- Email: [email protected]
WITHDRAWN: ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFκB
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB Jia Wang a, b, Jie Zuo c, Alafate Wahafu a, Hai Yu a, Wanfu Xie a, Hua Zhang a, b, Maode Wang a, b, * a b c
Department of Neurosurgery, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi, 710061, PR China Center of Brain Science, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi, 710061, PR China The Second Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi, 710004, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 October 2019 Received in revised form 16 October 2019 Accepted 16 October 2019 Available online xxx
Glioblastoma (GBM) is the most lethal type of glioma in human adults and frequently recurs. Therefore, identification of the underlying mechanisms of GBM therapy resistance is crucial. Endothelial cell specific molecule-1 (ESM1) expression is elevated in a wide range of malignant tumors and correlates with poor prognosis. However, the functional role of ESM1 in GBM remains unclear. Herein, we sought to determine the relevance of ESM1 in GBM and the potential underlying mechanisms of ESM1 in GBM development, progression, and radioresistance. Using bioinformatics analyses, we identified ESM1 as the gene most highly associated with radioresistance in GBM. Clinically, elevated ESM1 was observed in GBM and correlated with poor prognosis. Functionally, silencing of ESM1 significantly reduced GBM cell proliferation, tumorigenesis, and radioresistance. GSEA revealed a correlation between ESM1 and epithelialmesenchymal transition (EMT), and exogenous overexpression of ESM1 induced mesenchymal transition in GBM cells, enhancing radioresistance. Lastly, our data suggest that ESM1 regulates nuclear factor kappa B (NFkB) promoter activity, promoting the mesenchymal transition of GBM cells. Taken together, our findings suggest that ESM1-dependent transcriptional regulation of NFkB contributes to mesenchymal transition, and therefore enhances GBM radioresistance and tumorigenesis. © 2019 Elsevier Inc. All rights reserved.
Keywords: Mesenchymal transition ESM1 NFkB Radioresistance Glioblastoma
1. Introduction Glioblastoma (GBM) is the most lethal subtype of glioma in human adults. Despite aggressive therapeutic strategies including maximum surgical resection, radiotherapy, chemotherapy, and immune and gene therapy, the prognosis for GBM patients remains poor with a 5-year survival rate of less than 5% [1]. A recent study shows that GBMs were classified into 4 subtypes including proneural, proliferation, mesenchymal and neural depending on the epigenetics signatures [2]. Additionally, patients with mesenchymal GBM have the worst prognosis compared to patients with other subtypes of GBM [2]. Additionally, recurring proneural and classical GBM after radiation exhibit more mesenchymal-like phenotypes compared to the primary tumor [3]. These studies suggest that mesenchymal transition-based therapy resistance and
* Corresponding author. Department of Neurosurgery, Center of Brain Science, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi, PR China. E-mail address: [email protected] (M. Wang).
tumor progression are associated with tumor recurrence and poor outcomes in GBM. However, whether mesenchymal transition of GBM is induced by clonal selection or epigenetic reprogramming remains unclear. Endothelial cell specific molecule-1 (ESM1) is selectively expressed in organoids or metabolically active tissues including glandular, inflammatory cytokines, lymph nodes, and capillary endothelial cells [4]. Accumulating data demonstrates that increased ESM1 expression is observed in a wide range of malignant tumors [5,6]. Maurage et al. [7] shows that ESM1 is upregulated in response to tumor necrosis factor (TNF) and fibroblast growth factor 2 (FGF2) in GBM, and hypoxia inducible factor 1 (HIF1) increases ESM1 expression when GBM cells are exposed to hypoxia or cobalt chloride. Additionally, ESM1 is expressed in highgrade, but not low-grade, gliomas, and it is expressed in the palisading cells surrounding areas of necrosis in GBM [7]. To assess the mechanism of ESM1 as an oncogene more deeply, Chen et al. [5] showed that ESM1 promotes tumor migration, invasion, and metastasis via regulation of matrix metalloproteinases (MMPs).
https://doi.org/10.1016/j.bbrc.2019.10.126 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
2
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Despite these findings, the molecular mechanism, especially the downstream targets, of ESM1 in GBM progression remains unclear. The Nuclear Factor kappa B (NFkB) pathway is well known for its variety of functions on cellular responses and disease development. Abnormal activation of the NFkB pathway mediates a wide range of cellular processes related to tumorigenesis, including reduction of cell apoptosis, oncogene mutagenesis, and immune stimulation in multiple types of human cancers [8e10]. Activation of NFkB in cancers is most likely though either inflammatory stimulation such as induction of TNF, or induction of upstream regulators such as NFkB-inducing kinase (NIK) [11,12]. As an important regulator of GBM, NFkB elevation is associated with poor prognosis and enhanced radioresistance [3]. Kim et al. [13] reported that MLK4dependent activation of IkB kinase-a (IKKa) enhances NFkB activity in GBM and induces the transition from proneural to mesenchymal, thus promoting GBM cell proliferation and radioresistance. This study was performed to investigate the underlying mechanisms of ESM1-induced radioresistance in GBM. 2. Materials & methods 2.1. Ethical statement The usage of experimental animals and patient tumor samples was approved by the Scientific Ethics Committee of the First Affiliated Hospital of Xi’an Jiaotong University (no. 2016e18). 2.2. Reagents DMEM-F12 medium, fetal bovine serum (FBS), alamarBlue reagent, PageRuler plus pre-stained protein ladder, and the Alexa Fluor® 488 Annexin V/Dead Cell Apoptosis kit were purchased from Thermo Fisher Scientific. Accutase, RIPA lysis buffer, phosphatase inhibitor, and protease inhibitor were purchased from Merck KGaA. The Bradford reagent and iScript Reverse Transcription SuperMix were purchased from Bio-Rad Laboratories. Bovine serum albumin (BSA) was purchased from New England BioLabs. 2.3. Gene expression analysis Gene expression data were extracted from GEO datasets (GSE56937, 2017 and GSE67089, 2015). Hierarchical bi-clustering was performed to analyze the expression of the target genes via Cluster 3.0. Euclidean distance and average linkage were used as a similarity metric and clustering method, respectively. The comparison of the relative gene expression was presented as fold change.
3
2.5. Cell culture and in vitro cell proliferation assay Cell culture and cell proliferation assays were performed as previously described [15]. GBM cell lines U87, U251, U373MG, SHG44, A172, and normal astrocyte NHA were purchased from BeNa Culture Collection (Kunshan, China). 2.6. Quantitative RT-PCR (qRT-PCR) qRT-PCR was performed as previously described [15]. The sequences of the primers were shown as below: ESM1-forward: ACAGCAGTGAGTGCAAAAGCA, ESM1-reverse GCGGTAGCAAGTTTC TCCCC, N-Cadherin-forward: GGTGGAGGAGAAGAAGACCAG, NCadherin-reverse: GGCATCAGGCTCCACAGT, Vimentin-forward: GACGCCATCAACACCGAGTT; Vimentin-reverse: CTTTGTCGTTGGTT AGCTGGT, Snail1-forward: TCGGAAGCCTAACTACAGCGA, Snail1reverse: AGATGAGCATTGGCAGCGAG, Snail2-forward: CGAACTG GACACACATACAGTG, Snail2-reverse: CTGAGGATCTCTGGTTGTGGT, Twist-forward: GTCCGCAGTCTTACGAGGAG, Twist-reverse: GCTT GAGGGTCTGAATCTTGCT, Sox10-forward: CCTCACAGATCGCCTAC ACC, Sox10-reverse: CATATAGGAGAAGGCCGAGTAGA, MMP-2forward: TACAGGATCATTGGCTACACACC, MMP-2-reverse: GGTCA CATCGCTCCAGACT, MMP-3-forward: AGTCTTCCAATCCTACTGT TGCT, MMP-3-reverse: TCCCCGTCACCTCCAATCC, MMP-9-forward: GAACCAATCTCACCGACAGG, MMP-9-reverse: GCCACCCGAGTG TAACCATA, NFkB p65-forward: CCGCACCTCCACTCCATCC, NFkB p65-reverse: ACATCAGCACCCAAGGACACC, GAPDH-forward: GAAG GTGAAGGTCGGAGTCA, GAPDH-reverse: TTGAGGTCAATGAAGGG GTC. 2.7. Western blotting Western blots were performed as described previously [15]. Antibodies used for western blotting are as follows: ESM1 antibody was purchased from Abcam (ab103590), NFkB p65 antibody was purchased from Thermo Fisher Scientific (701079), TRAF1 antibody was purchased from Abcam (ab129279), CIAP1 antibody was purchased from Abcam (ab2399), CIAP2 antibody was purchased from Abcam (ab32059), and b-actin antibody was purchased from Sigma-Aldrich (A5316). 2.8. Immunohistochemistry (IHC) IHC was performed as previously described [15]. The ESM1 antibody was purchased from Abcam (ab103590). German immunohistochemical scoring (GIS) was used to measure the expression of ESM1 as previously described [15].
2.4. GSEA and KEGG pathway analysis
2.9. Lentivirus production and transduction
Gene expression profiles were derived from public databases including TCGA and Gene Expression Omnibus (GEO, GSE16011). All data were preprocessed using the R language, including normalization and gene ID transformation, then these data were divided into 2 groups based on high or low expression of ESM1. GSEA and KEGG pathway analyses were performed as previously described [14].
Lentivirus production and transduction was performed as previously described [15]. shRNA sequences are as follows: shESM1 #1: NM_007036.4e772s21c1 CCGGTAGGATACTTACAATCCATAACT CGAGTTATGGATTGTAAGTATCCTATTTTTG, and shESM1 #2: NM_007036.4e951s21c1 CCGGAGACCGCAGTGAGTCAAATTACTCGA GTAATTTGACTCACTGCGGTCTTTTTTG. The lentivirus for ESM1 overexpression was purchased from Genechem (Shanghai, China).
Fig. 1. ESM1 expression correlates with radioresistance and indicates poor prognosis in GBM. (A) Venn diagram showing ESM1 as one of the most differentially expressed genes correlating to GBM radioresistance and mesenchymal subtype. (B) Depiction of ESM1 as the most upregulated gene in GBM using data from the TCGA database. (C) Gene expression analysis with data from the Rembrandt database suggesting that ESM1 expression is elevated in GBM (***P < 0.001, with one-way ANOVA followed by Dunnett’s posttest). (DeE) qRT-PCR (D) and western blotting analysis (D) of ESM1 expression in GBM cell lines (**P < 0.01, ***P < 0.001, with one-way ANOVA followed by Dunnett’s posttest). (F) Representative IHC images of ESM1 expression in glioma samples. (G) ESM1 is enriched in GBM compared to low grade glioma samples or non-tumor tissue. (HeJ) Kaplan-Meier analysis of patient survival compared to ESM1 expression in patient samples (H) (P ¼ 0.0005, with log-rank test), TCGA database (I) (P ¼ 0.0321, with log-rank test) and CCGA database (J) (P < 0.0001, with log-rank test).
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
4
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2.10. Luciferase reporter assay After lentivirus transduction, 293T or U87 cells were seeded at a concentration of 1 106 cells per well in six-well plates. NFkB p65 activity was determined using the NFkB Reporter kit (BPS Bioscience, 60614). Normalized luciferase activity for the NFkB p65 reporter was measured as a ratio of firefly luminescence to Renilla luminescence. 2.11. Flow cytometry Flow cytometry was performed as previously described [15]. The Alexa Fluor® 488 Annexin V/Dead Cell Apoptosis kit was used to measure cell apoptosis according to the manufacturer’s protocol. 2.12. Intracranial xenograft tumor model Six-week-old female nude mice were used for GBM xenografts. Intracranial xenografts were generated as previously described [15]. TMZ (50 mg/kg/d) or DMSO was injected into the tail vein 7 days post-tumor implantation. 10 mice were used for each group and Kaplan-Meier plot were used to evaluate the survival. 2.13. Statistical analysis All the results in this study are presented as mean ± SD. Statistical differences between 2 groups were evaluated by using twotailed t-tests. Multiple groups were compared with one-way ANOVA followed by Dunnett’s post-test. Kaplan-Meier survival analysis was analyzed by the log-rank test. All statistical analyses were performed with SPSS 19.0 or GraphPad Prism 6 software. Data were considered statistically significant when the p-value was less than 0.05. 3. Results 3.1. ESM1 correlates with radioresistance and indicates poor prognosis in GBM Genome-wide hierarchical bi-clustering was performed using previously published microarray databases containing information on tumors which had rapid (4 days) or delayed (35 days) responses to radiotherapy, compared to the more radioresistant mesenchymal subtype (GSE56937 [16] and GSE67089 [17]). The differentially expressed genes were sorted by their fold change, and genes with more than 0.5-fold upregulation were selected. The overlapping genes from those three gene lists were summarized. Finally, we found 11 genes that significantly correlated with rapid response to radiotherapy, delayed response to radiotherapy, and mesenchymal subtype (Fig. 1A). Using expression data extracted from TCGA, the top 11 genes in GBM samples were compared to those in low grade glioma samples. The results showed that ESM1 was the most upregulated gene in GBM (Fig. 1B). Furthermore, data from the Rembrandt database showed a significant trend of increased ESM1 expression in GBM compared to other types of glioma and normal brain tissue (Fig. 1C). Five GBM cell lines were used to evaluate the expression of ESM1, and normal astrocyte NHA cells were used as a negative control. qRT-PCR analysis revealed that ESM1 is highly expressed in GBM cell lines (Fig. 1D). Similar results were observed in western blots (Fig. 1E). To determine the prognostic role of ESM1 in GBM, IHC was performed on glioma samples from 91 patients who underwent surgery during 2008e2014 in the First Affiliated Hospital of Xi’an Jiaotong University to analyze the expression of ESM1. Three brain tissue samples obtained from patients who underwent epilepsy
surgery were used as negative controls. The IHC results showed that ESM1 was enriched in the cytoplasm and membrane of glioma cells, while no significant staining was observed in normal tissues (Fig. 1F). In addition, the patients with glioma were divided into 2 groups according to the GIS of ESM1 expression. The data suggest that ESM1 is more likely to be enriched in GBM compared to low grade glioma (GBM accounted for 75.93% of ESM1High samples and 2.703% of ESM1Low samples) (Fig. 1G). Moreover, the survival of the patients was monitored until December 2018 and analyzed using the Kaplan-Meier method based on the expression of ESM1. We found that patients with lower expression of ESM1 exhibited prolonged overall survival compared to the patients with higher expression (Fig. 1H). Similar results were observed using data extracted from TCGA and CGGA (Fig. 1I and J). Altogether, these results indicate that ESM1 is enriched in GBM and correlates with radioresistance. 3.2. Silencing of ESM1 attenuates GBM growth and radioresistance To investigate the function of ESM1 in GBM tumorigenesis and radioresistance, exogenous silencing of ESM1 was performed in U87 and U251 cells using lentivirus infection. The infection efficiency was roughly evaluated by fluorescence (Fig. 2A). qRT-PCR and Western blot analysis confirmed decreased ESM1 expression in knockdown U87 and U251 cells (Fig. 2B, C, 2D and 2E). Furthermore, in vitro cell growth assays showed a decrease in proliferation and radioresistance of U87 and U251 after ESM1 silencing (Fig. 2F and G). Moreover, U87 cells with or without ESM1 knockdown were treated with radiotherapy and the number of cells undergoing apoptosis was determined. The results indicated that ESM1 silencing enhanced the radiosensitivity of U87 cells (Fig. 2H). Lastly, U87 cells were transfected with a luciferase reporter before infection with either non-targeting or lentivirus containing ESM1 shRNA (shESM1). These cells were then orthotopically implanted into nude mice. In vivo bioluminescence imaging revealed that silencing of ESM1 attenuates U87 tumor formation and radioresistance (Fig. 2I), and the combination of shESM1 and radiotherapy significantly prolonged survival (Fig. 2J). 3.3. ESM1 enhances radioresistance by inducing mesenchymal transition in GBM To investigate the potential biological function of ESM1 in GBM, patient data from the TCGA database was grouped into 2 groups according to the expression of ESM1. Hierarchical bi-clustering analysis indicated significantly altered gene expression signatures in ESM1High GBM compared to ESM1Low GBM (Fig. 3A). Based on the results, a total of 214 genes most highly associated with ESM1 expression (187 upregulated genes and 27 downregulated genes) were selected for GSEA based on the fold change and P-value (Fig. 3B). GSEA results demonstrated that EMT was the pathway most correlated with ESM1 expression (Fig. 3C and D). Moreover, gene expression analysis using data from the TCGA database showed that ESM1 was remarkably enriched in mesenchymal GBM compared to normal brain tissue. However, other subtypes of GBM, including proneural, neural, and classical, showed no significant elevation in ESM1 expression (Fig. 3E). To further investigate the biological functions of ESM1 in GBM cells, a lentivirus to overexpress ESM1 was introduced into U87 and U251 cells. Afterwards, qRT-PCR and Western blot confirmed the elevated expression of ESM1 (Fig. 3F, G, 3H and 3I). Additionally, transwell assays indicated that invasion of U87 cells was enhanced by ESM1 overexpression (Fig. 3J). Flow cytometry analysis also showed significantly reduced apoptosis in ESM1-overexpressed U87 cells after radiation treatment (Fig. 3K). Similarly, in vitro cell
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 2. Silencing of ESM1 attenuates tumor growth and radioresistance of GBM. (A) Representative fluorescence images of ESM1 knockdown in GBM cells. (BeC) qRT-PCR analysis of ESM1 in U87 (B) or U251 (C) cells transduced with shRNA against ESM1 (shESM1 #1 and shESM1 #2) or non-targeting control (shNT) (***P < 0.001, with one-way ANOVA followed by Dunnett’s posttest). (DeE) Western blotting analysis of ESM1 in U87 (D) or U251 (E) cells transduced with shRNA against ESM1 (shESM1 #1 and shESM1 #2) or non-targeting control (shNT). (FeG) In vitro cell growth assay for ESM1 knockdown (shESM1 #2) combined with radiation (IR) in U87 (F) or U251 (G) cells (**P < 0.01, ***P < 0.001, with one-way ANOVA). (H) Flow cytometry apoptosis analysis for U87 cells pretreated with ESM1 knockdown lentivirus (shESM1 #2) with or without radiation (IR). (IeJ) Bioluminescence images (I) and Kaplan-Meier analysis (J) of mice xenografted with luciferase-labeled U87 cells transduced with ESM1 knockdown lentivirus (shESM1 #2) then either left to grow or treated with 2 Gy radiation continuously for 5 days (*P < 0.05, ***P < 0.001, n ¼ 10, with log-rank test).
viability assays show that U87 and U251 cells overexpressing ESM1 were more resistant to radiotherapy than the control cells (Fig. 3L and M). Lastly, qRT-PCR was performed to evaluate mesenchymal biomarkers after ESM1 overexpression. The results indicated an increase in most of the EMT-specific biomarkers upon overexpression of ESM1 (Fig. 3N).
3.4. ESM1 regulates transcription of NFkB and induces mesenchymal transition in GBM To further clarify the potential downstream molecular pathways of ESM1 in GBM, we performed KEGG pathway analysis, which showed multiple molecular pathways related to malignant cancer and therapeutic resistance in response to ESM1 expression,
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
6
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
7
Fig. 4. ESM1 regulates transcription of NFkB and induces mesenchymal transition in GBM. (A) KEGG pathway analysis with data from the TCGA database assessing ESM1High GBM compared to ESM1Low GBM. (B) Pearson correlation analysis with data from the CGGA database showing that ESM1 mRNA correlates with NFkB mRNA (R ¼ 0.51, P < 0.001, with paired t-test). (CeD) qRT-PCR (C) and Western blot (D) for NFkB and downstream targets in U87 cells transduced with shRNA against ESM1 (shESM1 #1 and shESM1 #2) or nontargeting control (shNT) (**P < 0.01, ***P < 0.001, with one-way ANOVA followed by Dunnett’s post-test). (EeF) qRT-PCR (E) and Western blot (F) for NFkB and relative downstream targets in U251 cells transduced with ESM1 overexpression lentivirus (ESM1) or control lentivirus (Control) (*P < 0.05, with t-test). (G) Relative luciferase activity of the NFkB p65 promoter transfected into 293T or U87 cells pre-treated with shRNA against ESM1 (shESM1 #2) or non-targeting control (shNT) (*P < 0.05, ***P < 0.001, with t-test). (H) Relative luciferase activity of the NFkB p65 promoter transfected into 293T cells or U87 GBM cells pre-treated with ESM1 overexpression lentivirus (ESM1) or control lentivirus (Control) (**P < 0.01, ***P < 0.001, with t-test). (I) qRT-PCR analysis for expression of mesenchymal markers (N-Cadherin, Vimentin, Snail1, Snail2, Twist, Sox10, MMP-2m MMP-3 and MMP-9) in U87 cells transduced with shRNA against ESM1 (shESM1 #2) or non-targeting control (shNT) with or without NFkB overexpression (*P < 0.05, **P < 0.01, ***P < 0.001, with oneway ANOVA followed by Dunnett’s post-test).
Fig. 3. ESM1 enhances radioresistance by induction of mesenchymal transition in GBM. (A) Hierarchical bi-clustering analysis using data from the TCGA database shows significantly different gene signatures in ESM1High and ESM1Low GBM. (B) Volcano plot showing that 214 genes are associated with ESM1 expression. (CeD) GSEA results with data from the TCGA database showing epithelial-mesenchymal transition as the downstream pathway that most highly correlated with ESM1 expression. (E) Gene expression analysis showing that ESM1 expression is highly enriched in mesenchymal GBM compared to non-tumor, healthy tissue (**P<0.01, ns P>0.05, with one-way ANOVA followed by Dunnett’s posttest). (FeG) qRT-PCR analysis of ESM1 in U87 (F) and U251 (G) cells transduced with ESM1 overexpression lentivirus (ESM1) or control lentivirus (Control) (**P < 0.01, with ttest). (HeI) Western blot analysis of ESM1 in U87 (H) and U251 (I) cells transduced with ESM1 overexpression lentivirus (ESM1) or control lentivirus (Control). (J) Transwell assay showing increased invasion in ESM1-overexpressing U87 cells. (K) Flow cytometry apoptosis analysis for U87 cells pretreated with ESM1 overexpression lentivirus (ESM1) with or without radiation (IR). (LeM) In vitro cell growth assay for ESM1-overexpressing U87 (L) and U251 (M) cells treated with radiation (*P < 0.05, ***P < 0.001, with one-way ANOVA). (N) qRT-PCR analysis showing increased mesenchymal markers (N-Cadherin, Vimentin, Snail1, Snail2, Twist, Sox10, MMP-2 and MMP-9) in ESM1-overexpressing U87 cells (*P < 0.05, **P < 0.01, ***P < 0.001, ns P > 0.05, with t-test).
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
8
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
including positive regulation of NFkB transcription factor activity (Fig. 4A). Pearson correlation analysis with data obtained from the CGGA database showed that ESM1 strongly correlates with NFkB in GBM (Fig. 4B). Additionally, qRT-PCR analysis showed a significant reduction in NFkB p65 after ESM1 silencing in U87 cells (Fig. 4C). Further, Western blot analysis showed a decrease in NFkB and its downstream targets TRAF1, CIAP1, and CIAP2 after shESM1 transfection in U87 cells (Fig. 4D). Conversely, increased expression of NFkB and related downstream targets was found when ESM1 was overexpressed in U251 cells via lentivirus infection (Fig. 4E and F). To further evaluate the effect of ESM1 on NFkB promoter activity, we performed a luciferase reporter assay with constructs driven by a human NFkB promoter. As expected, shRNA-mediated knockdown of ESM1 resulted in a marked decrease in transcriptional activity of the NFkB p65 promoter region in 293T and U87 cells (Fig. 4G). In agreement with this, overexpression of ESM1 led to a significant increase in NFkB p65 promoter activity in both 293T and U87 cells (Fig. 4H). Lastly, U87 cells were transduced with shESM1 lentivirus, and then were transfected with control or NFkB overexpressing plasmids. The qRT-PCR analysis showed that mesenchymal-specific biomarkers were dramatically reduced after ESM1 knockdown, which was partly reversed by NFkB overexpression. These data suggest that the ESM1-dependent transcriptional regulation of NFkB contributes to acquired radioresistance via mesenchymal transition in GBM. 4. Discussion Increasing evidence has suggested that rapidly acquired radioand chemoresistance is one of the major causes for standard treatment failure, leading to glioma recurrence and high patient mortality [18]. Recent studies indicate that cells possess the ability to shift from epithelial to mesenchymal states during embryonic development, by which cells modify the expression of adhesion molecules to adopt a migratory or invasive behavior [19]. Moreover, mesenchymal transition has been observed in multiple cancers and is essential for tumor recurrence and therapy resistance [20]. EMT has been recognized as a main cause of tumor migration, invasion, and therapy resistance in a wide range of human malignant tumors [21]. Mesenchymal-like tumor cells dissociate from the primary tumor and invade into the adjacent blood vessels, leading to rapid tumor progression [19]. Interestingly, GBM cells have the ability to undergo a proneural-to-mesenchymal transition as a response to chemotherapy or radiotherapy [2]. In our study, GSEA revealed that ESM1 correlates with EMT. Moreover, we also found that exogenous overexpression of ESM1 promotes a mesenchymal subtype transition, thus inducing more rapid GBM growth and radioresistance, similar to previous studies. These new findings suggest that ESM1dependent mesenchymal transition contributes to acquired radioresistance in GBM. Further functional confirmation as well as epigenetic-based principal component analyses should be performed to validate this hypothesis. NFkB p65 is a well-recognized anti-apoptotic transcription factor, and abnormal expression or activation of NFkB p65 has been found in multiple types of malignant cancer [3,22]. NFkB promotes tumorigenesis and therapy resistance through induction of master transcription factors such as signal transducer and activator of transcription 3 (STAT3) and TAZ [23]. Lee et al. [24] reported that nuclear factor I-A (NFIA) increased NFkB transcription activity and thus NFkB expression at both the mRNA and protein levels. Interestingly, this study also demonstrated a feed-forward loop between NFIA and NFkB, which may increase GBM cell survival and protect GBM cells from chemotherapy-induced apoptosis. Moreover, Kang et al. [25] demonstrated that ESM1 overexpression in colorectal cancer cells enhanced cell proliferation through the Akt-dependent
activation of the NFkB promoter and pathway. Herein, our study shows that shRNA-mediated suppression of ESM1 induces a reduction of NFkB expression, decreasing cell proliferation and sensitizing U87 cells to radiotherapy. Moreover, shRNA-mediated suppression of ESM1 inhibits the activity of the NFkB promoter, and exogenous overexpression of ESM1 leads to a significant increase in NFkB promoter activity in both 293T and U87 cells, suggesting that ESM1-dependent transcriptional regulation of NFkB contributes to GBM tumorigenesis and radioresistance. Further studies involving ChIP-sequencing should be performed to clarify the mechanism for ESM1-dependent regulation of NFkB in GBM. Acknowledgements The authors would thank all the member of the Department of Neurosurgery and the Center of Brain Science of the First Affiliated Hospital of Xi’an Jiaotong University. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.10.126 Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.10.126. Funding This study was supported by the National Natural Science Foundation of China (81802502), the Project Supported by Natural Science Basic Research Plan in Shaanxi Province of China (2019JQ958) and the Fundamental Research Funds of Xi’an Jiaotong University (1191329177). References [1] P.D. Delgado-Lopez, E.M. Corrales-Garcia, Survival in glioblastoma: a review on the impact of treatment modalities, Clin. Transl. Oncol. 18 (2016) 1062e1071, https://doi.org/10.1007/s12094-016-1497-x. [2] H.S. Phillips, S. Kharbanda, R. Chen, et al., Molecular subclasses of high-grade glioma predict prognosis, delineate a pattern of disease progression, and resemble stages in neurogenesis, Cancer Cell 9 (2006) 157e173, https:// doi.org/10.1016/j.ccr.2006.02.019. [3] K.P.L. Bhat, V. Balasubramaniyan, B. Vaillant, et al., Mesenchymal differentiation mediated by NF-kappaB promotes radiation resistance in glioblastoma, Cancer Cell 24 (2013) 331e346, https://doi.org/10.1016/j.ccr.2013.08.001. [4] S.M. Zhang, L. Zuo, Q. Zhou, et al., Expression and distribution of endocan in human tissues, Biotech. Histochem. 87 (2012) 172e178, https://doi.org/ 10.3109/10520295.2011.577754. [5] C.M. Chen, C.L. Lin, H.L. Chiou, et al., Loss of endothelial cell-specific molecule 1 promotes the tumorigenicity and metastasis of prostate cancer cells through regulation of the TIMP-1/MMP-9 expression, Oncotarget 8 (2017) 13886e13897, https://doi.org/10.18632/oncotarget.14684. [6] M. Delehedde, L. Devenyns, C.A. Maurage, et al., Endocan in cancers: a lesson from a circulating dermatan sulfate proteoglycan, Int. J. Cell Biol. 2013 (2013) 705027, https://doi.org/10.1155/2013/705027. [7] C.A. Maurage, E. Adam, J.F. Mineo, et al., Endocan expression and localization in human glioblastomas, J. Neuropathol. Exp. Neurol. 68 (2009) 633e641, https://doi.org/10.1097/NEN.0b013e3181a52a7f. [8] A. Jana, N.L. Krett, G. Guzman, et al., NFkB is essential for activin-induced colorectal cancer migration via upregulation of PI3K-MDM2 pathway, Oncotarget 8 (2017) 37377e37393, https://doi.org/10.18632/oncotarget.16343. [9] H. Akca, A. Demiray, O. Tokgun, et al., Erratum to "Invasiveness and anchorage independent growth ability augmented by PTEN inactivation through the PI3K/AKT/NFkB pathway in lung cancer cells", Lung Cancer 73 (3) (2011) 302e309, https://doi.org/10.1016/j.lungcan.2016.05.006. Lung Cancer 101 (2016) 147. [10] S.E. Nennig, J.R. Schank, The role of NFkB in drug addiction: beyond inflammation, Alcohol Alcohol 52 (2017) 172e179, https://doi.org/10.1093/alcalc/ agw098. [11] Y. Min, M.J. Kim, S. Lee, et al., Inhibition of TRAF6 ubiquitin-ligase activity by
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
[12]
[13]
[14]
[15]
[16]
[17]
PRDX1 leads to inhibition of NFKB activation and autophagy activation, Autophagy 14 (2018) 1347e1358, https://doi.org/10.1080/15548627.2018. 1474995. J. Sode, S. Bank, U. Vogel, et al., Genetically determined high activities of the TNF-alpha, IL23/IL17, and NFkB pathways were associated with increased risk of ankylosing spondylitis, BMC Med. Genet. 19 (2018) 165, https://doi.org/ 10.1186/s12881-018-0680-z. S.H. Kim, R. Ezhilarasan, E. Phillips, et al., Serine/threonine kinase MLK4 determines mesenchymal identity in glioma stem cells in an NF-kappaBdependent manner, Cancer Cell 29 (2016) 201e213, https://doi.org/10.1016/ j.ccell.2016.01.005. J. Wang, J. Zuo, A. Wahafu, et al., Combined elevation of TRIB2 and MAP3K1 indicates poor prognosis and chemoresistance to temozolomide in glioblastoma, CNS Neurosci, Therapy (2019), https://doi.org/10.1111/cns.13197. J. Wang, P. Cheng, M.S. Pavlyukov, et al., Targeting NEK2 attenuates glioblastoma growth and radioresistance by destabilizing histone methyltransferase EZH2, J. Clin. Investig. 127 (2017) 3075e3089, https://doi.org/ 10.1172/JCI89092. J.T. McDonald, X. Gao, C. Steber, et al., Host mediated inflammatory influence on glioblastoma multiforme recurrence following high-dose ionizing radiation, PLoS One 12 (2017), https://doi.org/10.1371/journal.pone.0178155 e0178155. P. Mao, K. Joshi, J. Li, et al., Mesenchymal glioma stem cells are maintained by activated glycolytic metabolism involving aldehyde dehydrogenase 1A3, Proc. Natl. Acad. Sci. U.S.A. 110 (2013) 8644e8649, https://doi.org/10.1073/ pnas.1221478110.
9
[18] A. Tomiyama, K. Ichimura, Signal transduction pathways and resistance to targeted therapies in glioma, Semin. Cancer Biol. (2019), https://doi.org/ 10.1016/j.semcancer.2019.01.004. [19] M.A. Nieto, R.Y. Huang, R.A. Jackson, et al., EMT (2016) 21e45, https://doi.org/ 10.1016/j.cell.2016.06.028. Cell 166 (2016). [20] X. Yuan, W. Wei, Q. Bao, et al., Metformin inhibits glioma cells stemness and epithelial-mesenchymal transition via regulating YAP activity, Biomed. Pharmacother. 102 (2018) 263e270, https://doi.org/10.1016/j.biopha.2018. 03.031. [21] E. Tulchinsky, O. Demidov, M. Kriajevska, et al., EMT: a mechanism for escape from EGFR-targeted therapy in lung cancer, Biochim. Biophys. Acta Rev. Canc. 1871 (2019) 29e39, https://doi.org/10.1016/j.bbcan.2018.10.003. [22] L. Li, Y. Hou, J. Yu, et al., Synergism of ursolic acid and cisplatin promotes apoptosis and enhances growth inhibition of cervical cancer cells via suppressing NF-kappaB p65, Oncotarget 8 (2017) 97416e97427, https://doi.org/ 10.18632/oncotarget.22133. [23] C. Zuo, Y. Hong, X. Qiu, et al., Celecoxib suppresses proliferation and metastasis of pancreatic cancer cells by down-regulating STAT3/NF-kB and L1CAM activities, Pancreatology 18 (2018) 328e333, https://doi.org/10.1016/ j.pan.2018.02.006. [24] J. Lee, E. Hoxha, H.R. Song, A novel NFIA-NFkappaB feed-forward loop contributes to glioblastoma cell survival, Neuro Oncol. 19 (2017) 524e534, https://doi.org/10.1093/neuonc/now233. [25] Y.H. Kang, N.Y. Ji, S.R. Han, et al., ESM-1 regulates cell growth and metastatic process through activation of NF-kappaB in colorectal cancer, Cell, Signalling 24 (2012) 1940e1949, https://doi.org/10.1016/j.cellsig.2012.06.004.
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB Jia Wang a, b, Jie Zuo c, Alafate Wahafu a, Hai Yu a, Wanfu Xie a, Hua Zhang a, b, Maode Wang a, b, * a b c
Department of Neurosurgery, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi, 710061, PR China Center of Brain Science, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi, 710061, PR China The Second Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi, 710004, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 October 2019 Received in revised form 16 October 2019 Accepted 16 October 2019 Available online xxx
Glioblastoma (GBM) is the most lethal type of glioma in human adults and frequently recurs. Therefore, identification of the underlying mechanisms of GBM therapy resistance is crucial. Endothelial cell specific molecule-1 (ESM1) expression is elevated in a wide range of malignant tumors and correlates with poor prognosis. However, the functional role of ESM1 in GBM remains unclear. Herein, we sought to determine the relevance of ESM1 in GBM and the potential underlying mechanisms of ESM1 in GBM development, progression, and radioresistance. Using bioinformatics analyses, we identified ESM1 as the gene most highly associated with radioresistance in GBM. Clinically, elevated ESM1 was observed in GBM and correlated with poor prognosis. Functionally, silencing of ESM1 significantly reduced GBM cell proliferation, tumorigenesis, and radioresistance. GSEA revealed a correlation between ESM1 and epithelialmesenchymal transition (EMT), and exogenous overexpression of ESM1 induced mesenchymal transition in GBM cells, enhancing radioresistance. Lastly, our data suggest that ESM1 regulates nuclear factor kappa B (NFkB) promoter activity, promoting the mesenchymal transition of GBM cells. Taken together, our findings suggest that ESM1-dependent transcriptional regulation of NFkB contributes to mesenchymal transition, and therefore enhances GBM radioresistance and tumorigenesis. © 2019 Elsevier Inc. All rights reserved.
Keywords: Mesenchymal transition ESM1 NFkB Radioresistance Glioblastoma
1. Introduction Glioblastoma (GBM) is the most lethal subtype of glioma in human adults. Despite aggressive therapeutic strategies including maximum surgical resection, radiotherapy, chemotherapy, and immune and gene therapy, the prognosis for GBM patients remains poor with a 5-year survival rate of less than 5% [1]. A recent study shows that GBMs were classified into 4 subtypes including proneural, proliferation, mesenchymal and neural depending on the epigenetics signatures [2]. Additionally, patients with mesenchymal GBM have the worst prognosis compared to patients with other subtypes of GBM [2]. Additionally, recurring proneural and classical GBM after radiation exhibit more mesenchymal-like phenotypes compared to the primary tumor [3]. These studies suggest that mesenchymal transition-based therapy resistance and
* Corresponding author. Department of Neurosurgery, Center of Brain Science, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi, PR China. E-mail address: [email protected] (M. Wang).
tumor progression are associated with tumor recurrence and poor outcomes in GBM. However, whether mesenchymal transition of GBM is induced by clonal selection or epigenetic reprogramming remains unclear. Endothelial cell specific molecule-1 (ESM1) is selectively expressed in organoids or metabolically active tissues including glandular, inflammatory cytokines, lymph nodes, and capillary endothelial cells [4]. Accumulating data demonstrates that increased ESM1 expression is observed in a wide range of malignant tumors [5,6]. Maurage et al. [7] shows that ESM1 is upregulated in response to tumor necrosis factor (TNF) and fibroblast growth factor 2 (FGF2) in GBM, and hypoxia inducible factor 1 (HIF1) increases ESM1 expression when GBM cells are exposed to hypoxia or cobalt chloride. Additionally, ESM1 is expressed in highgrade, but not low-grade, gliomas, and it is expressed in the palisading cells surrounding areas of necrosis in GBM [7]. To assess the mechanism of ESM1 as an oncogene more deeply, Chen et al. [5] showed that ESM1 promotes tumor migration, invasion, and metastasis via regulation of matrix metalloproteinases (MMPs).
https://doi.org/10.1016/j.bbrc.2019.10.126 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
2
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Despite these findings, the molecular mechanism, especially the downstream targets, of ESM1 in GBM progression remains unclear. The Nuclear Factor kappa B (NFkB) pathway is well known for its variety of functions on cellular responses and disease development. Abnormal activation of the NFkB pathway mediates a wide range of cellular processes related to tumorigenesis, including reduction of cell apoptosis, oncogene mutagenesis, and immune stimulation in multiple types of human cancers [8e10]. Activation of NFkB in cancers is most likely though either inflammatory stimulation such as induction of TNF, or induction of upstream regulators such as NFkB-inducing kinase (NIK) [11,12]. As an important regulator of GBM, NFkB elevation is associated with poor prognosis and enhanced radioresistance [3]. Kim et al. [13] reported that MLK4dependent activation of IkB kinase-a (IKKa) enhances NFkB activity in GBM and induces the transition from proneural to mesenchymal, thus promoting GBM cell proliferation and radioresistance. This study was performed to investigate the underlying mechanisms of ESM1-induced radioresistance in GBM. 2. Materials & methods 2.1. Ethical statement The usage of experimental animals and patient tumor samples was approved by the Scientific Ethics Committee of the First Affiliated Hospital of Xi’an Jiaotong University (no. 2016e18). 2.2. Reagents DMEM-F12 medium, fetal bovine serum (FBS), alamarBlue reagent, PageRuler plus pre-stained protein ladder, and the Alexa Fluor® 488 Annexin V/Dead Cell Apoptosis kit were purchased from Thermo Fisher Scientific. Accutase, RIPA lysis buffer, phosphatase inhibitor, and protease inhibitor were purchased from Merck KGaA. The Bradford reagent and iScript Reverse Transcription SuperMix were purchased from Bio-Rad Laboratories. Bovine serum albumin (BSA) was purchased from New England BioLabs. 2.3. Gene expression analysis Gene expression data were extracted from GEO datasets (GSE56937, 2017 and GSE67089, 2015). Hierarchical bi-clustering was performed to analyze the expression of the target genes via Cluster 3.0. Euclidean distance and average linkage were used as a similarity metric and clustering method, respectively. The comparison of the relative gene expression was presented as fold change.
3
2.5. Cell culture and in vitro cell proliferation assay Cell culture and cell proliferation assays were performed as previously described [15]. GBM cell lines U87, U251, U373MG, SHG44, A172, and normal astrocyte NHA were purchased from BeNa Culture Collection (Kunshan, China). 2.6. Quantitative RT-PCR (qRT-PCR) qRT-PCR was performed as previously described [15]. The sequences of the primers were shown as below: ESM1-forward: ACAGCAGTGAGTGCAAAAGCA, ESM1-reverse GCGGTAGCAAGTTTC TCCCC, N-Cadherin-forward: GGTGGAGGAGAAGAAGACCAG, NCadherin-reverse: GGCATCAGGCTCCACAGT, Vimentin-forward: GACGCCATCAACACCGAGTT; Vimentin-reverse: CTTTGTCGTTGGTT AGCTGGT, Snail1-forward: TCGGAAGCCTAACTACAGCGA, Snail1reverse: AGATGAGCATTGGCAGCGAG, Snail2-forward: CGAACTG GACACACATACAGTG, Snail2-reverse: CTGAGGATCTCTGGTTGTGGT, Twist-forward: GTCCGCAGTCTTACGAGGAG, Twist-reverse: GCTT GAGGGTCTGAATCTTGCT, Sox10-forward: CCTCACAGATCGCCTAC ACC, Sox10-reverse: CATATAGGAGAAGGCCGAGTAGA, MMP-2forward: TACAGGATCATTGGCTACACACC, MMP-2-reverse: GGTCA CATCGCTCCAGACT, MMP-3-forward: AGTCTTCCAATCCTACTGT TGCT, MMP-3-reverse: TCCCCGTCACCTCCAATCC, MMP-9-forward: GAACCAATCTCACCGACAGG, MMP-9-reverse: GCCACCCGAGTG TAACCATA, NFkB p65-forward: CCGCACCTCCACTCCATCC, NFkB p65-reverse: ACATCAGCACCCAAGGACACC, GAPDH-forward: GAAG GTGAAGGTCGGAGTCA, GAPDH-reverse: TTGAGGTCAATGAAGGG GTC. 2.7. Western blotting Western blots were performed as described previously [15]. Antibodies used for western blotting are as follows: ESM1 antibody was purchased from Abcam (ab103590), NFkB p65 antibody was purchased from Thermo Fisher Scientific (701079), TRAF1 antibody was purchased from Abcam (ab129279), CIAP1 antibody was purchased from Abcam (ab2399), CIAP2 antibody was purchased from Abcam (ab32059), and b-actin antibody was purchased from Sigma-Aldrich (A5316). 2.8. Immunohistochemistry (IHC) IHC was performed as previously described [15]. The ESM1 antibody was purchased from Abcam (ab103590). German immunohistochemical scoring (GIS) was used to measure the expression of ESM1 as previously described [15].
2.4. GSEA and KEGG pathway analysis
2.9. Lentivirus production and transduction
Gene expression profiles were derived from public databases including TCGA and Gene Expression Omnibus (GEO, GSE16011). All data were preprocessed using the R language, including normalization and gene ID transformation, then these data were divided into 2 groups based on high or low expression of ESM1. GSEA and KEGG pathway analyses were performed as previously described [14].
Lentivirus production and transduction was performed as previously described [15]. shRNA sequences are as follows: shESM1 #1: NM_007036.4e772s21c1 CCGGTAGGATACTTACAATCCATAACT CGAGTTATGGATTGTAAGTATCCTATTTTTG, and shESM1 #2: NM_007036.4e951s21c1 CCGGAGACCGCAGTGAGTCAAATTACTCGA GTAATTTGACTCACTGCGGTCTTTTTTG. The lentivirus for ESM1 overexpression was purchased from Genechem (Shanghai, China).
Fig. 1. ESM1 expression correlates with radioresistance and indicates poor prognosis in GBM. (A) Venn diagram showing ESM1 as one of the most differentially expressed genes correlating to GBM radioresistance and mesenchymal subtype. (B) Depiction of ESM1 as the most upregulated gene in GBM using data from the TCGA database. (C) Gene expression analysis with data from the Rembrandt database suggesting that ESM1 expression is elevated in GBM (***P < 0.001, with one-way ANOVA followed by Dunnett’s posttest). (DeE) qRT-PCR (D) and western blotting analysis (D) of ESM1 expression in GBM cell lines (**P < 0.01, ***P < 0.001, with one-way ANOVA followed by Dunnett’s posttest). (F) Representative IHC images of ESM1 expression in glioma samples. (G) ESM1 is enriched in GBM compared to low grade glioma samples or non-tumor tissue. (HeJ) Kaplan-Meier analysis of patient survival compared to ESM1 expression in patient samples (H) (P ¼ 0.0005, with log-rank test), TCGA database (I) (P ¼ 0.0321, with log-rank test) and CCGA database (J) (P < 0.0001, with log-rank test).
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
4
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2.10. Luciferase reporter assay After lentivirus transduction, 293T or U87 cells were seeded at a concentration of 1 106 cells per well in six-well plates. NFkB p65 activity was determined using the NFkB Reporter kit (BPS Bioscience, 60614). Normalized luciferase activity for the NFkB p65 reporter was measured as a ratio of firefly luminescence to Renilla luminescence. 2.11. Flow cytometry Flow cytometry was performed as previously described [15]. The Alexa Fluor® 488 Annexin V/Dead Cell Apoptosis kit was used to measure cell apoptosis according to the manufacturer’s protocol. 2.12. Intracranial xenograft tumor model Six-week-old female nude mice were used for GBM xenografts. Intracranial xenografts were generated as previously described [15]. TMZ (50 mg/kg/d) or DMSO was injected into the tail vein 7 days post-tumor implantation. 10 mice were used for each group and Kaplan-Meier plot were used to evaluate the survival. 2.13. Statistical analysis All the results in this study are presented as mean ± SD. Statistical differences between 2 groups were evaluated by using twotailed t-tests. Multiple groups were compared with one-way ANOVA followed by Dunnett’s post-test. Kaplan-Meier survival analysis was analyzed by the log-rank test. All statistical analyses were performed with SPSS 19.0 or GraphPad Prism 6 software. Data were considered statistically significant when the p-value was less than 0.05. 3. Results 3.1. ESM1 correlates with radioresistance and indicates poor prognosis in GBM Genome-wide hierarchical bi-clustering was performed using previously published microarray databases containing information on tumors which had rapid (4 days) or delayed (35 days) responses to radiotherapy, compared to the more radioresistant mesenchymal subtype (GSE56937 [16] and GSE67089 [17]). The differentially expressed genes were sorted by their fold change, and genes with more than 0.5-fold upregulation were selected. The overlapping genes from those three gene lists were summarized. Finally, we found 11 genes that significantly correlated with rapid response to radiotherapy, delayed response to radiotherapy, and mesenchymal subtype (Fig. 1A). Using expression data extracted from TCGA, the top 11 genes in GBM samples were compared to those in low grade glioma samples. The results showed that ESM1 was the most upregulated gene in GBM (Fig. 1B). Furthermore, data from the Rembrandt database showed a significant trend of increased ESM1 expression in GBM compared to other types of glioma and normal brain tissue (Fig. 1C). Five GBM cell lines were used to evaluate the expression of ESM1, and normal astrocyte NHA cells were used as a negative control. qRT-PCR analysis revealed that ESM1 is highly expressed in GBM cell lines (Fig. 1D). Similar results were observed in western blots (Fig. 1E). To determine the prognostic role of ESM1 in GBM, IHC was performed on glioma samples from 91 patients who underwent surgery during 2008e2014 in the First Affiliated Hospital of Xi’an Jiaotong University to analyze the expression of ESM1. Three brain tissue samples obtained from patients who underwent epilepsy
surgery were used as negative controls. The IHC results showed that ESM1 was enriched in the cytoplasm and membrane of glioma cells, while no significant staining was observed in normal tissues (Fig. 1F). In addition, the patients with glioma were divided into 2 groups according to the GIS of ESM1 expression. The data suggest that ESM1 is more likely to be enriched in GBM compared to low grade glioma (GBM accounted for 75.93% of ESM1High samples and 2.703% of ESM1Low samples) (Fig. 1G). Moreover, the survival of the patients was monitored until December 2018 and analyzed using the Kaplan-Meier method based on the expression of ESM1. We found that patients with lower expression of ESM1 exhibited prolonged overall survival compared to the patients with higher expression (Fig. 1H). Similar results were observed using data extracted from TCGA and CGGA (Fig. 1I and J). Altogether, these results indicate that ESM1 is enriched in GBM and correlates with radioresistance. 3.2. Silencing of ESM1 attenuates GBM growth and radioresistance To investigate the function of ESM1 in GBM tumorigenesis and radioresistance, exogenous silencing of ESM1 was performed in U87 and U251 cells using lentivirus infection. The infection efficiency was roughly evaluated by fluorescence (Fig. 2A). qRT-PCR and Western blot analysis confirmed decreased ESM1 expression in knockdown U87 and U251 cells (Fig. 2B, C, 2D and 2E). Furthermore, in vitro cell growth assays showed a decrease in proliferation and radioresistance of U87 and U251 after ESM1 silencing (Fig. 2F and G). Moreover, U87 cells with or without ESM1 knockdown were treated with radiotherapy and the number of cells undergoing apoptosis was determined. The results indicated that ESM1 silencing enhanced the radiosensitivity of U87 cells (Fig. 2H). Lastly, U87 cells were transfected with a luciferase reporter before infection with either non-targeting or lentivirus containing ESM1 shRNA (shESM1). These cells were then orthotopically implanted into nude mice. In vivo bioluminescence imaging revealed that silencing of ESM1 attenuates U87 tumor formation and radioresistance (Fig. 2I), and the combination of shESM1 and radiotherapy significantly prolonged survival (Fig. 2J). 3.3. ESM1 enhances radioresistance by inducing mesenchymal transition in GBM To investigate the potential biological function of ESM1 in GBM, patient data from the TCGA database was grouped into 2 groups according to the expression of ESM1. Hierarchical bi-clustering analysis indicated significantly altered gene expression signatures in ESM1High GBM compared to ESM1Low GBM (Fig. 3A). Based on the results, a total of 214 genes most highly associated with ESM1 expression (187 upregulated genes and 27 downregulated genes) were selected for GSEA based on the fold change and P-value (Fig. 3B). GSEA results demonstrated that EMT was the pathway most correlated with ESM1 expression (Fig. 3C and D). Moreover, gene expression analysis using data from the TCGA database showed that ESM1 was remarkably enriched in mesenchymal GBM compared to normal brain tissue. However, other subtypes of GBM, including proneural, neural, and classical, showed no significant elevation in ESM1 expression (Fig. 3E). To further investigate the biological functions of ESM1 in GBM cells, a lentivirus to overexpress ESM1 was introduced into U87 and U251 cells. Afterwards, qRT-PCR and Western blot confirmed the elevated expression of ESM1 (Fig. 3F, G, 3H and 3I). Additionally, transwell assays indicated that invasion of U87 cells was enhanced by ESM1 overexpression (Fig. 3J). Flow cytometry analysis also showed significantly reduced apoptosis in ESM1-overexpressed U87 cells after radiation treatment (Fig. 3K). Similarly, in vitro cell
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 2. Silencing of ESM1 attenuates tumor growth and radioresistance of GBM. (A) Representative fluorescence images of ESM1 knockdown in GBM cells. (BeC) qRT-PCR analysis of ESM1 in U87 (B) or U251 (C) cells transduced with shRNA against ESM1 (shESM1 #1 and shESM1 #2) or non-targeting control (shNT) (***P < 0.001, with one-way ANOVA followed by Dunnett’s posttest). (DeE) Western blotting analysis of ESM1 in U87 (D) or U251 (E) cells transduced with shRNA against ESM1 (shESM1 #1 and shESM1 #2) or non-targeting control (shNT). (FeG) In vitro cell growth assay for ESM1 knockdown (shESM1 #2) combined with radiation (IR) in U87 (F) or U251 (G) cells (**P < 0.01, ***P < 0.001, with one-way ANOVA). (H) Flow cytometry apoptosis analysis for U87 cells pretreated with ESM1 knockdown lentivirus (shESM1 #2) with or without radiation (IR). (IeJ) Bioluminescence images (I) and Kaplan-Meier analysis (J) of mice xenografted with luciferase-labeled U87 cells transduced with ESM1 knockdown lentivirus (shESM1 #2) then either left to grow or treated with 2 Gy radiation continuously for 5 days (*P < 0.05, ***P < 0.001, n ¼ 10, with log-rank test).
viability assays show that U87 and U251 cells overexpressing ESM1 were more resistant to radiotherapy than the control cells (Fig. 3L and M). Lastly, qRT-PCR was performed to evaluate mesenchymal biomarkers after ESM1 overexpression. The results indicated an increase in most of the EMT-specific biomarkers upon overexpression of ESM1 (Fig. 3N).
3.4. ESM1 regulates transcription of NFkB and induces mesenchymal transition in GBM To further clarify the potential downstream molecular pathways of ESM1 in GBM, we performed KEGG pathway analysis, which showed multiple molecular pathways related to malignant cancer and therapeutic resistance in response to ESM1 expression,
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
6
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
7
Fig. 4. ESM1 regulates transcription of NFkB and induces mesenchymal transition in GBM. (A) KEGG pathway analysis with data from the TCGA database assessing ESM1High GBM compared to ESM1Low GBM. (B) Pearson correlation analysis with data from the CGGA database showing that ESM1 mRNA correlates with NFkB mRNA (R ¼ 0.51, P < 0.001, with paired t-test). (CeD) qRT-PCR (C) and Western blot (D) for NFkB and downstream targets in U87 cells transduced with shRNA against ESM1 (shESM1 #1 and shESM1 #2) or nontargeting control (shNT) (**P < 0.01, ***P < 0.001, with one-way ANOVA followed by Dunnett’s post-test). (EeF) qRT-PCR (E) and Western blot (F) for NFkB and relative downstream targets in U251 cells transduced with ESM1 overexpression lentivirus (ESM1) or control lentivirus (Control) (*P < 0.05, with t-test). (G) Relative luciferase activity of the NFkB p65 promoter transfected into 293T or U87 cells pre-treated with shRNA against ESM1 (shESM1 #2) or non-targeting control (shNT) (*P < 0.05, ***P < 0.001, with t-test). (H) Relative luciferase activity of the NFkB p65 promoter transfected into 293T cells or U87 GBM cells pre-treated with ESM1 overexpression lentivirus (ESM1) or control lentivirus (Control) (**P < 0.01, ***P < 0.001, with t-test). (I) qRT-PCR analysis for expression of mesenchymal markers (N-Cadherin, Vimentin, Snail1, Snail2, Twist, Sox10, MMP-2m MMP-3 and MMP-9) in U87 cells transduced with shRNA against ESM1 (shESM1 #2) or non-targeting control (shNT) with or without NFkB overexpression (*P < 0.05, **P < 0.01, ***P < 0.001, with oneway ANOVA followed by Dunnett’s post-test).
Fig. 3. ESM1 enhances radioresistance by induction of mesenchymal transition in GBM. (A) Hierarchical bi-clustering analysis using data from the TCGA database shows significantly different gene signatures in ESM1High and ESM1Low GBM. (B) Volcano plot showing that 214 genes are associated with ESM1 expression. (CeD) GSEA results with data from the TCGA database showing epithelial-mesenchymal transition as the downstream pathway that most highly correlated with ESM1 expression. (E) Gene expression analysis showing that ESM1 expression is highly enriched in mesenchymal GBM compared to non-tumor, healthy tissue (**P<0.01, ns P>0.05, with one-way ANOVA followed by Dunnett’s posttest). (FeG) qRT-PCR analysis of ESM1 in U87 (F) and U251 (G) cells transduced with ESM1 overexpression lentivirus (ESM1) or control lentivirus (Control) (**P < 0.01, with ttest). (HeI) Western blot analysis of ESM1 in U87 (H) and U251 (I) cells transduced with ESM1 overexpression lentivirus (ESM1) or control lentivirus (Control). (J) Transwell assay showing increased invasion in ESM1-overexpressing U87 cells. (K) Flow cytometry apoptosis analysis for U87 cells pretreated with ESM1 overexpression lentivirus (ESM1) with or without radiation (IR). (LeM) In vitro cell growth assay for ESM1-overexpressing U87 (L) and U251 (M) cells treated with radiation (*P < 0.05, ***P < 0.001, with one-way ANOVA). (N) qRT-PCR analysis showing increased mesenchymal markers (N-Cadherin, Vimentin, Snail1, Snail2, Twist, Sox10, MMP-2 and MMP-9) in ESM1-overexpressing U87 cells (*P < 0.05, **P < 0.01, ***P < 0.001, ns P > 0.05, with t-test).
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
8
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
including positive regulation of NFkB transcription factor activity (Fig. 4A). Pearson correlation analysis with data obtained from the CGGA database showed that ESM1 strongly correlates with NFkB in GBM (Fig. 4B). Additionally, qRT-PCR analysis showed a significant reduction in NFkB p65 after ESM1 silencing in U87 cells (Fig. 4C). Further, Western blot analysis showed a decrease in NFkB and its downstream targets TRAF1, CIAP1, and CIAP2 after shESM1 transfection in U87 cells (Fig. 4D). Conversely, increased expression of NFkB and related downstream targets was found when ESM1 was overexpressed in U251 cells via lentivirus infection (Fig. 4E and F). To further evaluate the effect of ESM1 on NFkB promoter activity, we performed a luciferase reporter assay with constructs driven by a human NFkB promoter. As expected, shRNA-mediated knockdown of ESM1 resulted in a marked decrease in transcriptional activity of the NFkB p65 promoter region in 293T and U87 cells (Fig. 4G). In agreement with this, overexpression of ESM1 led to a significant increase in NFkB p65 promoter activity in both 293T and U87 cells (Fig. 4H). Lastly, U87 cells were transduced with shESM1 lentivirus, and then were transfected with control or NFkB overexpressing plasmids. The qRT-PCR analysis showed that mesenchymal-specific biomarkers were dramatically reduced after ESM1 knockdown, which was partly reversed by NFkB overexpression. These data suggest that the ESM1-dependent transcriptional regulation of NFkB contributes to acquired radioresistance via mesenchymal transition in GBM. 4. Discussion Increasing evidence has suggested that rapidly acquired radioand chemoresistance is one of the major causes for standard treatment failure, leading to glioma recurrence and high patient mortality [18]. Recent studies indicate that cells possess the ability to shift from epithelial to mesenchymal states during embryonic development, by which cells modify the expression of adhesion molecules to adopt a migratory or invasive behavior [19]. Moreover, mesenchymal transition has been observed in multiple cancers and is essential for tumor recurrence and therapy resistance [20]. EMT has been recognized as a main cause of tumor migration, invasion, and therapy resistance in a wide range of human malignant tumors [21]. Mesenchymal-like tumor cells dissociate from the primary tumor and invade into the adjacent blood vessels, leading to rapid tumor progression [19]. Interestingly, GBM cells have the ability to undergo a proneural-to-mesenchymal transition as a response to chemotherapy or radiotherapy [2]. In our study, GSEA revealed that ESM1 correlates with EMT. Moreover, we also found that exogenous overexpression of ESM1 promotes a mesenchymal subtype transition, thus inducing more rapid GBM growth and radioresistance, similar to previous studies. These new findings suggest that ESM1dependent mesenchymal transition contributes to acquired radioresistance in GBM. Further functional confirmation as well as epigenetic-based principal component analyses should be performed to validate this hypothesis. NFkB p65 is a well-recognized anti-apoptotic transcription factor, and abnormal expression or activation of NFkB p65 has been found in multiple types of malignant cancer [3,22]. NFkB promotes tumorigenesis and therapy resistance through induction of master transcription factors such as signal transducer and activator of transcription 3 (STAT3) and TAZ [23]. Lee et al. [24] reported that nuclear factor I-A (NFIA) increased NFkB transcription activity and thus NFkB expression at both the mRNA and protein levels. Interestingly, this study also demonstrated a feed-forward loop between NFIA and NFkB, which may increase GBM cell survival and protect GBM cells from chemotherapy-induced apoptosis. Moreover, Kang et al. [25] demonstrated that ESM1 overexpression in colorectal cancer cells enhanced cell proliferation through the Akt-dependent
activation of the NFkB promoter and pathway. Herein, our study shows that shRNA-mediated suppression of ESM1 induces a reduction of NFkB expression, decreasing cell proliferation and sensitizing U87 cells to radiotherapy. Moreover, shRNA-mediated suppression of ESM1 inhibits the activity of the NFkB promoter, and exogenous overexpression of ESM1 leads to a significant increase in NFkB promoter activity in both 293T and U87 cells, suggesting that ESM1-dependent transcriptional regulation of NFkB contributes to GBM tumorigenesis and radioresistance. Further studies involving ChIP-sequencing should be performed to clarify the mechanism for ESM1-dependent regulation of NFkB in GBM. Acknowledgements The authors would thank all the member of the Department of Neurosurgery and the Center of Brain Science of the First Affiliated Hospital of Xi’an Jiaotong University. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.10.126 Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.10.126. Funding This study was supported by the National Natural Science Foundation of China (81802502), the Project Supported by Natural Science Basic Research Plan in Shaanxi Province of China (2019JQ958) and the Fundamental Research Funds of Xi’an Jiaotong University (1191329177). References [1] P.D. Delgado-Lopez, E.M. Corrales-Garcia, Survival in glioblastoma: a review on the impact of treatment modalities, Clin. Transl. Oncol. 18 (2016) 1062e1071, https://doi.org/10.1007/s12094-016-1497-x. [2] H.S. Phillips, S. Kharbanda, R. Chen, et al., Molecular subclasses of high-grade glioma predict prognosis, delineate a pattern of disease progression, and resemble stages in neurogenesis, Cancer Cell 9 (2006) 157e173, https:// doi.org/10.1016/j.ccr.2006.02.019. [3] K.P.L. Bhat, V. Balasubramaniyan, B. Vaillant, et al., Mesenchymal differentiation mediated by NF-kappaB promotes radiation resistance in glioblastoma, Cancer Cell 24 (2013) 331e346, https://doi.org/10.1016/j.ccr.2013.08.001. [4] S.M. Zhang, L. Zuo, Q. Zhou, et al., Expression and distribution of endocan in human tissues, Biotech. Histochem. 87 (2012) 172e178, https://doi.org/ 10.3109/10520295.2011.577754. [5] C.M. Chen, C.L. Lin, H.L. Chiou, et al., Loss of endothelial cell-specific molecule 1 promotes the tumorigenicity and metastasis of prostate cancer cells through regulation of the TIMP-1/MMP-9 expression, Oncotarget 8 (2017) 13886e13897, https://doi.org/10.18632/oncotarget.14684. [6] M. Delehedde, L. Devenyns, C.A. Maurage, et al., Endocan in cancers: a lesson from a circulating dermatan sulfate proteoglycan, Int. J. Cell Biol. 2013 (2013) 705027, https://doi.org/10.1155/2013/705027. [7] C.A. Maurage, E. Adam, J.F. Mineo, et al., Endocan expression and localization in human glioblastomas, J. Neuropathol. Exp. Neurol. 68 (2009) 633e641, https://doi.org/10.1097/NEN.0b013e3181a52a7f. [8] A. Jana, N.L. Krett, G. Guzman, et al., NFkB is essential for activin-induced colorectal cancer migration via upregulation of PI3K-MDM2 pathway, Oncotarget 8 (2017) 37377e37393, https://doi.org/10.18632/oncotarget.16343. [9] H. Akca, A. Demiray, O. Tokgun, et al., Erratum to "Invasiveness and anchorage independent growth ability augmented by PTEN inactivation through the PI3K/AKT/NFkB pathway in lung cancer cells", Lung Cancer 73 (3) (2011) 302e309, https://doi.org/10.1016/j.lungcan.2016.05.006. Lung Cancer 101 (2016) 147. [10] S.E. Nennig, J.R. Schank, The role of NFkB in drug addiction: beyond inflammation, Alcohol Alcohol 52 (2017) 172e179, https://doi.org/10.1093/alcalc/ agw098. [11] Y. Min, M.J. Kim, S. Lee, et al., Inhibition of TRAF6 ubiquitin-ligase activity by
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126
J. Wang et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
[12]
[13]
[14]
[15]
[16]
[17]
PRDX1 leads to inhibition of NFKB activation and autophagy activation, Autophagy 14 (2018) 1347e1358, https://doi.org/10.1080/15548627.2018. 1474995. J. Sode, S. Bank, U. Vogel, et al., Genetically determined high activities of the TNF-alpha, IL23/IL17, and NFkB pathways were associated with increased risk of ankylosing spondylitis, BMC Med. Genet. 19 (2018) 165, https://doi.org/ 10.1186/s12881-018-0680-z. S.H. Kim, R. Ezhilarasan, E. Phillips, et al., Serine/threonine kinase MLK4 determines mesenchymal identity in glioma stem cells in an NF-kappaBdependent manner, Cancer Cell 29 (2016) 201e213, https://doi.org/10.1016/ j.ccell.2016.01.005. J. Wang, J. Zuo, A. Wahafu, et al., Combined elevation of TRIB2 and MAP3K1 indicates poor prognosis and chemoresistance to temozolomide in glioblastoma, CNS Neurosci, Therapy (2019), https://doi.org/10.1111/cns.13197. J. Wang, P. Cheng, M.S. Pavlyukov, et al., Targeting NEK2 attenuates glioblastoma growth and radioresistance by destabilizing histone methyltransferase EZH2, J. Clin. Investig. 127 (2017) 3075e3089, https://doi.org/ 10.1172/JCI89092. J.T. McDonald, X. Gao, C. Steber, et al., Host mediated inflammatory influence on glioblastoma multiforme recurrence following high-dose ionizing radiation, PLoS One 12 (2017), https://doi.org/10.1371/journal.pone.0178155 e0178155. P. Mao, K. Joshi, J. Li, et al., Mesenchymal glioma stem cells are maintained by activated glycolytic metabolism involving aldehyde dehydrogenase 1A3, Proc. Natl. Acad. Sci. U.S.A. 110 (2013) 8644e8649, https://doi.org/10.1073/ pnas.1221478110.
9
[18] A. Tomiyama, K. Ichimura, Signal transduction pathways and resistance to targeted therapies in glioma, Semin. Cancer Biol. (2019), https://doi.org/ 10.1016/j.semcancer.2019.01.004. [19] M.A. Nieto, R.Y. Huang, R.A. Jackson, et al., EMT (2016) 21e45, https://doi.org/ 10.1016/j.cell.2016.06.028. Cell 166 (2016). [20] X. Yuan, W. Wei, Q. Bao, et al., Metformin inhibits glioma cells stemness and epithelial-mesenchymal transition via regulating YAP activity, Biomed. Pharmacother. 102 (2018) 263e270, https://doi.org/10.1016/j.biopha.2018. 03.031. [21] E. Tulchinsky, O. Demidov, M. Kriajevska, et al., EMT: a mechanism for escape from EGFR-targeted therapy in lung cancer, Biochim. Biophys. Acta Rev. Canc. 1871 (2019) 29e39, https://doi.org/10.1016/j.bbcan.2018.10.003. [22] L. Li, Y. Hou, J. Yu, et al., Synergism of ursolic acid and cisplatin promotes apoptosis and enhances growth inhibition of cervical cancer cells via suppressing NF-kappaB p65, Oncotarget 8 (2017) 97416e97427, https://doi.org/ 10.18632/oncotarget.22133. [23] C. Zuo, Y. Hong, X. Qiu, et al., Celecoxib suppresses proliferation and metastasis of pancreatic cancer cells by down-regulating STAT3/NF-kB and L1CAM activities, Pancreatology 18 (2018) 328e333, https://doi.org/10.1016/ j.pan.2018.02.006. [24] J. Lee, E. Hoxha, H.R. Song, A novel NFIA-NFkappaB feed-forward loop contributes to glioblastoma cell survival, Neuro Oncol. 19 (2017) 524e534, https://doi.org/10.1093/neuonc/now233. [25] Y.H. Kang, N.Y. Ji, S.R. Han, et al., ESM-1 regulates cell growth and metastatic process through activation of NF-kappaB in colorectal cancer, Cell, Signalling 24 (2012) 1940e1949, https://doi.org/10.1016/j.cellsig.2012.06.004.
Please cite this article as: J. Wang et al., ESM1-dependent mesenchymal transition enhances radioresistance of glioblastoma via transcriptional regulation of NFkB, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.126