- Email: [email protected]
Wolbachia affects sleep behavior in Drosophila melanogaster
Journal of Insect Physiology 107 (2018) 81–88
Contents lists available at ScienceDirect
Journal of Insect Physiology journal homepage: www.elsevier.com/locate/jinsphys
Wolbachia affects sleep behavior in Drosophila melanogaster Jie Bi a b
a,b
b
b
, Amita Sehgal , Julie A. Williams , Yu-Feng Wang
a,⁎
T
School of Life Sciences, Hubei Key Laboratory of Genetic Regulation and Integrative Biology, Central China Normal University, Wuhan 430079, PR China Department of Neuroscience, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA
A R T I C L E I N F O
A B S T R A C T
Keywords: Wolbachia Drosophila melanogaster Sleep Arousal Dopamine
Wolbachia are endosymbiotic bacteria present in a wide range of insects. Although their dramatic effects on host reproductive biology have been well studied, the effects of Wolbachia on sleep behavior of insect hosts are not well documented. In this study, we report that Wolbachia infection caused an increase of total sleep time in both male and female Drosophila melanogaster. The increase in sleep was associated with an increase in the number of nighttime sleep bouts or episodes, but not in sleep bout duration. Correspondingly, Wolbachia infection also reduced the arousal threshold of their fly hosts. However, neither circadian rhythm nor sleep rebound following deprivation was influenced by Wolbachia infection. Transcriptional analysis of the dopamine biosynthesis pathway revealed that two essential genes, Pale and Ddc, were significantly upregulated in Wolbachia-infected flies. Together, these results indicate that Wolbachia mediates the expression of dopamine related genes, and decreases the sleep quality of their insect hosts. Our findings help better understand the host-endosymbiont interactions and in particular the Wolbachia’s impact on behaviors, and thus on ecology and evolution in insect hosts.
1. Introduction Symbiotic organisms are particularly common in insects, and in some cases they may protect their hosts from pathogenic infections (Goodacre and Martin, 2012) or increase their hosts’ biological fitness. Wolbachia are gram-negative endosymbiotic bacteria that infect a wide range of arthropods and filarial nematodes. It is estimated that up to 40% of arthropod species are infected with Wolbachia (Zug and Hammerstein, 2012). Wolbachia are best known for infecting host reproductive tissues and thus manipulating host reproduction, enhancing their transmission through host populations. In addition to gonads, Wolbachia are also prevalent in tissues of the nervous system in Drosophila (Albertson et al., 2013; Casper-Lindley et al., 2011) as well as digestive and metabolic tissues such as the fat body, gut, salivary glands, and Malpighian tubules of many insect species where they may play a role in mediating host immunity and behavior (Pietri et al., 2016; Rohrscheib et al., 2015). Recently, studies have shown that Wolbachia affects male aggression and activity in Drosophila hosts (Rohrscheib et al., 2015; Vale and Jardine, 2015). When compared with Wolbachiafree flies, Wolbachia-infected flies exhibited significantly reduced activity, suggesting an increase of sleep resulted from Wolbachia (Vale and Jardine, 2015). Therefore Drosophila is an ideal model host to investigate questions at the interface of microbes and host behavior. The sleep-like state is widely conserved among animal species
⁎
(Crocker and Sehgal, 2010), and Drosophila has been frequently used in studies to identify the genetic basis of sleep/wake regulation (Allada et al., 2017; Dubowy and Sehgal, 2017). Sleep behavior in flies shares cardinal features with mammalian sleep such as prolonged reversible immobility, increased arousal thresholds and homeostatic influence (Shaw et al., 2000; Hendricks et al., 2000). The timing of sleep is controlled by a circadian system, which is seen in most living organisms and allows anticipation of the daily changes of the external world. Although these approximately 24 h rhythms persist in constant conditions, environmental fluctuations such as day: night light or temperature cycles entrain or reset rhythms to precisely 24 h periods and to an appropriate phase (Emery et al., 1998). Besides this clock system, animals have another sleep regulation system: a homeostatic drive that increases during waking, and dissipates during sleep. Although these two systems can operate independently, recent studies indicate a more intimate relationship (Donlea et al., 2011; Naylor et al., 2000; Sheeba et al., 2008). Among other neuromodulators, dopamine (DA) appears to have an important role in controlling sleep amount, and perhaps even its timing. In the mammalian mesencephalic tegmentum, DA-containing neurons are important for arousal (Jones, 2005). As in mammals, dopamine exerts a wake-promoting function in flies (Liu et al., 2012), indicating that this and other neurotransmitter pathways (Zimmerman et al., 2017) have common functions in sleep in both flies and mammalian species.
Corresponding author. E-mail address: [email protected] (Y.-F. Wang).
https://doi.org/10.1016/j.jinsphys.2018.02.011 Received 3 October 2017; Received in revised form 26 February 2018; Accepted 26 February 2018 Available online 27 February 2018 0022-1910/ © 2018 Elsevier Ltd. All rights reserved.
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
were individually placed into glass tubes with 5% sucrose/2% agar food and monitored in constant darkness (DD) for 7 days at 25 °C. All behavioral experiments were performed at least 2 independent times with at least 16 flies/group each. Circadian rhythm was analyzed with ClockLab software (Actimetrics, Wilmette IL, version: 2.72). Period and rhythm strength were determined for each individual fly using activity data collected from days 2–7 of DD. Period length was determined using χ2 periodogram analysis, and relative power (or amplitude) of circadian rhythm was determined using fast Fourier transform (FFT). Fly activity was considered rhythmic if the χ2 periodogram showed a peak above the 95% confidence interval and the FFT value at around a 24 h cycle was > 0.01 (King et al., 2017). Differences in FFT power between groups were considered significant if p < 0.05 by Student t-test, ns: not significant.
To better understand the impact of Wolbachia infection on the host’s sleep behavior, we investigated the influence of Wolbachia on sleep time, sleep homeostasis, circadian rhythm and arousal in Drosophila melanogaster. 2. Material and methods 2.1. Fly stocks The wMel Wolbachia infected D. melanogaster (Brisbane nuclear background with introgressed wMel from YW), designated as Dmel wMel, was kindly provided by Professor Scott O’Neill (Monash University, Australia). Tetracycline treatments were performed as described previously to generate genetically paired fly lines that were Wolbachia-free, here referred as Dmel T (Hoffmann et al., 1986). As tetracycline not only removes Wolbachia but also massively shifts the composition of the whole microbiome (Ye et al., 2017), to ensure the specificity of the effect of Wolbachia on sleep, we also treated a separate positive control group of flies with penicillin, which does not remove Wolbachia but depletes other bacteria. Penicillin treatments were performed as described previously (Gotoh et al., 2007), here referred as Dmel P. Gut flora of flies was reconstituted by standard methods (Chrostek et al., 2013) and all experiments involved in Dmel T or Dmel P flies were conducted at a minimum of six generations post antibiotic treatment. All fly lines were reared on standard cornmeal-yeast-agar medium at 25 °C with a photoperiod of 12 h:12 h LD (light:dark) under non-crowded conditions (200 ± 10 eggs per 50 mL vial of media in 150 mL conical flask).
2.4. Arousal assays For arousal threshold assays, flies were loaded into DAMs monitors (Trikinetics Inc) as described above, and recorded for three days in a 12 h:12 h LD cycle at 25 °C. On the third day, monitors were attached to a computer-controlled vortexer, and single, 0.6 s pulses were applied at nighttime hours at ZT14, ZT16, ZT18, ZT20 and ZT22. The number of sleeping flies that were awakened by the stimulus pulse was determined using Insomniac3 (written in MSVC6, by Thomas Coradetti). This number was divided by the total number of sleeping flies at the time of the stimulus pulse and reported as percent arousal. Sleep latency, or the length of time to the first sleep bout after the arousing stimulus pulse was also measured across all flies, excluding those that did not wake up from the stimulus. Student t-test and Mann-Whitney U test were used to analyze significance. p < 0.05 indicated significant difference.
2.2. Sleep assays Sleep was monitored using the Drosophila Activity Monitoring System (DAMs, TriKinetics, Waltham, MA). This system records activity from individual flies maintained in sealed tubes placed in activity monitors. An infrared beam directed through the midpoint of each tube measures an “activity event” each time a fly crosses the beam. Four day old flies were placed in glass locomotor tubes containing 5% sucrose/ 2% agarose food. Locomotor activity counts were collected in 1-min bins. Sleep in this assay was defined by zero activity counts for a minimum of five consecutive minutes (Huber et al., 2004). All behavioral experiments were conducted at 25 °C in a 12 h:12 h LD cycle. For sleep deprivation experiments, flies were loaded into activity monitors as described above, and recorded for three days. On the 4th day, flies were subjected to 6 h sleep deprivation from ZT 17–23 (ZT = zeitgeber time, where ZT 0 is lights-on, and ZT 12 is lights off) by mechanical stimulation using an adapted computer-controlled vortexer (TriKinetics, Waltham, MA). Vortexing stimuli were applied for 2 s at random intervals ranging from 20 to 40 s (1–3 times per minute). Net sleep loss and the amount of recovery sleep (or sleep rebound) were calculated for each fly by subtracting the previous corresponding 12 h baseline sleep period from the 12 h nighttime (for sleep loss) or daytime period following sleep deprivation (for sleep gain). Data were processed and analyzed using PySolo (Gilestro and Cirelli, 2009) or custom software, Insomniac 3 (gift of Thomas Coradetti, Gardner et al., 2016). Statistical analyses were performed using GraphPad Prism 6. Differences in daily sleep and other parameters were evaluated with a one-way ANOVA followed by Tukey’s post-hoc, or Student’s t-test, where appropriate. All experiments were conducted a minimum of three times using 16 flies per group per experimental replicate. Flies that did not survive the duration of the experiment were excluded from the analyses.
2.5. Quantitative reverse transcription-PCR (qRT-PCR) Total RNA was extracted from 3 to 7 day old flies using Trizol reagent (Thermo Fisher Scientific). RNA was reverse transcribed to generate cDNA using a High Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific). qRT-PCR was performed on a ViiA7 RealTime PCR System (Applied Biosystems) using SYBR Green PCR master mix (Thermo Fisher Scientific). Gene specific primers for Ddc and Pale were as follows: Ddc-F ACACAAATGGATGCTGGTGA; Ddc-R AAGAGG GTCCACATTGAACG; and Pale-F AGTTCTCGCAGGAGATTGGA; Pale-R TTCCTTGCAGAGACCGAACT. Ribosomal protein gene rp49 (primers are: rp49-F CTAAGCTGTCGCACAAATGG; rp49-R TAAACGCGGTTCTG CATGAG) was used as an internal control. The relative expression of each gene was calibrated against the reference gene using 2−ΔCt [ΔCt = Ct(target gene) − Ct(reference gene)]. p < 0.05 indicated significant difference by Student t-test. 3. Results 3.1. Wolbachia infection increases daily sleep Dmel wMel flies carrying Wolbachia were treated with tetracycline to render them free of infection of Wolbachia. We demonstrated that the effects of tetracycline treatment on sleep were stable across multiple generations (Table S1). We also treated a separate group of Dmel wMel flies with penicillin for removing other bacteria but Wolbachia as a positive control and found that the effects of penicillin treatment on sleep in flies were also stable across at least five generations post treatment (Table S1). We compared sleep time between Wolbachia infected flies, Dmel wMel and Dmel P (penicillin treated D. melanogaster), and the tetracycline treated Wolbachia-free flies, Dmel T. As shown in Fig. 1A and B, the total sleep time of Dmel wMel was longer than that of Dmel T for both females and males (ANOVA, p = 0.043, p = 0.044), particularly at nighttime. However, we did not observe any differences in sleep time
2.3. Circadian assays Circadian rhythm assays were performed with the DAMs as described previously (Cavanaugh et al., 2014). Flies were entrained to a 12 h:12 h LD (light:dark) cycle for > 3 days at 25 °C. Four-day-old flies 82
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Fig. 1. Wolbachia infection increases sleep. (A) Representative sleep profiles with standard error bars in female (n = 32), top, and male (n = 32) flies (bottom) of indicated groups. Horizontal bars at the top correspond to subjective day (white) and night (black). (B) Total sleep in female (left) and male (right) flies. For each fly line 48 flies were assayed over a 5 day period. (C) Number of nighttime sleep bouts in female (left) and male (right) flies of indicated groups. (D) Average nighttime sleep bout duration in female (left) and male (right) of flies. One-way ANOVA followed by Tukey’s post-hoc. Bars represent standard error. * represents p < 0.05, ns: not significant.
hosts, and furthermore, it is not other bacteria, but Wolbachia that affect daily sleep. We next tested the effects of Wolbachia infection on other sleep parameters, including the number of sleep bouts or episodes and the average duration of sleep bouts. Daytime sleep bout number and duration were not affected by Wolbachia infection in either males or
between Dmel P and Dmel wMel (Fig. 1B). To ensure that increased sleep was not attributed to a reduction in locomotor ability in flies, we evaluated waking activity rate (defined as activity counts per waking minute) and found that there was no change between Dmel wMel and Dmel T (data not shown). These data indicate that the Wolbachia infection results in an increase in total sleep time of their D. melanogaster 83
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Fig. 2. Wolbachia infection reduces arousal threshold in Drosophila. Percent flies awakened by a brief mechanical stimulus is shown in (A) at indicated time points. Mann-Whitney U test was performed, * represents p < 0.05. (From left to right: p = 0.035, p = 0.045, p = 0.04, p = 0.046, p = 0.047, p = 0.028, p = 0.018, p = 0.024, p = 0.037, p = 0.041). Latency to sleep onset after the stimulus pulse is shown in (B) at indicated time points. * represents p < 0.05. (From left to right: p = 0.044, p = 0.039, p = 0.048, p = 0.036, p = 0.037, p = 0.029, p = 0.038, p = 0.022, p = 0.036, p = 0.021; t = 6.267, t = 10.34, t = 1.788, t = 4.346, t = 3.089, t = 6.495, t = 5.725, t = 11.51, t = 6.482, t = 7.511). Student’s t-test. n = 32 flies per experiment across four replicate experiments.
of time elapsed since the last adequate sleep episode (Borbély, 1982). Since Wolbachia infected flies showed increased sleep, but had reduced sleep quality as indicated by a lower arousal threshold and more frequent sleep bouts, we next tested whether these effects were associated with a disruption in circadian rhythm and/or sleep homeostatic drive. No difference in circadian rest:activity behavior was found between Wolbachia-infected and uninfected flies (Fig. 3). Most flies showed strong behavioral rhythms, and the period length was the same between Wolbachia infected and the tetracycline treated Wolbachia-free flies, both males and females (Table 1). We next tested the effect of Wolbachia infection on sleep homeostasis in flies. Flies were subjected to 6 h sleep deprivation during the second half of the nighttime, from ZT 17–23. As shown in Fig. 4A and B, both Wolbachia-infected and uninfected females showed sleep rebound in the morning after sleep deprivation. No difference in sleep rebound time was found between Wolbachia-infected and uninfected females (Fig. 4C). Similar to female groups, equivalent amounts of recovery sleep were produced in Wolbachia-infected and uninfected male flies following 6 h sleep deprivation (Fig. 4D). Taken together, these results indicate that Wolbachia infection does not affect circadian rhythms or the sleep homeostatic process in D. melanogaster hosts.
females (data not shown). However, the number of sleep bouts during the nighttime (ZT12-ZT0) in Dmel wMel was significantly increased as compared to Dmel T for both males and females (ANOVA, p = 0.026, p = 0.034, Fig. 1C). The average nighttime sleep bout duration was not affected (Fig. 1D). These results indicate that the increase in sleep in Wolbachia-infected flies is due to an increased frequency of nighttime sleep bouts. 3.2. Wolbachia decreases the arousal threshold of flies A classic feature that defines sleep in flies and other organisms is an increased arousal threshold, or decreased responsiveness to an environmental stimulus (Hendricks et al, 2000; Shaw et al., 2000). Arousal threshold is also indicative of sleep quality, such that poor or “light” sleep would be expected to be easily disturbed by a minimal stimulus, whereas deep sleep would not. To test whether Wolbachia infection could reduce sleep quality, flies were subjected to brief vibratory stimulus pulses (see Methods Section 2.4) during nighttime hours. The percentage of Dmel wMel flies (both male and female) that were awakened by the mechanical stimulus was significantly higher than Dmel T flies at all time points tested (Fig. 2A). Likewise, the sleep latency, or the amount of time it took for flies to go back to sleep after the stimulus pulse, was longer in both male and female Dmel wMel flies than that in Dmel T flies (Fig. 2B). To ensure that awakenings were specific to the stimulus pulses, spontaneous awakenings were simultaneously measured in undisturbed controls. Undisturbed controls in both groups showed no difference in percent awakened or aroused; most flies remained asleep (Fig. S1). These results indicate that the Wolbachiainfected flies are easily disturbed by a minimal stimulus, i.e. Wolbachia infection lowered the arousal threshold of sleep in their fly hosts, and may thereby reduce sleep quality.
3.4. Expression of dopamine related genes is increased in Wolbachiainfected flies Dopaminergic signaling plays a critical function in the regulation of insect arousal, and is the primary mediator of arousal in Drosophila (Andretic et al., 2005; Liu et al., 2012; Ferguson et al., 2017). To investigate a molecular mechanism by which Wolbachia infection alters host sleep, we measured the expression of two well-characterized genes known to be related to dopamine in D. melanogaster: Pale and Ddc. Pale encodes tyrosine hydroxylase (TH), which is responsible for hydroxylating tyrosine to L-DOPA. Ddc encodes the protein DDC (L-3,4-dihydroxyphenylalanine (DOPA) decarboxylase), which is responsible for converting L-DOPA to dopamine by decarboxylation (Budnik and White, 1987; Ma et al., 2011). QRT-PCR showed that Pale and Ddc were significantly up-regulated in Dmel wMel flies relative to Dmel T flies (Fig. 5, p < 0.05). This result suggests that Wolbachia may regulate the expression of dopamine related genes in their hosts, thus affecting the
3.3. Wolbachia does not affect circadian locomotor activity rhythm or sleep homeostasis Sleep is regulated by both the circadian (process “C”) and sleep homeostatic (process “S”) factors. Process “C” contributes to the circadian drive for arousal and alertness levels, and Process “S” contributes to the homeostatic pressure to sleep as a function of the amount 84
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Table 1 Rhythmic behavior of Dmel T and Dmel wMel in constant darkness.
Dmel T male Dmel wMel male Dmel T female Dmel wMel female
Rhythmic (%) (Rhythmic/Total)
FFT Relative power
Mean period (h)
96.7 (30/31) 90.7 (29/32)
0.190 ± 0.089 0.20 ± 0.06
23.41 ± 0.05 23.64 ± 0.12
100 (31/31) 96.7 (31/32)
0.186 ± 0.057 0.189 ± 0.066
23.96 ± 0.06 23.85 ± 0.07
Flies were entrained to a light–dark cycle (12 h:12 h) for 3 days before being moved into constant darkness (DD). Behavior was analyzed from day 3 to day 11 in DD, and flies with a fast fourier transform value (FFT) above 0.01 were considered rhythmic. Period lengths and FFT values of rhythmic flies are listed as average value plus or minus the standard error of mean (SEM). Differences in FFT power and mean period time between fly lines were considered significant if p < 0.05 by Student t-test. No significant differences were found between infected and uninfected groups in either males or females (p > 0.05).
well studied. Recently, the pathogenic Wolbachia strain wMelPop, which accumulates in the nervous tissue in large clusters, was shown to significantly influence the expression of biogenic amines as well as some behaviors of insect hosts (Moreira et al., 2011; Rohrscheib et al., 2015). The presence of nonpathogenic Wolbachia strains in host CNS also affected host mating behaviors (Champion de Crespigny et al., 2006), olfactory responsiveness (Peng et al., 2008; Peng and Wang, 2009), and memory (Templé and Richard, 2015; Kishani Farahani et al., 2017). Here, we found that Wolbachia infection causes an increase in sleep in both male and female D. melanogaster hosts as compared to the tetracycline-treated Wolbachia-free flies (Fig. 1). This finding is in accordance with previous work measuring the effect of Wolbachia infection on activity of D. melanogaster (Vale and Jardine, 2015), where they showed that Wolbachia infection caused a decrease in the fraction of time spent being active in both male and female flies, which may have reflected an increase in sleep in flies of both sexes. Changes in behavior such as reduced activity and increased sleep are common among most animals after infection, and may therefore be considered as general indicators of infection (Adelman and Martin, 2009; Lopes, 2014; Kuo et al, 2010; Kuo and Williams, 2014). While they may reflect a direct cost of infection, these behavioral responses to infection may also be a kind of adaptation because the overall reduction in activity may help preserve metabolic resources to better fight against infection (Hart, 1988; Lopes, 2014). Wolbachia has been shown to influence host metabolic pathways (Evans et al., 2009; Brownlie et al., 2009; Yuan et al., 2015; Saucereau et al., 2017) such that they divert the host’s nutrients and energy for their own survival and proliferation. Thus the increase in sleep in D. melanogaster from Wolbachia infection could be an adaptive strategy to conserve limited resources and energy for the host. However, we also observed that Wolbachia infection resulted in an increase of the number of nighttime sleep bouts without affecting bout duration (Fig. 1). This together with the finding that Wolbachia-infected flies had a lower arousal threshold, indicates that sleep quality was reduced in the Wolbachia-infected flies relative to the tetracyclinetreated Wolbachia-free flies. The arousal threshold results (Fig. 2) are a little surprising because the patterns are contrary to our general expectation that as the night progresses arousal thresholds increase (the percentage of aroused flies decrease), and sleep latency decrease, which is how humans and other diurnally-active animals behave. However, the overall pattern of our arousal threshold results (Fig. 2) is consistent with previous findings in flies that arousal responses are lowest when flies are sleeping at maximal consolidated levels (Faville et al., 2015). In this case, the strain of flies used in this study showed peak sleep times between ZT 14–16 (Fig. 1A and B), which corresponded exactly to the times when both infected and tetracycline-treated flies showed the lowest responsiveness to an arousing stimulus and shortest sleep latency. Nevertheless, the Wolbachia infected flies showed lower arousal
Fig. 3. Wolbachia infected flies display strong circadian rhythm. (A) Representative actograms of Dmel T (top) male and Dmel T female flies (bottom). Horizontal bars at the top correspond to subjective day (gray) and night (black). Each horizontal line corresponds to successive days in constant dark; data are double-plotted. (B) Representative actograms of Dmel wMel (top) male and Dmel wMel (bottom) female flies.
insect hosts’ behaviors, including sleep and arousal.
4. Discussion Wolbachia are among the most successful intracellular bacteria that can infect a wide range of arthropod species as well as filarial nematodes. Wolbachia infection is well known to affect the host’s reproduction to enhance its own spreading and transmission (Werren et al., 2008). Therefore, research has focused on Wolbachia–host interactions in the gonad. However, in addition to the reproductive system, Wolbachia are also found in different somatic tissues, including the central nervous system (CNS) (Albertson et al., 2009, 2013; Strunov et al., 2017), which leads to speculation about bacterial influences on host behavior. Although the presence of Wolbachia in the brain is a common feature of the infection for Drosophila hosts (Albertson et al., 2013; Strunov et al., 2017), the effects of Wolbachia on host behavior are not 85
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Fig. 4. Sleep homeostasis was not altered in Wolbachia infected flies. Sleep profiles of female Dmel T (A) and Dmel wMel flies (B). Horizontal bars at the top correspond to subjective day (white) and night (black). Three days are superimposed in each panel, showing baseline (black), sleep deprivation (6 h at night; blue line), and recovery (pink/red) days. Mean ± SEM s sleep loss at night and gained during the next 12 h light period is shown in (C) female and (D) male flies of indicated groups. Student’s t-test. ns: not significant. For each fly line, n = 48 flies. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
in bout duration (Shirasu-Hiza et al., 2007). The greater pathogenicity of the bacterial species used in the earlier study may account for the greater severity of the effects on sleep quality. Wolbachia infection did not affect the circadian rhythm and sleep rebound following deprivation of D. melanogaster hosts. Circadian and homeostatic processes interact in complex ways to ensure that sleep occurs at optimal times (Dijk and Czeisler, 1995). The circadian system determines the timing of sleep caused by the Earth’s rotation, whereas
thresholds and increased sleep latency relative to the tetracyclinetreated flies throughout the nighttime. Together with the finding that Wolbachia increased the number of sleep bouts without affecting duration, this may indicate that Wolbachia infected flies were rendered incapable of experiencing deep, high quality sleep. Consistent with this notion, previous work also showed that bacterial infection with a pathogenic species, S. pneumoniae, increased sleep fragmentation in flies as indicated by an increase in the number of sleep bouts and a decrease 86
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Fig. 5. Wolbachia infection increased transcriptional level of Pale and Ddc in D. melanogaster, *p < 0.05, **p < 0.01. Student’s t-test (From left to right: p = 0.012, p = 0.031, p = 0.005, p = 0.002).
in particular into the Wolbachia impact on behavioral processes in invertebrate hosts. As Wolbachia-infected arthropods and filarial nematodes can be intermediate hosts during infection of vertebrates, the behavioral and ecological consequences of arthropod infection may be of great importance in controlling pests and insect-borne diseases.
the homeostatic system determines the amount and intensity of sleep (Donlea et al., 2014; Cavanaugh et al., 2016) to regulate sleep based on accumulated sleep need (Dubowy et al., 2016). An ideal ∼24 h clock present in most organisms ensures that rhythmic processes occur at the most suitable time of day. An altered circadian period results in mistimed peaks and troughs of biological functions, and thus a mismatch with the environment (Zheng and Sehgal, 2012). Wolbachia does not break this internal process as we observed in this study under the regular 24 h clock and normal environment. Studies have shown that dopaminergic signaling plays a critical function in the regulation of insect activity, and dopamine is one of the primary mediators of sleep and wakefulness in Drosophila (Van Swinderen and Andretic, 2011; Liu et al., 2012). Wolbachia infection has been demonstrated to widely alter gene expression in insect hosts (Zheng et al., 2011; Yuan et al., 2015; Ju et al., 2017; Caragata et al., 2017), including genes related to biogenic amine neurotransmitter biosynthetic pathways (Moreira et al., 2011; Rohrscheib et al., 2015). Therefore, the change of sleep behavior and quality associated with Wolbachia infection may be due to the altered expression of components in the dopamine synthesis pathway. In line with this prediction, we detected significant upregulation of Ddc and Pale, two key genes known to be related to dopamine synthesis in D. melanogaster. This is consistent with the previous work on mosquitoes by Moreira et al. (2011), where they found that dopamine levels were higher in Wolbachia-positive mosquitoes than in Wolbachia-free mosquitoes. A limitation of our study is that instead of introducing a Wolbachia infection to naïve flies, the infection was treated or removed with antibiotic. Thus an alternate interpretation is that tetracycline treatment may be responsible for the sleep altering effects rather than the infection. However, rearing flies on normal food medium (without antibiotics) for at least six generations post antibiotic treatment for reconstituting the gut flora is the standard method in Wolbachia work (Chrostek et al., 2013), and experiments did not show significant differences in total sleep time of flies across multiple generations post antibiotic treatment (Table S1). Moreover, a penicillin treatment was used to mimic effects of antibiotic without altering the Wolbachia infection. Given this control, along with previous findings that bacterial infection strongly alters sleep in flies (Shirasu-Hiza et al., 2007; Kuo et al, 2010) and vertebrate species (Imeri and Opp, 2009), it is unlikely that effects on sleep reported in this study are attributed to non-specific effects of antibiotics. In conclusion, Wolbachia infection interferes with sleep in their host, D. melanogaster, by increasing sleep time and the number of sleep bouts, and by reducing arousal threshold. Increased arousability is likely attributed to the increase in expression of some key genes involved in dopamine synthesis. Although increased sleep is generally not associated with high dopamine, this may occur in some cases (Van Swinderen and Andretic, 2011). In future work, we can address the possibility that this alteration in gene expression and sleep contributes to other behavioral deficits associated with Wolbachia infection. Our findings provide new insight into host-endosymbiont interactions and
Acknowledgements We thank Professor Scott L O’Neill (Monash University, Australia) for providing Dmel wMel flies. We acknowledge Anna N. King, Jack Jacobs and Christine Dubowy (University of Pennsylvania) for guidance the experimental methods. This work was supported by National Natural Science Foundation of China (No. 31672352) and the International Cooperation Projects of Science and Technology of Hubei Province (2017AHB050). Disclosure The authors declare no conflict of interest. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at https://doi.org/10.1016/j.jinsphys.2018.02.011. References Adelman, J.S., Martin, L.B., 2009. Vertebrate sickness behaviors: adaptive and integrated neuroendocrine immune responses. Integr. Comp. Biol. 49, 202–214. Albertson, R., Casper-Lindley, C., Cao, J., Tram, U., Sullivan, W., 2009. Symmetric and asymmetric mitotic segregation patterns influence Wolbachia distribution in host somatic tissue. J. Cell Sci. 122, 4570–4583. Albertson, R., Tan, V., Leads, R.R., Reyes, M., Sullivan, W., Casper-Lindley, C., 2013. Mapping Wolbachia distributions in the adult Drosophila brain. Cell. Microbiol. 15, 1527–1544. Allada, R., Cirelli, C., Sehgal, A., 2017. Molecular mechanisms of sleep homeostasis in flies and mammals. Cold Spring Harb. Perspect. Biol. 9, a027730. http://dx.doi.org/ 10.1101/cshperspect.a027730. Andretic, R., Van Swinderen, B., Greenspan, R.J., 2005. Dopaminergic modulation of arousal in Drosophila. Curr. Biol. 15, 1165–1175. Borbély, A.A., 1982. A two process model of sleep regulation. Hum. Neurobiol. 1, 195–204. Brownlie, J.C., Cass, B.N., Riegler, M., Witsenburg, J.J., Iturbe-Ormaetxe, I., McGraw, E.A., O’Neill, S.L., 2009. Evidence for metabolic provisioning by a common invertebrate endosymbiont, Wolbachia pipientis, during periods of nutritional stress. PLoS Pathog. 5 (4), e1000368. Budnik, V., White, K., 1987. Genetic dissection of dopamine and serotonin synthesis in the nervous system of Drosophila melanogaster. J. Neurogenet. 4, 309–314. Caragata, E.P., Pais, F.S., Baton, L.A., Silva, J.B.L., Sorgine, M.H.F., Moreira, L.A., 2017. The transcriptome of the mosquito Aedes fluviatilis (Diptera: Culicidae), and transcriptional changes associated with its native Wolbachia infection. BMC Genomics 18 (1), 6. Casper-Lindley, C., Kimura, S., Saxton, D.S., Essaw, Y., Simpson, I., Tan, V., Sullivan, W., 2011. Rapid fluorescence-based screening for Wolbachia endosymbionts in Drosophila germ line and somatic tissues. Appl. Environ. Microbiol. 77, 4788–4794. Cavanaugh, D.J., Geratowski, J.D., Wooltorton, J.R.A., Spaethling, J.M., Hector, C.E., Zheng, X., Johnson, E.C., Eberwine, J.H., Sehgal, A., 2014. Identification of a circadian output circuit for rest: Activity rhythms in Drosophila. Cell 157, 689–701.
87
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Kuo, T.H., Pike, D.H., Beizaeipour, Z., Williams, J.A., 2010. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC Neurosci. 11, 17. Kuo, T.H., Williams, J.A., 2014. Increased sleep promotes survival during a bacterial infection in Drosophila. Sleep 37 (1077–86) 1086A 1086A. Liu, Q., Liu, S., Kodama, L., Driscoll, M.R., Wu, M.N., 2012. Two dopaminergic neurons signal to the dorsal fan-shaped body to promote wakefulness in Drosophila. Curr. Biol. 22, 2114–2123. Lopes, P.C., 2014. When is it socially acceptable to feel sick? Proc. R. Soc. B 281, 20140218. Ma, Z., Guo, W., Guo, X., Wang, X., Kang, L., 2011. Modulation of behavioral phase changes of the migratory locust by the catecholamine metabolic pathway. Proc. Natl. Acad. Sci. U.S.A. 108, 3882–3887. Moreira, L.A., Ye, Y.H., Turner, K., Eyles, D.W., McGraw, E.A., O’Neill, S.L., 2011. The wMelPop strain of Wolbachia interferes with dopamine levels in Aedes aegypti. Parasit. Vect. 4, 28. Naylor, E., Bergmann, B.M., Krauski, K., Zee, P.C., Takahashi, J.S., Vitaterna, M.H., Turek, F.W., 2000. The circadian clock mutation alters sleep homeostasis in the mouse. J. Neurosci. 20, 8138–8143. Peng, Y., Nielsen, J.E., Cunningham, J.P., McGraw, E.A., 2008. Wolbachia infection alters olfactory-cued locomotion in Drosophila spp. Appl. Environ. Microbiol. 74, 3943–3948. Peng, Y., Wang, Y.F., 2009. Infection of Wolbachia may improve the olfactory response of Drosophila. Chin. Sci. Bull. 54, 1369–1375. Pietri, J.E., DeBruhl, H., Sullivan, W., 2016. The rich somatic life of Wolbachia. Microbiologyopen 5 (6), 923–936. Rohrscheib, C.E., Bondy, E., Josh, P., Riegler, M., Eyles, D., van Swinderen, B., Weible, M.W., Brownlie, J.C., 2015. Wolbachia influences the production of octopamine and affects Drosophila male aggression. Appl. Environ. Microbiol. 81, 4573–4580. Saucereau, Y., Valiente Moro, C., Dieryckx, C., Dupuy, J.-W., Tran, F.H., Girard, V., Potier, P., Mavingui, P., 2017. Comprehensive proteome profiling in Aedes albopictus to decipher Wolbachia-arbovirus interference phenomenon. BMC Genomics 18, 635. Shaw, P.J., Cirelli, C., Greenspan, R.J., Tononi, G., 2000. Correlates of sleep and waking in Drosophila melanogaster. Science 287, 1834–1837. Sheeba, V., Sharma, V.K., Gu, H., Chou, Y.-T., O’Dowd, D.K., Holmes, T.C., 2008. Pigment dispersing factor-dependent and -independent circadian locomotor behavioral rhythms. J. Neurosci. 28, 217–227. Shirasu-Hiza, M.M., Dionne, M.S., Pham, L.N., Ayres, J.S., Schneider, D.S., 2007. Interactions between circadian rhythm and immunity in Drosophila melanogaster. Curr. Biol. 17, R353–R355. Strunov, A., Schneider, D.I., Albertson, R., Miller, W.J., 2017. Restricted distribution and lateralization of mutualistic Wolbachia in the Drosophila brain. Cell. Microbiol. 19 (1). http://dx.doi.org/10.1111/cmi.12639. Templé, N., Richard, F.J., 2015. Intra-cellular bacterial infections affect learning and memory capacities of an invertebrate. Front. Zool. 12, 36. Vale, P.F., Jardine, M.D., 2015. Sex-specific behavioral symptoms of viral gut infection and Wolbachia in Drosophilamelanogaster. J. Insect Physiol. 82, 28–32. Van Swinderen, B., Andretic, R., 2011. Dopamine in Drosophila: setting arousal thresholds in a miniature brain. Proc. R. Soc. B: Biol. Sci. 278, 906–913. Werren, J.H., Baldo, L., Clark, M.E., 2008. Wolbachia: master manipulators of invertebrate biology. Nat. Rev. Microbiol. 6, 741–751. Ye, Y.H., Seleznev, A., Flores, H.A., Woolfit, M., McGraw, E.A., 2017. Gut microbiota in Drosophila melanogaster interacts with Wolbachia but does not contribute to Wolbachia-mediated antiviral protection. J. Invertebr. Pathol. 143, 18–25. Yuan, L.L., Chen, X., Zong, Q., Zhao, T., Wang, J.L., Zheng, Y., Zhang, M., Wang, Z., Brownlie, J.C., Yang, F., Wang, Y.F., 2015. Quantitative proteomic analyses of molecular mechanisms associated with cytoplasmic incompatibility in Drosophila melanogaster induced by Wolbachia. J. Proteome Res. 14, 3835–3847. Zimmerman, J.E., Chan, M.T., Lenz, O.T., Keenan, B.T., Maislin, G., Pack, A.I., 2017. Glutamate is a wake active neurotransmitter in Drosophila melanogaster. Sleep 40. http://dx.doi.org/10.1093/SLEEP/ZSW046. Zheng, Y., Wang, J.L., Liu, C., Wang, C.P., Walker, T., Wang, Y.F., 2011. Differentially expressed profiles in the larval testes of Wolbachia infected and uninfected Drosophila. BMC Genomics 12, 595. Zheng, X., Sehgal, A., 2012. Speed control: Cogs and gears that drive the circadian clock. Trends Neurosci. 35 (9), 574–585. Zug, R., Hammerstein, P., 2012. Still a host of hosts for Wolbachia: Analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One 7 (6), e38544.
Cavanaugh, D.J., Vigderman, A.S., Dean, T., Garbe, D.S., Sehgal, A., 2016. The Drosophila circadian clock gates sleep through time-of-day dependent modulation of sleep-promoting neurons. Sleep 39, 345–356. Champion de Crespigny, F.E., Pitt, T.D., Wedell, N., 2006. Increased male mating rate in Drosophila is associated with Wolbachia infection. J. Evol. Biol. 19, 1964–1972. Chrostek, E., Marialva, M.S., Esteves, S.S., Weinert, L.A., Martinez, J., Jiggins, F.M., Teixeira, L., 2013. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLoS Genet. 9, e1003896. Crocker, A., Sehgal, A., 2010. Genetic analysis of sleep. Genes Dev. 24, 1220–1235. Dijk, D.J., Czeisler, C.A., 1995. Contribution of the circadian pacemaker and the sleep homeostat to sleep propensity, sleep structure, electroencephalographic slow waves, and sleep spindle activity in humans. J. Neurosci. 15, 3526–3538. Donlea, J.M., Pimentel, D., Miesenböck, G., 2014. Neuronal machinery of sleep homeostasis in Drosophila. Neuron 81, 860–872. Donlea, J.M., Thimgan, M.S., Suzuki, Y., Gottschalk, L., Shaw, P.J., 2011. Inducing sleep by remote control facilitates memory consolidation in Drosophila. Science 332, 1571–1576. Dubowy, C., Moravcevic, K., Yue, Z., Wan, J.Y.J., Van Dongen, H.H.P.A., Sehgal, A., 2016. Genetic dissociation of daily sleep and sleep following thermogenetic sleep deprivation in Drosophila. Sleep 39, 1083–1095. Dubowy, C., Sehgal, A., 2017. Circadian rhythms and sleep in Drosophilamelanogaster. Genetics 205, 1373–1397. Emery, P., So, W.V., Kaneko, M., Hall, J.C., Rosbash, M., 1998. CRY, a Drosophila clock and light-regulated cryptochrome, is a major contributor to circadian rhythm resetting and photosensitivity. Cell 95, 669–679. Evans, O., Caragata, E.P., McMeniman, C.J., Woolfit, M., Green, D.C., Williams, C.R., Franklin, C.E., O’Neill, S.L., McGraw, E.A., 2009. Increased locomotor activity and metabolism of Aedes aegypti infected with a life-shortening strain of Wolbachia pipientis. J. Exp. Biol. 212, 1436–1441. Faville, R., Kottler, B., Goodhill, G.J., Shaw, P.J., van Swinderen, B., 2015. How deeply does your mutant sleep? Probing arousal to better understand sleep defects in Drosophila. Sci Rep. 5, 8454. Ferguson, L., Petty, A., Rohrscheib, C., Troup, M., Kirszenblat, L., Eyles, D.W., van Swinderen, B., 2017. Transient dysregulation of dopamine signaling in a developing Drosophila arousal circuit permanently impairs behavioral responsiveness in adults. Front. Psychiatry 8, 22. Gardner, B., Strus, E., Meng, Q.C., Coradetti, T., Naidoo, N.N., Kelz, M.B., Williams, J.A., 2016. Sleep homeostasis and general anesthesia: are fruit flies well rested after emergence from propofol? Anesthesiology 124, 404–416. Gilestro, G.F., Cirelli, C., 2009. PySolo: a complete suite for sleep analysis in Drosophila. Bioinformatics 25, 1466–1467. Goodacre, S.L., Martin, O.Y., 2012. Modification of insect and arachnid behaviors by vertically transmitted endosymbionts: infections as drivers of behavioral change and evolutionary novelty. Insects 3 (1), 246–261. Gotoh, T., Noda, H., Ito, S., 2007. Cardinium symbionts cause cytoplasmic incompatibility in spider mites. Heredity (Edinburg) 98, 13–20. Hart, B.L., 1988. Biological basis of the behavior of sick animals. Neurosci. Biobehav. Rev. 12, 123–137. Hendricks, J.C., Finn, S.M., Panckeri, K.A., Chavkin, J., Williams, J.A., Sehgal, A., Pack, A.I., 2000. Rest in Drosophila is a sleep-like state. Neuron 25, 129–138. Hoffmann, A.A., Turelli, M., Simmons, G.M., 1986. Unidirectional Incompatibility between populations of Drosophilasimulans. Source Evol. Evol. 40, 692–701. Huber, R., Hill, S.L., Holladay, C., Biesiadecki, M., Tononi, G., Cirelli, C., 2004. Sleep homeostasis in Drosophila melanogaster. Sleep 27, 628–639. Imeri, L., Opp, M.R., 2009. How (and why) the immune system makes us sleep. Nat. Rev. Neurosci. 10, 199–210. Jones, B.E., 2005. From waking to sleeping: neuronal and chemical substrates. Trends Pharmacol. Sci. 26 (11), 578–586. Ju, J.F., Hoffmann, A.A., Zhang, Y.K., Duan, X.Z., Guo, Y., Gong, J.T., Zhu, W.C., Hong, X.Y., 2017. Wolbachia-induced loss of male fertility is likely related to branch chain amino acid biosynthesis and iLvE in Laodelphax striatellus. Insect Biochem. Mol. Biol. 85, 11–20. King, A.N., Barber, A.F., Smith, A.E., Dreyer, A.P., Sitaraman, D., Nitabach, M.N., Cavanaugh, D.J., Sehgal, A., 2017. A peptidergic circuit links the circadian clock to locomotor activity. Curr. Biol. 27 (13), 1915–1927. Kishani Farahani, H., Ashouri, A., Goldansaz, S.H., Shapiro, M.S., Pierre, J.S., van Baaren, J., 2017. Decrease of memory retention in a parasitic wasp: an effect of host manipulation by Wolbachia? Insect Sci. 24, 569–583.
88
Contents lists available at ScienceDirect
Journal of Insect Physiology journal homepage: www.elsevier.com/locate/jinsphys
Wolbachia affects sleep behavior in Drosophila melanogaster Jie Bi a b
a,b
b
b
, Amita Sehgal , Julie A. Williams , Yu-Feng Wang
a,⁎
T
School of Life Sciences, Hubei Key Laboratory of Genetic Regulation and Integrative Biology, Central China Normal University, Wuhan 430079, PR China Department of Neuroscience, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA
A R T I C L E I N F O
A B S T R A C T
Keywords: Wolbachia Drosophila melanogaster Sleep Arousal Dopamine
Wolbachia are endosymbiotic bacteria present in a wide range of insects. Although their dramatic effects on host reproductive biology have been well studied, the effects of Wolbachia on sleep behavior of insect hosts are not well documented. In this study, we report that Wolbachia infection caused an increase of total sleep time in both male and female Drosophila melanogaster. The increase in sleep was associated with an increase in the number of nighttime sleep bouts or episodes, but not in sleep bout duration. Correspondingly, Wolbachia infection also reduced the arousal threshold of their fly hosts. However, neither circadian rhythm nor sleep rebound following deprivation was influenced by Wolbachia infection. Transcriptional analysis of the dopamine biosynthesis pathway revealed that two essential genes, Pale and Ddc, were significantly upregulated in Wolbachia-infected flies. Together, these results indicate that Wolbachia mediates the expression of dopamine related genes, and decreases the sleep quality of their insect hosts. Our findings help better understand the host-endosymbiont interactions and in particular the Wolbachia’s impact on behaviors, and thus on ecology and evolution in insect hosts.
1. Introduction Symbiotic organisms are particularly common in insects, and in some cases they may protect their hosts from pathogenic infections (Goodacre and Martin, 2012) or increase their hosts’ biological fitness. Wolbachia are gram-negative endosymbiotic bacteria that infect a wide range of arthropods and filarial nematodes. It is estimated that up to 40% of arthropod species are infected with Wolbachia (Zug and Hammerstein, 2012). Wolbachia are best known for infecting host reproductive tissues and thus manipulating host reproduction, enhancing their transmission through host populations. In addition to gonads, Wolbachia are also prevalent in tissues of the nervous system in Drosophila (Albertson et al., 2013; Casper-Lindley et al., 2011) as well as digestive and metabolic tissues such as the fat body, gut, salivary glands, and Malpighian tubules of many insect species where they may play a role in mediating host immunity and behavior (Pietri et al., 2016; Rohrscheib et al., 2015). Recently, studies have shown that Wolbachia affects male aggression and activity in Drosophila hosts (Rohrscheib et al., 2015; Vale and Jardine, 2015). When compared with Wolbachiafree flies, Wolbachia-infected flies exhibited significantly reduced activity, suggesting an increase of sleep resulted from Wolbachia (Vale and Jardine, 2015). Therefore Drosophila is an ideal model host to investigate questions at the interface of microbes and host behavior. The sleep-like state is widely conserved among animal species
⁎
(Crocker and Sehgal, 2010), and Drosophila has been frequently used in studies to identify the genetic basis of sleep/wake regulation (Allada et al., 2017; Dubowy and Sehgal, 2017). Sleep behavior in flies shares cardinal features with mammalian sleep such as prolonged reversible immobility, increased arousal thresholds and homeostatic influence (Shaw et al., 2000; Hendricks et al., 2000). The timing of sleep is controlled by a circadian system, which is seen in most living organisms and allows anticipation of the daily changes of the external world. Although these approximately 24 h rhythms persist in constant conditions, environmental fluctuations such as day: night light or temperature cycles entrain or reset rhythms to precisely 24 h periods and to an appropriate phase (Emery et al., 1998). Besides this clock system, animals have another sleep regulation system: a homeostatic drive that increases during waking, and dissipates during sleep. Although these two systems can operate independently, recent studies indicate a more intimate relationship (Donlea et al., 2011; Naylor et al., 2000; Sheeba et al., 2008). Among other neuromodulators, dopamine (DA) appears to have an important role in controlling sleep amount, and perhaps even its timing. In the mammalian mesencephalic tegmentum, DA-containing neurons are important for arousal (Jones, 2005). As in mammals, dopamine exerts a wake-promoting function in flies (Liu et al., 2012), indicating that this and other neurotransmitter pathways (Zimmerman et al., 2017) have common functions in sleep in both flies and mammalian species.
Corresponding author. E-mail address: [email protected] (Y.-F. Wang).
https://doi.org/10.1016/j.jinsphys.2018.02.011 Received 3 October 2017; Received in revised form 26 February 2018; Accepted 26 February 2018 Available online 27 February 2018 0022-1910/ © 2018 Elsevier Ltd. All rights reserved.
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
were individually placed into glass tubes with 5% sucrose/2% agar food and monitored in constant darkness (DD) for 7 days at 25 °C. All behavioral experiments were performed at least 2 independent times with at least 16 flies/group each. Circadian rhythm was analyzed with ClockLab software (Actimetrics, Wilmette IL, version: 2.72). Period and rhythm strength were determined for each individual fly using activity data collected from days 2–7 of DD. Period length was determined using χ2 periodogram analysis, and relative power (or amplitude) of circadian rhythm was determined using fast Fourier transform (FFT). Fly activity was considered rhythmic if the χ2 periodogram showed a peak above the 95% confidence interval and the FFT value at around a 24 h cycle was > 0.01 (King et al., 2017). Differences in FFT power between groups were considered significant if p < 0.05 by Student t-test, ns: not significant.
To better understand the impact of Wolbachia infection on the host’s sleep behavior, we investigated the influence of Wolbachia on sleep time, sleep homeostasis, circadian rhythm and arousal in Drosophila melanogaster. 2. Material and methods 2.1. Fly stocks The wMel Wolbachia infected D. melanogaster (Brisbane nuclear background with introgressed wMel from YW), designated as Dmel wMel, was kindly provided by Professor Scott O’Neill (Monash University, Australia). Tetracycline treatments were performed as described previously to generate genetically paired fly lines that were Wolbachia-free, here referred as Dmel T (Hoffmann et al., 1986). As tetracycline not only removes Wolbachia but also massively shifts the composition of the whole microbiome (Ye et al., 2017), to ensure the specificity of the effect of Wolbachia on sleep, we also treated a separate positive control group of flies with penicillin, which does not remove Wolbachia but depletes other bacteria. Penicillin treatments were performed as described previously (Gotoh et al., 2007), here referred as Dmel P. Gut flora of flies was reconstituted by standard methods (Chrostek et al., 2013) and all experiments involved in Dmel T or Dmel P flies were conducted at a minimum of six generations post antibiotic treatment. All fly lines were reared on standard cornmeal-yeast-agar medium at 25 °C with a photoperiod of 12 h:12 h LD (light:dark) under non-crowded conditions (200 ± 10 eggs per 50 mL vial of media in 150 mL conical flask).
2.4. Arousal assays For arousal threshold assays, flies were loaded into DAMs monitors (Trikinetics Inc) as described above, and recorded for three days in a 12 h:12 h LD cycle at 25 °C. On the third day, monitors were attached to a computer-controlled vortexer, and single, 0.6 s pulses were applied at nighttime hours at ZT14, ZT16, ZT18, ZT20 and ZT22. The number of sleeping flies that were awakened by the stimulus pulse was determined using Insomniac3 (written in MSVC6, by Thomas Coradetti). This number was divided by the total number of sleeping flies at the time of the stimulus pulse and reported as percent arousal. Sleep latency, or the length of time to the first sleep bout after the arousing stimulus pulse was also measured across all flies, excluding those that did not wake up from the stimulus. Student t-test and Mann-Whitney U test were used to analyze significance. p < 0.05 indicated significant difference.
2.2. Sleep assays Sleep was monitored using the Drosophila Activity Monitoring System (DAMs, TriKinetics, Waltham, MA). This system records activity from individual flies maintained in sealed tubes placed in activity monitors. An infrared beam directed through the midpoint of each tube measures an “activity event” each time a fly crosses the beam. Four day old flies were placed in glass locomotor tubes containing 5% sucrose/ 2% agarose food. Locomotor activity counts were collected in 1-min bins. Sleep in this assay was defined by zero activity counts for a minimum of five consecutive minutes (Huber et al., 2004). All behavioral experiments were conducted at 25 °C in a 12 h:12 h LD cycle. For sleep deprivation experiments, flies were loaded into activity monitors as described above, and recorded for three days. On the 4th day, flies were subjected to 6 h sleep deprivation from ZT 17–23 (ZT = zeitgeber time, where ZT 0 is lights-on, and ZT 12 is lights off) by mechanical stimulation using an adapted computer-controlled vortexer (TriKinetics, Waltham, MA). Vortexing stimuli were applied for 2 s at random intervals ranging from 20 to 40 s (1–3 times per minute). Net sleep loss and the amount of recovery sleep (or sleep rebound) were calculated for each fly by subtracting the previous corresponding 12 h baseline sleep period from the 12 h nighttime (for sleep loss) or daytime period following sleep deprivation (for sleep gain). Data were processed and analyzed using PySolo (Gilestro and Cirelli, 2009) or custom software, Insomniac 3 (gift of Thomas Coradetti, Gardner et al., 2016). Statistical analyses were performed using GraphPad Prism 6. Differences in daily sleep and other parameters were evaluated with a one-way ANOVA followed by Tukey’s post-hoc, or Student’s t-test, where appropriate. All experiments were conducted a minimum of three times using 16 flies per group per experimental replicate. Flies that did not survive the duration of the experiment were excluded from the analyses.
2.5. Quantitative reverse transcription-PCR (qRT-PCR) Total RNA was extracted from 3 to 7 day old flies using Trizol reagent (Thermo Fisher Scientific). RNA was reverse transcribed to generate cDNA using a High Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific). qRT-PCR was performed on a ViiA7 RealTime PCR System (Applied Biosystems) using SYBR Green PCR master mix (Thermo Fisher Scientific). Gene specific primers for Ddc and Pale were as follows: Ddc-F ACACAAATGGATGCTGGTGA; Ddc-R AAGAGG GTCCACATTGAACG; and Pale-F AGTTCTCGCAGGAGATTGGA; Pale-R TTCCTTGCAGAGACCGAACT. Ribosomal protein gene rp49 (primers are: rp49-F CTAAGCTGTCGCACAAATGG; rp49-R TAAACGCGGTTCTG CATGAG) was used as an internal control. The relative expression of each gene was calibrated against the reference gene using 2−ΔCt [ΔCt = Ct(target gene) − Ct(reference gene)]. p < 0.05 indicated significant difference by Student t-test. 3. Results 3.1. Wolbachia infection increases daily sleep Dmel wMel flies carrying Wolbachia were treated with tetracycline to render them free of infection of Wolbachia. We demonstrated that the effects of tetracycline treatment on sleep were stable across multiple generations (Table S1). We also treated a separate group of Dmel wMel flies with penicillin for removing other bacteria but Wolbachia as a positive control and found that the effects of penicillin treatment on sleep in flies were also stable across at least five generations post treatment (Table S1). We compared sleep time between Wolbachia infected flies, Dmel wMel and Dmel P (penicillin treated D. melanogaster), and the tetracycline treated Wolbachia-free flies, Dmel T. As shown in Fig. 1A and B, the total sleep time of Dmel wMel was longer than that of Dmel T for both females and males (ANOVA, p = 0.043, p = 0.044), particularly at nighttime. However, we did not observe any differences in sleep time
2.3. Circadian assays Circadian rhythm assays were performed with the DAMs as described previously (Cavanaugh et al., 2014). Flies were entrained to a 12 h:12 h LD (light:dark) cycle for > 3 days at 25 °C. Four-day-old flies 82
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Fig. 1. Wolbachia infection increases sleep. (A) Representative sleep profiles with standard error bars in female (n = 32), top, and male (n = 32) flies (bottom) of indicated groups. Horizontal bars at the top correspond to subjective day (white) and night (black). (B) Total sleep in female (left) and male (right) flies. For each fly line 48 flies were assayed over a 5 day period. (C) Number of nighttime sleep bouts in female (left) and male (right) flies of indicated groups. (D) Average nighttime sleep bout duration in female (left) and male (right) of flies. One-way ANOVA followed by Tukey’s post-hoc. Bars represent standard error. * represents p < 0.05, ns: not significant.
hosts, and furthermore, it is not other bacteria, but Wolbachia that affect daily sleep. We next tested the effects of Wolbachia infection on other sleep parameters, including the number of sleep bouts or episodes and the average duration of sleep bouts. Daytime sleep bout number and duration were not affected by Wolbachia infection in either males or
between Dmel P and Dmel wMel (Fig. 1B). To ensure that increased sleep was not attributed to a reduction in locomotor ability in flies, we evaluated waking activity rate (defined as activity counts per waking minute) and found that there was no change between Dmel wMel and Dmel T (data not shown). These data indicate that the Wolbachia infection results in an increase in total sleep time of their D. melanogaster 83
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Fig. 2. Wolbachia infection reduces arousal threshold in Drosophila. Percent flies awakened by a brief mechanical stimulus is shown in (A) at indicated time points. Mann-Whitney U test was performed, * represents p < 0.05. (From left to right: p = 0.035, p = 0.045, p = 0.04, p = 0.046, p = 0.047, p = 0.028, p = 0.018, p = 0.024, p = 0.037, p = 0.041). Latency to sleep onset after the stimulus pulse is shown in (B) at indicated time points. * represents p < 0.05. (From left to right: p = 0.044, p = 0.039, p = 0.048, p = 0.036, p = 0.037, p = 0.029, p = 0.038, p = 0.022, p = 0.036, p = 0.021; t = 6.267, t = 10.34, t = 1.788, t = 4.346, t = 3.089, t = 6.495, t = 5.725, t = 11.51, t = 6.482, t = 7.511). Student’s t-test. n = 32 flies per experiment across four replicate experiments.
of time elapsed since the last adequate sleep episode (Borbély, 1982). Since Wolbachia infected flies showed increased sleep, but had reduced sleep quality as indicated by a lower arousal threshold and more frequent sleep bouts, we next tested whether these effects were associated with a disruption in circadian rhythm and/or sleep homeostatic drive. No difference in circadian rest:activity behavior was found between Wolbachia-infected and uninfected flies (Fig. 3). Most flies showed strong behavioral rhythms, and the period length was the same between Wolbachia infected and the tetracycline treated Wolbachia-free flies, both males and females (Table 1). We next tested the effect of Wolbachia infection on sleep homeostasis in flies. Flies were subjected to 6 h sleep deprivation during the second half of the nighttime, from ZT 17–23. As shown in Fig. 4A and B, both Wolbachia-infected and uninfected females showed sleep rebound in the morning after sleep deprivation. No difference in sleep rebound time was found between Wolbachia-infected and uninfected females (Fig. 4C). Similar to female groups, equivalent amounts of recovery sleep were produced in Wolbachia-infected and uninfected male flies following 6 h sleep deprivation (Fig. 4D). Taken together, these results indicate that Wolbachia infection does not affect circadian rhythms or the sleep homeostatic process in D. melanogaster hosts.
females (data not shown). However, the number of sleep bouts during the nighttime (ZT12-ZT0) in Dmel wMel was significantly increased as compared to Dmel T for both males and females (ANOVA, p = 0.026, p = 0.034, Fig. 1C). The average nighttime sleep bout duration was not affected (Fig. 1D). These results indicate that the increase in sleep in Wolbachia-infected flies is due to an increased frequency of nighttime sleep bouts. 3.2. Wolbachia decreases the arousal threshold of flies A classic feature that defines sleep in flies and other organisms is an increased arousal threshold, or decreased responsiveness to an environmental stimulus (Hendricks et al, 2000; Shaw et al., 2000). Arousal threshold is also indicative of sleep quality, such that poor or “light” sleep would be expected to be easily disturbed by a minimal stimulus, whereas deep sleep would not. To test whether Wolbachia infection could reduce sleep quality, flies were subjected to brief vibratory stimulus pulses (see Methods Section 2.4) during nighttime hours. The percentage of Dmel wMel flies (both male and female) that were awakened by the mechanical stimulus was significantly higher than Dmel T flies at all time points tested (Fig. 2A). Likewise, the sleep latency, or the amount of time it took for flies to go back to sleep after the stimulus pulse, was longer in both male and female Dmel wMel flies than that in Dmel T flies (Fig. 2B). To ensure that awakenings were specific to the stimulus pulses, spontaneous awakenings were simultaneously measured in undisturbed controls. Undisturbed controls in both groups showed no difference in percent awakened or aroused; most flies remained asleep (Fig. S1). These results indicate that the Wolbachiainfected flies are easily disturbed by a minimal stimulus, i.e. Wolbachia infection lowered the arousal threshold of sleep in their fly hosts, and may thereby reduce sleep quality.
3.4. Expression of dopamine related genes is increased in Wolbachiainfected flies Dopaminergic signaling plays a critical function in the regulation of insect arousal, and is the primary mediator of arousal in Drosophila (Andretic et al., 2005; Liu et al., 2012; Ferguson et al., 2017). To investigate a molecular mechanism by which Wolbachia infection alters host sleep, we measured the expression of two well-characterized genes known to be related to dopamine in D. melanogaster: Pale and Ddc. Pale encodes tyrosine hydroxylase (TH), which is responsible for hydroxylating tyrosine to L-DOPA. Ddc encodes the protein DDC (L-3,4-dihydroxyphenylalanine (DOPA) decarboxylase), which is responsible for converting L-DOPA to dopamine by decarboxylation (Budnik and White, 1987; Ma et al., 2011). QRT-PCR showed that Pale and Ddc were significantly up-regulated in Dmel wMel flies relative to Dmel T flies (Fig. 5, p < 0.05). This result suggests that Wolbachia may regulate the expression of dopamine related genes in their hosts, thus affecting the
3.3. Wolbachia does not affect circadian locomotor activity rhythm or sleep homeostasis Sleep is regulated by both the circadian (process “C”) and sleep homeostatic (process “S”) factors. Process “C” contributes to the circadian drive for arousal and alertness levels, and Process “S” contributes to the homeostatic pressure to sleep as a function of the amount 84
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Table 1 Rhythmic behavior of Dmel T and Dmel wMel in constant darkness.
Dmel T male Dmel wMel male Dmel T female Dmel wMel female
Rhythmic (%) (Rhythmic/Total)
FFT Relative power
Mean period (h)
96.7 (30/31) 90.7 (29/32)
0.190 ± 0.089 0.20 ± 0.06
23.41 ± 0.05 23.64 ± 0.12
100 (31/31) 96.7 (31/32)
0.186 ± 0.057 0.189 ± 0.066
23.96 ± 0.06 23.85 ± 0.07
Flies were entrained to a light–dark cycle (12 h:12 h) for 3 days before being moved into constant darkness (DD). Behavior was analyzed from day 3 to day 11 in DD, and flies with a fast fourier transform value (FFT) above 0.01 were considered rhythmic. Period lengths and FFT values of rhythmic flies are listed as average value plus or minus the standard error of mean (SEM). Differences in FFT power and mean period time between fly lines were considered significant if p < 0.05 by Student t-test. No significant differences were found between infected and uninfected groups in either males or females (p > 0.05).
well studied. Recently, the pathogenic Wolbachia strain wMelPop, which accumulates in the nervous tissue in large clusters, was shown to significantly influence the expression of biogenic amines as well as some behaviors of insect hosts (Moreira et al., 2011; Rohrscheib et al., 2015). The presence of nonpathogenic Wolbachia strains in host CNS also affected host mating behaviors (Champion de Crespigny et al., 2006), olfactory responsiveness (Peng et al., 2008; Peng and Wang, 2009), and memory (Templé and Richard, 2015; Kishani Farahani et al., 2017). Here, we found that Wolbachia infection causes an increase in sleep in both male and female D. melanogaster hosts as compared to the tetracycline-treated Wolbachia-free flies (Fig. 1). This finding is in accordance with previous work measuring the effect of Wolbachia infection on activity of D. melanogaster (Vale and Jardine, 2015), where they showed that Wolbachia infection caused a decrease in the fraction of time spent being active in both male and female flies, which may have reflected an increase in sleep in flies of both sexes. Changes in behavior such as reduced activity and increased sleep are common among most animals after infection, and may therefore be considered as general indicators of infection (Adelman and Martin, 2009; Lopes, 2014; Kuo et al, 2010; Kuo and Williams, 2014). While they may reflect a direct cost of infection, these behavioral responses to infection may also be a kind of adaptation because the overall reduction in activity may help preserve metabolic resources to better fight against infection (Hart, 1988; Lopes, 2014). Wolbachia has been shown to influence host metabolic pathways (Evans et al., 2009; Brownlie et al., 2009; Yuan et al., 2015; Saucereau et al., 2017) such that they divert the host’s nutrients and energy for their own survival and proliferation. Thus the increase in sleep in D. melanogaster from Wolbachia infection could be an adaptive strategy to conserve limited resources and energy for the host. However, we also observed that Wolbachia infection resulted in an increase of the number of nighttime sleep bouts without affecting bout duration (Fig. 1). This together with the finding that Wolbachia-infected flies had a lower arousal threshold, indicates that sleep quality was reduced in the Wolbachia-infected flies relative to the tetracyclinetreated Wolbachia-free flies. The arousal threshold results (Fig. 2) are a little surprising because the patterns are contrary to our general expectation that as the night progresses arousal thresholds increase (the percentage of aroused flies decrease), and sleep latency decrease, which is how humans and other diurnally-active animals behave. However, the overall pattern of our arousal threshold results (Fig. 2) is consistent with previous findings in flies that arousal responses are lowest when flies are sleeping at maximal consolidated levels (Faville et al., 2015). In this case, the strain of flies used in this study showed peak sleep times between ZT 14–16 (Fig. 1A and B), which corresponded exactly to the times when both infected and tetracycline-treated flies showed the lowest responsiveness to an arousing stimulus and shortest sleep latency. Nevertheless, the Wolbachia infected flies showed lower arousal
Fig. 3. Wolbachia infected flies display strong circadian rhythm. (A) Representative actograms of Dmel T (top) male and Dmel T female flies (bottom). Horizontal bars at the top correspond to subjective day (gray) and night (black). Each horizontal line corresponds to successive days in constant dark; data are double-plotted. (B) Representative actograms of Dmel wMel (top) male and Dmel wMel (bottom) female flies.
insect hosts’ behaviors, including sleep and arousal.
4. Discussion Wolbachia are among the most successful intracellular bacteria that can infect a wide range of arthropod species as well as filarial nematodes. Wolbachia infection is well known to affect the host’s reproduction to enhance its own spreading and transmission (Werren et al., 2008). Therefore, research has focused on Wolbachia–host interactions in the gonad. However, in addition to the reproductive system, Wolbachia are also found in different somatic tissues, including the central nervous system (CNS) (Albertson et al., 2009, 2013; Strunov et al., 2017), which leads to speculation about bacterial influences on host behavior. Although the presence of Wolbachia in the brain is a common feature of the infection for Drosophila hosts (Albertson et al., 2013; Strunov et al., 2017), the effects of Wolbachia on host behavior are not 85
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Fig. 4. Sleep homeostasis was not altered in Wolbachia infected flies. Sleep profiles of female Dmel T (A) and Dmel wMel flies (B). Horizontal bars at the top correspond to subjective day (white) and night (black). Three days are superimposed in each panel, showing baseline (black), sleep deprivation (6 h at night; blue line), and recovery (pink/red) days. Mean ± SEM s sleep loss at night and gained during the next 12 h light period is shown in (C) female and (D) male flies of indicated groups. Student’s t-test. ns: not significant. For each fly line, n = 48 flies. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
in bout duration (Shirasu-Hiza et al., 2007). The greater pathogenicity of the bacterial species used in the earlier study may account for the greater severity of the effects on sleep quality. Wolbachia infection did not affect the circadian rhythm and sleep rebound following deprivation of D. melanogaster hosts. Circadian and homeostatic processes interact in complex ways to ensure that sleep occurs at optimal times (Dijk and Czeisler, 1995). The circadian system determines the timing of sleep caused by the Earth’s rotation, whereas
thresholds and increased sleep latency relative to the tetracyclinetreated flies throughout the nighttime. Together with the finding that Wolbachia increased the number of sleep bouts without affecting duration, this may indicate that Wolbachia infected flies were rendered incapable of experiencing deep, high quality sleep. Consistent with this notion, previous work also showed that bacterial infection with a pathogenic species, S. pneumoniae, increased sleep fragmentation in flies as indicated by an increase in the number of sleep bouts and a decrease 86
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Fig. 5. Wolbachia infection increased transcriptional level of Pale and Ddc in D. melanogaster, *p < 0.05, **p < 0.01. Student’s t-test (From left to right: p = 0.012, p = 0.031, p = 0.005, p = 0.002).
in particular into the Wolbachia impact on behavioral processes in invertebrate hosts. As Wolbachia-infected arthropods and filarial nematodes can be intermediate hosts during infection of vertebrates, the behavioral and ecological consequences of arthropod infection may be of great importance in controlling pests and insect-borne diseases.
the homeostatic system determines the amount and intensity of sleep (Donlea et al., 2014; Cavanaugh et al., 2016) to regulate sleep based on accumulated sleep need (Dubowy et al., 2016). An ideal ∼24 h clock present in most organisms ensures that rhythmic processes occur at the most suitable time of day. An altered circadian period results in mistimed peaks and troughs of biological functions, and thus a mismatch with the environment (Zheng and Sehgal, 2012). Wolbachia does not break this internal process as we observed in this study under the regular 24 h clock and normal environment. Studies have shown that dopaminergic signaling plays a critical function in the regulation of insect activity, and dopamine is one of the primary mediators of sleep and wakefulness in Drosophila (Van Swinderen and Andretic, 2011; Liu et al., 2012). Wolbachia infection has been demonstrated to widely alter gene expression in insect hosts (Zheng et al., 2011; Yuan et al., 2015; Ju et al., 2017; Caragata et al., 2017), including genes related to biogenic amine neurotransmitter biosynthetic pathways (Moreira et al., 2011; Rohrscheib et al., 2015). Therefore, the change of sleep behavior and quality associated with Wolbachia infection may be due to the altered expression of components in the dopamine synthesis pathway. In line with this prediction, we detected significant upregulation of Ddc and Pale, two key genes known to be related to dopamine synthesis in D. melanogaster. This is consistent with the previous work on mosquitoes by Moreira et al. (2011), where they found that dopamine levels were higher in Wolbachia-positive mosquitoes than in Wolbachia-free mosquitoes. A limitation of our study is that instead of introducing a Wolbachia infection to naïve flies, the infection was treated or removed with antibiotic. Thus an alternate interpretation is that tetracycline treatment may be responsible for the sleep altering effects rather than the infection. However, rearing flies on normal food medium (without antibiotics) for at least six generations post antibiotic treatment for reconstituting the gut flora is the standard method in Wolbachia work (Chrostek et al., 2013), and experiments did not show significant differences in total sleep time of flies across multiple generations post antibiotic treatment (Table S1). Moreover, a penicillin treatment was used to mimic effects of antibiotic without altering the Wolbachia infection. Given this control, along with previous findings that bacterial infection strongly alters sleep in flies (Shirasu-Hiza et al., 2007; Kuo et al, 2010) and vertebrate species (Imeri and Opp, 2009), it is unlikely that effects on sleep reported in this study are attributed to non-specific effects of antibiotics. In conclusion, Wolbachia infection interferes with sleep in their host, D. melanogaster, by increasing sleep time and the number of sleep bouts, and by reducing arousal threshold. Increased arousability is likely attributed to the increase in expression of some key genes involved in dopamine synthesis. Although increased sleep is generally not associated with high dopamine, this may occur in some cases (Van Swinderen and Andretic, 2011). In future work, we can address the possibility that this alteration in gene expression and sleep contributes to other behavioral deficits associated with Wolbachia infection. Our findings provide new insight into host-endosymbiont interactions and
Acknowledgements We thank Professor Scott L O’Neill (Monash University, Australia) for providing Dmel wMel flies. We acknowledge Anna N. King, Jack Jacobs and Christine Dubowy (University of Pennsylvania) for guidance the experimental methods. This work was supported by National Natural Science Foundation of China (No. 31672352) and the International Cooperation Projects of Science and Technology of Hubei Province (2017AHB050). Disclosure The authors declare no conflict of interest. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at https://doi.org/10.1016/j.jinsphys.2018.02.011. References Adelman, J.S., Martin, L.B., 2009. Vertebrate sickness behaviors: adaptive and integrated neuroendocrine immune responses. Integr. Comp. Biol. 49, 202–214. Albertson, R., Casper-Lindley, C., Cao, J., Tram, U., Sullivan, W., 2009. Symmetric and asymmetric mitotic segregation patterns influence Wolbachia distribution in host somatic tissue. J. Cell Sci. 122, 4570–4583. Albertson, R., Tan, V., Leads, R.R., Reyes, M., Sullivan, W., Casper-Lindley, C., 2013. Mapping Wolbachia distributions in the adult Drosophila brain. Cell. Microbiol. 15, 1527–1544. Allada, R., Cirelli, C., Sehgal, A., 2017. Molecular mechanisms of sleep homeostasis in flies and mammals. Cold Spring Harb. Perspect. Biol. 9, a027730. http://dx.doi.org/ 10.1101/cshperspect.a027730. Andretic, R., Van Swinderen, B., Greenspan, R.J., 2005. Dopaminergic modulation of arousal in Drosophila. Curr. Biol. 15, 1165–1175. Borbély, A.A., 1982. A two process model of sleep regulation. Hum. Neurobiol. 1, 195–204. Brownlie, J.C., Cass, B.N., Riegler, M., Witsenburg, J.J., Iturbe-Ormaetxe, I., McGraw, E.A., O’Neill, S.L., 2009. Evidence for metabolic provisioning by a common invertebrate endosymbiont, Wolbachia pipientis, during periods of nutritional stress. PLoS Pathog. 5 (4), e1000368. Budnik, V., White, K., 1987. Genetic dissection of dopamine and serotonin synthesis in the nervous system of Drosophila melanogaster. J. Neurogenet. 4, 309–314. Caragata, E.P., Pais, F.S., Baton, L.A., Silva, J.B.L., Sorgine, M.H.F., Moreira, L.A., 2017. The transcriptome of the mosquito Aedes fluviatilis (Diptera: Culicidae), and transcriptional changes associated with its native Wolbachia infection. BMC Genomics 18 (1), 6. Casper-Lindley, C., Kimura, S., Saxton, D.S., Essaw, Y., Simpson, I., Tan, V., Sullivan, W., 2011. Rapid fluorescence-based screening for Wolbachia endosymbionts in Drosophila germ line and somatic tissues. Appl. Environ. Microbiol. 77, 4788–4794. Cavanaugh, D.J., Geratowski, J.D., Wooltorton, J.R.A., Spaethling, J.M., Hector, C.E., Zheng, X., Johnson, E.C., Eberwine, J.H., Sehgal, A., 2014. Identification of a circadian output circuit for rest: Activity rhythms in Drosophila. Cell 157, 689–701.
87
Journal of Insect Physiology 107 (2018) 81–88
J. Bi et al.
Kuo, T.H., Pike, D.H., Beizaeipour, Z., Williams, J.A., 2010. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC Neurosci. 11, 17. Kuo, T.H., Williams, J.A., 2014. Increased sleep promotes survival during a bacterial infection in Drosophila. Sleep 37 (1077–86) 1086A 1086A. Liu, Q., Liu, S., Kodama, L., Driscoll, M.R., Wu, M.N., 2012. Two dopaminergic neurons signal to the dorsal fan-shaped body to promote wakefulness in Drosophila. Curr. Biol. 22, 2114–2123. Lopes, P.C., 2014. When is it socially acceptable to feel sick? Proc. R. Soc. B 281, 20140218. Ma, Z., Guo, W., Guo, X., Wang, X., Kang, L., 2011. Modulation of behavioral phase changes of the migratory locust by the catecholamine metabolic pathway. Proc. Natl. Acad. Sci. U.S.A. 108, 3882–3887. Moreira, L.A., Ye, Y.H., Turner, K., Eyles, D.W., McGraw, E.A., O’Neill, S.L., 2011. The wMelPop strain of Wolbachia interferes with dopamine levels in Aedes aegypti. Parasit. Vect. 4, 28. Naylor, E., Bergmann, B.M., Krauski, K., Zee, P.C., Takahashi, J.S., Vitaterna, M.H., Turek, F.W., 2000. The circadian clock mutation alters sleep homeostasis in the mouse. J. Neurosci. 20, 8138–8143. Peng, Y., Nielsen, J.E., Cunningham, J.P., McGraw, E.A., 2008. Wolbachia infection alters olfactory-cued locomotion in Drosophila spp. Appl. Environ. Microbiol. 74, 3943–3948. Peng, Y., Wang, Y.F., 2009. Infection of Wolbachia may improve the olfactory response of Drosophila. Chin. Sci. Bull. 54, 1369–1375. Pietri, J.E., DeBruhl, H., Sullivan, W., 2016. The rich somatic life of Wolbachia. Microbiologyopen 5 (6), 923–936. Rohrscheib, C.E., Bondy, E., Josh, P., Riegler, M., Eyles, D., van Swinderen, B., Weible, M.W., Brownlie, J.C., 2015. Wolbachia influences the production of octopamine and affects Drosophila male aggression. Appl. Environ. Microbiol. 81, 4573–4580. Saucereau, Y., Valiente Moro, C., Dieryckx, C., Dupuy, J.-W., Tran, F.H., Girard, V., Potier, P., Mavingui, P., 2017. Comprehensive proteome profiling in Aedes albopictus to decipher Wolbachia-arbovirus interference phenomenon. BMC Genomics 18, 635. Shaw, P.J., Cirelli, C., Greenspan, R.J., Tononi, G., 2000. Correlates of sleep and waking in Drosophila melanogaster. Science 287, 1834–1837. Sheeba, V., Sharma, V.K., Gu, H., Chou, Y.-T., O’Dowd, D.K., Holmes, T.C., 2008. Pigment dispersing factor-dependent and -independent circadian locomotor behavioral rhythms. J. Neurosci. 28, 217–227. Shirasu-Hiza, M.M., Dionne, M.S., Pham, L.N., Ayres, J.S., Schneider, D.S., 2007. Interactions between circadian rhythm and immunity in Drosophila melanogaster. Curr. Biol. 17, R353–R355. Strunov, A., Schneider, D.I., Albertson, R., Miller, W.J., 2017. Restricted distribution and lateralization of mutualistic Wolbachia in the Drosophila brain. Cell. Microbiol. 19 (1). http://dx.doi.org/10.1111/cmi.12639. Templé, N., Richard, F.J., 2015. Intra-cellular bacterial infections affect learning and memory capacities of an invertebrate. Front. Zool. 12, 36. Vale, P.F., Jardine, M.D., 2015. Sex-specific behavioral symptoms of viral gut infection and Wolbachia in Drosophilamelanogaster. J. Insect Physiol. 82, 28–32. Van Swinderen, B., Andretic, R., 2011. Dopamine in Drosophila: setting arousal thresholds in a miniature brain. Proc. R. Soc. B: Biol. Sci. 278, 906–913. Werren, J.H., Baldo, L., Clark, M.E., 2008. Wolbachia: master manipulators of invertebrate biology. Nat. Rev. Microbiol. 6, 741–751. Ye, Y.H., Seleznev, A., Flores, H.A., Woolfit, M., McGraw, E.A., 2017. Gut microbiota in Drosophila melanogaster interacts with Wolbachia but does not contribute to Wolbachia-mediated antiviral protection. J. Invertebr. Pathol. 143, 18–25. Yuan, L.L., Chen, X., Zong, Q., Zhao, T., Wang, J.L., Zheng, Y., Zhang, M., Wang, Z., Brownlie, J.C., Yang, F., Wang, Y.F., 2015. Quantitative proteomic analyses of molecular mechanisms associated with cytoplasmic incompatibility in Drosophila melanogaster induced by Wolbachia. J. Proteome Res. 14, 3835–3847. Zimmerman, J.E., Chan, M.T., Lenz, O.T., Keenan, B.T., Maislin, G., Pack, A.I., 2017. Glutamate is a wake active neurotransmitter in Drosophila melanogaster. Sleep 40. http://dx.doi.org/10.1093/SLEEP/ZSW046. Zheng, Y., Wang, J.L., Liu, C., Wang, C.P., Walker, T., Wang, Y.F., 2011. Differentially expressed profiles in the larval testes of Wolbachia infected and uninfected Drosophila. BMC Genomics 12, 595. Zheng, X., Sehgal, A., 2012. Speed control: Cogs and gears that drive the circadian clock. Trends Neurosci. 35 (9), 574–585. Zug, R., Hammerstein, P., 2012. Still a host of hosts for Wolbachia: Analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One 7 (6), e38544.
Cavanaugh, D.J., Vigderman, A.S., Dean, T., Garbe, D.S., Sehgal, A., 2016. The Drosophila circadian clock gates sleep through time-of-day dependent modulation of sleep-promoting neurons. Sleep 39, 345–356. Champion de Crespigny, F.E., Pitt, T.D., Wedell, N., 2006. Increased male mating rate in Drosophila is associated with Wolbachia infection. J. Evol. Biol. 19, 1964–1972. Chrostek, E., Marialva, M.S., Esteves, S.S., Weinert, L.A., Martinez, J., Jiggins, F.M., Teixeira, L., 2013. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLoS Genet. 9, e1003896. Crocker, A., Sehgal, A., 2010. Genetic analysis of sleep. Genes Dev. 24, 1220–1235. Dijk, D.J., Czeisler, C.A., 1995. Contribution of the circadian pacemaker and the sleep homeostat to sleep propensity, sleep structure, electroencephalographic slow waves, and sleep spindle activity in humans. J. Neurosci. 15, 3526–3538. Donlea, J.M., Pimentel, D., Miesenböck, G., 2014. Neuronal machinery of sleep homeostasis in Drosophila. Neuron 81, 860–872. Donlea, J.M., Thimgan, M.S., Suzuki, Y., Gottschalk, L., Shaw, P.J., 2011. Inducing sleep by remote control facilitates memory consolidation in Drosophila. Science 332, 1571–1576. Dubowy, C., Moravcevic, K., Yue, Z., Wan, J.Y.J., Van Dongen, H.H.P.A., Sehgal, A., 2016. Genetic dissociation of daily sleep and sleep following thermogenetic sleep deprivation in Drosophila. Sleep 39, 1083–1095. Dubowy, C., Sehgal, A., 2017. Circadian rhythms and sleep in Drosophilamelanogaster. Genetics 205, 1373–1397. Emery, P., So, W.V., Kaneko, M., Hall, J.C., Rosbash, M., 1998. CRY, a Drosophila clock and light-regulated cryptochrome, is a major contributor to circadian rhythm resetting and photosensitivity. Cell 95, 669–679. Evans, O., Caragata, E.P., McMeniman, C.J., Woolfit, M., Green, D.C., Williams, C.R., Franklin, C.E., O’Neill, S.L., McGraw, E.A., 2009. Increased locomotor activity and metabolism of Aedes aegypti infected with a life-shortening strain of Wolbachia pipientis. J. Exp. Biol. 212, 1436–1441. Faville, R., Kottler, B., Goodhill, G.J., Shaw, P.J., van Swinderen, B., 2015. How deeply does your mutant sleep? Probing arousal to better understand sleep defects in Drosophila. Sci Rep. 5, 8454. Ferguson, L., Petty, A., Rohrscheib, C., Troup, M., Kirszenblat, L., Eyles, D.W., van Swinderen, B., 2017. Transient dysregulation of dopamine signaling in a developing Drosophila arousal circuit permanently impairs behavioral responsiveness in adults. Front. Psychiatry 8, 22. Gardner, B., Strus, E., Meng, Q.C., Coradetti, T., Naidoo, N.N., Kelz, M.B., Williams, J.A., 2016. Sleep homeostasis and general anesthesia: are fruit flies well rested after emergence from propofol? Anesthesiology 124, 404–416. Gilestro, G.F., Cirelli, C., 2009. PySolo: a complete suite for sleep analysis in Drosophila. Bioinformatics 25, 1466–1467. Goodacre, S.L., Martin, O.Y., 2012. Modification of insect and arachnid behaviors by vertically transmitted endosymbionts: infections as drivers of behavioral change and evolutionary novelty. Insects 3 (1), 246–261. Gotoh, T., Noda, H., Ito, S., 2007. Cardinium symbionts cause cytoplasmic incompatibility in spider mites. Heredity (Edinburg) 98, 13–20. Hart, B.L., 1988. Biological basis of the behavior of sick animals. Neurosci. Biobehav. Rev. 12, 123–137. Hendricks, J.C., Finn, S.M., Panckeri, K.A., Chavkin, J., Williams, J.A., Sehgal, A., Pack, A.I., 2000. Rest in Drosophila is a sleep-like state. Neuron 25, 129–138. Hoffmann, A.A., Turelli, M., Simmons, G.M., 1986. Unidirectional Incompatibility between populations of Drosophilasimulans. Source Evol. Evol. 40, 692–701. Huber, R., Hill, S.L., Holladay, C., Biesiadecki, M., Tononi, G., Cirelli, C., 2004. Sleep homeostasis in Drosophila melanogaster. Sleep 27, 628–639. Imeri, L., Opp, M.R., 2009. How (and why) the immune system makes us sleep. Nat. Rev. Neurosci. 10, 199–210. Jones, B.E., 2005. From waking to sleeping: neuronal and chemical substrates. Trends Pharmacol. Sci. 26 (11), 578–586. Ju, J.F., Hoffmann, A.A., Zhang, Y.K., Duan, X.Z., Guo, Y., Gong, J.T., Zhu, W.C., Hong, X.Y., 2017. Wolbachia-induced loss of male fertility is likely related to branch chain amino acid biosynthesis and iLvE in Laodelphax striatellus. Insect Biochem. Mol. Biol. 85, 11–20. King, A.N., Barber, A.F., Smith, A.E., Dreyer, A.P., Sitaraman, D., Nitabach, M.N., Cavanaugh, D.J., Sehgal, A., 2017. A peptidergic circuit links the circadian clock to locomotor activity. Curr. Biol. 27 (13), 1915–1927. Kishani Farahani, H., Ashouri, A., Goldansaz, S.H., Shapiro, M.S., Pierre, J.S., van Baaren, J., 2017. Decrease of memory retention in a parasitic wasp: an effect of host manipulation by Wolbachia? Insect Sci. 24, 569–583.
88