Yeast mitochondrial DNA polymerase is a highly processive single-subunit enzyme

Mitochondrion 11 (2011) 119–126

Contents lists available at ScienceDirect

Mitochondrion j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / m i t o

Yeast mitochondrial DNA polymerase is a highly processive single-subunit enzyme Katrin Viikov, Priit Väljamäe, Juhan Sedman ⁎ Department of Biochemistry, Institute of Molecular and Cell Biology, University of Tartu, Vanemuise 46, Tartu 51014, Estonia

a r t i c l e

i n f o

Article history: Received 1 April 2010 Received in revised form 30 July 2010 Accepted 20 August 2010 Available online 31 August 2010 Keywords: DNA polymerase γ Mip1 Yeast mtDNA replication Processivity Strand displacement DNA synthesis

a b s t r a c t Polymerase γ is solely responsible for fast and faithful replication of the mitochondrial genome. High processivity of the polymerase γ is often achieved by association of the catalytic subunit with accessory factors that enhance its catalytic activity and/or DNA binding. Here we characterize the intrinsic catalytic activity and processivity of the recombinant catalytic subunit of yeast polymerase γ, the Mip1 protein. We demonstrate that Mip1 can efficiently synthesize DNA stretches of up to several thousand nucleotides without dissociation from the template. Furthermore, we show that Mip1 can perform DNA synthesis on double-stranded templates utilizing a strand displacement mechanism. Our observations confirm that in contrast to its homologues in other organisms, Mip1 can function as a single-subunit replicative polymerase. © 2010 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

1. Introduction Mitochondria possess an autonomous genome encoding several crucial components of the respiratory chain. Maintenance of mitochondrial DNA (mtDNA) integrity is therefore essential for oxidative metabolism. The mitochondrial DNA polymerase (Polγ) is one of the proteins directly involved in mtDNA maintenance (Genga et al., 1986; Lestienne, 1987). As the only DNA polymerase found in mitochondria, Polγ is solely responsible for all DNA synthesis in the organelle during replication as well as repair (Graziewicz et al., 2006). Thus, malfunction of Polγ leads to severe mitochondrial disorders in human (Van Goethem et al., 2001; Graziewicz et al., 2004; Longley et al., 2005; Kasiviswanathan et al., 2009). Based on homology Polγ's from different species are classified to family A of DNA polymerases with Escherichia coli DNA polymerase I as a prototype (Ito and Braithwaite, 1990; Lecrenier et al., 1997). Other well-studied members of the family A include DNA polymerase from bacteriophage T7 and Thermus aquaticus. Characteristically to the family, Polγ's possess a N-terminal 3′→5′ exonuclease domain and a C-terminal polymerase domain, which are determined by highly conserved exonuclease and polymerase motifs (Bernad et al., 1989; Blanco et al., 1991). Polγ's share six additional conserved regions termed γ1–6, therefore forming a distinctive group among the family A (Kaguni, 2004).

Abbreviations: Polγ, polymerase γ; mtDNA, mitochondrial DNA; BSA, bovine serum albumine; USP, universal primer; MTS, mitochondrial targeting sequence; ssDNA, single-stranded DNA; kpol, polymerase catalytic constant; SSB, ssDNA binding protein. ⁎ Corresponding author. Tel.: + 372 7375 838; fax: + 372 7420 286. E-mail address: [email protected] (J. Sedman).

Polγ's generally have oligomeric structure where the catalytic core subunit associates with accessory subunit(s) to form a holoenzyme (Graziewicz et al., 2006). Polγ's from Drosophila melanogaster and Xenopus laevis function as heterodimers consisting of the principal catalytic subunit PolγA and the accessory subunit PolγB (Wernette and Kaguni, 1986; Olson et al., 1995; Insdorf and Bogenhagen, 1989). Human and mouse mitochondrial DNA polymerases have been shown to function as heterotrimers PolγAB2 (Gray and Wong, 1992; Carrodeguas et al., 2001; Yakubovskaya et al., 2006). Unlike its homologues from higher eukaryotes no accessory subunit has been found for Polγ from yeast Saccharomyces cerevisiae. In fact, the only polypeptide copurifying with DNA polymerase activity from S. cerevisiae mitochondria is Mip1, yeast homologue of human catalytic subunit PolγA (Lucas et al., 2004). Accessory subunits of the DNA polymerases function to increase the processivity of the catalytic core through increasing its DNA affinity and/or catalytic activity (Kelman et al., 1998). Therefore, association with these processivity factors provides DNA polymerase with the ability to couple thousands of nucleotides before dissociation from the DNA. For example, bacterial thioredoxin confirms tighter DNA binding of the T7 DNA polymerase, thus increasing its processivity from few nucleotides to ~800 (Huber et al., 1987; Tabor et al., 1987; Lee et al., 2006). Association of human PolγB with catalytic subunit PolγA on the other hand results in almost ten-fold increase in the processivity mainly through stimulation of PolγA polymerization activity (Johnson et al., 2000). Crystal structure analysis of human Polγ revealed that PolγB accessory subunit interacts with PolγA through the spacer region located between the polymerase and exonuclease domains (Lee et al., 2009). Interestingly, the spacer region of Mip1 is considerably shorter than in human PolγA, particularly lacking the region responsible for

1567-7249/$ – see front matter © 2010 Elsevier B.V. and Mitochondria Research Society. All rights reserved. doi:10.1016/j.mito.2010.08.007

120

K. Viikov et al. / Mitochondrion 11 (2011) 119–126

accessory subunit interaction. Furthermore, Mip1 was shown to have a unique C-terminal extension following the polymerase domain not present in Polγ's from higher eukaryotes (Young et al., 2006). These differences indicate that the processive action of the yeast Polγ is probably achieved by different mechanisms. In this work we overexpress and purify recombinant Mip1 from E. coli and estimate the values for its catalytic constant and processivity on M13 ssDNA. Mip1 displays high polymerase activity and processivity being able to synthesize DNA stretches of over several thousand nucleotides per one binding event, suggesting that Mip1 does not require the processivity factor and could function as a single-subunit polymerase. We also show that recombinant Mip1 is able to perform DNA synthesis involving strand displacement and therefore is well adapted for an uncoupled DNA synthesis mode in vivo. 2. Materials and methods 2.1. Determination of the N-terminus of mature Mip1 For Mip1 overexpression in S. cerevisiae full-length MIP1 open reading frame with C-terminal hexahistidine (6 × His) tag was cloned to pRS425 vector under control of GAL1 promoter and CYC1 terminator. The protease deficient S. cerevisiae strain BJ2168 (MATα, prc1-407, prb1-1122, pep4-3, leu2, trp1, ura3-5; Jones, 1991) was used for Mip1 overexpression in 2% galactose synthetic complete medium for 15 h at 30 °C. Mitochondria were prepared from 500 ml yeast culture essentially as described by Daum et al. (1982). To minimize protein degradation, all solutions contained 1 mM PMSF, 1.8 μg/ml aprotinin, 5 μg/ml leupeptin, 5 μg/ml pepstatin A and 0.1% BSA. Crude preparations of mitochondria were subjected to Percoll density gradient centrifugation (30% Percoll for 45 min at 35,000 × g at 4 °C). Mitochondria from the Percoll density gradient were washed with 50 ml of 10 mM KPi pH 7.4, 0.3 M sorbitol, 1 mM EDTA, protease inhibitors and frozen at −80 °C. Overexpressed Mip1 was identified in mitochondrial lysate by Western blotting with anti-6xHis antibody (clone # 16-001, Quattromed). 50 μg (total protein) of mitochondrial lysate was separated on 7% SDS-PAGE followed by protein transfer onto PVDF membrane. Coomassie staining was used to visualize proteins, Mip1 band was cut out and N-terminal Edman sequencing was performed by the Protein Analysis Centre at Karolinska Institute, Sweden. 2.2. Expression and purification of recombinant Mip1 MIP1 was amplified by proofreading PCR from the S. cerevisiae strain L5791 (Rupp et al., 1999) genomic DNA using primers 5′– ATGGCTAGCACCAAGAAGAATACCGCAGAAG and 5′-CGGAAGCTTGTACTCTCTAGAAATAGTAAT. S. cerevisiae strain L5791 is congenic to ∑1278 background, thus carrying Mip1[∑] allele in its genome as described by Baruffini et al. (2007). The N-terminal mitochondrial targeting sequence of Mip1 was removed resulting in the expressed protein to start from Ser30. The amplified sequence was cloned into pET24d vector (Novagen) between NheI and XhoI restriction sites adding a C-terminal 6xHis tag to the protein. The expression construct was verified by sequencing. Mip1 was expressed in the E. coli strain BL21-CodonPlus(DE3)-RIL (Stratagene). Cultures of 7 l were grown in a B. Braun Biostate E fermenter at 37 °C in Luria-Bertani media (10 g bacto-tryptone, 5 g bacto-yeast extract and 10 g NaCl per liter) at constant pH 7.0 until OD600 was reached 0.5. Growth temperature was reduced to 23 °C over 2 h and expression of Mip1 was induced at OD600 1.6 by addition of 0.5 mM IPTG. After 3 h cultivation at 23 °C, cells were harvested and stored at − 80 °C.

Cell lysate was obtained by resuspending the cell pellet (3.6 g of wet weight) in 36 ml of lysis buffer (500 mM NaCl, 25 mM Hepes pH 7.5, 10% glycerol, 1 mM PMSF) with 1 mg/ml lysozyme and 1 h incubation on ice. Crude lysate was sonicated 3 × 10 s (50% cycle, 70% power, Bandelin Sonopuls HD 2070 60 W) and centrifuged at 27,000 × g for 20 min. The cleared lysate was adjusted to 5 mM imidazole and incubated with 1:10 (v/v) of Ni-NTA (Qiagen) for 2 h on an end-over-end rotator at 4 °C. The incubated Ni-NTA was washed with 50 ml of lysis buffer containing 5 mM imidazole and poured into a chromotography column. The column was washed with 20 volumes of lysis buffer with 15 mM imidazole and 3 volumes of 20 mM imidazole. Mip1 was eluted with 3 column volumes of elution buffer (300 mM NaCl, 25 mM Hepes pH 7.5, 10% glycerol, 1 mM PMSF, 500 mM imidazole). The peak fractions were pooled and diluted 10× with buffer S (25 mM Hepes pH 7.5, 10% glycerol, 1 mM PMSF, 0.5 mM EDTA, 1 mM DTT) containing 50 mM NaCl. Protein sample was loaded onto S-Sepharose ion exhange column (1 ml of matrix per 5 mg of protein, GE Healthcare) equilibrated with buffer S containing 100 mM NaCl. The column was washed with 20 volumes of buffer S containing 100 mM NaCl, 20 volumes 250 mM NaCl and 5 volumes 290 mM NaCl. Mip1 was eluted with 3 column volumes of buffer S containing 500 mM NaCl. The peak fractions were pooled, dialysed against storage buffer (100 mM NaCl, 25 mM Hepes pH 7.5, 50% glycerol, 1 mM PMSF, 0.1 mM EDTA, 1 mM DTT) and stored at −80 °C. The concentration of the protein was measured by Bradford assay with BSA as a standard. The purity of the protein sample was evaluated on 10% SDS-PAGE. 2.3. DNA polymerase activity on calf thymus activated DNA For all Mip1 DNA polymerase activity assays the buffer conditions were adjusted to 20 mM Tris pH 8.0, 2 mM DTT, 40 mM KCl and 0.5 mg/ml BSA. Mip1 specific activity was measured by incorporation of [α -32P]dCTP (Perkin Elmer) into calf thymus activated DNA (Sigma). The activity of 5–100 ng of Mip1 was measured in a 10 μl reaction containing 50 mM MgCl2, 50 μM dATP, 50 μM dGTP, 50 μM dTTP, 5 μM dCTP, 50 μg/ml activated calf thymus DNA, 1 μCi of [α -32P]-dCTP. Reactions were carried out for 5 min at 30 °C and terminated by addition of 10 μl 60 mM EDTA. 5 μl of the reaction were spotted onto DE81 filter paper (Whatman) and washed in sodium-phosphate buffer pH 6.4 (0.25 M Na2HPO4, 0.25 M NaH2PO4). Incorporated radioactivity was measured with a scintillation counter (WinSpectral™, Wallac). The percentage of incorporated [α -32P]-dCTP was plotted against the protein concentration and the specific activity was calculated from the slope of the resulting graph. Mip1 specific activity values were adjusted to standard DNA polymerase unit definition. One unit was defined as the amount of Mip1 that incorporates 1 pmol of dCTP in 30 min at 30 °C. 2.4. Glycerol gradient sedimentation 130 μg of Mip1 were loaded onto a 5-ml 10–30% glycerol gradient in 100 mM NaCl, 25 mM Hepes pH 7.5, 0.5 mM EDTA, 1 mM DTT and 1 mM PMSF. The gradient was centrifuged at 195,000 ×g for 13 h at 4 °C. Catalase (240 kDa), aldolase (161 kDa), BSA (67 kDa) and ovalbumin (45 kDa) were run on a parallel gradient as molecular mass markers. Gradient fractions were analyzed for absorbance at 280 nm and for DNA polymerase activity on calf thymus activated DNA. 2.5. DNA polymerase assay on single-primed M13 ssDNA To prepare single-primed ssDNA substrate (M13/USP), USP oligo 5′GTAAAACGACGGCCAGT-3′ was radiolabeled using T4 polynucleotide

K. Viikov et al. / Mitochondrion 11 (2011) 119–126

kinase (Fermentas) and [γ-32P]-dATP (Perkin Elmer) under the standard forward reaction conditions. Labeled primer was annealed to M13mp18 circular ssDNA and free primer was removed using the QIAquick PCR Purification Kit (Qiagene). 50 nM Mip1 was preincubated with 5 nM M13/USP substrate (as primer end groups) for 2 min on ice. The reaction was initiated by addition of an equal volume of prewarmed 200 μM dNTP, 20 mM MgCl2. The reaction was carried on at 30 °C and stopped after 10, 20, 30, 45, 60, 90, 120 and 180 s by addition of an equal amount of formamide loading buffer (80% deionized formamide, 25 mM EDTA). To obtain zero data point, formamide loading buffer was added to the enzyme and DNA substrate premix followed by addition of nucleotide mix. Samples were denaturated by heating at 100 °C for 5 min and loaded onto an 8% urea polyacrylamide gel. After completion of the electrophoresis, the gel was dried under vacuum and exposed to PhosphoImager screen (GE Healthcare). Data were analyzed using the software package ImageQuant TL 2005 (GE Healthcare). To estimate the catalytic constant for Mip1, the maximum DNA product length was divided by the time during which it was achieved. A signal from a DNA band was counted as positive if it exceeded average background level at least threefold. Three independent experiments were performed and kpol value is presented as the mean ± standard deviation. 2.6. Processivity assay 12 nM Mip1 was preincubated on ice with 12 nM M13/USP in the presence of 20 mM MgCl2. The reaction was started by addition of an equal volume of 200 μM dNTP and DNA trap (2 mg/ml of calf thymus activated DNA). The reaction was incubated at 30 °C and stopped by addition of an equal volume of stop buffer (0.5 mg/ml Proteinase K, 1% SDS, 20 mM EDTA) after 10 s, 20 s, 30 s, 1 min, 5 min and 10 min. Zero data point was obtained as described above. Reactions were incubated with stop buffer for 30 min 37 °C. DNA was purified by phenol/ chloroform extraction and ethanol precipitated in the presence of 0.4 mg/ml dextrane. Reaction products were separated on a 0.8% alkaline agarose gel. The gel was dried under a vacuum and exposed to PhosphoImager screen. DNA trap efficiency was verified in a parallel reaction where 2 mg/ml of calf thymus activated DNA was added to the Mip1, M13/USP mixture during preincubation on ice. As a positive control of the synthesis reaction, trap DNA was omitted from the reaction mix with the rest of the conditions remaining the same. Primer elongation was followed in time and analyzed as described above. The processivity of T7 DNA polymerase was measured in a parallel reaction. 0.002 U/μl of T7 DNA polymerase (Fermentas, #EP0081) was used and buffer conditions were adjusted to 40 mM Tris pH 7.5, 10 mM MgCl2, 1 mM DTT and 0.1 mg/ml BSA. Reaction was carried out at 37 °C and stopped as indicated above. 2.7. Mip1 strand displacement activity assay Mip1 was tested for strand displacement activity using minicircle DNA and M13/USP substrates. Minicircle DNA was prepared using the strategy described by (Falkenberg et al., 2000). 81-mer oligonucleotide 5′-TGAATTCTAATGTAGTATAGTAATCCGCTCTAAGCCATGCCTCGACCGCTATAGTTTGTATCGTCACCATAACTCTGTAAC was phosphorylated with T4 polynucleotide kinase. 100 pmol of 81-mer was hybridized to 200 pmol of 20-mer oligonucleotide 5′-TTAGAATTCAGTTACAGAGT by heating at 50 °C for 2 min and slowly cooling down to room temperature. The linear 81-mer oligonucleotide was then circularized by ligation at 20 °C for 2 h using 5 Weiss units of T4 DNA ligase (Fermentas). Formamide was added to 50% and denaturated products were separated on 10% urea polyacrylamide gel. The 81 nt monomeric circle band was cut out of the gel and eluted by incubation in 100 mM NaCl, 10 mM Tris pH 8.0, 0.1 M EDTA at 4 °C for 12 h.

121

To prepare a minicircle substrate, a [γ-32P]-dATP labeled 30-mer oligonucleotide primer 5′- GAGCGGATTACTATACTACATTAGAATTCA was annealed to the minicircle. 100 nM Mip1 was preincubated on ice with 40 nM minicircle substrate. Reactions were initiated by addition of an equal volume of prewarmed 200 μM dNTP and 20 mM MgCl2. The reaction was incubated at 30 °C and stopped after 15 s, 30 s, 45 s, 60 s, 2 min, 3 min, 5 min and 10 min by the addition of an equal amount of formamide loading buffer. Samples were analyzed on 8% urea polyacrylamide gel. T7 DNA polymerase activity on minicircle substrate was measured in parallel with final concentration of 0.2 U/μl. Reaction was performed at 37 °C with buffer conditions adjusted for T7 DNA polymerase and stopped after 10, 20 and 30 min. For strand displacement assay with M13 circular ssDNA as a substrate, following reaction conditions were used: 16 nM Mip1, 0.5 nM M13/USP substrate, 10 mM MgCl2, 20 mM Tris pH 8.0, 2 mM DTT, 40 mM KCl, 0.5 mg/ml BSA and 100 μM dNTP. Reaction was let to proceed for 1, 2, 5, 10, 30 and 60 min at 30 °C and stopped with equal amount of 0.25 mg/ml Proteinase K, 0.5% SDS, 10 mM EDTA. After 30 min incubation at 37 °C, reaction products were phenol/chloroform extracted, precipitated with ethanol, denaturated with alkali and separated on 0.8% alkaline agarose gel. The gel was dried under a vacuum and exposed to PhosphoImager screen. For T7 DNA polymerase, reaction was performed in parallel at 37 °C under following conditions: 0.02 U/μl T7 DNA polymerase, 0.5 nM M13/ USP substrate, 10 mM MgCl2, 100 μM dNTP, 40 mM Tris pH 7.5, 1 mM DTT, 0.1 mg/ml BSA. 3. Results and discussion 3.1. Determination of the native N-terminus for the mature Mip1 Mip1 is the mitochondrial DNA polymerase from S. cerevisiae. Like the majority of other mitochondrial proteins, Mip1 is encoded by a nuclear gene and post-translationally transported into mitochondria using mitochondria targeting sequence (MTS). In most cases MTS is located at the N-terminus of the protein and is proteolytically removed after translocation into mitochondria. In order to express the mature protein in E. coli, the MTS of Mip1 had to be determined and removed from the construct. We therefore analyzed the ORFtranslation of MIP1 using TargetP 1.1 (Nielsen et al., 1997; Emanuelsson et al., 2000). The program predicted an amphipatic helix indicative of the MTS to span the first 29 amino acids of the Mip1 pre-protein (Fig. 1A). To confirm in silico analysis data on the MTS of Mip1, we performed N-terminal sequencing of overexpressed Mip1 isolated from S. cerevisiae mitochondria. Edman degradation analysis resulted in the following sequence: S/F/A, T, K, K, N. First position of the sequence displayed a degree of ambiguity while others were clearly defined. The obtained sequence matches Mip1 N-terminal sequence from Ser30 to Asn34 (Fig. 1A). Therefore, Edman degradation data confirmed the in silico results and for the expression of recombinant Mip1 the coding sequence starting form Ser30 was used. 3.2. Expression and purification of Mip1 To date, the 140 kDa human Polγ catalytic subunit has only been successfully expressed in eukaryotic hosts. Expression of the catalytic subunit in E. coli resulted mostly in insoluble protein and the fraction of soluble protein was deficient in DNA polymerase activity (Graves et al., 1998; Longley et al., 1998). Thus, the purification of human PolγA from baculoviral infected insect cells has become a widespread practice (Korhonen et al., 2004; Luoma et al., 2005; Lee et al., 2009). Several studies describe the purification of endogenous Mip1 from S. cerevisiae mitochondria (Biswas et al., 1995; Lucas et al., 2004). To overcome an obstacle of low natural abundance of endogenous Mip1

122

K. Viikov et al. / Mitochondrion 11 (2011) 119–126

SDS-PAGE and tested for DNA polymerase activity in parallel (Fig. 2). Expected molecular weight for recombinant Mip1 was calculated to be 141.6 kDa. Glycerol gradient analysis showed indeed recombinant Mip1 to run as a single peak with the maximum in the gradient fraction corresponding to 125–145 kDa (Fig. 2A). DNA polymerase activity appeared in the same fractions, demonstrating that approximately 140 kDa protein is the active form of the polymerase (Fig. 2B). Thus, our purification scheme gained in homogenous preparation of recombinant catalytically active Mip1 suitable for further biochemical analysis. 3.3. Nucleotide polymerization activity of Mip1

Fig. 1. (A) N-terminal sequence of Mip1 pre-protein. Mature Mip1 N-terminus as predicted by TargetP 1.1 and estimated by Edman degradation are indicated accordingly. (B) Purification of recombinant S. cerevisiae mitochondrial DNA polymerase, Mip1. 6xHis-tagged Mip1 with truncated mitochondrial targeting sequence (141.6 kDa) was overexpressed in E. coli and purified from cleared bacterial lysate by combination of Ni-NTA affinity and S-Sepharose ion exchange chromatographies. Fractions from each purification step were analyzed on 10% SDS-PAGE.

In order to evaluate the catalytic activity of recombinant Mip1, a primer elongation assay was performed on single-primed M13 ssDNA. An enzyme-substrate complex was first allowed to form by incubation on ice, after what the reaction was started by the addition of dNTP and terminated with 80% formamide and 25 mM EDTA. Primer elongation was followed in time and reaction products were separated on a denaturing polyacrylamide gel (Fig. 3). Mip1 displayed high catalytic activity on M13 ssDNA as already during the first 10 s of polymerization reaction products of over 600 nt size were generated (Fig. 3, lane 1). From that we estimated that the rate constant value for Mip1 catalyzed DNA polymerization (kpol) at 30 °C is 63.2 ± 1.2 s− 1. It should be noted though that several distinct pause sites were observed on M13 ssDNA substrate indicating that some regions were harder to pass for Mip1. Therefore, it is possible that maximum polymerization rate of Mip1 could be even higher. Our estimate of kpol for Mip1 is in close accordance with kpol of 45 s−1 found for the human Polγ holoenzyme using pre-steady state kinetic measurements on oligomeric substrate at 30 °C (Johnson et al., 2000).

and its sensitivity to proteolysis, overexpression in S. cerevisiae has been used (Eriksson et al., 1995; Vanderstraeten et al., 1998). However no reports exist describing the purification of Mip1 from heterologous host. Here we describe a purification scheme of recombinant Mip1 from E. coli. C-terminally 6xHis tagged Mip1 was expressed in BL21CodonPlus(DE3)-RIL strain to compensate the difference in codon usage. The expression temperature was lowered to 23 °C to avoid packaging of the protein to inclusion bodies. Over 97% purity of recombinant Mip1 was achieved by purification with a combination of Ni-NTA affinity and S-Sepharose ion exchange chromatography (Fig. 1B). In total our purification scheme gained in 0.5 mg of catalytically active Mip1 from 360 mg of cleared bacterial lysate (Table 1). The specific activity of 7.0 × 105 U/mg was achieved after final purification step measured by incorporation of [α-32P]dCTP into calf thymus activated DNA (Table 1). This is in reasonable accordance with the specific activity of 1.6 × 106 U/mg reported for Mip1 overexpressed in yeast (Eriksson et al., 1995). The specific activity of 2.7 × 107 U/mg was reported for endogenous Mip1 purified from yeast mitochondria (Lucas et al., 2004). To investigate the oligomeric state of the recombinant Mip1, a sample of Mip1 was loaded onto a 10–30% glycerol gradient. Following centrifugation, gradient fractions were analyzed on 10% Table 1 Purification of recombinant Mip1.a Fraction

Total protein (mg)

Specific activity (U/mg)b

Total activity (U)

Cleared lysate Ni-NTA S Sepharose

360 4.9 0.5

– 1.9 × 105 7.0 × 105

– 9.2 × 105 5.8 × 105

a

Purification data from 3.6 g of bacterial cells (1.3 l of culture). One unit of DNA polymerase incorporates 1 pmol of dCTP into calf-thymus activated DNA in 30 min at 30 °C. b

Fig. 2. Glycerol gradient sedimentation of recombinant Mip1. 130 μg of recombinant Mip1 were loaded onto a 5 ml 10–30% glycerol gradient. After ultracentrifugation 200 μl fractions were collected from the top of the gradient and analyzed on 10% SDS-PAGE (A). A sample from each fraction was tested for DNA polymerase activity by incorporation of [α-32P]- dCTP into calf thymus activated DNA (B, ●) and protein concentration by UV absorbance at 280 nm (B, ○). Sedimentation profiles of catalase (240 kDa), aldolase (161 kDa), BSA (67 kDa) and ovalbumin (45 kDa) were determined in a parallel gradient.

K. Viikov et al. / Mitochondrion 11 (2011) 119–126

123

However, kpol of human Polγ drops significantly to 3.5 s− 1 when measured in the absence of the processivity subunit PolγB (Graves et al., 1998). The catalytic activity of Mip1 measured here is therefore more in the range of the human Polγ holoenzyme rather than catalytic subunit alone. Although to finalize this conclusion, a direct comparison of different Polγ's in an identical experimental setup should be performed. 3.4. Mip1 is a highly processive DNA polymerase

Fig. 3. Mip1 DNA polymerase activity on single-primed M13 ssDNA. 32P-labeled universal primer was annealed to circular M13 ssDNA to form a substrate. DNA polymerization reaction was performed at 30 °C under following conditions: 25 nM Mip1, 2.5 nM M13/ USP, 100 μM dNTP, 10 mM MgCl2, 20 mM Tris pH 8.0, 2 mM DTT, 40 mM KCl, 0.5 mg/ml BSA. Polymerase reaction was started by mixing enzyme–substrate premix with nucleotides and MgCl2. Reaction was stopped with 80% formamide, 25 mM EDTA after indicated time. Zero data point was obtained by mixing enzyme–substrate premix with stop buffer before addition of nucleotides. Reaction products were heat denaturated and resolved on a 6 M Urea 1× TBE 8% polyacrylamide gel.

In order to evaluate the processivity of Mip1, the polymerase activity was measured under single-turnover conditions (Bambara et al., 1995). Single-primed M13 ssDNA was preincubated with the DNA polymerase to let enzyme–substrate complex to form. The polymerase reaction was then started by the addition of dNTP and large excess of competitor unlabeled DNA substrate–DNA trap. Reaction products were denaturated under alkaline conditions and resolved on an alkaline agarose gel (Fig. 4A). DNA trap limits the extension of the primer to one round of processive synthesis and therefore provides single-turnover reaction conditions. The efficiency of the DNA trap was verified by adding it to the enzyme–substrate premix along with radiolabeled DNA substrate. Under these conditions no primer elongation was detected indicating that DNA trap worked efficiently (data not shown). As a positive control of the synthesis reaction, DNA trap was omitted allowing polymerase to rebind to the substrate (Fig. 4B, D). Under these reaction conditions Mip1 was able to synthesize the full length M13 ssDNA circle (7250 bp) in 2 min. This is in good agreement with the speed of ~ 60 nt/s as determined above (Section 3.4) as well as in accordance with the data obtained with endogenous Mip1 by Eriksson et al., where first products of fully elongated M13 DNA appear after 2 min of the reaction (Eriksson et al., 1995). Previous analysis of Mip1 purified from overexpressing yeast cells has shown Mip1 to display properties of a processive DNA polymerase (Vanderstraeten et al., 1998). Majority of elongated primer was present in the full-length size template fraction after 10 min incubation of endogenous Mip1 with primed M13 ssDNA (Vanderstraeten et al., 1998). Similar results were obtained with recombinant Mip1 in the absence of the DNA trap (Fig. 4B). However, upon addition of the trap DNA, primer elongation was visible during the first minute of the reaction. Afterwards no significant extension of the radiolabeled products was observed (Fig. 4A). Therefore, under single-hit conditions Mip1 also displayed the characteristics of a processive DNA polymerase as it was able to synthesize DNA stretches of up to 2000– 2500 nt per one binding event. Using a weighted mean analysis of the polymerization products an average processivity of Mip1 was evaluated to 480 ± 20 nt, which represents the number of nucleotides incorporated on average by Mip1 per one binding event. The DNA polymerase from bacteriophage T7 is known to be highly processive in complex with thioredoxin. The processivity of T7 DNA polymerase was measured to 800 nt on primed single-stranded substrate in a single-molecule experiment (Lee et al., 2006). Even higher processivity value of 1500 was calculated for T7 DNA polymerase from kpol/koff ratio determined by pre-steady state measurements (Graves et al., 1998). We measured the processivity of bacteriophage T7 DNA polymerase in complex with thioredoxin in a parallel reaction (Fig. 4C). T7 DNA polymerase was able to synthesize DNA stretches of up to 700–800 nt before dissociation from M13 ssDNA. The average processivity of T7 DNA polymerase was estimated to 257 ± 6 nt. The processivity of T7 measured here is in agreement with previously published (Lee et al., 2006). According to our data the processivity of Mip1 on M13 ssDNA is in the same range as that of the highly processive T7 DNA polymerase. The isolated catalytic subunit of human Polγ was shown to have processivity on M13 ssDNA of only 50–75 nucleotides (Longley et al., 1998). The processivity of PolγA was enhanced significantly by association with the accessory subunit PolγB. Human Polγ holoenzyme

124

K. Viikov et al. / Mitochondrion 11 (2011) 119–126

Fig. 4. Processivity of Mip1 and T7 DNA polymerase on M13 ssDNA. In A and C, processivity of the polymerases was measured under single turnover conditions on M13 ssDNA primed with 32P-labeled universal primer in the presence of large excess of trap DNA (1 mg/ml calf thymus activated DNA). First, enzyme–substrate complex was allowed to form on ice, then reaction was started by addition of dNTP and trap DNA. Reaction was allowed to proceed for indicated time and stopped with 0.25 mg/ml Proteinase K, 0.5% SDS, 10 mM EDTA. Reaction products were phenol/chloroform extracted, precipitated with ethanol, denaturated with alkali and separated on 0.8% alkaline agarose gel. In B and D, trap DNA was omitted from the reaction to allow the rebinding of the DNA polymerase to the already elongated substrate. For Mip1 (A, B), the reaction was performed at 30 °C under following conditions: 6 nM Mip1, 6 nM M13/USP substrate, 10 mM MgCl2, 20 mM Tris pH 8.0, 2 mM DTT, 40 mM KCl, 0.5 mg/ ml BSA, 100 μM dNTP. For T7 DNA polymerase (C, D), reaction was performed at 37 °C under following conditions: 0.002 U/μl T7 DNA polymerase/thioredoxin, 6 nM M13/USP substrate, 10 mM MgCl2, 100 μM dNTP, 40 mM Tris pH 7.5, 1 mM DTT, 0.1 mg/ml BSA. The arrow indicates the position of the 7250 nt long fully elongated M13 DNA circle.

was able to elongate M13 primer up to several thousand nucleotides under single-turnover conditions (Lim et al., 1999). Our data show that Mip1 is able to perform processive DNA synthesis at the comparable level with human Polγ holoenzyme. Thus, high intrinsic processivity and catalytic activity of Mip1 suggest that it could function as a singlesubunit enzyme without additional processivity factors. 3.5. Mip1 is capable of strand displacement DNA synthesis It is generally accepted that most DNA polymerases require destabilization of the duplex DNA by ssDNA binding protein (SSB) and/or the unwinding activity of a DNA helicase for strand

displacement DNA synthesis. For example, DNA polymerase from T7 bacteriophage requires stimulation by SSB to perform strand displacement DNA synthesis (He et al., 2003; Andraos et al., 2004). Human Polγ requires the helicase Twinkle as well as the accessory subunit PolγB to perform rolling circle DNA synthesis in vitro (Korhonen et al., 2004; Farge et al., 2007). To evaluate DNA synthesis involving strand displacement, an 81 nt minicircle ssDNA primed with a radiolabeled 30 nt oligomer was used as a substrate. In this case, elongation of the primer to products larger than 81 nt would indicate strand displacement synthesis. T7 DNA polymerase was used as a control in the reaction, as it was previously shown to be incapable of strand displacement activity (Andraos et al., 2004). Complete stalling of DNA synthesis at the product size of 81 nt was observed with T7 DNA polymerase (Fig. 5B). Larger products were not detected even after 30 min, confirming that T7 DNA polymerase does not perform strand displacement DNA synthesis. Mip1 on the other hand was able to elongate the 30 nt primer on the minicircle substrate without significant stalling of the polymerization process (Fig. 5A). This indicates that Mip1 has the intrinsic ability to displace duplex DNA strand during polymerization through double-stranded DNA regions. Mip1 performed strand displacement synthesis on minicircle DNA quite efficiently as its polymerization speed on double-stranded template was ~ 20 nt/s which is only 3 times lower than that on single-stranded substrate. Mip1 strand displacement activity was reevaluated on a long natural substrate such as circular M13 ssDNA (Fig. 5C). Excess of Mip1 over the template DNA was used and radiolabeled primer elongation was followed in time. A smear of products longer than the size of the fully elongated M13 DNA circle appeared after prolonged Mip1 incubation with the substrate (Fig. 5C). This indicated that to some extent Mip1 was also able to displace duplex DNA when M13 was used as a substrate. In case of T7 DNA polymerase, no products of longer size than 7 kb were detected as expected (Fig. 5D). However, Mip1 performed strand displacement synthesis on M13 DNA less efficiently than on a minicircle DNA as the majority of the synthesis products were terminated around 7 kb, the size of the fully elongated M13 DNA circle. This could be possibly due to the low processivity of the strand displacement synthesis by Mip1. Thus, when excess of the template over Mip1 was used as in Fig. 4B, no visible strand displacement products appeared during 10 min reaction. This may explain why strand displacement activity could have been left undetected on M13 ssDNA previously (Eriksson et al., 1995; Vanderstraeten et al., 1998). DNA polymerase from bacteriophage T5 is one other member of the polymerase family A known to perform extensive strand displacement DNA synthesis (Andraos et al., 2004; Fujimura and Roop, 1976). Interestingly, T5 DNA polymerase is also similar to Mip1 in the aspect of high processivity and single-subunit composition (Andraos et al., 2004; Das and Fujimura, 1979). While human Polγ replicase complex has several common features with that of T7 bacteriophage, Mip1 biochemical properties suggest that yeast mitochondrial replisome could utilize a different mechanism possibly similar to that of T5 bacteriophage. The replication mechanism of mtDNA in S. cerevisiae is not yet clarified. Among others there are evidences of rolling-circle like replication, as the head-to-tail concatemers of mtDNA were found as the major form of replication intermediates (Maleszka et al., 1991). The ability of Mip1 to perform strand displacement synthesis would make the polymerase well suited for uncoupled DNA synthesis like rolling circle. Unless there are specific mechanisms to coordinate Mip1 activity for leading and lagging strand synthesis in vivo, Mip1 strand displacement activity would act in favor of the uncoupled replication mechanism. To date, no homologue of human Twinkle DNA helicase has been identified in S. cerevisiae mitochondria. Two other DNA helicases, Pif1 and Hmi1 were shown to be involved in yeast mtDNA metabolism (Foury and Lahaye, 1987; Lahaye et al., 1991; Sedman et al., 2000;

K. Viikov et al. / Mitochondrion 11 (2011) 119–126

125

Sedman et al., 2005). Pif1 deletion affects the stability of mtDNA upon exposure to UV light and at elevated temperatures as 37 °C, and it was proposed to be involved in mtDNA repair and recombination (Foury and Kolodynski, 1983; O'Rourke et al., 2002). Deletion of Hmi1 has a more severe effect on mtDNA metabolism at 28 °C and Hmi1 mutants do not retain functional mtDNA (Sedman et al., 2000). However, Hmi1 displays the characteristics of a distributive helicase in vitro, thus the question of the replicative DNA helicase in yeast mitochondria remains to be unresolved (Kuusk et al., 2005). It has been also noted that certain S. cerevisiae strains, where mtDNA is largely deleted and the remaining part amplified, can maintain their so-called rho− genome in the absence of both Pif1 and Hmi1 (Sedman et al., 2000). Strand displacement activity would provide Mip1 with the ability to overcome substrate obstacles like hairpin structures and to elongate through double-stranded DNA regions. Thus, it is tempting to speculate that some S. cerevisiae rho− genomes can be propagated without the involvement of a replicative helicase. Acknowledgements We would like to thank Joachim Gerhold and Silja Kuusk for critical comments on the manuscript, Tiina Sedman for yeast expression plasmid and Maie Loorits for excellent technical support. This work was supported by grant 7013 from Estonian Science Foundation. References

Fig. 5. Strand displacement activity of Mip1 and T7 DNA polymerase. In A and B, 81 nt large single-stranded minicircle with annealed 32P-labeled 30 nt primer was used as a substrate. Reaction was stopped with 80% formamide, 25 mM EDTA and the products were resolved on a 6 M Urea 1× TBE 8% polyacrylamide gel. In C and D, strand displacement activity was measured using circular M13 ssDNA (7250 nt) primed with 32 P-labeled USP. Reaction was stopped with 0.25 mg/ml Proteinase K, 0.5% SDS, 10 mM EDTA. Reaction products were phenol/chlorophorm extracted, precipitated with ethanol, denaturated with alkali and separated on 0.8% alkaline agarose gel. For Mip1 (A, C), the reaction was performed at 30 °C under following conditions: 50 nM Mip1 and 20 nM minicircle substrate (or 16 nM Mip1 and 0.5 nM M13/USP substrate), 10 mM MgCl2, 20 mM Tris pH 8.0, 2 mM DTT, 40 mM KCl, 0.5 mg/ml BSA, 100 μM dNTP. For T7 DNA polymerase (B, D), reaction was performed at 37 °C under following conditions: 0.2 U/μl T7 DNA polymerase and 20 nM minicircle substrate (or 0.02 U/μl T7 DNA polymerase and 0.5 nM M13/USP substrate), 10 mM MgCl2, 100 μM dNTP, 40 mM Tris pH 7.5, 1 mM DTT, 0.1 mg/ml BSA. The arrow indicates the position of the 7250 nt long fully elongated M13 DNA circle.

Andraos, N., Tabor, S., Richardson, C.C., 2004. The highly processive DNA polymerase of bacteriophage T5. Role of the unique N and C termini. J. Biol. Chem. 279, 50609–50618. Bambara, R.A., Fay, P.J., Mallaber, L.M., 1995. Methods of analyzing processivity. Meth. Enzymol. 262, 270–280. Baruffini, E., Lodi, T., Dallabona, C., Foury, F., 2007. A single nucleotide polymorphism in the DNA polymerase gamma gene of Saccharomyces cerevisiae laboratory strains is responsible for increased mitochondrial DNA mutability. Genetics 177 (2), 1227–1231. Bernad, A., Blanco, L., Lazaro, J.M., Martin, G., Salas, M., 1989. A conserved 3′–5′ exonuclease active site in prokaryotic and eukaryotic DNA polymerases. Cell 59, 219–228. Biswas, T.K., Sengupta, P., Green, R., Hakim, P., Biswas, B., Sen, S., 1995. Properties of mitochondrial DNA polymerase in mitochondrial DNA synthesis in yeast. Acta Biochim. Pol. 42, 317–324. Blanco, L., Bernad, A., Salas, M., 1991. MIP1 DNA polymerase of S. cerevisiae: structural similarity with the E. coli DNA polymerase I-type enzymes. Nucleic Acids Res. 19, 955. Carrodeguas, J.A., Theis, K., Bogenhagen, D.F., Kisker, C., 2001. Crystal structure and deletion analysis show that the accessory subunit of mammalian DNA polymerase gamma, Pol gamma B, functions as a homodimer. Mol. Cell 7, 43–54. Das, S.K., Fujimura, R.K., 1979. Processiveness of DNA polymerases. A comparative study using a simple procedure. J. Biol. Chem. 254, 1227–1232. Daum, G., Bohni, P.C., Schatz, G., 1982. Import of proteins into mitochondria. Cytochrome b2 and cytochrome c peroxidase are located in the intermembrane space of yeast mitochondria. J. Biol. Chem. 257, 13028–13033. Emanuelsson, O., Nielsen, H., Brunak, S., von Heijne, G., 2000. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300, 1005–1016. Eriksson, S., Xu, B., Clayton, D.A., 1995. Efficient incorporation of anti-HIV deoxynucleotides by recombinant yeast mitochondrial DNA polymerase. J. Biol. Chem. 270, 18929–18934. Falkenberg, M., Lehman, I.R., Elias, P., 2000. Leading and lagging strand DNA synthesis in vitro by a reconstituted herpes simplex virus type 1 replisome. Proc. Natl. Acad. Sci. U.S.A. 97, 3896–3900. Farge, G., Pham, X.H., Holmlund, T., Khorostov, I., Falkenberg, M., 2007. The accessory subunit B of DNA polymerase gamma is required for mitochondrial replisome function. Nucleic Acids Res. 35, 902–911. Foury, F., Kolodynski, J., 1983. Pif mutation blocks recombination between mitochondrial rho+ and rho− genomes having tandemly arrayed repeat units in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U.S.A. 80, 5345–5349. Foury, F., Lahaye, A., 1987. Cloning and sequencing of the PIF gene involved in repair and recombination of yeast mitochondrial DNA. EMBO J. 6, 1441–1449. Fujimura, R.K., Roop, B.C., 1976. Characterization of DNA polymerase induced by bacteriophage T5 with DNA containing single strand breaks. J. Biol. Chem. 251, 2168–2174. Genga, A., Bianchi, L., Foury, F., 1986. A nuclear mutant of Saccharomyces cerevisiae deficient in mitochondrial DNA replication and polymerase activity. J. Biol. Chem. 261, 9328–9332.

126

K. Viikov et al. / Mitochondrion 11 (2011) 119–126

Graves, S.W., Johnson, A.A., Johnson, K.A., 1998. Expression, purification, and initial kinetic characterization of the large subunit of the human mitochondrial DNA polymerase. Biochemistry 37, 6050–6058. Gray, H., Wong, T.W., 1992. Purification and identification of subunit structure of the human mitochondrial DNA polymerase. J. Biol. Chem. 267, 5835–5841. Graziewicz, M.A., Longley, M.J., Bienstock, R.J., Zeviani, M., Copeland, W.C., 2004. Structure-function defects of human mitochondrial DNA polymerase in autosomal dominant progressive external ophthalmoplegia. Nat. Struct. Mol. Biol. 11, 770–776. Graziewicz, M.A., Longley, M.J., Copeland, W.C., 2006. DNA polymerase gamma in mitochondrial DNA replication and repair. Chem. Rev. 106, 383–405. He, Z.G., Rezende, L.F., Willcox, S., Griffith, J.D., Richardson, C.C., 2003. The carboxylterminal domain of bacteriophage T7 single-stranded DNA-binding protein modulates DNA binding and interaction with T7 DNA polymerase. J. Biol. Chem. 278, 29538–29545. Huber, H.E., Tabor, S., Richardson, C.C., 1987. Escherichia coli thioredoxin stabilizes complexes of bacteriophage T7 DNA polymerase and primed templates. J. Biol. Chem. 262, 16224–16232. Insdorf, N.F., Bogenhagen, D.F., 1989. DNA polymerase gamma from Xenopus laevis. I. The identification of a high molecular weight catalytic subunit by a novel DNA polymerase photolabeling procedure. J. Biol. Chem. 264, 21491–21497. Ito, J., Braithwaite, D.K., 1990. Yeast mitochondrial DNA polymerase is related to the family A DNA polymerases. Nucleic Acids Res. 18, 6716. Johnson, A.A., Tsai, Y., Graves, S.W., Johnson, K.A., 2000. Human mitochondrial DNA polymerase holoenzyme: reconstitution and characterization. Biochemistry 39, 1702–1708. Jones, E.W., 1991. Tackling the protease problem in Saccharomyces cerevisiae. Meth. Enzymol. 194, 428–453. Kaguni, L.S., 2004. DNA polymerase gamma, the mitochondrial replicase. Annu. Rev. Biochem. 73, 293–320. Kasiviswanathan, R., Longley, M.J., Chan, S.S., Copeland, W.C., 2009. Disease mutations in the human mitochondrial DNA polymerase thumb subdomain impart severe defects in mitochondrial DNA replication. J. Biol. Chem. 284, 19501–19510. Kelman, Z., Hurwitz, J., O'Donnell, M., 1998. Processivity of DNA polymerases: two mechanisms, one goal. Structure 6, 121–125. Korhonen, J.A., Pham, X.H., Pellegrini, M., Falkenberg, M., 2004. Reconstitution of a minimal mtDNA replisome in vitro. EMBO J. 23, 2423–2429. Kuusk, S., Sedman, T., Jõers, P., Sedman, J., 2005. Hmi1p from Saccharomyces cerevisiae mitochondria is a structure-specific DNA helicase. J. Biol. Chem. 280, 24322–24329. Lahaye, A., Stahl, H., Thines-Sempoux, D., Foury, F., 1991. PIF1: a DNA helicase in yeast mitochondria. EMBO J. 10, 997–1007. Lecrenier, N., Van Der Bruggen, P., Foury, F., 1997. Mitochondrial DNA polymerases from yeast to man: a new family of DNA polymerases. Gene 185, 147–152. Lee, J.B., Hite, R.K., Hamdan, S.M., Xie, X.S., Richardson, C.C., van Oijen, A.M., 2006. DNA primase acts as a molecular brake in DNA replication. Nature 439 (7076), 621–624. Lee, Y.S., Kennedy, W.D., Yin, Y.W., 2009. Structural insight into processive human mitochondrial DNA synthesis and disease-related polymerase mutations. Cell 139, 312–324. Lestienne, P., 1987. Evidence for a direct role of the DNA polymerase gamma in the replication of the human mitochondrial DNA in vitro. Biochem. Biophys. Res. Commun. 146, 1146–1153. Lim, S.E., Longley, M.J., Copeland, W.C., 1999. The mitochondrial p55 accessory subunit of human DNA polymerase gamma enhances DNA binding, promotes processive

DNA synthesis, and confers N-ethylmaleimide resistance. J. Biol. Chem. 274, 38197–38203. Longley, M.J., Ropp, P.A., Lim, S.E., Copeland, W.C., 1998. Characterization of the native and recombinant catalytic subunit of human DNA polymerase gamma: identification of residues critical for exonuclease activity and dideoxynucleotide sensitivity. Biochemistry 37, 10529–10539. Longley, M.J., Graziewicz, M.A., Bienstock, R.J., Copeland, W.C., 2005. Consequences of mutations in human DNA polymerase gamma. Gene 354, 125–131. Lucas, P., Lasserre, J.P., Plissonneau, J., Castroviejo, M., 2004. Absence of accessory subunit in the DNA polymerase gamma purified from yeast mitochondria. Mitochondrion 4, 13–20. Luoma, P.T., Luo, N., Löscher, W.N., Farr, C.L., Horvath, R., Wanschitz, J., Kiechl, S., Kaguni, L.S., Suomalainen, A., 2005. Functional defects due to spacer-region mutations of human mitochondrial DNA polymerase in a family with an ataxia-myopathy syndrome. Hum. Mol. Genet. 14, 1907–1920. Maleszka, R., Skelly, P.J., Clark-Walker, G.D., 1991. Rolling circle replication of DNA in yeast mitochondria. EMBO J. 10 (12), 3923–3929. Nielsen, H., Engelbrecht, J., Brunak, S., von Heijne, G., 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10, 1–6. Olson, M.W., Wang, Y., Elder, R.H., Kaguni, L.S., 1995. Subunit structure of mitochondrial DNA polymerase from Drosophila embryos. Physical and immunological studies. J. Biol. Chem. 270, 28932–28937. O'Rourke, T.W., Doudican, N.A., Mackereth, M.D., Doetsch, P.W., Shadel, G.S., 2002. Mitochondrial dysfunction due to oxidative mitochondrial DNA damage is reduced through cooperative actions of diverse proteins. Mol. Cell. Biol. 22, 4086–4093. Rupp, S., Summers, E., Lo, H.J., Madhani, H., Fink, G., 1999. MAP kinase and cAMP filamentation signaling pathways converge on the unusually large promoter of the yeast FLO11 gene. EMBO J. 18, 1257–1269. Sedman, T., Kuusk, S., Kivi, S., Sedman, J., 2000. A DNA helicase required for maintenance of the functional mitochondrial genome in Saccharomyces cerevisiae. Mol. Cell. Biol. 20, 1816–1824. Sedman, T., Jõers, P., Kuusk, S., Sedman, J., 2005. Helicase Hmi1 stimulates the synthesis of concatemeric mitochondrial DNA molecules in yeast Saccharomyces cerevisiae. Curr. Genet. 47, 213–222. Tabor, S., Huber, H.E., Richardson, C.C., 1987. Escherichia coli thioredoxin confers processivity on the DNA polymerase activity of the gene 5 protein of bacteriophage T7. J. Biol. Chem. 262, 16212–16223. Van Goethem, G., Dermaut, B., Löfgren, A., Martin, J.J., Van Broeckhoven, C., 2001. Mutation of POLG is associated with progressive external ophthalmoplegia characterized by mtDNA deletions. Nat. Genet. 28, 211–212. Vanderstraeten, S., Van den Brûle, S., Hu, J., Foury, F., 1998. The role of 3′–5′ exonucleolytic proofreading and mismatch repair in yeast mitochondrial DNA error avoidance. J. Biol. Chem. 273, 23690–23697. Wernette, C.M., Kaguni, L.S., 1986. A mitochondrial DNA polymerase from embryos of Drosophila melanogaster. Purification, subunit structure, and partial characterization. J. Biol. Chem. 261, 14764–14770. Yakubovskaya, E., Chen, Z., Carrodeguas, J.A., Kisker, C., Bogenhagen, D.F., 2006. Functional human mitochondrial DNA polymerase gamma forms a heterotrimer. J. Biol. Chem. 281, 374–382. Young, M.J., Theriault, S.S., Li, M., Court, D.A., 2006. The carboxyl-terminal extension on fungal mitochondrial DNA polymerases: identification of a critical region of the enzyme from Saccharomyces cerevisiae. Yeast 23, 101–116.