- Email: [email protected]
WNT7A Mutations in patients with Müllerian duct abnormalities
J Pediatr Adolesc Gynecol (2003) 16:217–221
Original Studies WNT7A Mutations in Patients with Mu¨llerian Duct Abnormalities L.S. Timmreck, MD, H.A. Pan, MD, R.H. Reindollar, MD, and M.R. Gray, PhD Department of Obstetrics, Gynecology, and Reproductive Biology, Division of Reproductive Endocrinology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts
Abstract. Study Objective: WNT7A gene mutations were evaluated as a potential cause for Mu¨llerian duct derivative abnormalities in human females. The WNT gene family encodes glycoproteins that serve as signaling molecules during early development. The WNT7A gene has been previously identified as necessary for normal murine Mu¨llerian duct development. WNT7A mutant mice display several Mu¨llerian duct derivative abnormalities. Design: Molecular genetic analysis of female patients with Mu¨llerian duct derivative abnormalities. Setting: Medical center-based academic research institution. Participants: 40 women with developmental abnormalities of the uterus and vagina and 12 normal controls. Interventions: Polymerase chain reaction DNA amplification from human genomic DNA and denaturing gradient gel electrophoresis analysis of amplified DNA fragments. Main Outcome Measures: Presence or absence of WNT7A gene mutations in analyzed DNA fragments. Results: No mutations were found in the WNT7A gene in any patient or control tested. Conclusions: WNT7A mutations are an unlikely cause of Mu¨llerian duct derivative abnormalities in humans.
Key Words. Mu¨llerian ducts—Congenital absence of the uterus and vagina—WNT7A—Mutation Introduction WNT genes, first identified in mice1,2 and Drosophila,3,4 are members of a large family of genes encoding highly conserved glycoproteins that function as signaling Address correspondence to: Richard H. Reindollar, MD, Department of Obstetrics, Gynecology, and Reproductive Biology, Division of Reproductive Endocrinology, Beth Israel Deaconess Medical Center, Harvard Medical School, 330 Brookline Avenue, KS322, Boston, MA 02215; Phone: 617-667-1862; Fax: 617-975-5575; E-mail: [email protected] Synopsis: WNT7A gene mutations were not found in 40 patients with Mu¨llerian duct abnormalities and, thus, are likely not etiologic.
쑖 2003 North American Society for Pediatric and Adolescent Gynecology Published by Elsevier Science Inc.
molecules.5,6 Homologous genes have since been found in many vertebrates including humans. To date, 19 WNT genes have been found in humans: WNT1, 2, 2b/13, 3, 3a, 4, 5a, 5b, 6, 7a, 7b, 8a, 8b, 10a, 10b, 11, 14, 15, and 16.7 The function of WNT genes is to direct and coordinate growth and development of specific groups of cells. The target group of cells varies with each WNT gene. Mutations in the WNT7a gene affect chick limb bud development,8 murine limb bud development,9 and murine Mu¨llerian duct development.9 Expression of the WNT7A gene has been extensively studied in mice.10 Female mice with complete loss of function mutations in the WNT7A gene had malformed Mu¨llerian duct derivatives including small uteri,9,11,12 incompletely differentiated Mu¨llerian ducts,9 thin muscular development in the uterine walls,9,12 incompletely coiled or absent oviducts,9,11–13 shallow vaginal fornices,13 uterine horns with features consistent with both uterus and vagina,11 disorganized uterine smooth muscle,11 and oviducts incompletely separated from uterus.11 Some mutant mice were infertile,12 In male mice, normal function of the WNT7A gene is required for Mu¨llerian duct regression.12 Expression of the WNT7A gene in humans has been detected in the placenta, kidney, testis, fetal lung, fetal and adult brain, and uterus.14 Among uterine tissues, WNT7A mRNA is found in endometrium, myometrium, leiomyomas, and endometrial cancer cell lines.15–17 Lower than normal levels of uterine WNT7A transcripts have been detected at birth in females exposed to DES in utero.17,18 No studies have evaluated the association of human WNT7A gene mutations with the development of Mu¨llerian duct derivative abnormalities. Mu¨llerian duct derivative abnormalities in humans include congenital absence of the uterus and vagina (CAUV or Mayer-Rokitansky-Kuster-Hauser syndrome), unicornuate uterus, didelphic uterus, bicornuate uterus, septate uterus, and vaginal septum. CAUV 1083-3188/03/$22.00 doi:10.1016/S1083-3188(03)00124-4
218
Timmreck et al: Mutations and Mu¨llerian Duct Abnormalities
is present in 1 in 4,000–5,000 newborn females19 and presents to the pediatrician or gynecologist with primary amenorrhea in the presence of otherwise normal pubertal development. The incidence of the less severe Mu¨llerian duct abnormalities is higher but incompletely quantified. The presentation of these abnormalities varies and may include infertility, recurrent pregnancy loss, malpresentation in pregnancy, and premature labor and delivery. In patients presenting with infertility, 1–3% have evidence of a uterine abnormality diagnosed by hysterosalpingogram (HSG).20,21 In women with recurrent pregnancy loss, as many as 5– 25% of HSG results demonstrate evidence of a uterine abnormality.21 Even women with normal reproductive histories demonstrate a 2–3% incidence of an abnormal HSG finding.21–23 Very little is known about genes that regulate Mu¨llerian duct development in humans. Although studies have evaluated candidate genes to date, no genetic cause for any Mu¨llerian duct derivative abnormality has been found. The direct relationship between murine WNT7A mutations and both Mu¨llerian and limb bud defects made this gene an attractive candidate for analysis in humans with Mu¨llerian duct derivative abnormalities. Approximately 10% of women with CAUV commonly have concomitant skeletal abnormalities, further implicating WNT7A as a particularly interesting candidate gene. In addition, the expression of WNT7A in endometrium and myometrium in human females adds further support to the hypothesis that Mu¨llerian duct derivative abnormalities are the result of WNT7A gene mutations.
Materials and Methods Genomic DNA was extracted from peripheral blood samples of 40 patients with Mu¨llerian duct derivative anomalies and 12 controls as previously described.24 Controls were defined as women with a normal reproductive history—at least one full-term live born infant with no history of infertility or miscarriage and no known abnormalities of the Mu¨llerian duct derivatives. These experiments were approved and monitored by the medical center human investigation review board for protection of research subjects. A board-certified reproductive endocrinologist and clinical medical geneticist examined all but three of the patients. These three subjects were identified, screened, and enrolled by referring obstetrician/gynecologists. Thirty-one patients had CAUV, three had uterus didelphys, two had a unicornuate uterus, three had a uterine septum, and one had a vaginal septum. Two patients were siblings, and the remaining patients were not known to have affected relatives. Of the patients with CAUV, two had unilateral renal agenesis, one had a horseshoe kidney, one was deaf, and five had varying degrees of
scoliosis. Of the patients with scoliosis, one had spina bifida occulta, and one had an abnormality of the left thumb. Of the patients with uterus didelphys, one had unilateral renal agenesis. Polymerase chain reaction (PCR) using genomic DNA templates was used to amplify all three exons of the human WNT7A gene (Fig. 1). Primers were selected from the full WNT7A sequence (National Center for Biotechnology Information) using a computer program (DNA Star, DNASTAR, Inc, Madison, WI). DNA fragments were amplified in vitro using optimized conditions for each exon. Oligonucleotide primers flanking the exon were used as follows: exon 1: 5′- GGGACTATGAACCGGAAAGC- 3′, and 5′TGTCCCTAGAGCCGGTAAGA -3′ (creating a 314 bp fragment); exon 2: 5′- CTGACCCCAACTTGTCTCCT 3′, and 5′-AAGCCATTTTGCAGCATCTC -3′ (323 bp fragment); exon 3: 5′- CTGGGCTACGTGCTCAAGGACAAG -3′, and 5′- GGAAACCCAGGAAAAGTA 3′ (469 bp fragment). DNA fragments amplified using these primers included all of the WNT7A coding sequence except for 32 codons. Each 50 µL reaction mixture included 100 ng genomic DNA, 50 mM of each exon-specific primer, 7.5– 15 mM MgCl (exon 1: 15 mM; exon 2: 10 mM; exon 3: 7.5 mM), 0.1 U Taq polymerase, and 100 µM dNTPs. PCR was performed using a Gene Amp쑓 PCR System 9700 (Applied Biosystems, Norwalk, CT, USA). After an initial 3 min denaturation step at 94ºC, the reactions were subjected to 40 amplification cycles of 94ºC × 1 min, 52–62ºC × 1 min, 73ºC × 1 min, followed by a 10-min incubation at 72ºC. The annealing temperature for exon 1 was 60ºC, exon 2, 62ºC, and exon 3, 52ºC. Following the amplification of exon 3, the restriction enzyme HinP1 I (NE Biolabs, Beverly, MA) was used to cut this 469 bp fragment into three smaller fragments of 182, 147, and 140 bp (Fig. 1). These PCR fragments (8 µL) were digested according to manufacturer’s suggestions. Intact and digested PCR fragments from exons 1, 2, 3 were electrophoresed in 1.5% agarose mini-gels to verify the expected lengths of the amplified fragments. These results were confirmed further by electrophoresis in 10% polyacrylamide gels to more precisely determine the length of each amplified fragment. Both types of gels were stained in ethidium bromide (1 µg/mL)
Fig. 1. Schematic of human WNT7A gene.
Timmreck et al: Mutations and Mu¨llerian Duct Abnormalities
for 20 min, rinsed with distilled water and photographed over a long-wave UV light source. Denaturing gradient gel electrophoresis (DGGE) analysis was then performed on each DNA sample.25 All DGGE gels included a 20–80% linear gradient of denaturants (100% ⫽ 7 M urea, 40% formamide). The gel was submerged in the electrophoresis chamber in TAE (Tris-Acetate-EDTA) buffer at 60ºC during electrophoresis at 50 volts for 14 h. Following electrophoresis, the gels were stained in ethidium bromide (1 µg/mL) for 5 min, rinsed with distilled water, and photographed over a long-wave UV light source. Results Electrophoresis of PCR fragments revealed the expected 314, 323, and 469 bp lengths in all patients and controls. No patients or controls had deletions or insertions in the WNT7A gene exons because not even subtle length differences were observed (data not shown). DGGE revealed no DNA fragment melting polymorphisms in any patients or controls (Fig. 2). Discussion The genes that control male sexual development have been well characterized. The SRY gene initiates testicular development,26,27 the MIS gene causes regression
Fig. 2. Representative DGGE analysis of PCR-amplified WNT7A gene fragments. (A), Exon 1. (B), Exon 2. (C), Exon 3, digested into 3 fragments.
219
of the Mu¨llerian system,28 while testosterone and dihydrotestosterone cause masculinization of the internal and external genitalia, respectively.29 In sharp contrast, very little is known about what genes direct female sexual differentiation. Previous studies of candidate genes for the etiology of CAUV focused on the genes encoding cystic fibrosis transmembrane regulator conductance regulator (CFTR),30 anti-Mu¨llerian hormone (AMH),31 antiMu¨llerian hormone receptor (AMHR),31 HOXA10,32 HOXA13,33 galactose-1-phosphate uridyl transferase (GALT),34,35 PAX2,36 and Wilms tumor transcription factor (WT1).37,38 No mutations were found in any of the genes in patients with CAUV. Except for the association of HOXA13 mutations and hand-foot-uterus syndrome,39 identification of a genetic cause for the other types of Mu¨llerian duct derivative abnormalities has remained elusive. Here we present data on another excellent candidate gene, WNT7A. In mice, mutations in WNT7a cause a spectrum of Mu¨llerian duct derivative abnormalities as well as limb bud defects. In those studies, it has been proposed that WNT7a signaling may regulate gene expression in the adjacent mesenchyme and may be required to generate a stromal response to estrogen.12 In addition, WNT7a gene expression may affect both Hoxa-10 and Hoxa11 gene expression, which are responsible for anteroposterior patterning in the developing urogenital tract.11 The human WNT7A gene shares 92% of its nucleotide sequence with that of the mouse WNT7A gene and encodes a 349 amino acid peptide that is 97–98% homologous between mice and humans.14,40 The identification of WNT7A gene expression in human endometrium and myometrium coupled with the finding of Wnt7A mutations in murine Mu¨llerian duct derivative anomalies led us to hypothesize that WNT7A gene mutations might disrupt normal development of the human Mu¨llerian ducts. Because both mice and humans with Mu¨llerian duct derivative abnormalities often have concomitant skeletal defects, the hypothesis that WNT7A mutations cause human Mu¨llerian duct derivative abnormalities is further supported. The evaluation of 40 patients with Mu¨llerian duct derivative abnormalities did not reveal any WNT7A gene mutations. DGGE analysis of DNA fragments enables the comparison of DNA sequences based on the fragment melting behavior. It detects sequence differences as small as a single base substitution.41 This strategy can detect mutations in 60–80% of the DNA sequence analyzed.42 In this study, 90.6% of the WNT7A protein coding sequence was amplified by PCR; 32 codons of exon 3 were not included. The first melting domains of each fragment were analyzed for mutations by DGGE. Although no DNA sequence
220
Timmreck et al: Mutations and Mu¨llerian Duct Abnormalities
polymorphisms were found in WNT7A exons, numerous polymorphisms and mutations have been found in other genes using DGGE.42,43 Although it remains possible that mutations may have been present in unanalyzed DNA, the likelihood of WNT7A gene mutations causing Mu¨llerian duct derivative abnormalities in women is small. In summary, analysis of the WNT7A gene in women with Mu¨llerian duct derivative anomalies did not identify any mutations. The fact that a number of excellent candidate genes have revealed similar negative data suggests that multiple genes likely control Mu¨llerian duct development. Mu¨llerian duct derivative anomalies probably have a multifactorial etiology and may not always be the result of mutations in a single gene. Acknowledgments: Financial support for this study consisted of departmental grants.
References 1. Nusse R, Varmus H: Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell 1982; 31:99 2. Van Ooyen A, Nusse R: Structure and nucleotide sequence of the putative mammary oncogene int-1; proviral insertions leave the protein-encoding domain intact. Cell 1984; 39:233 3. Cabrera C, Alonso M, Johnston P, et al: Phenocopies induced with antisense RNA identify the wingless gene. Cell 1987; 50:659 4. Rijsewijk F, Schuermann M, Wagenaar E, et al: The drosophila homolog of the mouse mammary oncogene int-1 is identical to the segment polarity gene wingless. Cell 1987; 50:649 5. Cadigan K, Nusse R: Wnt signaling, a common theme in animal development. Genes Dev 1997; 11:3286 6. Parr B, Shea M, Vassileva G, et al: Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS and limb buds. Development 1993; 119:247 7. Wnt genes in Vertebrates: Retrieved January, 2003, from http://www.stanford.edu/rnusse/wntgenes/humanwnt.html 8. Dealy C, Roth A, Ferrari D, et al: Wnt-5a and Wnt-7a are expressed in the developing chick limb bud in a manner suggesting roles in pattern formation along the proximodistal and dorsoventral axes. Mech Dev 1993; 43:175 9. Parr B, Avery E, Cygan J, et al: The classical mouse mutant postaxial hemimelia results from a mutation in the Wnt7a gene. Dev Bio 1998; 202:228 10. Gavin B, McMahon J, McMahon A: Expression of multiple novel Wnt-1/int-1-related genes during fetal and adult mouse development. Genes Dev 1990; 4:2319 11. Miller C, Sasson D: Wnt-7a maintains appropriate uterine patterning during the development of the mouse female reproductive tract. Development 1998; 125:3201 12. Parr B, McMahon A: Sexually dimorphic development of the mammalian reproductive tract requires Wnt-7a. Nature 1998; 395:707
13. Miller C, Degenhardt K, Sassoon D: Fetal exposure to DES results in de-regulation of Wnt7a during uterine morphogenesis. Nat Genet 1998; 20:228 14. Ikegawa S, Kumano Y, Okui K, et al: Isolation, characterization and chromosomal assignment of the human WNT7A gene. Cytogenet Cell Genet 1996; 74:149 15. Bui T, Rees M, Bicknell R, et al: Expression and hormone regulation of Wnt2, 3, 4, 5a, 7a, 7b, and 10b in normal human endometrium and endometrial carcinoma. Br J Cancer 1997; 75:1131 16. Li S, Chiang T, Davis G, et al: Decreased expression of Wnt7a mRNA is inversely associated with the expression of estrogen receptor-alpha in human uterine leiomyoma. J Clin Endo Metab 2001; 86:454 17. Kitajewski J, Sassoon D: The emergence of molecular gynecology: homeobox and Wnt genes in the female reproductive tract. Bioessays 2000; 22(10):902 18. Miller C, Degenhardt K, Sassoon D: Fetal exposure to DES results in de-regulation of Wnt7a during uterine morphogenesis. Nat Genet 1998; 20(3):228 19. Griffin J, Edwards C, Madden J, et al: Congenital absence of the vagina. The Mayer- Rokitansky-Kuster-Hauser syndrome. Ann Intern Med 1976; 85(2):224 20. Tulandi T, Arronet G, McInnes R: Arcuate and bicornuate uterine anomalies and infertility. Fertil Steril 1980; 34:362 21. Acien P: Incidence of Mu¨llerian defects in fertile and infertile women. Hum Reprod 1997; 12:1372 22. Simon C, Martinez L, Pardo P, et al: Mullerian defects in women with normal reproductive outcome. Fertil Steril 1991; 56:1192 23. Ashton D, Amin H, Richart R, et al: The incidence of asymptomatic uterine anomalies in women undergoing transcervical tubal sterilization. Obstet Gynecol 1988; 72:28 24. Gray M: Detection of DNA sequence polymorphisms in human genomic DNA by using denaturing gradient gel blots. Am J Hum Genet 1992; 50:331 25. Fischer S, Lerman L: Two-dimensional electrophoretic separation of restriction enzyme fragments of DNA. Meth Enzymol 1979; 68:183 26. Sinclair AH, Berta P, Palmer MS, et al: A gene encodes a protein from the human sex- determining region with homology to a conserved DNA-binding motif. Nature 1990; 346:240 27. Ferguson-Smith MA: Abnormalities of human sex determination. J Inherit Metab Dis 1992; 15:518 28. Lee MM, Donahoe PK: Mu¨llerian inhibiting substance: a gonadal hormone with multiple functions. Endocr Rev 1993; 14:152 29. Wilson JD, Griffin JE, George FW, et al: The role of gonadal steroids in sexual differentiation. Recent Prog Horm Res 1981; 37:1 30. Timmreck L, Gray M, Handelin B, et al: Cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina. Am J Med Genet 2003; In press 31. Resendes B, Sohn S, Stelling J, et al: Role for anti-Mu¨llerian hormone in congenital absence of the uterus and vagina. Am J Med Genet 2001; 98:129 32. Lalwani S, Karnis M, Timmreck L, et al: HOXA10 Mutation Analysis in Women with Congenital Absence of the Uterus and Vagina. J Soc Gynecol Invest 2001; 8(1):162A
Timmreck et al: Mutations and Mu¨llerian Duct Abnormalities 33. Karnis M, Stelling J, Lalwani S, et al: Mutation analysis of the HOXA13 gene in patients with congenital absence of the uterus and vagina. J Soc Gynecol Invest 2000; 7(1, suppl):172A 34. Bhagavath B, Stelling J, van Lingen B, et al: Congenital absence of the uterus and vagina is not associated with the N314D allele of the galactose-1-phosphate uridyl transferase (GALT) gene. J Soc Gynecol Invest 1998; 5:140A 35. Klipstein S, Bhagavath B, Topipat C, et al: The N314D polymorphism of the GALT gene is not associated with congenital absence of the uterus and vagina (CAUV). Mol Hum Reprod 2003; In press 36. van Lingen B, Eccles M, Reindollar R, et al: Molecular genetic analysis of the PAX2 gene in patients with congenital absence of the uterus and vagina. Fertil Steril 1998; 70:S402 37. van Lingen B, Gray M, Davis A, et al: Physical mapping of 3p23, a region that includes a translocation breakpoint in a patient with Mayer-Rokitansky-Ku¨ster-Hauser syndrome. Am J Hum Genet 1997; 61:A246
221
38. van Lingen B, Reindollar R, Davis A, et al: Further evidence that the WT1 gene does not have a role in the development of the derivatives of the mu¨llerian duct. Am J Obstet Gynecol 1998; 179:597 39. Mortlock D, Innis J: Mutation of HOXA13 in hand-footgenital syndrome. Nat Genet 1997; 15(2):179 40. Bui T, Lako M, Lejeune S, et al: Isolation of a full-length human WNT7A gene implicated in limb development and cell transformation, and mapping to chromosome 3p25. Gene 1997; 189:25 41. Fischer S, Lerman L: DNA fragments differing by single base pair substitutions are separated in denaturing gradient gels: Correspondence with melting theory. Proc Natl Acad Sci USA 1983; 80:1579 42. Gray M, Charpentier A, Walsh K, et al: Mapping point mutations in the Drosophila rosy locus using denaturing gradient gel blots. Genetics 1991; 127:139 43. Laprise S, Mak E, Killoran K, et al: Use of denaturing gradient gel blots to screen for point mutations in the factor VIII gene. Hum Mutat 1998; 12(6):393
Original Studies WNT7A Mutations in Patients with Mu¨llerian Duct Abnormalities L.S. Timmreck, MD, H.A. Pan, MD, R.H. Reindollar, MD, and M.R. Gray, PhD Department of Obstetrics, Gynecology, and Reproductive Biology, Division of Reproductive Endocrinology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts
Abstract. Study Objective: WNT7A gene mutations were evaluated as a potential cause for Mu¨llerian duct derivative abnormalities in human females. The WNT gene family encodes glycoproteins that serve as signaling molecules during early development. The WNT7A gene has been previously identified as necessary for normal murine Mu¨llerian duct development. WNT7A mutant mice display several Mu¨llerian duct derivative abnormalities. Design: Molecular genetic analysis of female patients with Mu¨llerian duct derivative abnormalities. Setting: Medical center-based academic research institution. Participants: 40 women with developmental abnormalities of the uterus and vagina and 12 normal controls. Interventions: Polymerase chain reaction DNA amplification from human genomic DNA and denaturing gradient gel electrophoresis analysis of amplified DNA fragments. Main Outcome Measures: Presence or absence of WNT7A gene mutations in analyzed DNA fragments. Results: No mutations were found in the WNT7A gene in any patient or control tested. Conclusions: WNT7A mutations are an unlikely cause of Mu¨llerian duct derivative abnormalities in humans.
Key Words. Mu¨llerian ducts—Congenital absence of the uterus and vagina—WNT7A—Mutation Introduction WNT genes, first identified in mice1,2 and Drosophila,3,4 are members of a large family of genes encoding highly conserved glycoproteins that function as signaling Address correspondence to: Richard H. Reindollar, MD, Department of Obstetrics, Gynecology, and Reproductive Biology, Division of Reproductive Endocrinology, Beth Israel Deaconess Medical Center, Harvard Medical School, 330 Brookline Avenue, KS322, Boston, MA 02215; Phone: 617-667-1862; Fax: 617-975-5575; E-mail: [email protected] Synopsis: WNT7A gene mutations were not found in 40 patients with Mu¨llerian duct abnormalities and, thus, are likely not etiologic.
쑖 2003 North American Society for Pediatric and Adolescent Gynecology Published by Elsevier Science Inc.
molecules.5,6 Homologous genes have since been found in many vertebrates including humans. To date, 19 WNT genes have been found in humans: WNT1, 2, 2b/13, 3, 3a, 4, 5a, 5b, 6, 7a, 7b, 8a, 8b, 10a, 10b, 11, 14, 15, and 16.7 The function of WNT genes is to direct and coordinate growth and development of specific groups of cells. The target group of cells varies with each WNT gene. Mutations in the WNT7a gene affect chick limb bud development,8 murine limb bud development,9 and murine Mu¨llerian duct development.9 Expression of the WNT7A gene has been extensively studied in mice.10 Female mice with complete loss of function mutations in the WNT7A gene had malformed Mu¨llerian duct derivatives including small uteri,9,11,12 incompletely differentiated Mu¨llerian ducts,9 thin muscular development in the uterine walls,9,12 incompletely coiled or absent oviducts,9,11–13 shallow vaginal fornices,13 uterine horns with features consistent with both uterus and vagina,11 disorganized uterine smooth muscle,11 and oviducts incompletely separated from uterus.11 Some mutant mice were infertile,12 In male mice, normal function of the WNT7A gene is required for Mu¨llerian duct regression.12 Expression of the WNT7A gene in humans has been detected in the placenta, kidney, testis, fetal lung, fetal and adult brain, and uterus.14 Among uterine tissues, WNT7A mRNA is found in endometrium, myometrium, leiomyomas, and endometrial cancer cell lines.15–17 Lower than normal levels of uterine WNT7A transcripts have been detected at birth in females exposed to DES in utero.17,18 No studies have evaluated the association of human WNT7A gene mutations with the development of Mu¨llerian duct derivative abnormalities. Mu¨llerian duct derivative abnormalities in humans include congenital absence of the uterus and vagina (CAUV or Mayer-Rokitansky-Kuster-Hauser syndrome), unicornuate uterus, didelphic uterus, bicornuate uterus, septate uterus, and vaginal septum. CAUV 1083-3188/03/$22.00 doi:10.1016/S1083-3188(03)00124-4
218
Timmreck et al: Mutations and Mu¨llerian Duct Abnormalities
is present in 1 in 4,000–5,000 newborn females19 and presents to the pediatrician or gynecologist with primary amenorrhea in the presence of otherwise normal pubertal development. The incidence of the less severe Mu¨llerian duct abnormalities is higher but incompletely quantified. The presentation of these abnormalities varies and may include infertility, recurrent pregnancy loss, malpresentation in pregnancy, and premature labor and delivery. In patients presenting with infertility, 1–3% have evidence of a uterine abnormality diagnosed by hysterosalpingogram (HSG).20,21 In women with recurrent pregnancy loss, as many as 5– 25% of HSG results demonstrate evidence of a uterine abnormality.21 Even women with normal reproductive histories demonstrate a 2–3% incidence of an abnormal HSG finding.21–23 Very little is known about genes that regulate Mu¨llerian duct development in humans. Although studies have evaluated candidate genes to date, no genetic cause for any Mu¨llerian duct derivative abnormality has been found. The direct relationship between murine WNT7A mutations and both Mu¨llerian and limb bud defects made this gene an attractive candidate for analysis in humans with Mu¨llerian duct derivative abnormalities. Approximately 10% of women with CAUV commonly have concomitant skeletal abnormalities, further implicating WNT7A as a particularly interesting candidate gene. In addition, the expression of WNT7A in endometrium and myometrium in human females adds further support to the hypothesis that Mu¨llerian duct derivative abnormalities are the result of WNT7A gene mutations.
Materials and Methods Genomic DNA was extracted from peripheral blood samples of 40 patients with Mu¨llerian duct derivative anomalies and 12 controls as previously described.24 Controls were defined as women with a normal reproductive history—at least one full-term live born infant with no history of infertility or miscarriage and no known abnormalities of the Mu¨llerian duct derivatives. These experiments were approved and monitored by the medical center human investigation review board for protection of research subjects. A board-certified reproductive endocrinologist and clinical medical geneticist examined all but three of the patients. These three subjects were identified, screened, and enrolled by referring obstetrician/gynecologists. Thirty-one patients had CAUV, three had uterus didelphys, two had a unicornuate uterus, three had a uterine septum, and one had a vaginal septum. Two patients were siblings, and the remaining patients were not known to have affected relatives. Of the patients with CAUV, two had unilateral renal agenesis, one had a horseshoe kidney, one was deaf, and five had varying degrees of
scoliosis. Of the patients with scoliosis, one had spina bifida occulta, and one had an abnormality of the left thumb. Of the patients with uterus didelphys, one had unilateral renal agenesis. Polymerase chain reaction (PCR) using genomic DNA templates was used to amplify all three exons of the human WNT7A gene (Fig. 1). Primers were selected from the full WNT7A sequence (National Center for Biotechnology Information) using a computer program (DNA Star, DNASTAR, Inc, Madison, WI). DNA fragments were amplified in vitro using optimized conditions for each exon. Oligonucleotide primers flanking the exon were used as follows: exon 1: 5′- GGGACTATGAACCGGAAAGC- 3′, and 5′TGTCCCTAGAGCCGGTAAGA -3′ (creating a 314 bp fragment); exon 2: 5′- CTGACCCCAACTTGTCTCCT 3′, and 5′-AAGCCATTTTGCAGCATCTC -3′ (323 bp fragment); exon 3: 5′- CTGGGCTACGTGCTCAAGGACAAG -3′, and 5′- GGAAACCCAGGAAAAGTA 3′ (469 bp fragment). DNA fragments amplified using these primers included all of the WNT7A coding sequence except for 32 codons. Each 50 µL reaction mixture included 100 ng genomic DNA, 50 mM of each exon-specific primer, 7.5– 15 mM MgCl (exon 1: 15 mM; exon 2: 10 mM; exon 3: 7.5 mM), 0.1 U Taq polymerase, and 100 µM dNTPs. PCR was performed using a Gene Amp쑓 PCR System 9700 (Applied Biosystems, Norwalk, CT, USA). After an initial 3 min denaturation step at 94ºC, the reactions were subjected to 40 amplification cycles of 94ºC × 1 min, 52–62ºC × 1 min, 73ºC × 1 min, followed by a 10-min incubation at 72ºC. The annealing temperature for exon 1 was 60ºC, exon 2, 62ºC, and exon 3, 52ºC. Following the amplification of exon 3, the restriction enzyme HinP1 I (NE Biolabs, Beverly, MA) was used to cut this 469 bp fragment into three smaller fragments of 182, 147, and 140 bp (Fig. 1). These PCR fragments (8 µL) were digested according to manufacturer’s suggestions. Intact and digested PCR fragments from exons 1, 2, 3 were electrophoresed in 1.5% agarose mini-gels to verify the expected lengths of the amplified fragments. These results were confirmed further by electrophoresis in 10% polyacrylamide gels to more precisely determine the length of each amplified fragment. Both types of gels were stained in ethidium bromide (1 µg/mL)
Fig. 1. Schematic of human WNT7A gene.
Timmreck et al: Mutations and Mu¨llerian Duct Abnormalities
for 20 min, rinsed with distilled water and photographed over a long-wave UV light source. Denaturing gradient gel electrophoresis (DGGE) analysis was then performed on each DNA sample.25 All DGGE gels included a 20–80% linear gradient of denaturants (100% ⫽ 7 M urea, 40% formamide). The gel was submerged in the electrophoresis chamber in TAE (Tris-Acetate-EDTA) buffer at 60ºC during electrophoresis at 50 volts for 14 h. Following electrophoresis, the gels were stained in ethidium bromide (1 µg/mL) for 5 min, rinsed with distilled water, and photographed over a long-wave UV light source. Results Electrophoresis of PCR fragments revealed the expected 314, 323, and 469 bp lengths in all patients and controls. No patients or controls had deletions or insertions in the WNT7A gene exons because not even subtle length differences were observed (data not shown). DGGE revealed no DNA fragment melting polymorphisms in any patients or controls (Fig. 2). Discussion The genes that control male sexual development have been well characterized. The SRY gene initiates testicular development,26,27 the MIS gene causes regression
Fig. 2. Representative DGGE analysis of PCR-amplified WNT7A gene fragments. (A), Exon 1. (B), Exon 2. (C), Exon 3, digested into 3 fragments.
219
of the Mu¨llerian system,28 while testosterone and dihydrotestosterone cause masculinization of the internal and external genitalia, respectively.29 In sharp contrast, very little is known about what genes direct female sexual differentiation. Previous studies of candidate genes for the etiology of CAUV focused on the genes encoding cystic fibrosis transmembrane regulator conductance regulator (CFTR),30 anti-Mu¨llerian hormone (AMH),31 antiMu¨llerian hormone receptor (AMHR),31 HOXA10,32 HOXA13,33 galactose-1-phosphate uridyl transferase (GALT),34,35 PAX2,36 and Wilms tumor transcription factor (WT1).37,38 No mutations were found in any of the genes in patients with CAUV. Except for the association of HOXA13 mutations and hand-foot-uterus syndrome,39 identification of a genetic cause for the other types of Mu¨llerian duct derivative abnormalities has remained elusive. Here we present data on another excellent candidate gene, WNT7A. In mice, mutations in WNT7a cause a spectrum of Mu¨llerian duct derivative abnormalities as well as limb bud defects. In those studies, it has been proposed that WNT7a signaling may regulate gene expression in the adjacent mesenchyme and may be required to generate a stromal response to estrogen.12 In addition, WNT7a gene expression may affect both Hoxa-10 and Hoxa11 gene expression, which are responsible for anteroposterior patterning in the developing urogenital tract.11 The human WNT7A gene shares 92% of its nucleotide sequence with that of the mouse WNT7A gene and encodes a 349 amino acid peptide that is 97–98% homologous between mice and humans.14,40 The identification of WNT7A gene expression in human endometrium and myometrium coupled with the finding of Wnt7A mutations in murine Mu¨llerian duct derivative anomalies led us to hypothesize that WNT7A gene mutations might disrupt normal development of the human Mu¨llerian ducts. Because both mice and humans with Mu¨llerian duct derivative abnormalities often have concomitant skeletal defects, the hypothesis that WNT7A mutations cause human Mu¨llerian duct derivative abnormalities is further supported. The evaluation of 40 patients with Mu¨llerian duct derivative abnormalities did not reveal any WNT7A gene mutations. DGGE analysis of DNA fragments enables the comparison of DNA sequences based on the fragment melting behavior. It detects sequence differences as small as a single base substitution.41 This strategy can detect mutations in 60–80% of the DNA sequence analyzed.42 In this study, 90.6% of the WNT7A protein coding sequence was amplified by PCR; 32 codons of exon 3 were not included. The first melting domains of each fragment were analyzed for mutations by DGGE. Although no DNA sequence
220
Timmreck et al: Mutations and Mu¨llerian Duct Abnormalities
polymorphisms were found in WNT7A exons, numerous polymorphisms and mutations have been found in other genes using DGGE.42,43 Although it remains possible that mutations may have been present in unanalyzed DNA, the likelihood of WNT7A gene mutations causing Mu¨llerian duct derivative abnormalities in women is small. In summary, analysis of the WNT7A gene in women with Mu¨llerian duct derivative anomalies did not identify any mutations. The fact that a number of excellent candidate genes have revealed similar negative data suggests that multiple genes likely control Mu¨llerian duct development. Mu¨llerian duct derivative anomalies probably have a multifactorial etiology and may not always be the result of mutations in a single gene. Acknowledgments: Financial support for this study consisted of departmental grants.
References 1. Nusse R, Varmus H: Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell 1982; 31:99 2. Van Ooyen A, Nusse R: Structure and nucleotide sequence of the putative mammary oncogene int-1; proviral insertions leave the protein-encoding domain intact. Cell 1984; 39:233 3. Cabrera C, Alonso M, Johnston P, et al: Phenocopies induced with antisense RNA identify the wingless gene. Cell 1987; 50:659 4. Rijsewijk F, Schuermann M, Wagenaar E, et al: The drosophila homolog of the mouse mammary oncogene int-1 is identical to the segment polarity gene wingless. Cell 1987; 50:649 5. Cadigan K, Nusse R: Wnt signaling, a common theme in animal development. Genes Dev 1997; 11:3286 6. Parr B, Shea M, Vassileva G, et al: Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS and limb buds. Development 1993; 119:247 7. Wnt genes in Vertebrates: Retrieved January, 2003, from http://www.stanford.edu/rnusse/wntgenes/humanwnt.html 8. Dealy C, Roth A, Ferrari D, et al: Wnt-5a and Wnt-7a are expressed in the developing chick limb bud in a manner suggesting roles in pattern formation along the proximodistal and dorsoventral axes. Mech Dev 1993; 43:175 9. Parr B, Avery E, Cygan J, et al: The classical mouse mutant postaxial hemimelia results from a mutation in the Wnt7a gene. Dev Bio 1998; 202:228 10. Gavin B, McMahon J, McMahon A: Expression of multiple novel Wnt-1/int-1-related genes during fetal and adult mouse development. Genes Dev 1990; 4:2319 11. Miller C, Sasson D: Wnt-7a maintains appropriate uterine patterning during the development of the mouse female reproductive tract. Development 1998; 125:3201 12. Parr B, McMahon A: Sexually dimorphic development of the mammalian reproductive tract requires Wnt-7a. Nature 1998; 395:707
13. Miller C, Degenhardt K, Sassoon D: Fetal exposure to DES results in de-regulation of Wnt7a during uterine morphogenesis. Nat Genet 1998; 20:228 14. Ikegawa S, Kumano Y, Okui K, et al: Isolation, characterization and chromosomal assignment of the human WNT7A gene. Cytogenet Cell Genet 1996; 74:149 15. Bui T, Rees M, Bicknell R, et al: Expression and hormone regulation of Wnt2, 3, 4, 5a, 7a, 7b, and 10b in normal human endometrium and endometrial carcinoma. Br J Cancer 1997; 75:1131 16. Li S, Chiang T, Davis G, et al: Decreased expression of Wnt7a mRNA is inversely associated with the expression of estrogen receptor-alpha in human uterine leiomyoma. J Clin Endo Metab 2001; 86:454 17. Kitajewski J, Sassoon D: The emergence of molecular gynecology: homeobox and Wnt genes in the female reproductive tract. Bioessays 2000; 22(10):902 18. Miller C, Degenhardt K, Sassoon D: Fetal exposure to DES results in de-regulation of Wnt7a during uterine morphogenesis. Nat Genet 1998; 20(3):228 19. Griffin J, Edwards C, Madden J, et al: Congenital absence of the vagina. The Mayer- Rokitansky-Kuster-Hauser syndrome. Ann Intern Med 1976; 85(2):224 20. Tulandi T, Arronet G, McInnes R: Arcuate and bicornuate uterine anomalies and infertility. Fertil Steril 1980; 34:362 21. Acien P: Incidence of Mu¨llerian defects in fertile and infertile women. Hum Reprod 1997; 12:1372 22. Simon C, Martinez L, Pardo P, et al: Mullerian defects in women with normal reproductive outcome. Fertil Steril 1991; 56:1192 23. Ashton D, Amin H, Richart R, et al: The incidence of asymptomatic uterine anomalies in women undergoing transcervical tubal sterilization. Obstet Gynecol 1988; 72:28 24. Gray M: Detection of DNA sequence polymorphisms in human genomic DNA by using denaturing gradient gel blots. Am J Hum Genet 1992; 50:331 25. Fischer S, Lerman L: Two-dimensional electrophoretic separation of restriction enzyme fragments of DNA. Meth Enzymol 1979; 68:183 26. Sinclair AH, Berta P, Palmer MS, et al: A gene encodes a protein from the human sex- determining region with homology to a conserved DNA-binding motif. Nature 1990; 346:240 27. Ferguson-Smith MA: Abnormalities of human sex determination. J Inherit Metab Dis 1992; 15:518 28. Lee MM, Donahoe PK: Mu¨llerian inhibiting substance: a gonadal hormone with multiple functions. Endocr Rev 1993; 14:152 29. Wilson JD, Griffin JE, George FW, et al: The role of gonadal steroids in sexual differentiation. Recent Prog Horm Res 1981; 37:1 30. Timmreck L, Gray M, Handelin B, et al: Cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina. Am J Med Genet 2003; In press 31. Resendes B, Sohn S, Stelling J, et al: Role for anti-Mu¨llerian hormone in congenital absence of the uterus and vagina. Am J Med Genet 2001; 98:129 32. Lalwani S, Karnis M, Timmreck L, et al: HOXA10 Mutation Analysis in Women with Congenital Absence of the Uterus and Vagina. J Soc Gynecol Invest 2001; 8(1):162A
Timmreck et al: Mutations and Mu¨llerian Duct Abnormalities 33. Karnis M, Stelling J, Lalwani S, et al: Mutation analysis of the HOXA13 gene in patients with congenital absence of the uterus and vagina. J Soc Gynecol Invest 2000; 7(1, suppl):172A 34. Bhagavath B, Stelling J, van Lingen B, et al: Congenital absence of the uterus and vagina is not associated with the N314D allele of the galactose-1-phosphate uridyl transferase (GALT) gene. J Soc Gynecol Invest 1998; 5:140A 35. Klipstein S, Bhagavath B, Topipat C, et al: The N314D polymorphism of the GALT gene is not associated with congenital absence of the uterus and vagina (CAUV). Mol Hum Reprod 2003; In press 36. van Lingen B, Eccles M, Reindollar R, et al: Molecular genetic analysis of the PAX2 gene in patients with congenital absence of the uterus and vagina. Fertil Steril 1998; 70:S402 37. van Lingen B, Gray M, Davis A, et al: Physical mapping of 3p23, a region that includes a translocation breakpoint in a patient with Mayer-Rokitansky-Ku¨ster-Hauser syndrome. Am J Hum Genet 1997; 61:A246
221
38. van Lingen B, Reindollar R, Davis A, et al: Further evidence that the WT1 gene does not have a role in the development of the derivatives of the mu¨llerian duct. Am J Obstet Gynecol 1998; 179:597 39. Mortlock D, Innis J: Mutation of HOXA13 in hand-footgenital syndrome. Nat Genet 1997; 15(2):179 40. Bui T, Lako M, Lejeune S, et al: Isolation of a full-length human WNT7A gene implicated in limb development and cell transformation, and mapping to chromosome 3p25. Gene 1997; 189:25 41. Fischer S, Lerman L: DNA fragments differing by single base pair substitutions are separated in denaturing gradient gels: Correspondence with melting theory. Proc Natl Acad Sci USA 1983; 80:1579 42. Gray M, Charpentier A, Walsh K, et al: Mapping point mutations in the Drosophila rosy locus using denaturing gradient gel blots. Genetics 1991; 127:139 43. Laprise S, Mak E, Killoran K, et al: Use of denaturing gradient gel blots to screen for point mutations in the factor VIII gene. Hum Mutat 1998; 12(6):393