- Email: [email protected]
XenopusCRMP-2 is an early response gene to neural induction
Molecular Brain Research 57 Ž1998. 201–210
Research report
Xenopus CRMP-2 is an early response gene to neural induction Tohru Kamata
a,)
, Ira O. Daar b, Marianne Subleski a , Terry Copeland c , Hsiang-fu Kung d , Ren-He Xu a a
c
IRSP, SAIC r Frederick, NCI-FCRDC, Frederick, MD 21702-1201, USA b LLB, DBS, NCI-FCRDC, Frederick, MD 21702-1201, USA Protein Chemistry, ABL-Basic Research Program, NCI-FCRDC, Frederick, MD 21702, USA d LBP, DBS, NCI-FCRDC, Frederick, MD 21702-1201, USA Accepted 17 March 1998
Abstract A neural specific protein, CRMP-2 Žfor Collapsin Response Mediator Protein-2., is considered to mediate collapsin-induced growth cone collapse during neural development. We have isolated the Xenopus homologue of the CRMP-2 ŽXCRMP-2. cDNA and studied the expression of XCRMP-2 mRNA and protein during neural induction. Induction of XCRMP-2 mRNA and protein expression, like N-CAM, occurred at the midgastrula stage and increased through early neural developmental stages. Whole mount in situ hybridization demonstrated that expression of XCRMP-2 mRNA was localized in neural tissues such as the neural plate and tube at early stages, while its expression in the brain, spinal cord, and eyes was observed at later stages. Immunostaining of Xenopus embryos with the antibody against CRMP-2 also showed that the protein was specifically expressed in the neural tissues at early stages. XCRMP-2 expression was induced by neural inducers such as noggin and chordin which antagonize a neural inhibitor, BMP4. A dominant negative BMP receptor also induced XCRMP-2 expression, suggesting that transcription of XCRMP-2 gene was negatively regulated by the BMP4 signaling. These results indicate that expression of XCRMP-2 is an early response marking neural commitment, and that transcriptional control of XCRMP-2 gene, is one of the targets of BMP4 signaling. q 1998 Elsevier Science B.V. All rights reserved. Keywords: Xenopus; XCRMP-2 gene; Neural induction
1. Introduction Neurons extend axons along specific pathways to find their right targets during neural development. Axon growth appears to be guided by the family of molecules including cell surface, membrane-bound, and soluble factors. The identification and characterization of molecules involved in transducing axon guidance signals would be essential to understand the mechanism of neural network formation. We have recently isolated a neural specific protein, Collapsin Response Mediator Protein-2 ŽCRMP-2. w5,28x from bovine brain w14x, and DNA sequence analysis revealed that the protein is highly homologous Ž97% identity., to rCRMP-2 of the rat CRMP gene family w14x. This gene family consists of rCRMP-1, rCRMP-2, rCRMP-3,
) Corresponding author. Bldg. 567, Rm. 152, Laboratory of Biochemical Physiology, NCI-FCRDC, Frederick, MD 21702-1201, USA. Fax: q1-301-846-6863; E-mail: [email protected]
0169-328Xr98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 9 - 3 2 8 X Ž 9 8 . 0 0 0 8 2 - 5
and rCRMP-4, all of which have 70–79% sequence identity to each other w28x. rCRMP-2 and rCRMP-4 are identical to the previously identified TOAD-64 w19x and rUlip w1x genes, respectively, and the chicken homologue of rCRMP-2 is CRMP-62 w5x. Although selectively expressed in neural tissues, rCRMP mRNAs show different temporal and spatial expression patterns w28x. CRMP-2rTOAD-64 is expressed in most neurons at early stages in development. For example, it is specifically detectable in both the central and peripheral nervous system in rat or mice and is localized in the axon, dendrite and cytoplasm of differentiating neurons w5,14,19,28x. As for the functional role, CRMP-62, a chicken homologue of CRMP-2 was shown to mediate the action of collapsin, a chemotactic factor of the semaphorin family, which directs developing neuronal axons by collapsing the growth cone w5x. Furthermore, CRMP-2 has sequence homology to Caenorhabditis elegans unc-33, a gene controlling the guidance and growth of neuronal axons in nematodes w16x. Genetic studies demonstrated that a mutation in unc-33
202
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
caused severely uncoordinated movement and abnormal elaboration of axons w9x. These observations suggest that CRMP-2 may play an important role in axonal guidance and growth of developing neurons in vertebrates. While the regulatory mechanism of CRMP-2 function remains unknown, it has been proposed that CRMP-2 is an element of the multimeric receptor complex that couples collapsinbinding transmembrane receptors to the signaling pathways w5x. Our study implicates the possible involvement of a serine protein kinaseŽs. in the control of CRMP-2 activity, because serine residues of CRMP-2 in PC12 cells were phosphorylated both in vivo and in vitro w14x. In view of the ample information available on the cellular and molecular aspects of Xenopus early development, the Xenopus system appears to be suitable for investigating the involvement of cellular molecules in neurogenesis. The amphibian nervous system arises during gastrulation. A portion of the ectoderm receives an inductive signal from dorsal mesoderm and consequently initiates neural development. Recent studies have dissected the signaling pathways involving several neural inducers, and three secreted factors Žnoggin, chordin, and follistatin. have been shown to initiate neural induction and mesoderm dorsalization in Xenopus embryos Žreviewed by Tanabe and Jessell, w27x.. Noggin and chordin w22,30x antagonize signaling from bone morphogenic protein 4 ŽBMP4. by blocking binding to its receptor and thereby cause neuralization of ectoderm. Since disruption of the BMP4 signaling results in neuralization, BMP4 is considered as a physiological neural inhibitor as well as a potent ventralizing factor for mesoderm patterning w3,8,13,25,29x. It is assumed that the early stages of neural tissue formation require new gene expression in response to the neuralization signals triggered, in part, by the above mechanism. Thus far, few neural specific proteins have been identified that are expressed at the initial stage of neural development. Among them, two cell adhesion molecules, neural cell adhesion molecule ŽN-CAM. w12x and N-cadherin w26x are expressed between blastula and neurula stage of Xenopus embryo and are believed to mediate cell–cell interactions critical for morphogenesis during neural development. In order to investigate the role of CRMP-2 during neural induction, we focused our attention on the expression and regulation of CRMP-2 in neurogenesis of Xenopus embryos as a model system. The results of this report indicate that CRMP-2 mRNA synthesis begins during gastrulation, followed by the onset of CRMP-2 protein synthesis at the early neural plate stage. Both RNA and protein levels increase through subsequent neural developmental stages. CRMP-2 expression is localized to neural tissues including the neural plate and neural tube. Moreover, there is induction of CRMP-2 expression in response to neural inducers such as noggin and chordin which antagonize the BMP4-signaling. From these findings, we conclude that CRMP-2 expression is an event marking the early stages
of neural induction in Xenopus embryos and is regulated by the BMP4-signaling pathway.
2. Materials and methods 2.1. Isolation of Xenopus CRMP-2 cDNAs Xenopus CRMP-2 ŽXCRMP-2. cDNAs were isolated by screening an adult frog brain lgt10 cDNA library Ža kind gift from Dr. I. Dawid. with a bovine CRMP-2 cDNA fragment ŽpB12a. by the protocol described previously w14x. Hybridization and washing were performed under low-stringency conditions. Five positive phage clones were isolated and cDNA inserts were subcloned into pBluescript SK ŽStratagene. and sequenced on both strands by the Sequenase kit ŽU.S. Biochemical.. One partial length clone contained a 2.5-kb cDNA insert yielding an open reading frame for XCRMP-2, which encompasses 563 amino acids, but lacked a small portion of amino terminus. 2.2. Analysis of XCRMP-2 transcription leÕel RNA from Xenopus embryo at various stages was extracted in Trizol ŽGibco-BRL. and primed with either oligo ŽdT. 16 mers or random hexamers with murine leukemia virus reverse transcriptase ŽGibco-BRL.. To process the synthesized cDNAs for PCR, primers for XCRMP-2 were designed to generate 1.6 kb of the XCRMP-2 cDNA: forward, 5X-AAGAGCGATCGGCTACTCATT corresponding to KSDRLLIK; reverse, 5XGCGGAGGTGGTAATGTTGGCA corresponding to CQHYHLR. Reactions were performed in PCR buffer containing 20 pmol of primers and 1 m Ci of w a y32 PxdCTP Ž3000 Cirmmol Amersham. and underwent 30 cycles of 948C for 45 S, 558C for 1 min, and 728C for 1 min. Reaction products were analyzed by 1% agarose gel electrophoresis, followed by autoradiography. 2.3. RNA synthesis Capped mRNAs were generated from the appropriate DNA templates using an in vitro transcription kit ŽAmbion. as described previously w29x. Noggin, chordin, BMP4 and dominant negative BMP receptor cDNAs were inserted into the pSP64TEN plasmid vector Ža kind gift from Dr. D. Melton. for transcription using SP6 promoter. 2.4. In situ hybridization Digoxigenin labeled probes were produced from XCRMP-2 cDNA that was inserted into the EcoRI site of a Bluescript SK vector. The plasmid was linearized with NotI and transcribed with T7 polymerase to produce an antisense riboprobe. Sense riboprobes were produced by
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
linearizing the plasmid with HindIII and transcription with T3 polymerase. Whole mount in situ hybridization was essentially done as described by Harland w7x. Briefly, embryos were derived from in vitro fertilization of albino eggs with albino sperm, then fixed in MEMFA buffer Ž0.1 M MOPS ph 7.4, 2 mM EGTA, 1 mM MgSO4 , and 3.7% formaldehyde., dehydrated in 100% methanol and stored at y208C until use. Embryos were treated with 100% ethanol overnight, then rehydrated in successive 5-min washes with 100% methanol, 75% methanol, 50% methanol, and 25% methanolr75% PTW ŽPhosphate buffered saline 7.4, and 0.1% Tween-20., 100% PTW. No proteinase K treatment was applied, and four 5-min washes in 0.1 M triethanolamine pH7.5 were performed. The last two washes included 12.5 ul of acetic anhydride. Four washes in PTW were performed and embryos were prehybridized in 1 ml of hybridization buffer Ž50% formamide, 5 = SSC, 1 mgrml Torula RNA, 100 ugrml heparin, 1 = Denhardts, 0.1% Tween-20, 0.1% CHAPS, 10 mM EDTA. for 6 h at 608C. This solution was replaced with 0.5 ml of hybridization solution containing 1 ugrml of digoxigenin labeled antisense or sense RNA and incubated overnight at 608C. The embryos were washed three times in 2 = SSC at 608C for 20 min each, then washed once in 2 = SSC containing RNAse A Ž20 ugrml., RNAse T1 Ž10 unitsrml. at 378C for 30 min. Embryos were washed extensively in 0.2 = SSC at 608C, then maleic acid buffer wMabx Ž100 mM maleic acid, 150 mM NaCl ph 7.5. at room temperature. Non-specific antibody binding sites were blocked with Mab containing 2% BMB blocking reagent and 20% heat inactivated lamb serum for 2 h at room temperature. This solution was replaced with Mab Žwith 2% BMB block and 20% lamb serum. containing a 1:2000 dilution of affinity purified sheep anti-digoxigenin antibody coupled to alkaline phosphatase and incubated overnight at 48C. After five washes over 5 h in Mab the embryos were washed in alkaline phosphatase buffer Ž100 mM Tris pH 9.5, 50 mM MgCl 2 , 100 mM NaCl, 0.1% Tween-20, 5 mM levamisol.. Embryos were placed in the BM-Purple ŽBoehringer Mannheim. chromogenic substrate with 2 mM levamisole for 3 h at room temperature. The reaction was stopped and the embryos fixed in Bouin’s stain Ž1 g picric acid in 3.7% formaldehyde, 5% acetic acid. overnight. Background was removed by several washes in 70% buffered ethanol ŽpH 7.5.. Then embryos were cleared with benzyl benzoaterbenzyl alcohol Ž2:1.. Photographs were taken under a dissecting microscope ŽZeiss SV6. with MC-80 camera ŽZeiss..
203
thetic RNA. For animal cap explant assay, animal caps were dissected from injected embryos at stage 8.5–9 and cultured in 67% Leibovitz’s L-15 medium, pH 7.5 as described previously w29x. The explants were harvested at equivalent of stage 24 for assay of cell differentiation using molecular markers. 2.6. Immunoblotting Frog adult brain or embryonic tissues were homogenized in solubilization buffer Ž20 mM Tris–Cl, pH 7.5, 1 mM DTT, 1 mM EDTA, 0.5% NP-40, 10 m grml leupeptin, and 10 m grml pepstatin A. by passing through a needle and the homogenates were spun at 100,000 = g for 10 min at 48C. The resulting supernatant was subjected to sodium dodcyl sulfate ŽSDS.-10% polyacrylamide gel electrophoresis ŽPAGE. and the blots were probed with the rabbit anti-CRMP-2 antibody N17 which was raised against a peptide from residues 1 to 17 of bovine CRMP-2 as described w14x. Protein bands were visualized by ECL ŽAmersham.. 2.7. Detection of molecular marker RNA from animal cap explants was extracted as mentioned above. Oligonucleotides for N-CAM and EF1-a were designed and the condition for RT-PCR was standardized as described by Hemmati-Brivanlou and Melton w11x. Primers for XCRMP-2 were designed to generate about 300 bp of the XCRMP-2 cDNA coding region as follows: forward, 5X-GGAGAACATGGTTCACACTA and reverse, 5X-TGCAGCATTTGTACTGGTGAC. 2.8. Immunohistochemistry and histology Whole mount staining of embryos was performed as described previously w10x. CRMP-2 in embryos was stained with the rabbit anti-CRMP-2 antibody ŽN17.. Immunostaining of PC12 cells were performed according to the manufacturer’s protocol ŽVector.. PC12 cells were treated with nerve growth factor ŽNGF. Ž50 ngrml. for 48 h. Differentiated PC12 cells were washed with PBS plus 0.05% Tween20, fixed with 5% acetic acid in methanol at y208C for 1 h, and blocked with 4.5% normal goat serum prior to incubation with the rabbit anti-CRMP-2 antibody N17 Ž1:10,000.. CRMP-2 immunoreactivity was visualized using peroxidase vectastain kit ŽVector. with DAB as chromogen.
2.5. Embryos and microinjections
3. Results
Xenopus laeÕis embryos were obtained and cultured as previously described w29x. Developmental stages were determined as described by Nieuwkoop and Faber w21x. Each blastomere at the 2-cell stage was injected with the syn-
3.1. Expression of CRMP-2 in Xenopus embryos In order to study the functional role of CRMP-2 in early Xenopus embryos, we first identified the Xenopus CRMP-2
204
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
gene. Since the full length bovine CRMP-2 cDNA was isolated in our previous study w14x, we screened a Xenopus adult brain cDNA library with a bovine CRMP-2 cDNA fragment under conditions of low stringency. A 2.5-kb cDNA clone, which contains an open reading frame coding for 560 amino acids, was isolated ŽFig. 1.. Motif analysis indicates that the Xenopus cDNA lacks a signal peptide, a transmembrane domain or any catalytic domain of known
enzymes, while it contains consensus sites for serine, threonine, and tyrosine phosphorylation, as does bovine CRMP-2 w14x. Amino acid alignment of the cDNA with other genes shows the extensive homology with bovine CRMP-2 Ž89% identity., rCRMP-2rTOAD-64 w19x Ž89% identity., and chicken CRMP-62 Ž88% identity.. CRMP-62 was suggested to mediate the intracellular cascade triggered by collapsin w5x. It is noteworthy that the Xenopus
Fig. 1. Amino acid alignments of XCRMP-2 and CRMP-related proteins. A partial length XCRMP-2 cDNA of 2.5 kb contained an open reading frame encompassing 563 amino acids, but the NH 2 -terminus has not been assigned yet. The amino acid sequence of XCRMP-2 was aligned with the corresponding amino acid sequences of bovine CRMP-2, chicken CRMP-62, rat TOAD-64, rCRMP-1, rCRMP-2, rCRMP-3, rCRMP-4, Ulip and C. elegans unc-33. Dots indicate that the amino acids are identical. The solid lines indicate gaps in the alignment. The numbers are counted from each NH 2 -terminus of bCRMP-2, CRMP62, ULIP, rCRMP-1, rCRMP-2, rCRMP-3, and rCRMP-4. Homology comparison were performed using the BLAST system.
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
cDNA is 36% identical to C. elegans unc-33 over the entire region. Unc-33 has been proposed to play a role in axonal guidance and growth in C. elegans, and animals carrying the mutated gene are paralyzed and are defective in neuritic outgrowth and guidance w9,16x. The Xenopus cDNA also shares sequence homology with rCRMP-1 Ž72% identity., rCRMP-3 Ž72% identity. and rCRMP4rUlip w1x Ž76% identity. of the rat CRMP gene family w28x. Interestingly, a region of 34 amino acids corresponding to the domain from residues 386 to 419 in bovine CRMP-2 is highly conserved among species ŽFig. 1.,
205
suggesting its functional importance. Based on its high degree of homology with CRMP-2 homologues of bovine and other species, we believe the obtained cDNA encodes a Xenopus CRMP-2 ŽXCRMP-2.. Upon aligning CRMP-2 sequence to other homologous vertebrate genes, it appears that 12 amino acids at the NH 2-terminus of XCRMP-2 is still missing and the isolation of the full length XCRMP-2 is in progress. XCRMP-2 is also 72%, 72%, and 73% identical to human dihydropyrimidinase-related protein-1, -2, and -3 isolated from human brain w6x. Currently, the biological significance of this similarity is unknown, however, the function of XCRMP-2 is likely to be well conserved throughout evolution. To examine the expression of CRMP-2 mRNA in frog embryos, the mRNA level was determined by RT-PCR. cDNAs prepared from total RNA of embryos at various stages were used in PCR reactions utilizing sense and antisense primers derived from the XCRMP-2 cDNA. The XCRMP-2 transcript was not expressed in the egg, but was first detected at midgastrula Žstage 11. ŽFig. 2A.. The increased level of transcription was detectable as the embryo developed further during neurula stage Žstage 14. through tailbud stage Žstage 37.. This indicates that XCRMP-2 transcripts are not present as maternal RNA, but appear during gastrulation. Immunoblotting studies demonstrated that the antibody to bovine CRMP-2 recognized XCRMP-2 with a molecular weight of 60 kd in Xenopus adult brains ŽFig. 2B.. In immunoblotting analyses of early embryos at various stages, the XCRMP-2 protein was first detected around the early neural plate stage Žst 13. at the low level and its expression level increased at later stages ŽFig. 2B.. Thus, the expression pattern of XCRMP-2 protein correlated well with that of XCRMP-2 mRNA.
3.2. In situ hybridization analysis of XCRMP-2 expression in Xenopus embryonic stages
Fig. 2. Expression of XCRMP-2 mRNA and proteins. ŽA. Total RNA was prepared from eggs, midgastrula Žstage 11., neural plate stage Žstage 14., late tailbud stage Žstages 27. and tadpole stage Žstage 37. embryos. The mRNA levels of XCRMP-2 were analyzed by RT-PCR ŽSee Section 2.. A 1.6-kb cDNA fragment was generated. The amount of RNA was quantitated by ethidium bromide staining of 28 s and 18 s rRNA. ŽB. Indicated amounts of cytoplasmic extracts prepared from eggs, midgastrula Žstage 11., late tailbud stage Žstage 27., and adult frog brain ŽAd. were loaded onto SDS-10% PAGE and immunoblotted with the antiCRMP-2 antibody N17.
To determine the temporal and spatial localization of XCRMP-2 mRNA, the pattern of expression in whole embryos from gastrula to swimming tadpole stages were examined by in situ hybridization. Digoxigenin-labeled antisense and sense RNA probes were hybridized with embryos throughout development and stained with a chromogenic substrate. During blastula Žnot shown. and early gastrula stages, no hybridization was detected ŽFig. 3A.. Hybridization begins to be detected at the neural plate stage Žstage 13.. The sensorial layer of the neuroectoderm has become several cell layers thick laterally, while the center notoplate remains thin. Strong staining is visualized along the neural plate with only weak diffuse staining past the lateral border of the neural plate ŽFig. 3B.. At stage 18, the neural tube is closing and the axial mesoderm differentiates asynchronously along the A–P axis. The presump-
206
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
Fig. 3. Localization of XCRMP-2 mRNA in Xenopus embryos. Whole mount in situ hybridization of Xenopus embryos with digoxigenin-labeled XRMP-2 antisense RNA reveals expression of XCRMP-2 transcripts during neurulation. Stages according to Nieuwkoop and Faber w21x refer to ŽA. early gastrula Žstage 10., ŽB. early neural plate Žstage 13., ŽC. midneurula Žstage 16., ŽD. late neurula Žstage 20., ŽE. lateral view of early tailbud Žstage 23., ŽF. dorsal view of early tailbud Žstage 23., ŽG. late tailbud Žstage 27., and ŽH. tadpole Žstage 36..
tive brain and neural tube are staining intensely ŽFig. 3C lateral view.. Staining of the presumptive epidermis has greatly diminished. At stage 20, the neural folds have fused and the brain is subdivided into the arch- and deuteroencephalon. The brain and spinal chord are showing intense hybridization and the neural folds are displaying strong staining ŽFig. 3D, dorsal view.. In stage 23 embryos, cephalic flexure has occurred and the brain is divided into the pros-, mes-, and rhombencephalon. The paraxial mesoderm is in the process of segmenting and the motor neuron axons invade the myotome. During this stage the entire central nervous system, including eyes are intensely stained ŽFig. 3E and F.. Somitic junctions are also staining positively for XCRMP-2 ŽFig. 3E, lateral view.. The stomodeal–hypophyseal anlage shows weaker expression than the brain and eye. Weak staining is also present surrounding the otic placodes and staining is absent from the anterior midline of the spinal chord ŽFig. 3F dorsal view.. At the tailbud stage, expression in the olfactory placodes and otic vesicles is more prominent. Staining of the branchial arches and cranial ganglia is apparent ŽFig. 3G.. In the swimming tadpole stage Žst. 36., there is continued high expression of XCRMP-2 in the spinal chord, brain and cranial nerves.
3.3. RT-PCR analysis of XCRMP-2 mRNA expression in neural tissues In another approach to examine XCRMP-2 mRNA expression at the neural fold, tissues were dissected from embryos at stage 17 and assayed for the presence of XCRMP-2 mRNA by using RT-PCR. As expected, neural fold tissues alone or dorsal mesoderm plus neural fold tissues expressed significant levels of XCRMP-2 transcripts, whereas dorsal mesoderm tissues, such as somite and notochord neighboring the neural fold expressed no detectable level of XCRMP-2 mRNA ŽFig. 4.. N-CAM, a general neural marker was also detected in the neural fold but not in the dorsal mesoderm. 3.4. Tissue distribution of XCRMP-2 protein in Xenopus embryos To determine where XCRMP-2 protein is localized in Xenopus early embryos, the distribution of XCRMP-2 was analyzed by whole-mount immunocytochemistry of embryos using the antibody directed against bovine CRMP-2. The antibody can specifically stain CRMP-2 localized in
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
207
peripheral nervous systems in mice w14x. When frog embryos at various stages were immunostained with the antibody, XCRMP-2 was undetectable in blastula embryos Žnot shown., and strong XCRMP-2 staining was detected in brain, spinal cord and eyes at tailbud stage Žstage 37. ŽFig. 5.. Taken together, these data demonstrate that consistent with in situ hybridization data, XCRMP-2 is specifically expressed in neural tissues during early neural development.
3.5. Expression of CRMP-2 following neural induction
Fig. 4. RT-PCR analysis of XCRMP-2 mRNA expression in neural tissues. The middle 1r3 of the dorsal tissue was excised from stage 17 embryos. The explants contained neural fold ŽNF. and dorsal mesoderm ŽDM. tissues such as notochord and somite. NF and DM were separated from some of the explants. Molecular markers were analyzed in NF, DM or NFqDM, using RT-PCR. Whole embryo ŽEmb. as a positive control was included. EFI-a expression indicates that comparable amounts of RNA were used in each set.
the neurite and cytoplasm of differentiated pheochromocytoma PC12 cells after NGF treatment Ždata not shown. and also recognized CRMP-2 expressed in both central and
BMP4 blocks both neuralization and mesoderm dorsalization, leading to epidermalization in the ectoderm and ventralization in the mesoderm w3,8,13,25,29x. In the current prevailing model of the neuralization mechanism, noggin and chordin are thought to induce neuralization by antagonizing the BMP4 signaling w22,30x. It is likely that the expression of XCRMP-2 in the neuroectoderm is an early consequence of neural induction in the ectoderm by prospective dorsal mesoderm. We therefore addressed the question of whether XCRMP-2 expression is induced after exposure of ectoderm explants to the above neural inducers. To this end, noggin, chordin, BMP4, or dominant negative BMP receptor mRNA was microinjected into the animal pole of 2-cell stage embryos. Animal caps were removed at blastula stage, cultured until the equivalent of neurula stage, and assayed for the presence of XCRMP-2 mRNA. The expression of XCRMP-2 was detected in parallel with the general neural marker, N-CAM, in animal caps injected with noggin and chordin, but not with BMP4 ŽFig. 6.. Furthermore, a dominant negative BMP receptor also induced the expression of both XCRMP-2 and N-CAM ŽFig. 6.. The results indicate that CRMP-2 expression occurs in ectoderm following neural induction by secreted
Fig. 5. Distribution of XCRMP-2 protein in Xenopus embryos. XCRMP-2 immunoreactivity in the central nervous system Žspinal cord and brain. in embryo at tadpole stage Žstage 37. was visualized by whole-mount staining with the anti-CRMP-2 antibody N17.
208
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
Fig. 6. Induction of XCRMP-2 expression by neuralizing molecules. The animal pole of 2-cell stage embryos was injected with RNAs encoding b-galactosidase Ž2 ng., noggin Ž0.2 ng., chordin Ž1.5 ng., BMP-4 Ž2 ng. and dominant negative BMP receptor ŽDN-BR. Ž1 ng.. Animal caps were explanted at blastula stage and cultured to stage 24 before harvest. RNAs were extracted and gene expression was analyzed by RT-PCR as described in Fig. 4.
neural inducers, consistent with its exclusive expression in the neural tissues of whole embryos ŽFigs. 3–5..
4. Discussion In this study, we have isolated and characterized a Xenopus CRMP-2 cDNA clone. Deduced amino acid sequence reveals that XCRMP-2 is highly homologous to CRMP-related proteins among various vertebrates. Particularly, XCRMP-2 is highly related to chicken CRMP-62 w5x, rat TOAD-64rrCRMP-2 w19,28x, and bovine CRMP-2 w14x. Previous studies suggested that CRMP-62 is an intracellular component necessary for collapsin-induced growth cone collapse during neuritic outgrowth and axonal guidance w5x, and that CRMP-2 is one of the proteins expressed at early stages of nervous system development in rat and mouse w14,19,28x. Furthermore, XCRMP-2 shares sequence homology to unc-33, a gene implicated in appropriate axonal guidance and growth of neurons in nematode w9,16x. Thus, it is likely that XCRMP-2 plays a similarly important role at the early stages of the development of the Xenopus nervous system. Previous studies suggested that CRMP-2rTOAD-64 has the broadest neural expression among the CRMP gene
family, and that expression of rat or mouse CRMP-2 mRNAs begins at embryonic day 11–12 and is detectable in the midbrain and developing cerebellum w14,19,28x. However, it is not known precisely when the transcription of the CRMP-2 gene starts and where this event occurs. Our data show that XCRMP-2 transcript first appeared at midgastrula stage and increased to tailbud stage, indicating the correlation between XCRMP-2 transcription and the developmental stage at which neural induction takes place. Since XCRMP-2 mRNA appears immediately after gastrulation begins, the activation of XCRMP-2 gene expression could be a very early response gene to neural induction signals. In situ hybridization analysis using XCRMP-2 probes revealed little or no staining from the blastula to early gastrula stages. XCRMP-2 mRNA expression is detected at the neural plate stage where strong staining along the neural plate is observed in regions that will later develop into various structures in the brain w4x. As development progresses, the anterior portions of the neural plate fated to become the fore- and mid-brain and eye show hybridization, while posterior hybridization was indicative of the future spinal cord w4x. While XCRMP-2 is a gene expressed early in neural induction, it is likely to have a role during the stages of neural development when activated neuroectoderm is transformed into various regions of the central nervous system Žst. 13.. One of the later inductive events results from an interaction between the notochord and neural tube that results in the development of certain neuroepithelial cells known as the floorplate. It has been shown that notochordless embryos lack floorplate cells, but have various neurons, although axon guidance is disorganized w2x. Further experiments will be necessary to determine the effect floorplate signals may have on XCRMP-2, a molecule that may be involved in axon guidance w5x. XCRMP-2 staining is observed along the neural folds during neurulation stages with accumulation in the anterior and posterior regions. XCRMP-2 has a very general expression pattern in the developing nervous system. While XCRMP-2 is almost neural specific, there is prominent expression in the myotomes even at tailbud stages. Whether XCRMP-2 has a role in myogenesis or motor axon migration is presently unclear. At later stages, XCRMP-2 expression can be found in the branchial arches derived from neural crest cells, which originate in the neural tube w24x. While XCRMP-2 is found in sensory structures derived from the neural tube, like the retina, it is also found in sensory structures derived from the placodes Žoptic vesicle and olfactory placode.. At later stages, XCRMP-2 mRNA is found to stain strongly in the telencephalon, diencephalon, mesencephalon, hindbrain and along the spinal cord. This pattern of expression is broader than that observed for collapsin w17,18,23x, indicating that XCRMP-2 may transduce signals other than those that emanate from collapsin. The antibody raised against bovine CRMP-2 first detected XCRMP-2 protein around early neural plate
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
stage, and its expression level increased parallel to that of XCRMP-2 mRNA. Immunostaining showed the specific localization of XCRMP-2 protein in the nervous system including spinal cord and brain, which is consistent with the distribution of XCRMP-2 mRNA in neural tissues as shown by in situ hybridization. As for a model for neurogenesis, it has been proposed that the initial stages of neural tissue formation require new gene products, and that new gene expression occurs as an immediate response to neural induction. The expression of many neural specific genes seems to begin relatively late in development. For example, neurofilament is first expressed after neural tube closure and is not expressed until after postmitotic neurons begin to elaborate axons and dendrites w20x. In contrast, N-CAM, which is thought to mediate cell–cell interactions essential for morphogenesis in neural tissue formation, is expressed early in neural development w26x. In this respect, it is noteworthy that the gene expression of XCRMP-2 occurs as early as midgastrula stage in Xenopus development. This suggests that XCRMP-2 expression could be one of the early responses to neural induction. Other research groups have reported that expression of the CRMP family does not begin until embryonic day ŽE. 7 in chicks, E11 in mice, or E12 in rats, when neurons are differentiating and extending processes w5,14,19x. The finding of early expression of XCRMP-2 at the time of neurulation is in marked contrast to the findings of these reports, and suggests that the genes probably play much different roles depending on the species or exert a undefined role in addition to that suggested for growth cone collapse. BMP4, that is widely expressed in the early ectoderm, represses neural differentiation w3,8,13,25,29x. It has been anticipated that neural tissue formation is induced by means of endogenous proteins that block signaling mediated by BMP4. Noggin and chordin are known to induce neural tissues directly in the absence of mesoderm w15,25x. Recently, these ligands have been shown to bind to BMP4 and thereby block the biological activity of BMP4, resulting in neural induction w22,30x. Our data demonstrate that transcription of XCRMP-2, like N-CAM, was activated by neural-inducing molecules, noggin and chordin that antagonize the action of BMP4. Furthermore, BMP4, a physiological neural inhibitor, was unable to induce XCRMP-2 expression, but the dominant negative BMP receptor induced XCRMP-2 expression. Thus, this observation suggests that the transcriptional control of XCRMP-2 gene is at least one of the targets of BMP4 signaling, although other pathways of BMP4 inhibition-independent regulation of XCRMP-2 transcription may also exist. In conclusion, we believe that XCRMP-2 is one of the candidates for genes expressed in early neural development and could be a primarily important component for the commitment to a neuronal phenotype. The availability of the XCRMP-2 cDNA will facilitate the functional study of CRMP-2 by using the Xenopus embryo system.
209
Acknowledgements We thank Dr. M. Taira for valuable discussion. We also thank Mrs. A. Rogers for preparation of this manuscript. This research was supported in part by the National Cancer Institute, NIH, DHHS under contract with ABL.
References w1x T. Byk, T. Dobransky, C. Cifuentes-Diaz, A. Sobel, Identification and molecular characterization of unc-33-like phosphoprotein ŽUlip., a putative mammalian homology of the axonal guidance-associated unc-33 gene product, J. Neurosci. 16 Ž1996. 688–701. w2x J.D. Clarke, N. Holder, S.R. Soffe, J. Storm-Mathisen, Neuroanatomical and functional analysis of neural tube formation in notochordless Xenopus embryos; laterality of the ventral spinal cord is lost, Development 112 Ž1991. 499–516. w3x L. Dale, G. Howes, B.M.J. Price, J.C. Smith, Bone morphogenetic protein 4: a ventralizing factor in early Xenopus development, Development 115 Ž1992. 573–585. w4x G.W. Eagleson, W.A. Harris, Mapping of the presumptive brain regions in the neural plate of Xenopus laeÕis, J. Neurobiol. 21 Ž1990. 427–440. w5x Y. Goshima, F. Nakamura, D. Strittmatter, S.M. Strittmatter, Collapsin-induced growth cone collapse mediated by an intracellular protein related to unc-33, Nature 376 Ž1995. 509–514. w6x N. Hamajima, K. Matsuda, S. Sakata, N. Tamaki, M. Sasaki, M. Nonako, A novel gene family defined by human dihydropyrimidinase and three related proteins with differential tissue distribution, Gene 180 Ž1996. 157–163. w7x R.M. Harland, in: B.K. Kay, H.B. Peng ŽEds.., Xenopus LaeÕis: Practical Uses in Cell and Molecular Biology, Academic Press, London Ž1991. pp. 685–695. w8x S.H.B. Hawley, K. Wunnenberg-Stapleton, C. Hashimoto, M.N. ¨ Laurent, T. Watabe, B.W. Blumberg, K.Y. Cho, Disruption of BMP signals in embryonic Xenopus ectoderm leads to direct neural induction, Genes Dev. 9 Ž1995. 2923–2935. w9x E.M. Hedgecock, J.G. Culotti, J.N. Thomson, L.A. Perkins, Axonal guidance mutants of Caenorhabditis elegans identified by filling sensory neurons with fluorescein dyes, Dev. Biol. 111 Ž1985. 158– 170. w10x A. Hemmati-Brivanlou, R.M. Harland, Expression of an engrailedrelated protein is induced in the anterior neural ectoderm of early Xenopus embryos, Development 106 Ž1989. 611–617. w11x A. Hemmati-Brivanlou, D.A. Melton, Inhibition of activin receptor signaling promotes neuralization in Xenopus, Cell 77 Ž1994. 273– 281. w12x T.M. Jessel, Adhesion molecules and the hierarchy of neural development, Neuron 1 Ž1988. 3–13. w13x C.M. Jones, K.M. Lyons, P.M. Lapan, C.V.E. Wright, B.L.M. Hogan, DVR-4 Žbone morphogenetic protein-4. as a posteriorventralizing factor in Xenopus mesoderm induction, Development 115 Ž1992. 639–647. w14x T. Kamata, M. Subleski, K. Hara, N. Yuhki, H.-F. Kung, N.G. Copeland, N.A. Jenkins, T. Yoshimura, W. Modi, T.D. Copeland, Isolation and characterization of a bovine neural specific protein ŽCRMP-2. cDNA homologues to unc-33, a C. elegans gene implicated in axonal outgrowth and guidance, Mol. Brain Res. 54 Ž1998. 219–236. w15x T.M. Lamb, A.K. Knecht, W.C. Smith, S.E. Stachel, A.N. Economides, N. Stahl, G.D. Yancopolous, R.M. Harland, Neural induction by the secreted polypeptide noggin, Science 262 Ž1993. 713–718. w16x W. Li, R.K. Herman, J.E. Shaw, Analysis of the Caenorhabditis
210
w17x
w18x
w19x
w20x
w21x w22x
w23x
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210 elegans axonal guidance and outgrowth, Genetics 132 Ž1992. 675– 689. Y. Luo, I. Shepherd, J. Li, M.J. Renzi, S. Chang, J.A. Raper, A family of molecules related to collapsin in the embryonic chick nervous system, Neuron 14 Ž1995. 1131–1140. E.K. Messersmith, E.D. Leonardo, C.J. Shatz, T.-L. Marc, C.S. Goodman, A.L. Kolodkin, Semaphorin III can function as a selective chemorepellent to pattern sensory projections in the spinal cord, Neuron 14 Ž1995. 949–959. J.E. Minturn, H.J.L. Fryer, D.H. Geschwind, S. Hockfield, TOAD-64, a gene expressed early in neuronal differentiation in the rat, is related to unc-33, a C. elegans gene involved in axon outgrowth, J. Neurosci. 15 Ž1995. 6757–6766. K. Nakahara, K. Ikenaka, T. Wada, T. Tamura, T. Furuichi, K. Mikoshiba, Structure of the 68-kDa neurofilament gene and regulation of its expression, J. Biol. Chem. 265 Ž1990. 19786–19791. P.D. Nieuwkoop, J. Faber, Normal Table of Xenopus LaeÕis, North-Holland Publishing, Amsterdam, 1967. S. Piccolo, B. Sasai, B. Lu, E.M. DeRobertis, Dorsoventral patterning in Xenopus: inhibition of ventral signals by direct binding of chordin to BMP-4, Cell 86 Ž1996. 589–598. A.W. Puschel, R.H. Adams, H. Betz, Murine semaphorin Drcol-
w24x
w25x
w26x w27x w28x
w29x
w30x
lapsin is a member of a diverse gene family and creates domains inhibitory for axonal extension, Neuron 14 Ž1995. 941–948. B. Sadaghiani, C.H. Thiebaud, Neural crest development in the ´ Xenopus laeÕis embryo, studied by interspecific transplantation and scanning electron microscopy, Dev. Biol. 124 Ž1987. 91–110. Y. Sasai, B. Lu, H. Steinbeisser, E.M. DeRobertis, Regulation of neural induction by the Chd and BMP-4 antagonistic patterning signals in Xenopus, Nature 376 Ž1995. 333–336. M. Takeichi, The cadherins: cell–cell adhesion molecules controlling animal morphogenesis, Development 102 Ž1988. 639–655. Y. Tanabe, T.M. Jessell, Diversity and pattern in the developing spinal cord, Science 274 Ž1996. 1115–1123. L-H. Wang, S.M. Strittmatter, A family of rat CRMP genes is differentially expressed in the nervous system, J. Neurosci. 16 Ž1996. 6197–6207. R-H. Xu, J. Kim, M. Taira, S. Zhan, D. Sredni, H-F. Kung, A dominant negative bone morphogenetic protein 4 receptor causes neuralization in Xenopus ectoderm, Biochem. Biophys. Res. Commun. 212 Ž1995. 212–219. L.B. Zimmerman, J.M. DeJesus-Escobar, R.M. Harland, The Speman organizer signal noggin binds and inactivates bone morphogenetic protein 4, Cell 86 Ž1996. 599–606.
Research report
Xenopus CRMP-2 is an early response gene to neural induction Tohru Kamata
a,)
, Ira O. Daar b, Marianne Subleski a , Terry Copeland c , Hsiang-fu Kung d , Ren-He Xu a a
c
IRSP, SAIC r Frederick, NCI-FCRDC, Frederick, MD 21702-1201, USA b LLB, DBS, NCI-FCRDC, Frederick, MD 21702-1201, USA Protein Chemistry, ABL-Basic Research Program, NCI-FCRDC, Frederick, MD 21702, USA d LBP, DBS, NCI-FCRDC, Frederick, MD 21702-1201, USA Accepted 17 March 1998
Abstract A neural specific protein, CRMP-2 Žfor Collapsin Response Mediator Protein-2., is considered to mediate collapsin-induced growth cone collapse during neural development. We have isolated the Xenopus homologue of the CRMP-2 ŽXCRMP-2. cDNA and studied the expression of XCRMP-2 mRNA and protein during neural induction. Induction of XCRMP-2 mRNA and protein expression, like N-CAM, occurred at the midgastrula stage and increased through early neural developmental stages. Whole mount in situ hybridization demonstrated that expression of XCRMP-2 mRNA was localized in neural tissues such as the neural plate and tube at early stages, while its expression in the brain, spinal cord, and eyes was observed at later stages. Immunostaining of Xenopus embryos with the antibody against CRMP-2 also showed that the protein was specifically expressed in the neural tissues at early stages. XCRMP-2 expression was induced by neural inducers such as noggin and chordin which antagonize a neural inhibitor, BMP4. A dominant negative BMP receptor also induced XCRMP-2 expression, suggesting that transcription of XCRMP-2 gene was negatively regulated by the BMP4 signaling. These results indicate that expression of XCRMP-2 is an early response marking neural commitment, and that transcriptional control of XCRMP-2 gene, is one of the targets of BMP4 signaling. q 1998 Elsevier Science B.V. All rights reserved. Keywords: Xenopus; XCRMP-2 gene; Neural induction
1. Introduction Neurons extend axons along specific pathways to find their right targets during neural development. Axon growth appears to be guided by the family of molecules including cell surface, membrane-bound, and soluble factors. The identification and characterization of molecules involved in transducing axon guidance signals would be essential to understand the mechanism of neural network formation. We have recently isolated a neural specific protein, Collapsin Response Mediator Protein-2 ŽCRMP-2. w5,28x from bovine brain w14x, and DNA sequence analysis revealed that the protein is highly homologous Ž97% identity., to rCRMP-2 of the rat CRMP gene family w14x. This gene family consists of rCRMP-1, rCRMP-2, rCRMP-3,
) Corresponding author. Bldg. 567, Rm. 152, Laboratory of Biochemical Physiology, NCI-FCRDC, Frederick, MD 21702-1201, USA. Fax: q1-301-846-6863; E-mail: [email protected]
0169-328Xr98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 9 - 3 2 8 X Ž 9 8 . 0 0 0 8 2 - 5
and rCRMP-4, all of which have 70–79% sequence identity to each other w28x. rCRMP-2 and rCRMP-4 are identical to the previously identified TOAD-64 w19x and rUlip w1x genes, respectively, and the chicken homologue of rCRMP-2 is CRMP-62 w5x. Although selectively expressed in neural tissues, rCRMP mRNAs show different temporal and spatial expression patterns w28x. CRMP-2rTOAD-64 is expressed in most neurons at early stages in development. For example, it is specifically detectable in both the central and peripheral nervous system in rat or mice and is localized in the axon, dendrite and cytoplasm of differentiating neurons w5,14,19,28x. As for the functional role, CRMP-62, a chicken homologue of CRMP-2 was shown to mediate the action of collapsin, a chemotactic factor of the semaphorin family, which directs developing neuronal axons by collapsing the growth cone w5x. Furthermore, CRMP-2 has sequence homology to Caenorhabditis elegans unc-33, a gene controlling the guidance and growth of neuronal axons in nematodes w16x. Genetic studies demonstrated that a mutation in unc-33
202
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
caused severely uncoordinated movement and abnormal elaboration of axons w9x. These observations suggest that CRMP-2 may play an important role in axonal guidance and growth of developing neurons in vertebrates. While the regulatory mechanism of CRMP-2 function remains unknown, it has been proposed that CRMP-2 is an element of the multimeric receptor complex that couples collapsinbinding transmembrane receptors to the signaling pathways w5x. Our study implicates the possible involvement of a serine protein kinaseŽs. in the control of CRMP-2 activity, because serine residues of CRMP-2 in PC12 cells were phosphorylated both in vivo and in vitro w14x. In view of the ample information available on the cellular and molecular aspects of Xenopus early development, the Xenopus system appears to be suitable for investigating the involvement of cellular molecules in neurogenesis. The amphibian nervous system arises during gastrulation. A portion of the ectoderm receives an inductive signal from dorsal mesoderm and consequently initiates neural development. Recent studies have dissected the signaling pathways involving several neural inducers, and three secreted factors Žnoggin, chordin, and follistatin. have been shown to initiate neural induction and mesoderm dorsalization in Xenopus embryos Žreviewed by Tanabe and Jessell, w27x.. Noggin and chordin w22,30x antagonize signaling from bone morphogenic protein 4 ŽBMP4. by blocking binding to its receptor and thereby cause neuralization of ectoderm. Since disruption of the BMP4 signaling results in neuralization, BMP4 is considered as a physiological neural inhibitor as well as a potent ventralizing factor for mesoderm patterning w3,8,13,25,29x. It is assumed that the early stages of neural tissue formation require new gene expression in response to the neuralization signals triggered, in part, by the above mechanism. Thus far, few neural specific proteins have been identified that are expressed at the initial stage of neural development. Among them, two cell adhesion molecules, neural cell adhesion molecule ŽN-CAM. w12x and N-cadherin w26x are expressed between blastula and neurula stage of Xenopus embryo and are believed to mediate cell–cell interactions critical for morphogenesis during neural development. In order to investigate the role of CRMP-2 during neural induction, we focused our attention on the expression and regulation of CRMP-2 in neurogenesis of Xenopus embryos as a model system. The results of this report indicate that CRMP-2 mRNA synthesis begins during gastrulation, followed by the onset of CRMP-2 protein synthesis at the early neural plate stage. Both RNA and protein levels increase through subsequent neural developmental stages. CRMP-2 expression is localized to neural tissues including the neural plate and neural tube. Moreover, there is induction of CRMP-2 expression in response to neural inducers such as noggin and chordin which antagonize the BMP4-signaling. From these findings, we conclude that CRMP-2 expression is an event marking the early stages
of neural induction in Xenopus embryos and is regulated by the BMP4-signaling pathway.
2. Materials and methods 2.1. Isolation of Xenopus CRMP-2 cDNAs Xenopus CRMP-2 ŽXCRMP-2. cDNAs were isolated by screening an adult frog brain lgt10 cDNA library Ža kind gift from Dr. I. Dawid. with a bovine CRMP-2 cDNA fragment ŽpB12a. by the protocol described previously w14x. Hybridization and washing were performed under low-stringency conditions. Five positive phage clones were isolated and cDNA inserts were subcloned into pBluescript SK ŽStratagene. and sequenced on both strands by the Sequenase kit ŽU.S. Biochemical.. One partial length clone contained a 2.5-kb cDNA insert yielding an open reading frame for XCRMP-2, which encompasses 563 amino acids, but lacked a small portion of amino terminus. 2.2. Analysis of XCRMP-2 transcription leÕel RNA from Xenopus embryo at various stages was extracted in Trizol ŽGibco-BRL. and primed with either oligo ŽdT. 16 mers or random hexamers with murine leukemia virus reverse transcriptase ŽGibco-BRL.. To process the synthesized cDNAs for PCR, primers for XCRMP-2 were designed to generate 1.6 kb of the XCRMP-2 cDNA: forward, 5X-AAGAGCGATCGGCTACTCATT corresponding to KSDRLLIK; reverse, 5XGCGGAGGTGGTAATGTTGGCA corresponding to CQHYHLR. Reactions were performed in PCR buffer containing 20 pmol of primers and 1 m Ci of w a y32 PxdCTP Ž3000 Cirmmol Amersham. and underwent 30 cycles of 948C for 45 S, 558C for 1 min, and 728C for 1 min. Reaction products were analyzed by 1% agarose gel electrophoresis, followed by autoradiography. 2.3. RNA synthesis Capped mRNAs were generated from the appropriate DNA templates using an in vitro transcription kit ŽAmbion. as described previously w29x. Noggin, chordin, BMP4 and dominant negative BMP receptor cDNAs were inserted into the pSP64TEN plasmid vector Ža kind gift from Dr. D. Melton. for transcription using SP6 promoter. 2.4. In situ hybridization Digoxigenin labeled probes were produced from XCRMP-2 cDNA that was inserted into the EcoRI site of a Bluescript SK vector. The plasmid was linearized with NotI and transcribed with T7 polymerase to produce an antisense riboprobe. Sense riboprobes were produced by
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
linearizing the plasmid with HindIII and transcription with T3 polymerase. Whole mount in situ hybridization was essentially done as described by Harland w7x. Briefly, embryos were derived from in vitro fertilization of albino eggs with albino sperm, then fixed in MEMFA buffer Ž0.1 M MOPS ph 7.4, 2 mM EGTA, 1 mM MgSO4 , and 3.7% formaldehyde., dehydrated in 100% methanol and stored at y208C until use. Embryos were treated with 100% ethanol overnight, then rehydrated in successive 5-min washes with 100% methanol, 75% methanol, 50% methanol, and 25% methanolr75% PTW ŽPhosphate buffered saline 7.4, and 0.1% Tween-20., 100% PTW. No proteinase K treatment was applied, and four 5-min washes in 0.1 M triethanolamine pH7.5 were performed. The last two washes included 12.5 ul of acetic anhydride. Four washes in PTW were performed and embryos were prehybridized in 1 ml of hybridization buffer Ž50% formamide, 5 = SSC, 1 mgrml Torula RNA, 100 ugrml heparin, 1 = Denhardts, 0.1% Tween-20, 0.1% CHAPS, 10 mM EDTA. for 6 h at 608C. This solution was replaced with 0.5 ml of hybridization solution containing 1 ugrml of digoxigenin labeled antisense or sense RNA and incubated overnight at 608C. The embryos were washed three times in 2 = SSC at 608C for 20 min each, then washed once in 2 = SSC containing RNAse A Ž20 ugrml., RNAse T1 Ž10 unitsrml. at 378C for 30 min. Embryos were washed extensively in 0.2 = SSC at 608C, then maleic acid buffer wMabx Ž100 mM maleic acid, 150 mM NaCl ph 7.5. at room temperature. Non-specific antibody binding sites were blocked with Mab containing 2% BMB blocking reagent and 20% heat inactivated lamb serum for 2 h at room temperature. This solution was replaced with Mab Žwith 2% BMB block and 20% lamb serum. containing a 1:2000 dilution of affinity purified sheep anti-digoxigenin antibody coupled to alkaline phosphatase and incubated overnight at 48C. After five washes over 5 h in Mab the embryos were washed in alkaline phosphatase buffer Ž100 mM Tris pH 9.5, 50 mM MgCl 2 , 100 mM NaCl, 0.1% Tween-20, 5 mM levamisol.. Embryos were placed in the BM-Purple ŽBoehringer Mannheim. chromogenic substrate with 2 mM levamisole for 3 h at room temperature. The reaction was stopped and the embryos fixed in Bouin’s stain Ž1 g picric acid in 3.7% formaldehyde, 5% acetic acid. overnight. Background was removed by several washes in 70% buffered ethanol ŽpH 7.5.. Then embryos were cleared with benzyl benzoaterbenzyl alcohol Ž2:1.. Photographs were taken under a dissecting microscope ŽZeiss SV6. with MC-80 camera ŽZeiss..
203
thetic RNA. For animal cap explant assay, animal caps were dissected from injected embryos at stage 8.5–9 and cultured in 67% Leibovitz’s L-15 medium, pH 7.5 as described previously w29x. The explants were harvested at equivalent of stage 24 for assay of cell differentiation using molecular markers. 2.6. Immunoblotting Frog adult brain or embryonic tissues were homogenized in solubilization buffer Ž20 mM Tris–Cl, pH 7.5, 1 mM DTT, 1 mM EDTA, 0.5% NP-40, 10 m grml leupeptin, and 10 m grml pepstatin A. by passing through a needle and the homogenates were spun at 100,000 = g for 10 min at 48C. The resulting supernatant was subjected to sodium dodcyl sulfate ŽSDS.-10% polyacrylamide gel electrophoresis ŽPAGE. and the blots were probed with the rabbit anti-CRMP-2 antibody N17 which was raised against a peptide from residues 1 to 17 of bovine CRMP-2 as described w14x. Protein bands were visualized by ECL ŽAmersham.. 2.7. Detection of molecular marker RNA from animal cap explants was extracted as mentioned above. Oligonucleotides for N-CAM and EF1-a were designed and the condition for RT-PCR was standardized as described by Hemmati-Brivanlou and Melton w11x. Primers for XCRMP-2 were designed to generate about 300 bp of the XCRMP-2 cDNA coding region as follows: forward, 5X-GGAGAACATGGTTCACACTA and reverse, 5X-TGCAGCATTTGTACTGGTGAC. 2.8. Immunohistochemistry and histology Whole mount staining of embryos was performed as described previously w10x. CRMP-2 in embryos was stained with the rabbit anti-CRMP-2 antibody ŽN17.. Immunostaining of PC12 cells were performed according to the manufacturer’s protocol ŽVector.. PC12 cells were treated with nerve growth factor ŽNGF. Ž50 ngrml. for 48 h. Differentiated PC12 cells were washed with PBS plus 0.05% Tween20, fixed with 5% acetic acid in methanol at y208C for 1 h, and blocked with 4.5% normal goat serum prior to incubation with the rabbit anti-CRMP-2 antibody N17 Ž1:10,000.. CRMP-2 immunoreactivity was visualized using peroxidase vectastain kit ŽVector. with DAB as chromogen.
2.5. Embryos and microinjections
3. Results
Xenopus laeÕis embryos were obtained and cultured as previously described w29x. Developmental stages were determined as described by Nieuwkoop and Faber w21x. Each blastomere at the 2-cell stage was injected with the syn-
3.1. Expression of CRMP-2 in Xenopus embryos In order to study the functional role of CRMP-2 in early Xenopus embryos, we first identified the Xenopus CRMP-2
204
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
gene. Since the full length bovine CRMP-2 cDNA was isolated in our previous study w14x, we screened a Xenopus adult brain cDNA library with a bovine CRMP-2 cDNA fragment under conditions of low stringency. A 2.5-kb cDNA clone, which contains an open reading frame coding for 560 amino acids, was isolated ŽFig. 1.. Motif analysis indicates that the Xenopus cDNA lacks a signal peptide, a transmembrane domain or any catalytic domain of known
enzymes, while it contains consensus sites for serine, threonine, and tyrosine phosphorylation, as does bovine CRMP-2 w14x. Amino acid alignment of the cDNA with other genes shows the extensive homology with bovine CRMP-2 Ž89% identity., rCRMP-2rTOAD-64 w19x Ž89% identity., and chicken CRMP-62 Ž88% identity.. CRMP-62 was suggested to mediate the intracellular cascade triggered by collapsin w5x. It is noteworthy that the Xenopus
Fig. 1. Amino acid alignments of XCRMP-2 and CRMP-related proteins. A partial length XCRMP-2 cDNA of 2.5 kb contained an open reading frame encompassing 563 amino acids, but the NH 2 -terminus has not been assigned yet. The amino acid sequence of XCRMP-2 was aligned with the corresponding amino acid sequences of bovine CRMP-2, chicken CRMP-62, rat TOAD-64, rCRMP-1, rCRMP-2, rCRMP-3, rCRMP-4, Ulip and C. elegans unc-33. Dots indicate that the amino acids are identical. The solid lines indicate gaps in the alignment. The numbers are counted from each NH 2 -terminus of bCRMP-2, CRMP62, ULIP, rCRMP-1, rCRMP-2, rCRMP-3, and rCRMP-4. Homology comparison were performed using the BLAST system.
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
cDNA is 36% identical to C. elegans unc-33 over the entire region. Unc-33 has been proposed to play a role in axonal guidance and growth in C. elegans, and animals carrying the mutated gene are paralyzed and are defective in neuritic outgrowth and guidance w9,16x. The Xenopus cDNA also shares sequence homology with rCRMP-1 Ž72% identity., rCRMP-3 Ž72% identity. and rCRMP4rUlip w1x Ž76% identity. of the rat CRMP gene family w28x. Interestingly, a region of 34 amino acids corresponding to the domain from residues 386 to 419 in bovine CRMP-2 is highly conserved among species ŽFig. 1.,
205
suggesting its functional importance. Based on its high degree of homology with CRMP-2 homologues of bovine and other species, we believe the obtained cDNA encodes a Xenopus CRMP-2 ŽXCRMP-2.. Upon aligning CRMP-2 sequence to other homologous vertebrate genes, it appears that 12 amino acids at the NH 2-terminus of XCRMP-2 is still missing and the isolation of the full length XCRMP-2 is in progress. XCRMP-2 is also 72%, 72%, and 73% identical to human dihydropyrimidinase-related protein-1, -2, and -3 isolated from human brain w6x. Currently, the biological significance of this similarity is unknown, however, the function of XCRMP-2 is likely to be well conserved throughout evolution. To examine the expression of CRMP-2 mRNA in frog embryos, the mRNA level was determined by RT-PCR. cDNAs prepared from total RNA of embryos at various stages were used in PCR reactions utilizing sense and antisense primers derived from the XCRMP-2 cDNA. The XCRMP-2 transcript was not expressed in the egg, but was first detected at midgastrula Žstage 11. ŽFig. 2A.. The increased level of transcription was detectable as the embryo developed further during neurula stage Žstage 14. through tailbud stage Žstage 37.. This indicates that XCRMP-2 transcripts are not present as maternal RNA, but appear during gastrulation. Immunoblotting studies demonstrated that the antibody to bovine CRMP-2 recognized XCRMP-2 with a molecular weight of 60 kd in Xenopus adult brains ŽFig. 2B.. In immunoblotting analyses of early embryos at various stages, the XCRMP-2 protein was first detected around the early neural plate stage Žst 13. at the low level and its expression level increased at later stages ŽFig. 2B.. Thus, the expression pattern of XCRMP-2 protein correlated well with that of XCRMP-2 mRNA.
3.2. In situ hybridization analysis of XCRMP-2 expression in Xenopus embryonic stages
Fig. 2. Expression of XCRMP-2 mRNA and proteins. ŽA. Total RNA was prepared from eggs, midgastrula Žstage 11., neural plate stage Žstage 14., late tailbud stage Žstages 27. and tadpole stage Žstage 37. embryos. The mRNA levels of XCRMP-2 were analyzed by RT-PCR ŽSee Section 2.. A 1.6-kb cDNA fragment was generated. The amount of RNA was quantitated by ethidium bromide staining of 28 s and 18 s rRNA. ŽB. Indicated amounts of cytoplasmic extracts prepared from eggs, midgastrula Žstage 11., late tailbud stage Žstage 27., and adult frog brain ŽAd. were loaded onto SDS-10% PAGE and immunoblotted with the antiCRMP-2 antibody N17.
To determine the temporal and spatial localization of XCRMP-2 mRNA, the pattern of expression in whole embryos from gastrula to swimming tadpole stages were examined by in situ hybridization. Digoxigenin-labeled antisense and sense RNA probes were hybridized with embryos throughout development and stained with a chromogenic substrate. During blastula Žnot shown. and early gastrula stages, no hybridization was detected ŽFig. 3A.. Hybridization begins to be detected at the neural plate stage Žstage 13.. The sensorial layer of the neuroectoderm has become several cell layers thick laterally, while the center notoplate remains thin. Strong staining is visualized along the neural plate with only weak diffuse staining past the lateral border of the neural plate ŽFig. 3B.. At stage 18, the neural tube is closing and the axial mesoderm differentiates asynchronously along the A–P axis. The presump-
206
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
Fig. 3. Localization of XCRMP-2 mRNA in Xenopus embryos. Whole mount in situ hybridization of Xenopus embryos with digoxigenin-labeled XRMP-2 antisense RNA reveals expression of XCRMP-2 transcripts during neurulation. Stages according to Nieuwkoop and Faber w21x refer to ŽA. early gastrula Žstage 10., ŽB. early neural plate Žstage 13., ŽC. midneurula Žstage 16., ŽD. late neurula Žstage 20., ŽE. lateral view of early tailbud Žstage 23., ŽF. dorsal view of early tailbud Žstage 23., ŽG. late tailbud Žstage 27., and ŽH. tadpole Žstage 36..
tive brain and neural tube are staining intensely ŽFig. 3C lateral view.. Staining of the presumptive epidermis has greatly diminished. At stage 20, the neural folds have fused and the brain is subdivided into the arch- and deuteroencephalon. The brain and spinal chord are showing intense hybridization and the neural folds are displaying strong staining ŽFig. 3D, dorsal view.. In stage 23 embryos, cephalic flexure has occurred and the brain is divided into the pros-, mes-, and rhombencephalon. The paraxial mesoderm is in the process of segmenting and the motor neuron axons invade the myotome. During this stage the entire central nervous system, including eyes are intensely stained ŽFig. 3E and F.. Somitic junctions are also staining positively for XCRMP-2 ŽFig. 3E, lateral view.. The stomodeal–hypophyseal anlage shows weaker expression than the brain and eye. Weak staining is also present surrounding the otic placodes and staining is absent from the anterior midline of the spinal chord ŽFig. 3F dorsal view.. At the tailbud stage, expression in the olfactory placodes and otic vesicles is more prominent. Staining of the branchial arches and cranial ganglia is apparent ŽFig. 3G.. In the swimming tadpole stage Žst. 36., there is continued high expression of XCRMP-2 in the spinal chord, brain and cranial nerves.
3.3. RT-PCR analysis of XCRMP-2 mRNA expression in neural tissues In another approach to examine XCRMP-2 mRNA expression at the neural fold, tissues were dissected from embryos at stage 17 and assayed for the presence of XCRMP-2 mRNA by using RT-PCR. As expected, neural fold tissues alone or dorsal mesoderm plus neural fold tissues expressed significant levels of XCRMP-2 transcripts, whereas dorsal mesoderm tissues, such as somite and notochord neighboring the neural fold expressed no detectable level of XCRMP-2 mRNA ŽFig. 4.. N-CAM, a general neural marker was also detected in the neural fold but not in the dorsal mesoderm. 3.4. Tissue distribution of XCRMP-2 protein in Xenopus embryos To determine where XCRMP-2 protein is localized in Xenopus early embryos, the distribution of XCRMP-2 was analyzed by whole-mount immunocytochemistry of embryos using the antibody directed against bovine CRMP-2. The antibody can specifically stain CRMP-2 localized in
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
207
peripheral nervous systems in mice w14x. When frog embryos at various stages were immunostained with the antibody, XCRMP-2 was undetectable in blastula embryos Žnot shown., and strong XCRMP-2 staining was detected in brain, spinal cord and eyes at tailbud stage Žstage 37. ŽFig. 5.. Taken together, these data demonstrate that consistent with in situ hybridization data, XCRMP-2 is specifically expressed in neural tissues during early neural development.
3.5. Expression of CRMP-2 following neural induction
Fig. 4. RT-PCR analysis of XCRMP-2 mRNA expression in neural tissues. The middle 1r3 of the dorsal tissue was excised from stage 17 embryos. The explants contained neural fold ŽNF. and dorsal mesoderm ŽDM. tissues such as notochord and somite. NF and DM were separated from some of the explants. Molecular markers were analyzed in NF, DM or NFqDM, using RT-PCR. Whole embryo ŽEmb. as a positive control was included. EFI-a expression indicates that comparable amounts of RNA were used in each set.
the neurite and cytoplasm of differentiated pheochromocytoma PC12 cells after NGF treatment Ždata not shown. and also recognized CRMP-2 expressed in both central and
BMP4 blocks both neuralization and mesoderm dorsalization, leading to epidermalization in the ectoderm and ventralization in the mesoderm w3,8,13,25,29x. In the current prevailing model of the neuralization mechanism, noggin and chordin are thought to induce neuralization by antagonizing the BMP4 signaling w22,30x. It is likely that the expression of XCRMP-2 in the neuroectoderm is an early consequence of neural induction in the ectoderm by prospective dorsal mesoderm. We therefore addressed the question of whether XCRMP-2 expression is induced after exposure of ectoderm explants to the above neural inducers. To this end, noggin, chordin, BMP4, or dominant negative BMP receptor mRNA was microinjected into the animal pole of 2-cell stage embryos. Animal caps were removed at blastula stage, cultured until the equivalent of neurula stage, and assayed for the presence of XCRMP-2 mRNA. The expression of XCRMP-2 was detected in parallel with the general neural marker, N-CAM, in animal caps injected with noggin and chordin, but not with BMP4 ŽFig. 6.. Furthermore, a dominant negative BMP receptor also induced the expression of both XCRMP-2 and N-CAM ŽFig. 6.. The results indicate that CRMP-2 expression occurs in ectoderm following neural induction by secreted
Fig. 5. Distribution of XCRMP-2 protein in Xenopus embryos. XCRMP-2 immunoreactivity in the central nervous system Žspinal cord and brain. in embryo at tadpole stage Žstage 37. was visualized by whole-mount staining with the anti-CRMP-2 antibody N17.
208
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
Fig. 6. Induction of XCRMP-2 expression by neuralizing molecules. The animal pole of 2-cell stage embryos was injected with RNAs encoding b-galactosidase Ž2 ng., noggin Ž0.2 ng., chordin Ž1.5 ng., BMP-4 Ž2 ng. and dominant negative BMP receptor ŽDN-BR. Ž1 ng.. Animal caps were explanted at blastula stage and cultured to stage 24 before harvest. RNAs were extracted and gene expression was analyzed by RT-PCR as described in Fig. 4.
neural inducers, consistent with its exclusive expression in the neural tissues of whole embryos ŽFigs. 3–5..
4. Discussion In this study, we have isolated and characterized a Xenopus CRMP-2 cDNA clone. Deduced amino acid sequence reveals that XCRMP-2 is highly homologous to CRMP-related proteins among various vertebrates. Particularly, XCRMP-2 is highly related to chicken CRMP-62 w5x, rat TOAD-64rrCRMP-2 w19,28x, and bovine CRMP-2 w14x. Previous studies suggested that CRMP-62 is an intracellular component necessary for collapsin-induced growth cone collapse during neuritic outgrowth and axonal guidance w5x, and that CRMP-2 is one of the proteins expressed at early stages of nervous system development in rat and mouse w14,19,28x. Furthermore, XCRMP-2 shares sequence homology to unc-33, a gene implicated in appropriate axonal guidance and growth of neurons in nematode w9,16x. Thus, it is likely that XCRMP-2 plays a similarly important role at the early stages of the development of the Xenopus nervous system. Previous studies suggested that CRMP-2rTOAD-64 has the broadest neural expression among the CRMP gene
family, and that expression of rat or mouse CRMP-2 mRNAs begins at embryonic day 11–12 and is detectable in the midbrain and developing cerebellum w14,19,28x. However, it is not known precisely when the transcription of the CRMP-2 gene starts and where this event occurs. Our data show that XCRMP-2 transcript first appeared at midgastrula stage and increased to tailbud stage, indicating the correlation between XCRMP-2 transcription and the developmental stage at which neural induction takes place. Since XCRMP-2 mRNA appears immediately after gastrulation begins, the activation of XCRMP-2 gene expression could be a very early response gene to neural induction signals. In situ hybridization analysis using XCRMP-2 probes revealed little or no staining from the blastula to early gastrula stages. XCRMP-2 mRNA expression is detected at the neural plate stage where strong staining along the neural plate is observed in regions that will later develop into various structures in the brain w4x. As development progresses, the anterior portions of the neural plate fated to become the fore- and mid-brain and eye show hybridization, while posterior hybridization was indicative of the future spinal cord w4x. While XCRMP-2 is a gene expressed early in neural induction, it is likely to have a role during the stages of neural development when activated neuroectoderm is transformed into various regions of the central nervous system Žst. 13.. One of the later inductive events results from an interaction between the notochord and neural tube that results in the development of certain neuroepithelial cells known as the floorplate. It has been shown that notochordless embryos lack floorplate cells, but have various neurons, although axon guidance is disorganized w2x. Further experiments will be necessary to determine the effect floorplate signals may have on XCRMP-2, a molecule that may be involved in axon guidance w5x. XCRMP-2 staining is observed along the neural folds during neurulation stages with accumulation in the anterior and posterior regions. XCRMP-2 has a very general expression pattern in the developing nervous system. While XCRMP-2 is almost neural specific, there is prominent expression in the myotomes even at tailbud stages. Whether XCRMP-2 has a role in myogenesis or motor axon migration is presently unclear. At later stages, XCRMP-2 expression can be found in the branchial arches derived from neural crest cells, which originate in the neural tube w24x. While XCRMP-2 is found in sensory structures derived from the neural tube, like the retina, it is also found in sensory structures derived from the placodes Žoptic vesicle and olfactory placode.. At later stages, XCRMP-2 mRNA is found to stain strongly in the telencephalon, diencephalon, mesencephalon, hindbrain and along the spinal cord. This pattern of expression is broader than that observed for collapsin w17,18,23x, indicating that XCRMP-2 may transduce signals other than those that emanate from collapsin. The antibody raised against bovine CRMP-2 first detected XCRMP-2 protein around early neural plate
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210
stage, and its expression level increased parallel to that of XCRMP-2 mRNA. Immunostaining showed the specific localization of XCRMP-2 protein in the nervous system including spinal cord and brain, which is consistent with the distribution of XCRMP-2 mRNA in neural tissues as shown by in situ hybridization. As for a model for neurogenesis, it has been proposed that the initial stages of neural tissue formation require new gene products, and that new gene expression occurs as an immediate response to neural induction. The expression of many neural specific genes seems to begin relatively late in development. For example, neurofilament is first expressed after neural tube closure and is not expressed until after postmitotic neurons begin to elaborate axons and dendrites w20x. In contrast, N-CAM, which is thought to mediate cell–cell interactions essential for morphogenesis in neural tissue formation, is expressed early in neural development w26x. In this respect, it is noteworthy that the gene expression of XCRMP-2 occurs as early as midgastrula stage in Xenopus development. This suggests that XCRMP-2 expression could be one of the early responses to neural induction. Other research groups have reported that expression of the CRMP family does not begin until embryonic day ŽE. 7 in chicks, E11 in mice, or E12 in rats, when neurons are differentiating and extending processes w5,14,19x. The finding of early expression of XCRMP-2 at the time of neurulation is in marked contrast to the findings of these reports, and suggests that the genes probably play much different roles depending on the species or exert a undefined role in addition to that suggested for growth cone collapse. BMP4, that is widely expressed in the early ectoderm, represses neural differentiation w3,8,13,25,29x. It has been anticipated that neural tissue formation is induced by means of endogenous proteins that block signaling mediated by BMP4. Noggin and chordin are known to induce neural tissues directly in the absence of mesoderm w15,25x. Recently, these ligands have been shown to bind to BMP4 and thereby block the biological activity of BMP4, resulting in neural induction w22,30x. Our data demonstrate that transcription of XCRMP-2, like N-CAM, was activated by neural-inducing molecules, noggin and chordin that antagonize the action of BMP4. Furthermore, BMP4, a physiological neural inhibitor, was unable to induce XCRMP-2 expression, but the dominant negative BMP receptor induced XCRMP-2 expression. Thus, this observation suggests that the transcriptional control of XCRMP-2 gene is at least one of the targets of BMP4 signaling, although other pathways of BMP4 inhibition-independent regulation of XCRMP-2 transcription may also exist. In conclusion, we believe that XCRMP-2 is one of the candidates for genes expressed in early neural development and could be a primarily important component for the commitment to a neuronal phenotype. The availability of the XCRMP-2 cDNA will facilitate the functional study of CRMP-2 by using the Xenopus embryo system.
209
Acknowledgements We thank Dr. M. Taira for valuable discussion. We also thank Mrs. A. Rogers for preparation of this manuscript. This research was supported in part by the National Cancer Institute, NIH, DHHS under contract with ABL.
References w1x T. Byk, T. Dobransky, C. Cifuentes-Diaz, A. Sobel, Identification and molecular characterization of unc-33-like phosphoprotein ŽUlip., a putative mammalian homology of the axonal guidance-associated unc-33 gene product, J. Neurosci. 16 Ž1996. 688–701. w2x J.D. Clarke, N. Holder, S.R. Soffe, J. Storm-Mathisen, Neuroanatomical and functional analysis of neural tube formation in notochordless Xenopus embryos; laterality of the ventral spinal cord is lost, Development 112 Ž1991. 499–516. w3x L. Dale, G. Howes, B.M.J. Price, J.C. Smith, Bone morphogenetic protein 4: a ventralizing factor in early Xenopus development, Development 115 Ž1992. 573–585. w4x G.W. Eagleson, W.A. Harris, Mapping of the presumptive brain regions in the neural plate of Xenopus laeÕis, J. Neurobiol. 21 Ž1990. 427–440. w5x Y. Goshima, F. Nakamura, D. Strittmatter, S.M. Strittmatter, Collapsin-induced growth cone collapse mediated by an intracellular protein related to unc-33, Nature 376 Ž1995. 509–514. w6x N. Hamajima, K. Matsuda, S. Sakata, N. Tamaki, M. Sasaki, M. Nonako, A novel gene family defined by human dihydropyrimidinase and three related proteins with differential tissue distribution, Gene 180 Ž1996. 157–163. w7x R.M. Harland, in: B.K. Kay, H.B. Peng ŽEds.., Xenopus LaeÕis: Practical Uses in Cell and Molecular Biology, Academic Press, London Ž1991. pp. 685–695. w8x S.H.B. Hawley, K. Wunnenberg-Stapleton, C. Hashimoto, M.N. ¨ Laurent, T. Watabe, B.W. Blumberg, K.Y. Cho, Disruption of BMP signals in embryonic Xenopus ectoderm leads to direct neural induction, Genes Dev. 9 Ž1995. 2923–2935. w9x E.M. Hedgecock, J.G. Culotti, J.N. Thomson, L.A. Perkins, Axonal guidance mutants of Caenorhabditis elegans identified by filling sensory neurons with fluorescein dyes, Dev. Biol. 111 Ž1985. 158– 170. w10x A. Hemmati-Brivanlou, R.M. Harland, Expression of an engrailedrelated protein is induced in the anterior neural ectoderm of early Xenopus embryos, Development 106 Ž1989. 611–617. w11x A. Hemmati-Brivanlou, D.A. Melton, Inhibition of activin receptor signaling promotes neuralization in Xenopus, Cell 77 Ž1994. 273– 281. w12x T.M. Jessel, Adhesion molecules and the hierarchy of neural development, Neuron 1 Ž1988. 3–13. w13x C.M. Jones, K.M. Lyons, P.M. Lapan, C.V.E. Wright, B.L.M. Hogan, DVR-4 Žbone morphogenetic protein-4. as a posteriorventralizing factor in Xenopus mesoderm induction, Development 115 Ž1992. 639–647. w14x T. Kamata, M. Subleski, K. Hara, N. Yuhki, H.-F. Kung, N.G. Copeland, N.A. Jenkins, T. Yoshimura, W. Modi, T.D. Copeland, Isolation and characterization of a bovine neural specific protein ŽCRMP-2. cDNA homologues to unc-33, a C. elegans gene implicated in axonal outgrowth and guidance, Mol. Brain Res. 54 Ž1998. 219–236. w15x T.M. Lamb, A.K. Knecht, W.C. Smith, S.E. Stachel, A.N. Economides, N. Stahl, G.D. Yancopolous, R.M. Harland, Neural induction by the secreted polypeptide noggin, Science 262 Ž1993. 713–718. w16x W. Li, R.K. Herman, J.E. Shaw, Analysis of the Caenorhabditis
210
w17x
w18x
w19x
w20x
w21x w22x
w23x
T. Kamata et al.r Molecular Brain Research 57 (1998) 201–210 elegans axonal guidance and outgrowth, Genetics 132 Ž1992. 675– 689. Y. Luo, I. Shepherd, J. Li, M.J. Renzi, S. Chang, J.A. Raper, A family of molecules related to collapsin in the embryonic chick nervous system, Neuron 14 Ž1995. 1131–1140. E.K. Messersmith, E.D. Leonardo, C.J. Shatz, T.-L. Marc, C.S. Goodman, A.L. Kolodkin, Semaphorin III can function as a selective chemorepellent to pattern sensory projections in the spinal cord, Neuron 14 Ž1995. 949–959. J.E. Minturn, H.J.L. Fryer, D.H. Geschwind, S. Hockfield, TOAD-64, a gene expressed early in neuronal differentiation in the rat, is related to unc-33, a C. elegans gene involved in axon outgrowth, J. Neurosci. 15 Ž1995. 6757–6766. K. Nakahara, K. Ikenaka, T. Wada, T. Tamura, T. Furuichi, K. Mikoshiba, Structure of the 68-kDa neurofilament gene and regulation of its expression, J. Biol. Chem. 265 Ž1990. 19786–19791. P.D. Nieuwkoop, J. Faber, Normal Table of Xenopus LaeÕis, North-Holland Publishing, Amsterdam, 1967. S. Piccolo, B. Sasai, B. Lu, E.M. DeRobertis, Dorsoventral patterning in Xenopus: inhibition of ventral signals by direct binding of chordin to BMP-4, Cell 86 Ž1996. 589–598. A.W. Puschel, R.H. Adams, H. Betz, Murine semaphorin Drcol-
w24x
w25x
w26x w27x w28x
w29x
w30x
lapsin is a member of a diverse gene family and creates domains inhibitory for axonal extension, Neuron 14 Ž1995. 941–948. B. Sadaghiani, C.H. Thiebaud, Neural crest development in the ´ Xenopus laeÕis embryo, studied by interspecific transplantation and scanning electron microscopy, Dev. Biol. 124 Ž1987. 91–110. Y. Sasai, B. Lu, H. Steinbeisser, E.M. DeRobertis, Regulation of neural induction by the Chd and BMP-4 antagonistic patterning signals in Xenopus, Nature 376 Ž1995. 333–336. M. Takeichi, The cadherins: cell–cell adhesion molecules controlling animal morphogenesis, Development 102 Ž1988. 639–655. Y. Tanabe, T.M. Jessell, Diversity and pattern in the developing spinal cord, Science 274 Ž1996. 1115–1123. L-H. Wang, S.M. Strittmatter, A family of rat CRMP genes is differentially expressed in the nervous system, J. Neurosci. 16 Ž1996. 6197–6207. R-H. Xu, J. Kim, M. Taira, S. Zhan, D. Sredni, H-F. Kung, A dominant negative bone morphogenetic protein 4 receptor causes neuralization in Xenopus ectoderm, Biochem. Biophys. Res. Commun. 212 Ž1995. 212–219. L.B. Zimmerman, J.M. DeJesus-Escobar, R.M. Harland, The Speman organizer signal noggin binds and inactivates bone morphogenetic protein 4, Cell 86 Ž1996. 599–606.