Xenopus laevis red cone opsin and Prph2 promoters allow transgene expression in amphibian cones, or both rods and cones

Gene 298 (2002) 173–182 www.elsevier.com/locate/gene

Xenopus laevis red cone opsin and Prph2 promoters allow transgene expression in amphibian cones, or both rods and cones Orson L. Moritz*, Allison Peck, Beatrice M. Tam Department of Neuroscience, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-3401, USA Received 29 May 2002; received in revised form 5 August 2002; accepted 20 August 2002 Received by S. Yokoyama

Abstract We have cloned the promoter regions of two Xenopus laevis genes, Prph2 (also called RDS) and red cone opsin (RCO) using a polymerase chain reaction-based gene-walking method. The proteins coded by these genes are expressed exclusively in retinal photoreceptors. Although these promoter sequences are evolutionarily distant from previously described homologues, potentially informative similarities were noted that suggest conserved binding sites of the transcription factors Crx and Rx. The promoters were tested for function in transgenic X. laevis. RCOdriven expression was restricted to cones and pinealocytes, while the Prph2 promoter drove expression of a reporter green fluorescent protein transgene in both rod and cone photoreceptors, as well as low levels of expression in muscle tissue. This is the first description of transgene expression driven by a Prph2 promoter homologue from any species. In combination with the previously reported X. laevis opsin and arrestin promoters, these sequences will facilitate the development and analysis of X. laevis models of inherited retinal degeneration. q 2002 Elsevier Science B.V. All rights reserved. Keywords: Transgenic; Xenopus; Retina; Photoreceptor; RDS; Peripherin-2

1. Introduction Methods for generating transgenic Xenopus laevis and Xenopus tropicalis have only recently become available (Kroll and Amaya, 1996). However, transgenic X. laevis are becoming an important research animal system, particularly for developmental biology and visual science. Because of the ease of generation, they are an alternative to tissue culture systems for examining gene expression and localization of gene products. Experiments can be carried out and evaluated rapidly and at lower cost compared with transgenic mammals. Currently, one major limitation of the system is a lack of promoter sequences used to drive cellspecific expression of transgenes. Often, mammalian promoters do not function in evolutionarily distant systems

Abbreviations: bp, base pairs; cDNA, complementary DNA; DNA, deoxyribonucleic acid; dNTPs, deoxyribonucleotide tri-phosphates; DMSO, dimethyl sulfoxide; fmol, femtomole; GFP, green fluorescent protein; kb, kilobase(s); pmol, picomole; RCO, red cone opsin; RNA, ribonucleic acid; RT, reverse transcriptase; TE, 10 mM Tris 1 mM EDTA pH 8.0; TR-WGA, Texas Red conjugated wheat germ agglutinin; PCR, polymerase chain reaction; X. laevis, Xenopus laevis * Corresponding author. Present address: Department of Ophthalmology, University of British Columbia, 2550 Willow Street, Vancouver, BC, V5Z 3N9, Canada. Tel.: 11-604-875-4357; fax: 11-604-875-4663. E-mail address: [email protected] (O.L. Moritz).

such as X. laevis. For example, we have attempted to use the human red cone opsin promoter to drive expression in X. laevis cones without success. However, this is not the case for all mammalian promoters (Boatright et al., 2001). X. laevis are a useful animal for studying many aspects of retinal cell biology. X. laevis eyes develop shortly after fertilization, their photoreceptors are unusually large and easily visualized by light microscopy, and unlike mice and rats, their retinas contain large numbers of cone photoreceptors. Our lab has used transgenic X. laevis to study aspects of rhodopsin transport and targeting (Tam et al., 2000; Moritz et al., 2001a), as well as to generate models of inherited retinal degeneration (Moritz et al., 2001a). Rod photoreceptors play a major role in human vision only under dim conditions, for example a moonless night. However, several inherited retinal degenerations are caused by mutations in genes that function only in rods, such as Rhodopsin. The death of rods can go unnoticed by patients, but eventually secondary cone death occurs by unknown mechanisms, resulting in blindness (Papermaster, 1995). Rods outnumber cones in human retina, although cones predominate in the macula, where they confer high acuity and color vision. Thus the loss of cones accounts for most of the disability associated with blindness. We have modeled these inherited retinal disorders in X. laevis using transgenes that induce rod death. Previously, we

0378-1119/02/$ - see front matter q 2002 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(02)00923-X

174

O.L. Moritz et al. / Gene 298 (2002) 173–182

2. Materials and methods

vectorette technique described by Siebert et al. (1995). Briefly, genomic DNA was isolated from 50 X. laevis embryos as previously described (Moritz et al., 2001b) and used to prepare five different PCR templates. Genomic DNA (2.5 mg) was digested using five different restriction enzymes that generate blunt ends: HincII, SmaI, EcoRV, StuI, and MscI. Each digest was extracted with phenol/ chloroform, and ethanol precipitated. Five ligations were assembled that included the genomic DNA digests resuspended in 10 ml dH2O, 4 ml of 5 £ ligase buffer (Invitrogen), 10 units of T4 ligase (Invitrogen), and 5 mM of a short synthetic DNA adapter (composed of two partially overlapping oligonucleotides) in a final volume of 20 ml. The ligations proceeded overnight at room temperature and were terminated by heating to 708C for 5 min, and diluted to 200 ml using 10 mM Tris 1 mM EDTA pH 8.0 (TE). The sequences of the adapter oligonucleotides were identical to those previously described (Siebert et al., 1995), including a 3 0 amine on the shorter oligonucleotide that prevents extension by polymerases. Two rounds of PCR were carried out on genomic templates using nested gene-specific primers and adapter-specific primers. Adapter-specific primers (AP1 and AP2) were identical to those previously described (Siebert et al., 1995). Gene-specific primers were based on the previously published cDNA sequences of Xrds38 (Kedzierski et al., 1996) and red cone opsin (Chang and Harris, 1998), and were designed to amplify regions upstream of the known sequences. In order to obtain additional upstream sequence, a second set of gene-specific nested primers was synthesized for Prph2 once preliminary sequence data was obtained. Prph2 gene-specific primer sequences were: Xrds38gsp1, ggcaatgcctgctaaga, Xrds38gsp2, tttcatcagggccattg, Xrds38gsp4, ctagcacttgcccagga, and Xrds38gsp5, ggggatgaggggttaaa. RCO gene-specific primer sequences were: Xrcogsp1, cctccgagcagcaaata, and Xrcogsp2, cccaactccaccacctt. Each first round PCR reaction contained 10 mM Tris pH 9.0, 50 mM KCl, 0.2 mM deoxyribonucleotide tri-phosphates, 1.5 mM MgCl2, 1% dimethyl sulfoxide, 8% glycerol, 10 pmol each of primer AP1 and the first gene-specific primer, 1.25 units Taq polymerase (Invitrogen), 0.125 units Pfu polymerase (Stratagene) and 1 ml of diluted genomic DNA template. For second round PCR, the product of the first round PCR was diluted 100 £ and used as a template, and the primers used were AP2 and the second gene-specific primer. For conventional PCR of Prph2 using unmodified genomic DNA as a template, reaction conditions were the same as described above and primers were Xrds38gsp6 gcatgcggccgctggccgtacagaaaa and Xrds38gsp7 gcatcccgggtccttagccaaatgagt. Gel purified PCR products were directly sequenced using an ABI prism DNA sequencer.

2.1. Cloning of promoter sequences

2.2. Generation of transgenic X. laevis

developed a transgenic model of retinal degeneration in which the X. laevis rod opsin promoter drove expression of a mutant GFP-rab8T22N fusion protein. This resulted in rapid death of rods, followed by gradual death of cones (Moritz et al., 2001a). In order to expand the utility of this model, we need the flexibility to drive expression in cones or in all photoreceptors to ascertain if there are reciprocal interactions between rods and cones, and to provide us with the potential to examine cone-protective strategies. Although transgene expression in X. laevis rods has also been reported using the X. laevis Arrestin promoter (Mani et al., 1999) and the human b -PDE promoter (Lerner et al., 2001), and overexpression of transgene products in both rods and cones of X. laevis retina has also been recently reported using both the IRBP promoter (Boatright et al., 2001) and the Nocturnin promoter (Liu and Green, 2001), suitable X. laevis promoters for expression in cones were not available, and a human cone opsin promoter does not function in X. laevis. We have cloned promoters for both X. laevis cone-specific opsin (red cone opsin or RCO) and Prph2. Prph2 (also called RDS) encodes Peripherin-2 (also called rds, or Xrds38 in X. laevis), a structural protein found at the rims of rod and cone outer segment disks (Connell et al., 1991). Of the three Peripherin-2 homologues identified in X. laevis, Xrds38 is the most similar to mammalian Peripherin-2 in both sequence and expression patterns (Kedzierski et al., 1996). Mutations in Prph2 are associated with retinal degeneration in humans and mice (Shastry, 1994). Other researchers have previously published the complementary deoxyribonucleic acids (cDNAs) encoded by these genes (Kedzierski et al., 1996; Chang and Harris, 1998). We employed a polymerase chain reaction (PCR)-based method that is relatively easy and rapid, and could be applied by others seeking X. laevis promoters. We mapped the transcription initiation site of the RCO promoter, and demonstrate that both sequences can drive cell-specific expression of green fluorescent protein (GFP) in transgenic X. laevis photoreceptors. We found that the Prph2 promoter frequently drove low-level expression of GFP in skeletal and heart muscle, but were unable to find evidence of endogenous Xrds38 messenger RNA (mRNA) or Xrds38 protein in muscle tissue. This is the first use of a Prph2 promoter for transgene expression in any species. Sequence comparisons of these promoters with evolutionarily distant homologues reveal conserved sequences that may be informative for identifying transcription factor binding sites, or other conserved promoter elements that have roles in photoreceptor function and retinal disease.

The gene-walking procedure used was based on the

Constructs for generating transgenic X. laevis were

O.L. Moritz et al. / Gene 298 (2002) 173–182

obtained by cloning PCR-amplified promoter fragments into peGFP-EV (Moritz et al., 1999), a vector containing a promoterless GFP cDNA downstream of Not1 and EcoRV restriction sites. All PCR products contained an upstream Not1 site derived from the oligonucleotide adapters used for generating the PCR templates. To introduce a blunt restriction site at the downstream end of the product, a third round of PCR was used. Primers for the third round of PCR were AP2 and a third gene-specific primer. Gene-specific primers were: Xrds38gsp3, gcatgatatccttagccaaatgagt and Xrcogsp3, gcatgatatcccaactccaccacctt. Primers Xrds38gsp6 and Xrds38gsp7 used to amplify the long Prph2 promoter fragment (see Section 2.1) incorporated Not1 and Sma1 sites, allowing similar cloning into peGFP-EV. For transgenesis, plasmids were linearized (Not1), and purified using Gene Clean (Bio101). Transgenic X. laevis were generated by a modification of the method of Kroll and Amaya (1996) (Moritz et al., 1999). Embryos expressing GFP were identified using a dissecting microscope equipped with epifluorescence optics suitable for excitation and visualization of GFP. 2.3. Microscopy Frozen sections cut from formaldehyde-fixed X. laevis eyes were labeled with antibodies cos-1 (Rohlich et al., 1989) or mabE (Witt et al., 1984) to label cone or rod outer segments, and Cy3-conjugated secondary antibodies (Jackson), or with Texas-red conjugated wheat germ agglutinin lectin (TR-WGA, Molecular Probes), which labels the glycoproteins of rods and cones, and Hoechst 33342 nuclear stain. Fixation and staining methods were as previously described (Moritz et al., 1999; Tam et al., 2000). Stained sections were imaged using a Zeiss 510 confocal microscope and a Zeiss Axioskop with epi-fluorescence. Zeiss Axioskop images were processed using Openlab 2.0 deconvolution software (Improvision). 2.4. Purification of RNA and primer extension assay For primer extension, 10 (RCO) or 50 mg (Prph2) of total RNA, obtained from adult X. laevis tissues using TRIZOL reagent (Invitrogen), were hybridized with 100 fmol of 32P end-labeled primers Xrcogsp2, Xrds38gsp3, or Xrds38gsp2 at room temperature overnight as described (Sambrook et al., 1989). Reactions were precipitated, and primer extension was performed using the Primer Extension System (Promega) according to the manufacturer’s protocol. Reactions were run on a 7% denaturing polyacrylamide gel and detected by autoradiography. DNA sequencing (used as size standards) was performed using the same primers and the Sequenase Version 2.0 kit (USB). 2.5. RT-PCR cDNA was synthesized using 1 mg of total RNA, oligodT(12–18) primers (AP biotech), and MMLV reverse tran-

175

scriptase (RT) (Invitrogen) according to the manufacturer’s protocol. 20 ml RT reactions were diluted to 100 ml with TE, and 1 ml was used as a PCR template. PCR was carried out using the primers Xrds38rt1, cccgcttagtccagatg and Xrds38rt2, tcagcatgggggtattc using the conditions described above.

3. Results 3.1. Cloning of promoter fragments Using a PCR-based method for gene walking, we were able to obtain 2146 bp (base pairs) of previously unreported upstream sequence from the Prph2 gene, and 813 bp of previously unreported upstream sequence from the RCO gene. This involved a single round of walking for RCO, and two rounds of walking for Prph2 (see Section 2.1). A typical result of a chromosome walk on the RCO gene is shown in Fig. 1. This method generally gave sufficient yields to allow direct sequencing of PCR products. The PCR primers were designed such that regions of overlap with known sequence (20–60 bp) would be present in correctly amplified DNA. Newly obtained sequences were examined to determine whether these overlapping regions were present, and products that did not contain these regions were considered non-specific. However, only a single nonspecific product was obtained. This specificity was likely due to the use of two rounds of PCR and two gene specific primers to generate each PCR product. The number, size and degree of overlap of PCR products for both genes is summarized in Fig. 2. In order to generate a Prph2 PCR product that incorporated sequence obtained from both gene walks, a large fragment (2071 bp) incorporating the majority of the sequence obtained was also amplified by conventional PCR from genomic DNA (Fig. 2). This also verified that the complete sequence obtained was present in the genome. The sequence of this PCR product was compared to the sequence obtained by gene walking. Only a few mismatches were noted among the sequences obtained by these two methods. Several single base mismatches were also noted between the results of direct sequencing of RCO products and the sequences of cloned PCR products. These differences may be due to the genetic diversity of the starting material, which was not derived from inbred X. laevis strains, or errors introduced by the PCR procedure. However, the inclusion of pfu polymerase in the PCR reaction should have resulted in relatively low polymerase error rates. In case of discrepancy, the results reported are for direct sequencing, which was considered more representative of the starting material. The nucleotide sequence for the X. laevis RCO promoter has been deposited in the GenBank database under accession number AY082662. The nucleotide sequence for the X. laevis

176

O.L. Moritz et al. / Gene 298 (2002) 173–182

Fig. 1. Gene walking and primer extension results for RCO. (A) Genomic DNA templates prepared using EcoRV (E) MscI (M), or ScaI (S) restriction enzymes were used for 1st and 2nd round PCR reactions (1, 2). Products were analyzed on a 1.5% agarose gel. Control 1st round reactions (C) contained no template, and 2nd round reactions used first round products as templates. Second round products (arrowheads) were obtained using EcoRV and MscI templates, but not in control reactions. Similar results were obtained for Prph2. (B) The transcription initiation site of the RCO gene was mapped by primer extension using total RNA as a template. A specific product of primer extension was seen in X. laevis retina RNA (R) using primer Xrcogsp2. No specific products were obtained from heart RNA (H) or a control reaction containing no RNA (N). DNA sequencing reactions using Xrcogsp2 are shown on the left (GATC). Similar analysis of X. laevis Prph2 failed to give any detectable products.

Prph2 promoter has been deposited in the GenBank database under accession number AY082663. 3.2. Primer extension analysis To determine the transcription initiation site for the promoters, primer extension analysis was performed on X.

laevis retina total RNA. As a control, X. laevis heart total RNA was also examined. For RCO, a single product of primer extension 55 bp in length (including primer) was observed in reactions using retina RNA, but not in heart RNA (Fig. 1). The corresponding position in the gene was determined by comparing the size of the extension product to DNA sequencing reactions performed using the same

Fig. 2. Summary of PCR results. The relative sizes and positions of clones obtained by PCR gene walking are summarized above. Gene walking allowed us to obtain 2146 bp of novel sequence from Prph2 and 813 bp of novel sequence from RCO using genomic DNA templates prepared with MscI, EcoRV, and HincII restriction enzymes. Clones obtained by this method terminated with restriction enzyme half-sites, as indicated. Clones tested for promoter activity in transgenic X. laevis are indicated, as is the relative position of the large Prph2 fragment obtained by conventional PCR.

O.L. Moritz et al. / Gene 298 (2002) 173–182

primer. The transcription start site is located immediately downstream of a consensus TATAA sequence centered at position 227 relative to the site of transcription initiation (also indicated on Fig. 3). A similar analysis of Prph2 using primers Xrds38gsp2 and Xrds38gsp3 did not yield specific products from retina, heart or liver RNA, despite increasing the input RNA fivefold (not shown). Either the transcript concentration was too low, or Prph2 does not have a rigorously defined transcription start site. The second possibility is also suggested by previous studies of transcription initiation in mouse Prph2 (Cheng et al., 1997), and the lack of a consensus TATAA element. (Multiple transcription start sites are often features of TATAA-less promoters). However, Ma et al. (1995) describe a unique initiation site for mouse Prph2. 3.3. Sequence comparisons of the X. laevis Prph2 promoter The GenBank database was scanned with the novel Prph2 promoter sequences obtained in this study using the NCBI BLAST server to perform a BLAST alignment search. Only sequences of very limited similarity were identified, which did not have other identifiable relationships to the Prph2 gene or other genes expressed in photoreceptors apart from isolated short regions of similarity. These regions were most likely identified because they lacked complexity (e.g. ttataaataaaatattt). We used the program Clustal-W to compare the X. laevis Prph2 promoter to equivalent regions of the human Prph2 gene sequence obtained by the human genome sequencing project (GenBank Accession Number AL049843), and the mouse Prph2 promoter, previously reported by Ma et al. (1995). Results for the proximal regions of the promoters are given in Fig. 3. Some conserved regions and similarities were noted. In particular, a region surrounding the transcription initiation site of mouse Prph2 was conserved in all three sequences, as was a region centered at 233 bp with the consensus sequence CCAYTTTTCAA. It has been suggested that this region may function as a TATAA box (Ma et al., 1995; Cheng et al., 1997). Interestingly, this sequence contains a consensus initiator (Inr) element, YYAN(T/A)YY. However, although transcription initiation generally occurs within Inr, Cheng et al. do not report any initiation sites in this region (Cheng et al., 1997). Another TATAA-like sequence was located farther upstream in the X. laevis promoter, but was not conserved across species (Fig. 3).

177

transcription initiation site) and was due to the presence of a X. laevis-specific dispersed repetitive DNA sequence of the Xori family (Riggs and Taylor, 1987) (GenBank Accession Number M28447) (Fig. 3). Approximately 30,000 Xori elements are estimated to be present in the X. laevis genome. The presence of this repetitive element may confound attempts to clone sequences farther upstream using genewalking techniques. The non-X. laevis sequence with the highest degree of similarity identified by the BLAST search was the Anolis carolinensis red visual pigment gene (Kawamura and Yokoyama, 1993). The region of highest similarity between these genes was centered at 283 bp upstream of the site of transcription initiation in the X. laevis sequence (Figs. 1 and 3). Another 25 bp extended region of homology was centered at 2216 bp. A TATAA box centered at 229 bp was also conserved (Fig. 3). (The transcription initiation site has not been identified in the Anolis sequence.) We searched for short sequences within conserved regions of the two promoters that might correspond to the binding sites of known retina-specific transcription factors, including sites for the retina-specific transcription factors Rx (PCE1 or ret-1 sites) (Mathers et al., 1997), Crx (ret4, OTX, and BAT-1 sites) (Chen et al., 1997; Furukawa et al., 1997), Nrl (NRE sites) (Swaroop et al., 1992; Kumar et al., 1996) and Glass (Moses and Rubin, 1991). One consensus PCE1 and one OTX element were conserved between the A. carolinensis and X. laevis RCO promoters (Fig. 3). The consensus OTX element was a component of the 283 bp conserved region, and is also conserved in the human red and green cone opsin promoter sequences (not shown, GenBank Accession Numbers M13306 and M13300). The remainder of this region was AT-rich, and could be an equivalent of the AT-rich region known as BAT-1 found in the bovine rhodopsin proximal promoter, which binds protein factors including Crx (DesJardin and Hauswirth, 1996; Chen et al., 1997). The conserved region at 2216 is similar to a Drosophila Glass-binding site (Moses and Rubin, 1991). Similar sequences are present in the X. laevis and chick Rhodopsin promoters (Batni et al., 1996). The X. laevis Prph2 promoter sequence contained two consensus OTX elements, but these were not conserved across species. We did not identify any conserved consensus NRE sites or ret-4 sites (potential binding sites for the transcription factors Nrl and Crx) in either promoter. 3.5. Testing PCR products for promoter activity in transgenic X. laevis

3.4. Sequence comparisons of the X. laevis RCO promoter A similar BLAST search was performed using the novel 813 bp of X. laevis RCO promoter sequence obtained in this study. A number of X. laevis-derived sequences were identified as having significant similarity to this region, including X. laevis calbindin D28k mRNA and X. laevis olfactory marker protein 1 (xomp1). The majority of similarity was found in the first 100 bp of the clone (farthest from the

PCR products of various lengths were tested for the ability to function as promoters and drive photoreceptor-specific expression of GFP in X. laevis. The tested fragments are summarized in Fig. 2. The promoter fragments are identified by their approximate length in kilobases appended to either RCO or Prph2, i.e. RCO-0.9 refers to the 868 bp product derived from the RCO gene. We found that Prph2-1.2 was capable of driving expres-

178

O.L. Moritz et al. / Gene 298 (2002) 173–182

Fig. 3. Promoter alignments. Sequences derived from X. laevis Prph2 and RCO genes aligned with previously cloned homologues. (A) The X. laevis Prph2 product obtained with MscI (see Fig. 2) aligned with human and mouse homologues. (B) The X. laevis RCO product obtained with EcoRV (Figs. 1 and 2) aligned with the A. carolinensis cone opsin promoter (Kawamura and Yokoyama, 1993). Completely conserved bases are highlighted green, identical bases are yellow, and similar bases are blue. Italics indicate regions of overlap with previously cloned cDNAs, used to confirm the specificity of the PCR. Interesting features of the sequences are noted. In the Prph2 alignment, the transcription initiation site of mouse Prph2 (Ma et al., 1995) is indicated by an arrow and numbered 11. A consensus Inr element is found within a conserved region (extended by blue dashed line) previously suggested to function as a TATAA element. A non-conserved TATAA element is also present upstream. For RCO, the transcription start site of the X. laevis gene is indicated by the arrow and numbered 11 (see Fig. 1). Conserved potential binding sites for the retina-specific transcription factors Rx (PCE1 sites) and Crx (OTX sites) were identified, as well as a conserved TATAA box and a glass-like element. The AT-rich sequence indicated by the dashed line immediately follows a conserved PCE1 site, and could be functionally similar to a BAT-1 site. The region that resembles a previously described X. laevis dispersed repeat sequence (Riggs and Taylor, 1987) is underlined.

O.L. Moritz et al. / Gene 298 (2002) 173–182

179

Fig. 4. PCR products function as promoters in transgenic X. laevis. (A) Ventral view of a transgenic tadpole expressing GFP under control of RCO-0.9 (see Fig. 2). A fluorescence image (green) is superimposed on a bright field image (grayscale). Expression of GFP was seen in the eyes (e). No fluorescence was seen in the heart (arrow). The gut (g) is auto-fluorescent. (B) Similar ventral view of a tadpole expressing GFP under control of Prph2-1.2. Fluorescence was seen in the eyes (e) and the heart (arrow). (C) Dorsal view of a tadpole expressing GFP under control of RCO-0.9, with strong pineal expression (arrow) (eye fluorescence cannot be seen in this view.) (D) Three-quarters view of a tadpole expressing GFP under control of Prph2-1.2. The image is a grayscale representation of green fluorescence without superimposed bright field. Low-level GFP expression was observed in the muscles of the jaw (j) and heart (h). In panels A–D the anterior end of each tadpole is on the right side of the image, marked (a). (E) Section of a tadpole eye expressing GFP under control of Prph21.2. Within the retina, GFP expression was seen in the photoreceptor or outer nuclear layer (onl), but not the inner nuclear layer (inl) or ganglion cell layer (gcl). (red ¼ wheat germ agglutinin, blue ¼ Hoechst 33342 nuclear stain). (F) Similar results were obtained with RCO-0.9, although low-level expression was occasionally observed in lens. At higher magnification, we observed Prph2-1.2-driven expression of GFP in photoreceptors of all rod and cone types (G), while RCO-0.9 drove expression only in cones (H) (red ¼ anti-rhodopsin, which labels rods but not cones). (I) Cones expressing GFP under control of RCO-0.9 were labeled by antibody cos-1 (red), which reacts with the X. laevis long-wavelength cone pigment (Rohlich et al., 1989). (J) In some transgenic retinas RCO-0.9driven expression varied dramatically among cells, allowing individual cones to be imaged. As previously shown for rods (Moritz et al., 1999) GFP was distributed throughout the cones, but was found at lower concentrations in outer segments (os) and the mitochondria-containing region (m) and was excluded from oil droplets (od). Inner segment ¼ is, synapse ¼ s. A–D bar ¼ 100 mm, G–I bar ¼ 30 mm, J Bar ¼ 10 mm.

180

O.L. Moritz et al. / Gene 298 (2002) 173–182

sion of GFP in the retinas of transgenic X. laevis (Fig. 4). The expression levels obtained were distributed over a broad range, as judged by fluorescence intensity when animals were observed using an epi-fluorescence microscope. However, expression levels did not approach the high levels often seen in rods using the X. laevis opsin promoter (Moritz et al., 1999, 2001b). In many tadpoles with high levels of ocular GFP expression we also observed GFP expression in non-ocular cell types. This non-ocular fluorescence was faint, and distributed throughout the muscular regions of the tadpoles, but was particularly well defined in the muscles of the jaw and heart (Fig. 4). Prominent non-ocular GFP was also associated with the highest levels of ocular GFP, and therefore this expression pattern may have existed in all animals, with levels below the detection limits in non-ocular tissues in some of the tadpoles. Although we have previously observed occasional ectopic expression of GFP when using the X. laevis opsin promoter (Moritz et al., 1999), the distribution of the ectopic GFP was not consistent as it was in this case. Because of the recurrent non-ocular expression we obtained with Prph2-1.2, we wondered if a longer promoter fragment would give greater cell specificity, and drive expression only in the eye. Therefore, we used a longer fragment (Prph2-2.0) for transgenesis, and compared the results to those obtained with Prph2-1.2. No identifiable differences were seen in GFP localization patterns or expression levels between animals generated using the two different constructs. Although this suggested that Xrds38 might be expressed at low levels in muscle, we were unable to obtain any corroborating evidence (see Section 3.6). We found that RCO-0.9 and RCO-0.5 were capable of driving expression of GFP in the retinas of transgenic X. laevis. Again, expression levels were distributed over a broad range, intermediate between that obtained with Prph2-1.2 and the X. laevis Rhodopsin promoter. In addition, we also observed expression of GFP within the pineal region of the brain in these animals (Fig. 4). Similar pineal expression is seen with the X. laevis Rhodopsin promoter. In animals with very high levels of expression, GFP fluorescence was also observed in other associated brain regions. Occasionally, ectopic GFP was observed in other tissues, but the distribution was not consistent. No significant differences were noted between animals generated using RCO-0.9 and RCO-0.5. Tadpoles that survived to 14 days post-fertilization (developmental stage 50) were sacrificed and their eyes were cryosectioned. Sections were labeled with TR-WGA, which labels glycosylated membranes including photoreceptor Golgi, plasma, and outer segment membranes (Moritz et al., 2001a), monoclonal antibody mabE, which labels the opsin of the principal rod photoreceptors of the X. laevis retina (Witt et al., 1984), or monoclonal antibody cos1, which labels the principal (red) cones (Rohlich et al., 1989). Nuclei were counter-stained with Hoechst 33342.

Sections were examined by conventional and confocal fluorescence microscopy. Within the eye, we found that Prph2-1.2 drove expression in both rods and cones, but not other cell types (Fig. 4). This was in contrast to the X. laevis Rhodopsin promoter, which only drives expression in rod photoreceptors and pinealocytes (Knox et al., 1998). Within the eye, we found that the RCO promoter fragments RCO-0.9 and RCO-0.5 drove expression of GFP in both the cones of the photoreceptor layer and occasionally in the central region of the lens (juvenile lens) (Fig. 4). However, the expression levels in the lens were generally low relative to cone photoreceptor expression levels. Within the retina, GFP expression was restricted to cones. Cones that expressed GFP were also labeled by monoclonal antibody cos-1, indicating that GFP was expressed in the principal cone type (Rohlich et al., 1989). We did not identify any GFP-expressing cones whose outer segments did not label with cos-1. As with the X. laevis opsin promoter (Moritz et al., 1999), we frequently observed transgenic retinas with mosaic expression patterns, in which only a small subset of cones expressed GFP. This was most likely due to transgene position effects (Moritz et al., 2001b), and allowed us to image individual cones by fluorescence microscopy (Fig. 4). 3.6. RT-PCR analysis To determine whether the Prph2-1.2 and Prph2-2.0driven expression of GFP in heart and skeletal muscle was an artifact or reflected an actual extra-retinal distribution of Xrds38, we performed RT-PCR on samples of normal X. laevis retina and heart RNA. A strong band of the anticipated size was obtained from retina RNA (Fig. 5), but no signal was obtained from heart RNA, indicating that significant levels of Xrds38 mRNA were not present in heart tissue. Similarly, we were unable to detect Xrds38 (or peripherin-2) protein in western blot studies of both X. laevis and rat heart tissue (not shown). 4. Discussion Using a PCR-based cloning method, we obtained two novel promoters for X. laevis retina-specific genes RCO and Prph2. Perhaps because of the tetraploid X. laevis genome, relatively few X. laevis promoter sequences have been cloned. Researchers working with transgenic X. laevis, or other transgenic systems, could use this procedure to obtain useful promoters. Importantly, the procedure is rapid, highly specific, and requires few resources, as there is no need to construct a plasmid- or phage-based genomic library. The time between experimental design and characterization of transgene expression can be extremely short. The promoter sequences we obtained share only limited similarity with known homologues. Evolutionarily conserved regions are likely to be important features of a promoter, such as transcription factor binding sites. We

O.L. Moritz et al. / Gene 298 (2002) 173–182

Fig. 5. Endogenous Xrds38 mRNA is not detectable in heart tissue. (A) RTPCR analysis of retina and heart RNA using primers designed to amplify a 956 bp fragment of the Xrds38 cDNA. RT-PCR was carried out as described in Section 2 using oligo-dT primed cDNA templates, and analyzed on a 1.5% agarose gel. cDNA templates were generated using total RNA from X. laevis retina (R), heart (H), or no RNA (N), and in the presence (1) or absence (2) of RT. RT-dependent products were only obtained from retina. (B) RNA used for cDNA synthesis was checked for integrity on a 1.5% agarose gel. 18S and 28S ribosomal RNA bands are clearly visible, indicating that both RNA samples were of good quality.

identified several conserved sequences that may be binding sites for the retina-specific transcription factors Crx and Rx within the RCO promoter. Although we did not test any specific regions to determine their importance for promoter activity in this study, transgenic X. laevis are an excellent system for examining these problems (Mani et al., 1999; Liu and Green, 2001). In contrast, the lack of conserved consensus binding sites for retina-specific transcription factors in the Prph2 promoter suggests that it acts via novel mechanisms. Unexpectedly, we frequently obtained very low levels of transgene expression in muscle tissue using the Prph2 promoter. Xrds38 is present at the highly curved photoreceptor outer segment disk rim, and may have a role in generating or maintaining this unusual structure. Conceivably, Xrds38 (or an evolutionarily related protein) could be involved in maintaining a similar structure in muscle, such as the curvature of the sarcoplasmic reticulum. However, we were unable to find any evidence for extra-occular Xrds38 mRNA or protein. If Xrds38 is expressed in X. laevis heart, it is at a level below our limits of detection. We were also unable to detect the Xrds38 homologue Peripherin-2 in rat heart by western blot (not shown). As this is the first report of gene expression using a Prph2 promoter from any species, it is not clear whether this expression pattern is a unique property of the X. laevis promoter, or a feature of Prph2 promoters in general.

181

The pseudo-tetraploid X. laevis genome results in complex genetics. Many genes are present in multiple copies, some of which may be non-functional, or may have diverged in sequence and function. There are at least three functional Prph2 homologues in X. laevis (Kedzierski et al., 1996), while humans have only one; it is not known whether multiple RCO gene copies are present. Nevertheless, our primary purpose in this study was not to fully characterize these genes but to identify useful promoters as tools for working with transgenic X. laevis. It is possible that other RCO genes and promoters are present in the X. laevis genome. In combination with the X. laevis opsin promoter, the Prph2 and RCO promoters allow expression of transgenes in rods, cones or both rods and cones of transgenic X. laevis. These sequences should allow us to test the effects of transgenes encoding anti-apoptotic proteins on cone survival in previously developed X. laevis models of retinal degeneration. In addition, the RCO promoter will allow us to develop cone degeneration models in which toxic gene products are expressed in cones. Finally, retinas expressing GFP in cones will provide a useful means of monitoring the health of cones non-invasively, as individual fluorescent photoreceptors can be imaged in vivo using a fluorescence microscope (Moritz et al., 1999). Acknowledgements Due to space limitations, some references have been eliminated. Confocal microscopy facilities were provided by the UCHC Center for Biomedical Imaging Technology. The authors would like to thank Dr David S. Papermaster for helpful discussions, and Ms Tricia Clarke for technical assistance. This research was supported by EY-6891 from the National Eye Institute and the Foundation Fighting Blindness. References Batni, S., Scalzetti, L., Moody, S.A., Knox, B.E., 1996. Characterization of the Xenopus rhodopsin gene. J. Biol. Chem. 271, 3179–3186. Boatright, J.H., Knox, B.E., Jones, K.M., Stodulkova, E., Nguyen, H.T., Padove, S.A., Borst, D.E., Nickerson, J.M., 2001. Evidence of a tissuerestricting DNA regulatory element in the mouse IRBP promoter. FEBS Lett. 504, 27–30. Chang, W.S., Harris, W.A., 1998. Sequential genesis and determination of cone and rod photoreceptors in Xenopus. J. Neurobiol. 35, 227–244. Chen, S., Wang, Q.L., Nie, Z., Sun, H., Lennon, G., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., Zack, D.J., 1997. Crx, a novel Otx-like paired-homeodomain protein, binds to and transactivates photoreceptor cell-specific genes. Neuron 19, 1017–1030. Cheng, T., al Ubaidi, M.R., Naash, M.I., 1997. Structural and developmental analysis of the mouse peripherin/rds gene. Somat. Cell Mol. Genet. 23, 165–183. Connell, G., Bascom, R., Molday, L., Reid, D., McInnes, R.R., Molday, R.S., 1991. Photoreceptor peripherin is the normal product of the gene responsible for retinal degeneration in the rds mouse. Proc. Natl. Acad. Sci. USA 88, 723–726.

182

O.L. Moritz et al. / Gene 298 (2002) 173–182

DesJardin, L.E., Hauswirth, W.W., 1996. Developmentally important DNA elements within the bovine opsin upstream region. Invest. Ophthalmol. Vis. Sci. 37, 154–165. Furukawa, T., Morrow, E.M., Cepko, C.L., 1997. Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell 91, 531–541. Kawamura, S., Yokoyama, S., 1993. Molecular characterization of the red visual pigment gene of the American chameleon (Anolis carolinensis). FEBS Lett. 323, 247–251. Kedzierski, W., Moghrabi, W.N., Allen, A.C., Jablonski-Stiemke, M.M., Azarian, S.M., Bok, D., Travis, G.H., 1996. Three homologs of rds/ peripherin in Xenopus laevis photoreceptors that exhibit covalent and non-covalent interactions. J. Cell Sci. 109, 2551–2560. Knox, B.E., Schlueter, C., Sanger, B.M., Green, C.B., Besharse, J.C., 1998. Transgene expression in Xenopus rods. FEBS Lett. 423, 117–121. Kroll, K.L., Amaya, E., 1996. Transgenic Xenopus embryos from sperm nuclear transplantations reveal FGF signaling requirements during gastrulation. Development 122, 3173–3183. Kumar, R., Chen, S., Scheurer, D., Wang, Q.L., Duh, E., Sung, C.H., Rehemtulla, A., Swaroop, A., Adler, R., Zack, D.J., 1996. The bZIP transcription factor Nrl stimulates rhodopsin promoter activity in primary retinal cell cultures. J. Biol. Chem. 271, 29612–29618. Lerner, L.E., Gribanova, Y.E., Ji, M., Knox, B.E., Farber, D.B., 2001. Nrl and Sp nuclear proteins mediate transcription of rod-specific cGMPphosphodiesterase beta-subunit gene: involvement of multiple response elements. J. Biol. Chem. 276, 34999–35007. Liu, X., Green, C.B., 2001. A novel promoter element, photoreceptor conserved element II, directs photoreceptor-specific expression of nocturnin in Xenopus laevis. J. Biol. Chem. 276, 15146–15154. Ma, J., Norton, J.C., Allen, A.C., Burns, J.B., Hasel, K.W., Burns, J.L., Sutcliffe, J.G., Travis, G.H., 1995. Retinal degeneration slow (rds) in mouse results from simple insertion of a t haplotype-specific element into protein-coding exon II. Genomics 28, 212–219. Mani, S.S., Besharse, J.C., Knox, B.E., 1999. Immediate upstream sequence of arrestin directs rod-specific expression in Xenopus. J. Biol. Chem. 274, 15590–15597. Mathers, P.H., Grinberg, A., Mahon, K.A., Jamrich, M., 1997. The Rx homeobox gene is essential for vertebrate eye development. Nature 387, 603–607. Moritz, O.L., Tam, B.M., Hurd, L.L., Peranen, J., Deretic, D., Papermaster,

D.S., 2001a. Mutant rab8 impairs docking and fusion of Rhodopsinbearing post-Golgi membranes and causes cell death of transgenic Xenopus rods. Mol. Biol. Cell 12, 2341–2351. Moritz, O.L., Tam, B.M., Knox, B.E., Papermaster, D.S., 1999. Fluorescent photoreceptors of transgenic Xenopus laevis imaged in vivo by two microscopy techniques. Invest. Ophthalmol. Vis. Sci. 40, 3276–3280. Moritz, O.L., Tam, B.M., Papermaster, D.S., Nakayama, T., 2001b. A functional rhodopsin-green fluorescent protein fusion protein localizes correctly in transgenic Xenopus laevis retinal rods and is expressed in a time-dependent pattern. J. Biol. Chem. 276, 28242–28251. Moses, K., Rubin, G.M., 1991. Glass encodes a site-specific DNA-binding protein that is regulated in response to positional signals in the developing Drosophila eye. Genes Dev. 5, 583–593. Papermaster, D.S., 1995. Necessary but insufficient. Nat. Med. 1, 874– 875. Riggs, C.D., Taylor, J.H., 1987. Sequence organization and developmentally regulated transcription of a family of repetitive DNA sequences of Xenopus laevis. Nucleic Acids Res. 15, 9551–9565. Rohlich, P., Szel, A., Papermaster, D.S., 1989. Immunocytochemical reactivity of Xenopus laevis retinal rods and cones with several monoclonal antibodies to visual pigments. J. Comp. Neurol. 290, 105–117. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: a Laboratory Manual. 2nd Edition. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Shastry, B.S., 1994. Retinitis pigmentosa and related disorders: phenotypes of rhodopsin and peripherin/RDS mutations. Am. J. Med. Genet. 52, 467–474. Siebert, P.D., Chenchik, A., Kellogg, D.E., Lukyanov, K.A., Lukyanov, S.A., 1995. An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res. 23, 1087–1088. Swaroop, A., Xu, J.Z., Pawar, H., Jackson, A., Skolnick, C., Agarwal, N., 1992. A conserved retina-specific gene encodes a basic motif/leucine zipper domain. Proc. Natl. Acad. Sci. USA 89, 266–270. Tam, B.M., Moritz, O.L., Hurd, L.B., Papermaster, D.S., 2000. Identification of an outer segment targeting signal in the COOH terminus of rhodopsin using transgenic Xenopus laevis. J. Cell Biol. 151, 1369– 1380. Witt, P.L., Hamm, H.E., Bownds, M.D., 1984. Preparation and characterization of monoclonal antibodies to several frog rod outer segment proteins. J. Gen. Physiol. 84, 251–263.