several children’s with mitogenic cardiomyopathy has identified pathogenic variants in ALMS1 (Casey et al., 2014; Long, Evans, & Olson, 2017; Shenje et al., 2014). The knockdown of Alms1 mRNA in the neonatal murine cardiomyocyte cultured cell, activated the Wnt/β-catenin signalling cascade, and increased the number of cardiomyocytes cytokinesis through the cell cycle proliferation (Shenje et al., 2014). Multiple lines of evidence have elucidated the role of ALMS1 in intracellular trafficking and regulation of extracellular matrix interactions. Collin et al. identified several partner proteins, mainly α-actinins isoforms and other proteins associated with endosome recycling and centrosome function, which directly interact with C terminus of murine ALMS1 (Collin et al., 2012). They also identified that Alms1 is required for the correct localization of rhodopsin to the outer nuclear layer (ONL) and Alms1 knockout mice showed modified outer segments of photoreceptors due to defective intracellular trafficking (Collin et al., 2005). Collectively, impaired intracellular transport across the connecting cilium is the cause of progressive retinal degeneration in AS patients. Given these reports, the destructive effect of identified frameshift and missense variants on the function of ALMS1 in this study are consistent with our patient clinical symptoms. In conclusion, by using WES, we identified two homozygous mutations inherited in Cis on each allele of ALMS1 in a child from a consanguineous marriage. We confirmed the pathogenicity of these variants through bioinformatics analysis, computational modeling and segregation in the pedigree. It should be reminded that WES is very useful in the accurate and early diagnosis of diseases with gradually emerging symptoms such as AS, and this is very important for the effective clinical management of patients. Conflict of Interest The authors declare that they have no conflict of interest. Acknowledgement The authors sincerely thank the patient and her parents for participation in the study.
References Akbari MR, F. Z., Beheshtian M, Mohseni M, Poustchi H, Sellars E, Nezhadi H, Amini A, Arzhangi S, Jalalvand K, Jamali P, Davarnia B, Nikuei P, Oladnabi M, Mohammadzadeh A, Zohrehvand E, Shamsi-Gooshki E, Börno S, Timmermann B, Najafipour R, Khorram Khorshid HR, Kahrizi K, Najmabadi H. (2017). Iranome: A human genome variation database of eight major ethnic groups that live in Iran and neighboring countries in the Middle East. Retrieved from: http://www.iranome.ir/ Alvarez-Satta, M., Castro-Sanchez, S., & Valverde, D. (2015). Alstrom syndrome: current perspectives. Appl Clin Genet, 8, 171-179. doi:10.2147/TACG.S56612 Brofferio, A., Sachdev, V., Hannoush, H., Marshall, J. D., Naggert, J. K., Sidenko, S., . . . Gunay-Aygun, M. (2017). Characteristics of cardiomyopathy in Alstrom syndrome: Prospective single-center data on 38 patients. Mol Genet Metab, 121(4), 336-343. doi:10.1016/j.ymgme.2017.05.017 Casey, J., McGettigan, P., Brosnahan, D., Curtis, E., Treacy, E., Ennis, S., & Lynch, S. A. (2014). Atypical Alstrom syndrome with novel ALMS1 mutations precluded by current diagnostic criteria. Eur J Med Genet, 57(2-3), 55-59. doi:10.1016/j.ejmg.2014.01.007 Collin, G. B., Cyr, E., Bronson, R., Marshall, J. D., Gifford, E. J., Hicks, W., . . . Naggert, J. K. (2005). Alms1-disrupted mice recapitulate human Alstrom syndrome. Hum Mol Genet, 14(16), 2323-2333. doi:10.1093/hmg/ddi235 Collin, G. B., Marshall, J. D., King, B. L., Milan, G., Maffei, P., Jagger, D. J., & Naggert, J. K. (2012). The Alstrom syndrome protein, ALMS1, interacts with alpha-actinin and components of the endosome recycling pathway. PLoS One, 7(5), e37925. doi:10.1371/journal.pone.0037925 Dyer, D. S., Wilson, M. E., Small, K. W., & Pai, G. S. (1994). Alstrom syndrome: a case misdiagnosed as Bardet-Biedl syndrome. J Pediatr Ophthalmol Strabismus, 31(4), 272-274. Favaretto, F., Milan, G., Collin, G. B., Marshall, J. D., Stasi, F., Maffei, P., . . . Naggert, J. K. (2014). GLUT4 defects in adipose tissue are early signs of metabolic alterations in Alms1GT/GT, a mouse model for obesity and insulin resistance. PLoS One, 9(10), e109540. doi:10.1371/journal.pone.0109540 Hearn, T. (2019). ALMS1 and Alstrom syndrome: a recessive form of metabolic, neurosensory and cardiac deficits. J Mol Med (Berl), 97(1), 1-17. doi:10.1007/s00109-018-1714-x Heydet, D., Chen, L. X., Larter, C. Z., Inglis, C., Silverman, M. A., Farrell, G. C., & Leroux, M. R. (2013). A truncating mutation of Alms1 reduces the number of hypothalamic neuronal cilia in obese mice. Dev Neurobiol, 73(1), 1-13. doi:10.1002/dneu.22031 Katagiri, S., Yoshitake, K., Akahori, M., Hayashi, T., Furuno, M., Nishino, J., . . . Iwata, T. (2013). Whole-exome sequencing identifies a novel ALMS1 mutation (p.Q2051X) in two Japanese brothers with Alstrom syndrome. Mol Vis, 19, 2393-2406. Knorz, V. J., Spalluto, C., Lessard, M., Purvis, T. L., Adigun, F. F., Collin, G. B., . . . Hearn, T. (2010). Centriolar association of ALMS1 and likely centrosomal functions of the ALMS motif-containing proteins C10orf90 and KIAA1731. Mol Biol Cell, 21(21), 3617-3629. doi:10.1091/mbc.E10-03-0246 Long, P. A., Evans, J. M., & Olson, T. M. (2017). Diagnostic Yield of Whole Exome Sequencing in Pediatric Dilated Cardiomyopathy. J Cardiovasc Dev Dis, 4(3). doi:10.3390/jcdd4030011 Marshall, J. D., Beck, S., Maffei, P., & Naggert, J. K. (2007). Alstrom syndrome. Eur J Hum Genet, 15(12), 1193-1202. doi:10.1038/sj.ejhg.5201933 Marshall, J. D., Bronson, R. T., Collin, G. B., Nordstrom, A. D., Maffei, P., Paisey, R. B., . . . Nishina, P. M. (2005). New Alstrom syndrome phenotypes based on the evaluation of 182 cases. Arch Intern Med, 165(6), 675-683. doi:10.1001/archinte.165.6.675 Marshall, J. D., Hinman, E. G., Collin, G. B., Beck, S., Cerqueira, R., Maffei, P., . . . Naggert, J. K. (2007). Spectrum of ALMS1 variants and evaluation of genotype-phenotype correlations in Alstrom syndrome. Hum Mutat, 28(11), 1114-1123. doi:10.1002/humu.20577 Marshall, J. D., Maffei, P., Collin, G. B., & Naggert, J. K. (2011). Alstrom syndrome: genetics and clinical overview. Curr Genomics, 12(3), 225-235. doi:10.2174/138920211795677912 Marshall, J. D., Muller, J., Collin, G. B., Milan, G., Kingsmore, S. F., Dinwiddie, D., . . . Naggert, J. K. (2015). Alstrom Syndrome: Mutation Spectrum of ALMS1. Hum Mutat, 36(7), 660-668. doi:10.1002/humu.22796
Ozanturk, A., Marshall, J. D., Collin, G. B., Duzenli, S., Marshall, R. P., Candan, S., . . . Ozgul, R. K. (2015). The phenotypic and molecular genetic spectrum of Alstrom syndrome in 44 Turkish kindreds and a literature review of Alstrom syndrome in Turkey. J Hum Genet, 60(1), 1-9. doi:10.1038/jhg.2014.85 Purvis, T. L., Hearn, T., Spalluto, C., Knorz, V. J., Hanley, K. P., Sanchez-Elsner, T., . . . Wilson, D. I. (2010). Transcriptional regulation of the Alstrom syndrome gene ALMS1 by members of the RFX family and Sp1. Gene, 460(1-2), 20-29. doi:10.1016/j.gene.2010.03.015 Richard B Paisey, F., Rick Steeds, Tim Barrett, Denise Williams, Tarekegn Geberhiwot, Meral Gunay-Aygun. (2019). Alström Syndrome. Retrieved from https://www.ncbi.nlm.nih.gov/books/NBK1267/ Sanyoura, M., Woudstra, C., Halaby, G., Baz, P., Senee, V., Guillausseau, P. J., . . . Julier, C. (2014). A novel ALMS1 splice mutation in a non-obese juvenile-onset insulin-dependent syndromic diabetic patient. Eur J Hum Genet, 22(1), 140-143. doi:10.1038/ejhg.2013.87 Shenje, L. T., Andersen, P., Halushka, M. K., Lui, C., Fernandez, L., Collin, G. B., . . . Judge, D. P. (2014). Mutations in Alstrom protein impair terminal differentiation of cardiomyocytes. Nat Commun, 5, 3416. doi:10.1038/ncomms4416 Uhlen, M., Fagerberg, L., Hallstrom, B. M., Lindskog, C., Oksvold, P., Mardinoglu, A., . . . Ponten, F. (2015). Proteomics. Tissue-based map of the human proteome. Science, 347(6220), 1260419. doi:10.1126/science.1260419 Venselaar, H., Te Beek, T. A., Kuipers, R. K., Hekkelman, M. L., & Vriend, G. (2010). Protein structure analysis of mutations causing inheritable diseases. An e-Science approach with life scientist friendly interfaces. BMC Bioinformatics, 11, 548. doi:10.1186/1471-2105-11-548 Wiel, L., Venselaar, H., Veltman, J. A., Vriend, G., & Gilissen, C. (2017). Aggregation of population-based genetic variation over protein domain homologues and its potential use in genetic diagnostics. Hum Mutat, 38(11), 1454-1463. doi:10.1002/humu.23313 Yang, J., Yan, R., Roy, A., Xu, D., Poisson, J., & Zhang, Y. (2015). The I-TASSER Suite: protein structure and function prediction. Nat Methods, 12(1), 7-8. doi:10.1038/nmeth.3213
Fig. 1. A) The family pedigree B) The mutation status of ALMS1 c.7262 G>T and c.7303-7305delAG was confirmed by the Sanger sequencing (Mutation location indicated with dashed line red box) in the Father, Mother and Affected child genomics. The patient was homozygous for c.7262G>T, and c.7303-7305delAG and her parents were in the heterozygous state. C) The location of mutations (in red) in a schematic diagram showing all exons (Gray boxes), introns and UTR of ALMS1, GenBank: NG_011690.1and, the 4169 amino acid protein, GenBank: NP_055935.4. Protein features and motif include polyglutamic acid, poly alanine, serine-rich, large tandem repeat, leucine zipper, and ALMS motif D) Multiple sequence alignment of ALMS1 at the position of identified mutations. The position of mutations indicated with a red triangle. WT: wild type allele, Mut: Mutant allele, C: C-terminus, N: N terminus, fs: frameshift (Color figures can be included in the online version of the Journal) Fig. 2. A) Overall cartoons structure of ALMS1 (1400 amino acid out of 4169) was created with I-TASSER modelling. B, C) The magnified black backgrounds view of the normal and mutated residues at position 2421 of ALMS1 protein are shown as sticks (Serine as normal and Isoleucine as mutant residue). D) A tolerance landscape for ALMS1 was created with MetaDome web server. The mutations located in the
intolerant regions based on a missense-over-synonymous ratio. (Color figures can be included in the online version of the Journal)
Table 1. Filtering strategy for variant detection
Total number of variant
4,32,837
Total number of SNP
366973
Total number of INDEL
65868
Variants remaining on exonic, exonicsplicing and splicing region
22675
SNP variant on exonic, exonicsplicing and splicing region
21910
INDEL variant on exonic, exonicsplicing and splicing region
765
SNP variant remaining after filtering for synonymous
11574
Variants after filtering for 1000 genomes (MAF ≤ 0.01)
1469
Variants after filtering for Exome Variant Server (MAF ≤ 0.01)
701
Novel SNP variant
172
Variant INDEL Novel
56
Number of rare and novel homozygous variant
79
Number of rare and novel heterozygous variant
622
Homozygous SNP variants remaining after excluding benign variants with polyphen2, Sift and mutation taster
5
Homozygous novel INDEL variants
11