- Email: [email protected]
ZDHHC17 promotes axon outgrowth by regulating TrkA–tubulin complex formation
Molecular and Cellular Neuroscience 68 (2015) 194–202
Contents lists available at ScienceDirect
Molecular and Cellular Neuroscience journal homepage: www.elsevier.com/locate/ymcne
ZDHHC17 promotes axon outgrowth by regulating TrkA–tubulin complex formation Wei Shi a, Fen Wang a, Ming Gao c, Yang Yang d, Zhaoxia Du a, Chen Wang a, Yao Yao a, Kun He a, Xueran Chen b,⁎, Aijun Hao a,⁎⁎ a Key Laboratory of the Ministry of Education for Experimental Teratology, Shandong Provincial Key Laboratory of Mental Disorders, Department of Histology and Embryology, Shandong University School of Medicine, No. 44, Wenhua Xi Road, Jinan, Shandong 250012, PR China b Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, PR China c Reproductive Medical Center of Shandong University, Shandong University School of Medicine, No. 44, Wenhua Xi Road, Jinan, Shandong 250012, PR China d Infertility Center, Qilu Hospital, Shandong University School of Medicine, No. 44, Wenhua Xi Road, Jinan, Shandong 250012, PR China
a r t i c l e
i n f o
Article history: Received 21 August 2014 Revised 7 July 2015 Accepted 23 July 2015 Available online 29 July 2015 Keywords: ZDHHC17 Axon outgrowth ERK1/2 TrkA Tubulin
a b s t r a c t Correct axonal growth during nervous system development is critical for synaptic transduction and nervous system function. Proper axon outgrowth relies on a suitable growing environment and the expression of a series of endogenous neuronal factors. However, the mechanisms of these neuronal proteins involved in neuronal development remain unknown. ZDHHC17 is a member of the DHHC (Asp-His-His-Cys)-containing family, a family of highly homologous proteins. Here, we show that loss of function of ZDHHC17 in zebrafish leads to motor dysfunction in 3-day post-fertilization (dpf) larvae. We performed immunolabeling analysis to reveal that mobility dysfunction was due to a significant defect in the axonal outgrowth of spinal motor neurons (SMNs) without affecting neuron generation. In addition, we found a similar phenotype in zdhhc17 siRNA-treated neural stem cells (NSCs) and PC12 cells. Inhibition of zdhhc17 limited neurite outgrowth and branching in both NSCs and PC12. Furthermore, we discovered that the level of phosphorylation of extracellular-regulated kinase (ERK) 1/2, a major downstream effector of tyrosine kinase (TrkA), was largely upregulated in ZDHHC17 overexpressing PC12 cells by a mechanism independent on its palmitoyltransferase (PAT) activity. Specifically, ZDHHC17 is necessary for proper TrkA–tubulin module formation in PC12 cells. These results strongly indicate that ZDHHC17 is essential for correct axon outgrowth in vivo and in vitro. Our findings identify ZDHHC17 as an important upstream factor of ERK1/2 to regulate the interaction between TrkA and tubulin during neuronal development. © 2015 Elsevier Inc. All rights reserved.
1. Introduction Successful axon outgrowth and formation primarily depend on two factors: a permissive environment and the expression of growthassociated proteins (GAPs) in neurons including transcription factors, GAP-43, and several cell adhesion and cytoskeletal proteins (Akiyama et al., 2012; Cheng and Poo, 2012; Euteneuer et al., 2013; Franze, 2013; Auer et al., 2012; Frey et al., 2000; Langhorst et al., 2008; Li et al., 2013; Ye et al., 2012). In response to appropriate signals, neurons exhibit remarkable properties that they express growth-associated proteins to promote neuron differentiation and axon outgrowth. However, Abbreviations: DHHC, Asp-His-His-Cys; dpf, days post-fertilization; ERK1/2, extracellular signal-related kinase1/2; hpf, hours post-fertilization; JNK, c-Jun N terminus kinase; MAPK, mitogen-activated protein kinase; NSC, neural stem cell; PAT, palmitoyltransferase; SMN, spinal motor neuron; TrkA, tyrosine kinase. ⁎ Correspondence to: X. Chen, Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, No. 350 Shushan Hu Road, Hefei 230031, PR China. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (X. Chen), [email protected] (A. Hao).
http://dx.doi.org/10.1016/j.mcn.2015.07.005 1044-7431/© 2015 Elsevier Inc. All rights reserved.
the neuron-intrinsic factors involved in this precise temporal and spatial assembly are not well defined. In particular, the molecular mechanisms by which these signals regulate the assembly of complexes for cytoskeletal remodeling are largely unknown. The zinc finger DHHC-containing (ZDHHC) proteins belong to a family of palmitoyltransferases (PATs) that catalyze protein palmitoylation, a posttranslational lipid modification affecting protein targeting, trafficking, and function (Fukata et al., 2004, 2006a). Many members of the DHHC family are expressed in neurons, but ZDHHC17 is detected far more frequently at both mRNA and protein levels in neuronal studies (Doyle et al., 2008; Heiman et al., 2008; Huang et al., 2004, 2009). This suggests that ZDHHC17 might be particularly important in neuronal regulation. Consistent with this hypothesis, ZDHHC17 is implicated in higher brain function, since mice with reduced ZDHHC17 levels displayed behavioral, biochemical, and neuropathological defects that are reminiscent of Huntington's disease (HD) (Singaraja et al., 2011; Young et al., 2012b). ZDHHC17 was recently identified as a key player in ischemic stroke and a regulator of neuronal cell death (Yang and Cynader, 2011). In addition to its well-studied function in protein palmitoylation, other roles of ZDHHC17 are just beginning
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
to be appreciated, including the mediation of Mg2+ transport (Goytain et al., 2008), regulation of Ca2+ channel functions (Hines et al., 2010) and activation of c-Jun N-terminus kinase (JNK) pathways (Harada et al., 2003). Moreover, ZDHHC17 is responsible for palmitoylation of large conductance calcium- and voltage-activated potassium (BK) channels, which controls membrane potential and calcium influx (Tian et al., 2010). However, the roles and molecular mechanisms of ZDHHC17 in neuronal development and function are not yet fully understood. We used zdhhc17 morpholino (MO) in zebrafish and zdhhc17specific siRNA in NSCs and PC12 cells to demonstrate that ZDHHC17 regulates spinal motor neuron (SMN) axonal formation in vivo, axonal growth in vitro, NSC differentiation, and PC12 neurite outgrowth. Collectively, our results show that ZDHHC17 is a neuron-intrinsic factor for axon growth that is crucial for the TrkA–tubulin interaction, which regulates signal transmission, including ERK1/2 phosphorylation. 2. Material and methods 2.1. Zebrafish maintenance and treatment The zebrafish strains AB was maintained and bred according to standard procedures. We used the Esen zebrafish culture system (Esen environ science, Beijing, China) to control the temperature and the day–night cycles. All embryos were maintained at 28.5 °C without crowding (5–10 embryos/mL). Larval movements stimulated by the touch response test were quantified using the ImageJ manual tracking plugins (National Institutes of Health, Bethesda, MD, USA).
195
PC12 is a cell line derived from a pheochromocytoma of the rat adrenal medulla. Their embryonic origin is the neural crest, which contains a mixture of neuroblastic cells and eosinophilic cells. PC12 cells were maintained in DMEM plus 10% horse serum, 5% fetal calf serum (FCS) and antibiotics at 37 °C with 5% CO2 and 95% air. For differentiation, neuronal growth factor (NGF, Invitrogen) was added at 50 ng/mL under the serum conditions. Neurite outgrowth was visible 3 days later. For protein expression and zdhhc17 RNAi, the transfection of expression plasmids and pSuper-zdhhc17 siRNA was carried out using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. 2.4. Immunoprecipitation and immunoblotting Cells were washed once in PBS and lysed 30 min at 4 °C in IP buffer (0.5% Nonidet P-40, 500 mM Tris·HCl (pH 7.4), 20 mM EDTA, 10 mM NaF, 2 mM benzamidine, and a mixture of protease inhibitors) and centrifuged 15 min, 13,000 rpm at 4 °C. The supernatants were incubated with adequate antibody(1 μg) at 4 °C overnight and incubated 2–4 h at 4 °C with anti-protein A-coupled Sepharose beads. The proteins were then eluted and analyzed by Western blotting as described previously (Zhao et al., 2011). The primary antibodies were as follows: For Western blotting: anti-ERK1/2 (1:2000, Cell Signaling Technology), anti-p-ERK1/2 (1:2000, Cell Signaling Technology), anti-p38 (1:1000, Cell Signaling Technology), anti-p-p38 (1:1000, Cell Signaling Technology), anti-JNK (1:1000, Cell Signaling Technology), anti-p-JNK (1:1000, Cell Signaling Technology) and anti-β-actin (1:2000, Sigma). For immunoprecipitation: anti-TrkA (Abcam), anti-tubulin (Santa Cruz Biotechnology) and anti-GFP (Santa Cruz Biotechnology).
2.2. Reverse transcription polymerase chain reaction (RT-PCR) Total RNA was isolated using an RNeasy kit (Qiagen, USA) according to the manufacturer's instructions. During this process, total RNA was treated with DNaseI. First-strand cDNA synthesis was carried out using Reverse Transcription System (Promega, USA), following the manufacturer's protocol. PCR was performed with Premix Taq mixture (Invitrogen, USA). β-Actin was used as an internal control. The PCR products were separated on 1.2% agarose gel by electrophoresis, stained with ethidium bromide and visualized under the ultraviolet light. The primers' sequences and the sizes of amplified products were shown in Table 1. 2.3. Cell culture and transfection All reagents for cell cultures were purchased from Invitrogen. For primary NSC culture, brains were removed from Kun Ming mouse (KM strain) embryos at E12.5. After washing and resuspension, cells were seeded at 2 × 105 cells/mL in Dulbecco's modified Eagle's medium (DMEM)/F12 (1:1) medium supplemented with 2% B27 (Gibco BRL) plus 100 U/mL penicillin, 100 U/mL streptomycin, and basic fibroblast growth factor (bFGF, 20 ng/mL; R&D Systems, USA). The cells were cultured at 37 °C in a humidified atmosphere of 5% CO2 and 95% air. For NSC differentiation, the neurospheres were transferred into differentiation medium containing 2% fetal bovine serum (FBS) without growth factors and cultured for 7 days.
2.5. Constructs and mutagenesis Zdhhc17 siRNA primers were annealed and inserted into the HindIII/ BglII sites of the pSUPER vector (Oligo Engine). The primers used to generate zdhhc17 siRNA were as follows. Complementary oligonucleotides: 5′-GATCCCCGGAGATACAAGCACTTTAATTCAAGAGATTAAAGTGCTTGT ATCTCCTTTTTGGAAA-3′, and 5′-AGCTTTTCCAAAAAGGAGATACAAGCAC TTTAATCTCTTGAATTAAAGTGCTTGTATCTCCGGG-3′ (corresponding to nucleotides 2039–2057 of mouse zdhhc17 mRNA). The primers used to generate scrambled siRNA (control siRNA) were as follows: 5′GATCCCCGATAAGAACAGCGGCTATATTCAAGAGATATAGCCGCTGTTCT TATCTTTTTA-3′ and 5′-AGCTTAAAAAGATAAGAACAGCGGCTATATCTCT TGAATATAGCCGCTGTTCTTATCGGGGATCGGG-3′. Zebrafish full-length zdhhc17 cDNA was amplified using 5′CGCGGATCCATGGCGGACGCTCTGGTTGGATATG-3′ forward and 5′CCGCTCGAGCACCAGCTGGTATCCTGAGCCGGAC-3′ reverse primers and cloned into pCS2-GFP expression vectors using BamHI and XhoI restriction sites included in the primers (underlined). Mouse full-length zdhhc17 cDNA was amplified with 5′-CCCAAGC TTATGCAGCGGGAGGAGGGATTTAACA-3′ forward and 5′-CTAGTCTA GACTACACAAGCTGGTACCCAGATCC-3′ reverse primers and cloned into a pCS2+ expression vector using the HindIII and XbaI restriction sites included in the primers (underlined). Zdhhc17Δ ankyrin domain was generated by the deletion of nucleotides encoding amino acids 89–257 using an Easy Mutagenesis System (Transgen Biotech).
Table 1 Primers for RT-PCR and RNA probe synthesis. Genes
Primer sequence (5′–3′)
Danio rerio zdhhc17
Sense primer Anti-sense primer Sense primer Anti-sense primer Sense primer Anti-sense primer
Mus musculus dhhc17 Rattus norvegicus dhhc17
Product length (bp) CAAGACAAGGTCATCTCTCCA CAAATCAGCAATAAATCCCAC CATGGGTGGGTAACTGTGTAGGTG GGGCTTTCAATAGATGTTGTCGTA GGATGAGTACGATACCGAAACG TCCAAACTGAGCAGCCAAGTGG
575 352 460
196
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
Mouse full-length zdhhc17 cDNA was amplified with 5′-CCGCTCG AGATGCAGCGGGAGGAGGGATTTAACAC-3′ forward and 5′-ACGCGTCG ACCACAAGCTGGTACCCAGATCCTGAT-3′ reverse primers and cloned into a pEGFP-N1 (Clontech) expression vector using the XhoI and SalI restriction sites included in the primers (underlined). Zebrafish full-length TrkA cDNA was amplified with 5′-CGCGGAT CCATGTTCACTGTGACTGTAGTATTTCTC-3′ forward and 5′-CCGCTCG AGTACGGCAGATGTGGCAGTTGGTTTGAC-3′ reverse primers and cloned into pCS2-GFP expression vectors using BamHI and XhoI restriction sites included in the primers (underlined). All constructs were verified by DNA sequencing.
2.6. MO and mRNA injections The following translation initiation (zdhhc17MO1:5′-CAACCAGAGC GTCCGCCATCTTGCT-3′) as well as the control MO (control MO: 5′CAAaCAGAaCGTaCGCCATaTTaCT-3′) were designed by Gene Tools and injected at the one-to two-cell stage with concentration of 5.0 ng/embryo. The specificity and efficiency of ZDHHC17 knockdown in zebrafish were detected by Western blot after coinjection zdhhc17MO or control MO with GFP-tagged zdhhc17 mRNA (Supplementary Fig. 1). Mouse zdhhc17 mRNAs were transcribed from linearized pCS2 + constructs in vitro using SP6 transcriptase (Thermo Fisher) and injected 25 pg/embryo for both rescue and overexpression experiments.
2.7. Whole-mount in situ hybridization (WISH) and immunostaining Antisense digoxigenin-labeled RNA probes were synthesized with a digoxigenin RNA labeling kits (Roche).The primers' sequences that were used for antisense RNA probe synthesis were shown in Table 1. For WISH and whole-mount immunostaining, embryos were collected at different stages and carried out as described (Gonzalez-Quevedo et al., 2010). In some cases, 0.2 mM phenylthiourea (PTU) was added to prevent melanization. The primary antibodies were used as follows: znp1 (1:200, University of Oregon) and Islet1 (1:500, DSHB).
3. Results 3.1. Knockdown of zdhhc17 leads to abnormal SMN axon architecture in zebrafish Using WISH, we detected that zdhhc17 mRNA expressed from late somitogenesis onwards (Fig. 1A), although RT-PCR analysis showed that zdhhc17 is maternally expressed in the zebrafish (Fig. 1B). More interestingly, we found that the zdhhc17 transcript was highly expressed in the developing central nervous system (CNS) from the presumptive telencephalon to the caudal tip of the spinal cord. To investigate the function of ZDHHC17 during zebrafish development, we disrupted its translation using antisense MO oligonucleotides targeted against the translation initiation site. After injection of 5 ng zdhhc17 MO in one-cell stage embryos, the MO-injected embryos appeared to develop normally compared with control MO-injected siblings. Expression of zdhhc17 in the developing spinal cord prompted us to assess the motor behavior of morphant larvae using the touchresponse test. The motility of morphants was markedly lower than that of control embryos from 3 days post-fertilization (dpf) onwards (Supplementary Movies 1 and 2). In response to touch, morphant larvae moved significantly slower and swam shorter distances than control embryos (Fig. 1C and D). To identify the cause of this mobility defect, we immunolabeled the spinal neuron axonal tracts of morphants and control embryos using the motor axon marker Znp1. Znp1 immunostaining of 28-hours post-fertilization (hpf) morphants showed that SMN axons were truncated (Fig. 1E and F). This axonal tract defect was partly rescued by expression of mouse zdhhc17, which confirmed that the axonal defect of morphants was caused by zdhhc17 knockdown (Fig. 1E and F). Moreover, axogenesis of spinal neuron in zebrafish was sensitive to zdhhc17 levels, overexpression of zdhhc17 resulted in excrescent SMN axonal tracts (Fig. 1E and F). Immunolabeling with an antibody against the neuronal marker Islet1 showed no significant difference in the numbers of spinal differentiated neurons between control and morphant embryos at 22 hpf, indicating that the abnormal SMN axon architecture was not the consequence of an earlier event that affected spinal neuron generation and patterning (Fig. 1F). Taken together, these results suggest that ZDHHC17 is specifically involved in zebrafish SMN outgrowth.
2.8. Immunocytochemistry 3.2. Zdhhc17 siRNA impairs NSC differentiation For immunocytochemistry, cells were seeded on precoated glass coverslips with poly-D-lysine and fixed with 4% paraformaldehyde in PBS for 30 min at room temperature, permeabilized with 0.1% Triton X-100 for 20 min, blocked with 10% goat serum. Subsequently, cells were incubated with primary antibodies: anti-microtubule-associated protein 2 (MAP2, 1:200, EMD Millipore Corporation) and TrkA (1:100, Abcam) followed by secondary antibody (FITC-conjugated goat antimouse IgG, 1:100; Sigma-Aldrich). The cells were then counterstained with DAPI (1:1000, Invitrogen) and visualized under a fluorescence microscope.
2.9. Image and statistical analyses Images were acquired by a stereomicroscope (Olympus SZX16) for in situ hybridizations and a fluorescence microscope (Olympus IX71) for immunostaining. Images were adjusted for brightness and contrast using Image-Pro Plus 6.0 and Adobe Photoshop software. Each experiment was repeated at least three times. Statistical significance was analyzed using Student's t-tests or one-way ANOVA followed by Bonferoni's test using GraphPad Prism 5.0 software. All bar graphs were plotted as mean ± standard error of mean (S.E.M.).
To further analyze potential axonal growth defects, we isolated mouse NSCs, transfected with zdhhc17 siRNA and identified the role of ZDHHC17 during neuron differentiation. RT-PCR analysis showed that zdhhc17 mRNA was dramatically increased and maintained at a high level during neuron differentiation (Fig. 2A and B). The upregulated zdhhc17mRNA levels during neuron differentiation were extremely inhibited in zdhhc17 siRNA-treated cells compared with untreated controls (Fig. 2C and D). Inhibition of ZDHHC17 expression by siRNA did not significantly reduce the number of MAP2-positive cells (Fig. 2E). However, most of the neurons displayed severe perturbations in neurite outgrowth and failed to develop axons compared with controls (Fig. 2F and G). These results indicate that ZDHHC17 is involved in NSC differentiation, and particularly in axon outgrowth. 3.3. ZDHHC17 induces neurite outgrowth in PC12 cells We used nerve growth factor (NGF)-induced PC12 cells as a model system to gain insight into the signal transduction pathways affected by zdhhc17 and to demonstrate the loss-of-function phenotypes caused by zdhhc17 knockdown in addition to signaling defects. Mouse PC12 cells were chosen since there are no equivalent zebrafish cell lines or signal transduction pathway test kits available as there are for mammalian cells.
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
197
Fig. 1. Knockdown of zdhhc17 results in SMN axon defects in zebrafish. (A) Expression analysis of zdhhc17 in zebrafish by WISH at the indicated stages from 16 hpf to 24 hpf. Magnified view of coronal sections of the region indicated by the black arrows is showed in the black boxes in the right corner, pointing out the spinal cord. (B) RT-PCR analysis of zdhhc17 gene expression during zebrafish developmental stages ranging from 8-cell stage to 48 hpf. Bar graphs showed the relative levels of zdhhc17 mRNA expression. Amplification of β-actin served as a control to calibrate the amount of the cDNA template used in the PCR reaction. The error bars showed the standard error of the mean (S.E.M.). (C–D) Touch-response test results showed that zdhhc17 knockdown caused significant mobility defects in 3 dpf larvae. The bars represent the mean speed and distance of each larva swimming. Each bar represents the mean ± S.E.M. of at least three independent experiments.∗∗∗ denotes P b 0.001 versus control. (E) Statistical analysis of axonal length in 28 hpf morphants. Con MO: missense MO-injected group, zdhhc17MO: zdhhc17MO-injected group, zdhhc17MO + mRNA: mouse zdhhc17 mRNA rescued group. The values represent the means ± S.E.M. of at least three independent experiments. ∗∗ denotes P b 0.01, ∗∗∗ denotes P b 0.001 versus control. (F) Immunostaining analysis of 28 hpf morphants with znp1 (ventral and dorsal spinal neurons) showed that SMN axons were truncated and could be partly rescued by mouse zdhhc17, whereas islet1 labeling (ventral and dorsal spinal neurons) showed no difference in the quantity of spinal differentiated neurons at 22 hpf. Con MO: missense MO-injected group, zdhhc17MO: zdhhc17MO-injected group, zdhhc17MO + mRNA: mouse zdhhc17 mRNA rescued group, zdhhc17 mRNA: zdhhc17 mRNA overexpressed group. White triangles indicate truncated axons. White arrows showed excrescent branches of axons. Abbreviations: RB, Rohon–Beard neurons; MN, motor neurons. Scale bar: 100 μm.
RT-PCR analysis showed that, during NGF-induced neurite growth in PC12 cells, zdhhc17 mRNA exhibited basal expression in non-induced cells and was significantly increased in the first day of NGF induction and maintained following the differentiation stage (Fig. 3A and B). This result indicates that zdhhc17 upregulation might be a differentiation-related event and could be involved in neurite growth. Next, we investigated the role of ZDHHC17 in neurite growth. After transfection with zdhhc17-specific siRNA, the zdhhc17 mRNA level was evidently downregulated (Fig. 3C and D) and fewer cells had neurites compared to control cells (Fig. 3E). These effects were abrogated in zdhhc17 rescue experiments (Fig. 3E). In addition, zdhhc17 overexpressing cells had more and longer neurites per cell, suggesting that ZDHHC17 had a significant effect on neuritogenesis (Fig. 3E and F). All of these results were consistent with our observations of SMN axon outgrowth in zebrafish and during NSC differentiation, indicating that ectopic and inhibited zdhhc17 PC12 cells are an appropriate model for
assessing the cellular and molecular consequences of the zdhhc17 phenotype in vivo and in NSCs.
3.4. ERK1/2 activation is involved in ZDHHC17-induced neurite outgrowth We next turned our attention to finding out the signal pathway responsible for ZDHHC17-induced neurite outgrowth. Signaling through mitogen-activated protein kinase (MAPK) classes has been shown to play a critical role in neuronal differentiation (Fig. 4A and B) (Cowley et al., 1994). Our results demonstrated that ZDHHC17 promoted ERK1/2 phosphorylation and activity in NGF induced PC12 cells (Fig. 4C). Notably, this effect was dependent on the ankyrin domain of ZDHHC17, because ZDHHC17Δ did not clearly upregulate ERK1/2 phosphorylation as observed with wild-type ZDHHC17 (Fig. 4D). Conversely, ZDHHC17 had no influence on the phosphorylation of p38 and JNK (Supplementary Fig. 2).
198
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
Fig. 2. The role of ZDHHC17 during neuron differentiation in NSCs in vitro. (A–B) RT-PCR analysis of zdhhc17 mRNA expression during NSC differentiation. The bar graphs showed that the relative levels of zdhhc17 mRNA was significantly increased and maintained at 1, 3, 5, and 7 days after induction (B). Amplification of β-actin served as a control to calibrate the amounts of cDNA template used in the PCR reactions. The values represent the means ± S.E.M. of at least three independent experiments. * denotes P b 0.05; ** denotes P b 0.01 versus control. (C–D) The RT-PCR analysis of zdhhc17 mRNA expression in zdhhc17 siRNA-treated NSCs. Quantification of zdhhc17 mRNA levels was dramatically repressed in zdhhc17 siRNA-treated cells after differentiation induction (D). Amplification of β-actin served as a control to calibrate the amounts of cDNA template used in the PCR reactions. Each bar represents mean ± S.E.M. of at least three independent experiments. ∗∗ denotes P b 0.01 versus control. (E–G) Immunostaining of MAP2-positive cells differentiated from NSCs for 5 days showed that neurite outgrowth was defected in zdhhc17 siRNA-treated cells (F,G) whereas there was no effect on the quantity of MAP2-positive cells (E,F). Each bar represents the mean ± S.E.M. of three independent experiments. Not significant (ns) versus control. Scale bar: 50 μm.
3.5. ZDHHC17 promotes formation of the TrkA-tubulin module Since ZDHHC17 does not have a canonical kinase domain, we further attempted to clarify whether TrkA and cAMP-dependent protein kinase A (PKA), possible upstream kinases in the ERK1/2 signaling pathway, are involved (Mitchell et al., 2012; Obara et al., 2004). Coimmunoprecipitation experiments revealed that ZDHHC17 was associated with TrkA but not PKA (Fig. 5A). Indeed, ZDHHC17 was
linked to the trafficking capabilities of the TrkA. In zdhhc17 siRNAtreated induced PC12 cells, the TrkA-positive endosomes exhibited perinuclear localization rather than peripheral localization as observed in control cells (Fig. 5B). In contrast, ZDHHC17 increased TrkA recycling and could rescue the observed endosomal abnormalities (Fig. 5B). Thus, these results suggest that the abnormalities in endosomal dynamics might contribute to the dysregulation of receptor signaling in the endocytic pathway.
Fig. 3. Neurite outgrowth deficiencies in zdhhc17 siRNA-treated PC12 cells. (A–B) RT-PCR analysis of zdhhc17 mRNA expression during differentiation of PC12 cells induced by NGF. Quantification levels of zdhhc17 mRNA were significantly increased and maintained at 1, 3, 5, and 7 days after induction (B). Amplification of β-actin served as a control to calibrate the amount of cDNA template used in the PCR reactions. Each bar represents mean ± S.E.M. of at least three independent experiments. ∗ denotes P b 0.05; ** denotes P b 0.01 versus control. (C–D) RT– PCR analysis of zdhhc17 mRNA expression in zdhhc17 siRNA-treated PC12 cells. The bar graphs indicated that the expression of zdhhc17 mRNA was dramatically repressed in zdhhc17 siRNA-treated PC12 cells after differentiation (D). Amplification of β-actin served as a control to calibrate the amount of cDNA template used in the PCR reactions. Each bar represents mean ± S.E.M. of at least three independent experiments. ∗∗ denotes P b 0.01 versus control. (E–F) NGF-induced PC12 cells transfected with zdhhc17 siRNA showed defects in neurite outgrowth, whereas the mouse zdhhc17 mRNA overexpressed group exhibits more and longer neurite branches. Control: scrambled siRNA-transfected group, zdhhc17siRNA: zdhhc17 siRNAtransfected group, zdhhc17 siRNA + mRNA: mouse zdhhc17 mRNA-rescued group, zdhhc17 mRNA: mouse zdhhc17 mRNA overexpressed group. Each bar represents the mean ± S.E.M. of three independent experiments. ∗ denotes P b 0.05; ∗∗ denotes P b 0.01; not significant (ns) versus control.
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
199
Fig. 4. Zdhhc17 influences ERK1/2 phosphorylation during neurite outgrowth. (A–B) Western blot analysis showed that molecules of the MAPK signaling pathway were required for neuronal differentiation in PC12 cells. The levels of p-ERK1/2, p-p38, and p-JNK were significantly upregulated in NGF-induced PC12 cells. β-Actin served as a loading control. Values represent mean ± S.E.M. of three independent experiments. (C) Western blot analysis showed that the level of p-ERK1/2 was downregulated after zdhhc17 knockdown in NGF-induced PC12 cells, whereas zdhhc17 overexpression promoted ERK1/2 phosphorylation. The bar graphs clarified the relative level of (p-ERK1/2)/(t-ERK1/2) expression for at least three independent experiments. Values represent mean ± S.E.M. ∗ denotes P b 0.05; ∗∗ denotes P b 0.01; not significant (ns) versus control. (D) The affect of ZDHHC17 on ERK1/2 phosphorylation in NGF-induced PC12 cells required the ankyrin domain. Western blot analysis of p-ERK1/2 and t-ERK1/2 showed that ZDHHC17Δ overexpression did not upregulate the ERK1/2 phosphorylation level compared to wild-type ZDHHC17. The bar graphs showed the relative level of (p-ERK1/2)/(t-ERK1/2) expression for at least three independent experiments. Values represent mean ± S.E.M. ∗∗∗ denotes P b 0.001; not significant (ns) versus control.
The accumulation of TrkA in zdhhc17 siRNA-treated cells might be related to altered transport of these endosomes. Several lines of evidences suggest that TrkA-positive endosome traffics along microtubules, and TrkA also affects microtubule dynamics (Moises et al., 2007). Indeed, consistent with TrkA recycling dysfunction, we observed abnormal downregulated of TrkA–tubulin complex formation in zdhhc17siRNA -treated induced PC12 cells (Fig. 5C and D). This was also detected in zebrafish with co-injection of zdhhc17MO and TrkAGFP (Fig. 5E) as well as in zdhhc17 siRNA-treated differentiated NSCs (Fig. 5F). Moreover, the association between TrkA and tubulin, as assessed by coimmunoprecipitation, was exceedingly enhanced in the presence of ZDHHC17 (Fig. 5G). Therefore, these results indicate that
ZDHHC17 recruits TrkA and tubulin to form a trafficking module for TrkA recycling and signal transmission during neurite formation.
4. Discussion While the role of ZDHHC17 as a PAT is well established, its involvements in other mechanisms of the neural system are just beginning to be appreciated. Here, we report that ZDHHC17 possesses a novel mechanism that regulates axon outgrowth both in vivo and in vitro. ZDHHC17 regulates neuronal signal transmission and axonal transport by promoting TrkA–tubulin interaction.
200
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
Fig. 5. ZDHHC17 is required for TrkA–tubulin complex formation. (A) ZDHHC17 associated with TrkA but not PKA in PC12 cells, as TrkA was present in the GFP-ZDHHC17 immunoprecipitates obtained using an anti-GFP antibody. (B) TrkA-positive endosomes were distributed in the periphery of the cytoplasm in control PC12 cells (Ba). In zdhhc17 siRNA-treated cells, the TrkA-positive endosomes were localized in perinuclear areas (Bb) and could be rescued by increased ZDHHC17 expression (Bc). Overexpression of ZDHHC17 could upregulate TrkA recycling (Bd). Scale bar: 20 μm. (C–D) ZDHHC17 is crucial for TrkA–tubulin complex formation in NGF-induced PC12 cells. Values and error bars represent the mean ± S.E.M. of at least three independent experiments. ∗∗ denotes P b 0.01; ∗∗∗ denotes P b 0.001; not significant (ns) versus control. (E) Coimmunoprecipitation analysis of TrkA–tubulin complex formation in zebrafish. The bar graphs showed abnormally downregulation of the TrkA–tubulin complex formation in zebrafish with co-injection of zdhhc17MO and TrkA-GFP. Values represent mean ± S.E.M. of at least three independent experiments. ∗ denotes P b 0.05 versus control. (F) Coimmunoprecipitation analysis of TrkA–tubulin complex formation in zdhhc17 siRNAtreated differentiated NSCs. The bar graphs demonstrated that the TrkA–tubulin module formation was decreased in zdhhc17 siRNA-treated differentiated NSCs. Each bar represents the mean ± S.E.M. of at least three independent experiments. ∗ denotes P b 0.05 versus control. (G) Coimmunoprecipitation analysis of TrkA–tubulin complex formation in ZDHHC17 overexpression PC12 cells. ZDHHC17 overexpression dramatically promoted TrkA–tubulin complex formation in PC12 cells. The bar graphs indicated the potential binding ability of TrkA–tubulin complex formation for at least three independent experiments. Values represent mean ± S.E.M. ∗ denotes P b 0.05 versus control.
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
Many DHHC proteins have recently emerged as critical modulators of neuronal function, and their disruptions are linked to neurodevelopmental and neuropsychiatric conditions (el-Husseini Ael and Bredt, 2002; Fukata and Fukata, 2010). There are 23 putative mammalian DHHC proteins, and hundreds of proteins have been identified as their substrates (Fukata et al., 2006b; Tsutsumi et al., 2008). Moreover, most of them share substrates, making it challenging to investigate the direct roles of DHHC proteins in vivo. For example, some of the previous observations in vitro are not consistent with the changes in ZDHHC17 −/− mice, such as the palmitoylation level of huntingtin (HTT) (Singaraja et al., 2011). It is possible that the loss of ZDHHC17 activity in ZDHHC17 −/− mice will be compensated by other DHHC proteins, such as ZDHHC13, as they are closely related in mice. Interestingly, ZDHHC17 is the most highly conserved of all 23 DHHC proteins (88% identity, human-zebrafish), but ZDHHC13 appears to have significantly diverged in non-mammalian vertebrates (Young et al., 2012a). Thus, using zebrafish as a model could reveal some unexpected roles for ZDHHC17 in vivo. From a neurodevelopmental point of view, we found that ZDHHC17 is necessary for appropriate SMN axon architecture in zebrafish. The similar results are also found in the work showing a regulatory role of ZDHHC17 on axon outgrowth during NSC and PC12 cell differentiation. We found that zdhhc13 expression level was extremely low or undetectable in NSCs and PC12 cells (Supplementary Fig. 3). Other studies have also demonstrated roles of the DHHC family for axon and dendrite formation during neural development. In ZDHHC5 −/− NSCs, there was little evidence of neuron differentiation (Li et al., 2011). Furthermore, overexpression of ZDHHC7 induced neurite elongation in N2A cells (Fukata and Fukata, 2010). Thus, these investigations into how DHHC proteins regulate axogenesis or axon outgrowth may identify new mechanisms associated with several neurological disorders. Our results demonstrate that ZDHHC17 possesses a novel function that might be unique within the DHHC family. During axon outgrowth, ZDHHC17–TrkA–tubulin forms a trafficking module for TrkA recycling and ERK activation. Moreover, the ankyrin domain of ZDHHC17, which is important for protein–protein interaction and signaling (Huang et al., 2009), is likely involved in this module assembly as ZDHHC17Δ did not clearly upregulate ERK1/2 phosphorylation. As reported previously, ZDHHC17 acts as a PAT that catalyzes palmitoylation, and PSD-95 and GAP-43 were identified as its substrates in vitro (Fukata et al., 2004; Huang et al., 2004; Tsutsumi et al., 2008). This suggests that the palmitoylation role of ZDHHC17 could also contribute to axogenesis during neuron differentiation. Altered palmitoylation and interaction profiles of ZDHHC17 protein substrates, as well as activation of MAPK pathways, have been noted in the pathogenesis of several diseases (Bandyopadhyay et al., 2010; Goytain et al., 2008; Yanai et al., 2006; Yang and Cynader, 2011). Thus, we propose that the different functions of ZDHHC17 could be systematically connected and directly or indirectly contribute to axon outgrowth in neurons. Additional studies regarding the relationship between ZDHHC17 substrates and signaling pathway activation may help to elucidate the role of ZDHHC17 during neural development. Axon outgrowth is a highly complex process that must be precisely orchestrated through a number of neuron-intrinsic properties. It is becoming increasingly apparent that balanced TrkA activation and positioning regulate successful axon outgrowth (Campenot, 2009; MacInnis et al., 2003; Riccio et al., 1997). In this study, we observed an obvious change in the trafficking capabilities of TrkA receptors in zdhhc17 siRNA-treated cells. Generally, this change involved an abnormal distribution of early and recycling endosomes (Cabeza et al., 2012). Increasing evidence has recently highlighted the importance of endocytic trafficking in regulating the activity and distribution of developmental signaling pathways (Fassier et al., 2010; Piddini and Vincent, 2003). During axon outgrowth, long-lasting activation of a number of signaling pathways depends on TrkA receptor recycling (Chen et al., 2005). Indeed, these endosomal distribution abnormalities could reflect changes
201
in the Rab-GTPases and motor activity. Accordingly, we found that the interaction between TrkA and tubulin was impaired in zdhhc17 siRNAtreated cells. Moreover, TrkA also affects microtubule dynamics during the stabilization of outgrowing neurites (Pryor et al., 2012). Therefore, our results suggest that by regulating the interaction between TrkA and tubulin, ZDHHC17 is specifically involved in both axonal transport and the organization of the microtubule network in developing neurons. 5. Conclusions Our results demonstrate that ZDHHC17 is a neuron-intrinsic factor that is crucial for axon growth in vivo and in vitro via a mechanism independent on its PAT activity. Moreover, we find that ZDHHC17 regulates the TrkA–tubulin complex formation specifically. Our results extend the function of ZDHHC17 during neural development and provide a framework, which fully understand the roles of DHHC family members and further explain disease processes that involved with DHHC protein dysfunction. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.mcn.2015.07.005. Acknowledgments This work was supported by funding from the National Natural Science Foundation of China (no. 31440056 and 31271289), Ministry of Education of China (no. 20110131110036), Natural Science Foundation of Shandong Province (no. 2012GSF11842 and ZR2010HQ022) and Shandong University (no. 2012JC006). References Akiyama, H., Tojima, T., Kamiguchi, H., 2012. Mechanisms of neuronal growth cone navigation. Seikagaku 84, 848–853. Auer, M., Schweigreiter, R., Hausott, B., Thongrong, S., Holtje, M., Just, I., Bandtlow, C., Klimaschewski, L., 2012. Rho-independent stimulation of axon outgrowth and activation of the ERK and Akt signaling pathways by C3 transferase in sensory neurons. Front. Cell. Neurosci. 6, 43. Bandyopadhyay, S., Chiang, C.-Y., Srivastava, J., Gersten, M., White, S., Bell, R., Kurschner, C., Martin, C.H., Smoot, M., Sahasrabudhe, S., 2010. A human MAP kinase interactome. Nat. Methods 7, 801–805. Cabeza, C., Figueroa, A., Lazo, O.M., Galleguillos, C., Pissani, C., Klein, A., Gonzalez-Billault, C., Inestrosa, N.C., Alvarez, A.R., Zanlungo, S., Bronfman, F.C., 2012. Cholinergic abnormalities, endosomal alterations and up-regulation of nerve growth factor signaling in Niemann–Pick type C disease. Mol. Neurodegener. 7, 11. Campenot, R.B., 2009. NGF uptake and retrograde signaling mechanisms in sympathetic neurons in compartmented cultures. Results Probl. Cell Differ. 48, 141–158. Chen, Z.Y., Ieraci, A., Tanowitz, M., Lee, F.S., 2005. A novel endocytic recycling signal distinguishes biological responses of Trk neurotrophin receptors. Mol. Biol. Cell 16, 5761–5772. Cheng, P.L., Poo, M.M., 2012. Early events in axon/dendrite polarization. Annu. Rev. Neurosci. 35, 181–201. Cowley, S., Paterson, H., Kemp, P., Marshall, C.J., 1994. Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells. Cell 77, 841–852. Doyle, J.P., Dougherty, J.D., Heiman, M., Schmidt, E.F., Stevens, T.R., Ma, G., Bupp, S., Shrestha, P., Shah, R.D., Doughty, M.L., 2008. Application of a translational profiling approach for the comparative analysis of CNS cell types. Cell 135, 749–762. el-Husseini Ael, D., Bredt, D.S., 2002. Protein palmitoylation: a regulator of neuronal development and function. Nat. Rev. Neurosci. 3, 791–802. Euteneuer, S., Yang, K.H., Chavez, E., Leichtle, A., Loers, G., Olshansky, A., Pak, K., Schachner, M., Ryan, A.F., 2013. Glial cell line-derived neurotrophic factor (GDNF) induces neuritogenesis in the cochlear spiral ganglion via neural cell adhesion molecule (NCAM). Mol. Cell. Neurosci. 54, 30–43. Fassier, C., Hutt, J.A., Scholpp, S., Lumsden, A., Giros, B., Nothias, F., Schneider-Maunoury, S., Houart, C., Hazan, J., 2010. Zebrafish atlastin controls motility and spinal motor axon architecture via inhibition of the BMP pathway. Nat. Neurosci. 13, 1380–1387. Franze, K., 2013. The mechanical control of nervous system development. Development 140, 3069–3077. Frey, D., Laux, T., Xu, L., Schneider, C., Caroni, P., 2000. Shared and unique roles of CAP23 and GAP43 in actin regulation, neurite outgrowth, and anatomical plasticity. J. Cell Biol. 149, 1443–1454. Fukata, Y., Fukata, M., 2010. Protein palmitoylation in neuronal development and synaptic plasticity. Nat. Rev. Neurosci. 11, 161–175. Fukata, M., Fukata, Y., Adesnik, H., Nicoll, R.A., Bredt, D.S., 2004. Identification of PSD-95 palmitoylating enzymes. Neuron 44, 987–996.
202
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
Fukata, Y., Bredt, D.S., Fukata, M., 2006a. Protein Palmitoylation by DHHC Protein Family. Fukata, Y., Iwanaga, T., Fukata, M., 2006b. Systematic screening for palmitoyl transferase activity of the DHHC protein family in mammalian cells. Methods 40, 177–182. Gonzalez-Quevedo, R., Lee, Y., Poss, K.D., Wilkinson, D.G., 2010. Neuronal regulation of the spatial patterning of neurogenesis. Dev. Cell 18, 136–147. Goytain, A., Hines, R.M., Quamme, G.A., 2008. Huntingtin-interacting proteins, HIP14 and HIP14L, mediate dual functions, palmitoyl acyltransferase and Mg2 + transport. J. Biol. Chem. 283, 33365–33374. Harada, T., Matsuzaki, O., Hayashi, H., Sugano, S., Matsuda, A., Nishida, E., 2003. AKRL1 and AKRL2 activate the JNK pathway. Genes Cells 8, 493–500. Heiman, M., Schaefer, A., Gong, S., Peterson, J.D., Day, M., Ramsey, K.E., Suárez-Fariñas, M., Schwarz, C., Stephan, D.A., Surmeier, D.J., 2008. A translational profiling approach for the molecular characterization of CNS cell types. Cell 135, 738–748. Hines, R.M., Kang, R., Goytain, A., Quamme, G.A., 2010. Golgi-specific DHHC zinc finger protein GODZ mediates membrane Ca2+ transport. J. Biol. Chem. 285, 4621–4628. Huang, K., Yanai, A., Kang, R., Arstikaitis, P., Singaraja, R.R., Metzler, M., Mullard, A., Haigh, B., Gauthier-Campbell, C., Gutekunst, C.-A., 2004. Huntingtin-interacting protein HIP14 is a palmitoyl transferase involved in palmitoylation and trafficking of multiple neuronal proteins. Neuron 44, 977–986. Huang, K., Sanders, S., Singaraja, R., Orban, P., Cijsouw, T., Arstikaitis, P., Yanai, A., Hayden, M.R., El-Husseini, A., 2009. Neuronal palmitoyl acyl transferases exhibit distinct substrate specificity. FASEB J. 23, 2605–2615. Langhorst, M.F., Jaeger, F.A., Mueller, S., Sven Hartmann, L., Luxenhofer, G., Stuermer, C.A., 2008. Reggies/flotillins regulate cytoskeletal remodeling during neuronal differentiation via CAP/ponsin and Rho GTPases. Eur. J. Cell Biol. 87, 921–931. Li, Y., Martin, B.R., Cravatt, B.F., Hofmann, S.L., 2011. DHHC5 palmitoylates flotillin-2 and is rapidly degraded on induction of neuronal differentiation in cultured cells. J. Biol. Chem. Li, S., Leshchyns'ka, I., Chernyshova, Y., Schachner, M., Sytnyk, V., 2013. The neural cell adhesion molecule (NCAM) associates with and signals through p21-activated kinase 1 (Pak1). J. Neurosci. 33, 790–803. MacInnis, B.L., Senger, D.L., Campenot, R.B., 2003. Spatial requirements for TrkA kinase activity in the support of neuronal survival and axon growth in rat sympathetic neurons. Neuropharmacology 45, 995–1010. Mitchell, D.J., Blasier, K.R., Jeffery, E.D., Ross, M.W., Pullikuth, A.K., Suo, D., Park, J., Smiley, W.R., Lo, K.W.-H., Shabanowitz, J., 2012. Trk activation of the ERK1/2 kinase pathway stimulates intermediate chain phosphorylation and recruits cytoplasmic dynein to signaling endosomes for retrograde axonal transport. J. Neurosci. 32, 15495–15510. Moises, T., Dreier, A., Flohr, S., Esser, M., Brauers, E., Reiss, K., Merken, D., Weis, J., Kruttgen, A., 2007. Tracking TrkA's trafficking: NGF receptor trafficking controls NGF receptor signaling. Mol. Neurobiol. 35, 151–159.
Obara, Y., Labudda, K., Dillon, T.J., Stork, P.J., 2004. PKA phosphorylation of Src mediates Rap1 activation in NGF and cAMP signaling in PC12 cells. J. Cell Sci. 117, 6085–6094. Piddini, E., Vincent, J.P., 2003. Modulation of developmental signals by endocytosis: different means and many ends. Curr. Opin. Cell Biol. 15, 474–481. Pryor, S., McCaffrey, G., Young, L.R., Grimes, M.L., 2012. NGF causes TrKA to specifically attract microtubules to lipid rafts. PLoS One 7, e35163. Riccio, A., Pierchala, B.A., Ciarallo, C.L., Ginty, D.D., 1997. An NGF-TrkA-mediated retrograde signal to transcription factor CREB in sympathetic neurons. Science 277, 1097–1100. Singaraja, R.R., Huang, K., Sanders, S.S., Milnerwood, A.J., Hines, R., Lerch, J.P., Franciosi, S., Drisdel, R.C., Vaid, K., Young, F.B., Doty, C., Wan, J., Bissada, N., Henkelman, R.M., Green, W.N., Davis, N.G., Raymond, L.A., Hayden, M.R., 2011. Altered palmitoylation and neuropathological deficits in mice lacking HIP14. Hum. Mol. Genet. 20, 3899–3909. Tian, L., McClafferty, H., Jeffries, O., Shipston, M.J., 2010. Multiple palmitoyltransferases are required for palmitoylation-dependent regulation of large conductance calcium- and voltage-activated potassium channels. J. Biol. Chem. 285, 23954–23962. Tsutsumi, R., Fukata, Y., Fukata, M., 2008. Discovery of protein-palmitoylating enzymes. Pflugers Arch. - Eur. J. Physiol. 456, 1199–1206. Yanai, A., Huang, K., Kang, R., Singaraja, R.R., Arstikaitis, P., Gan, L., Orban, P.C., Mullard, A., Cowan, C.M., Raymond, L.A., Drisdel, R.C., Green, W.N., Ravikumar, B., Rubinsztein, D.C., El-Husseini, A., Hayden, M.R., 2006. Palmitoylation of huntingtin by HIP14 is essential for its trafficking and function. Nat. Neurosci. 9, 824–831. Yang, G., Cynader, M.S., 2011. Palmitoyl acyltransferase zD17 mediates neuronal responses in acute ischemic brain injury by regulating JNK activation in a signaling module. J. Neurosci. 31, 11980–11991. Ye, T., Fu, A.K., Ip, N.Y., 2012. Cyclin-dependent kinase 5 in axon growth and regeneration. Int. Rev. Neurobiol. 105, 91–115. Young, F.B., Butland, S.L., Sanders, S.S., Sutton, L.M., Hayden, M.R., 2012a. Putting proteins in their place: palmitoylation in Huntington disease and other neuropsychiatric diseases. Prog. Neurobiol. 97, 220–238. Young, F.B., Franciosi, S., Spreeuw, A., Deng, Y., Sanders, S., Tam, N.C., Huang, K., Singaraja, R.R., Zhang, W., Bissada, N., Kay, C., Hayden, M.R., 2012b. Low levels of human HIP14 are sufficient to rescue neuropathological, behavioural, and enzymatic defects due to loss of murine HIP14 in Hip14−/− mice. PLoS One 7 e36315. Zhao, S., Yuan, Q., Hao, H., Guo, Y., Liu, S., Zhang, Y., Wang, J., Liu, H., Wang, F., Liu, K., Ling, E.A., Hao, A., 2011. Expression of OCT4 pseudogenes in human tumours: lessons from glioma and breast carcinoma. J. Pathol. 223, 672–682.
Contents lists available at ScienceDirect
Molecular and Cellular Neuroscience journal homepage: www.elsevier.com/locate/ymcne
ZDHHC17 promotes axon outgrowth by regulating TrkA–tubulin complex formation Wei Shi a, Fen Wang a, Ming Gao c, Yang Yang d, Zhaoxia Du a, Chen Wang a, Yao Yao a, Kun He a, Xueran Chen b,⁎, Aijun Hao a,⁎⁎ a Key Laboratory of the Ministry of Education for Experimental Teratology, Shandong Provincial Key Laboratory of Mental Disorders, Department of Histology and Embryology, Shandong University School of Medicine, No. 44, Wenhua Xi Road, Jinan, Shandong 250012, PR China b Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, PR China c Reproductive Medical Center of Shandong University, Shandong University School of Medicine, No. 44, Wenhua Xi Road, Jinan, Shandong 250012, PR China d Infertility Center, Qilu Hospital, Shandong University School of Medicine, No. 44, Wenhua Xi Road, Jinan, Shandong 250012, PR China
a r t i c l e
i n f o
Article history: Received 21 August 2014 Revised 7 July 2015 Accepted 23 July 2015 Available online 29 July 2015 Keywords: ZDHHC17 Axon outgrowth ERK1/2 TrkA Tubulin
a b s t r a c t Correct axonal growth during nervous system development is critical for synaptic transduction and nervous system function. Proper axon outgrowth relies on a suitable growing environment and the expression of a series of endogenous neuronal factors. However, the mechanisms of these neuronal proteins involved in neuronal development remain unknown. ZDHHC17 is a member of the DHHC (Asp-His-His-Cys)-containing family, a family of highly homologous proteins. Here, we show that loss of function of ZDHHC17 in zebrafish leads to motor dysfunction in 3-day post-fertilization (dpf) larvae. We performed immunolabeling analysis to reveal that mobility dysfunction was due to a significant defect in the axonal outgrowth of spinal motor neurons (SMNs) without affecting neuron generation. In addition, we found a similar phenotype in zdhhc17 siRNA-treated neural stem cells (NSCs) and PC12 cells. Inhibition of zdhhc17 limited neurite outgrowth and branching in both NSCs and PC12. Furthermore, we discovered that the level of phosphorylation of extracellular-regulated kinase (ERK) 1/2, a major downstream effector of tyrosine kinase (TrkA), was largely upregulated in ZDHHC17 overexpressing PC12 cells by a mechanism independent on its palmitoyltransferase (PAT) activity. Specifically, ZDHHC17 is necessary for proper TrkA–tubulin module formation in PC12 cells. These results strongly indicate that ZDHHC17 is essential for correct axon outgrowth in vivo and in vitro. Our findings identify ZDHHC17 as an important upstream factor of ERK1/2 to regulate the interaction between TrkA and tubulin during neuronal development. © 2015 Elsevier Inc. All rights reserved.
1. Introduction Successful axon outgrowth and formation primarily depend on two factors: a permissive environment and the expression of growthassociated proteins (GAPs) in neurons including transcription factors, GAP-43, and several cell adhesion and cytoskeletal proteins (Akiyama et al., 2012; Cheng and Poo, 2012; Euteneuer et al., 2013; Franze, 2013; Auer et al., 2012; Frey et al., 2000; Langhorst et al., 2008; Li et al., 2013; Ye et al., 2012). In response to appropriate signals, neurons exhibit remarkable properties that they express growth-associated proteins to promote neuron differentiation and axon outgrowth. However, Abbreviations: DHHC, Asp-His-His-Cys; dpf, days post-fertilization; ERK1/2, extracellular signal-related kinase1/2; hpf, hours post-fertilization; JNK, c-Jun N terminus kinase; MAPK, mitogen-activated protein kinase; NSC, neural stem cell; PAT, palmitoyltransferase; SMN, spinal motor neuron; TrkA, tyrosine kinase. ⁎ Correspondence to: X. Chen, Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, No. 350 Shushan Hu Road, Hefei 230031, PR China. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (X. Chen), [email protected] (A. Hao).
http://dx.doi.org/10.1016/j.mcn.2015.07.005 1044-7431/© 2015 Elsevier Inc. All rights reserved.
the neuron-intrinsic factors involved in this precise temporal and spatial assembly are not well defined. In particular, the molecular mechanisms by which these signals regulate the assembly of complexes for cytoskeletal remodeling are largely unknown. The zinc finger DHHC-containing (ZDHHC) proteins belong to a family of palmitoyltransferases (PATs) that catalyze protein palmitoylation, a posttranslational lipid modification affecting protein targeting, trafficking, and function (Fukata et al., 2004, 2006a). Many members of the DHHC family are expressed in neurons, but ZDHHC17 is detected far more frequently at both mRNA and protein levels in neuronal studies (Doyle et al., 2008; Heiman et al., 2008; Huang et al., 2004, 2009). This suggests that ZDHHC17 might be particularly important in neuronal regulation. Consistent with this hypothesis, ZDHHC17 is implicated in higher brain function, since mice with reduced ZDHHC17 levels displayed behavioral, biochemical, and neuropathological defects that are reminiscent of Huntington's disease (HD) (Singaraja et al., 2011; Young et al., 2012b). ZDHHC17 was recently identified as a key player in ischemic stroke and a regulator of neuronal cell death (Yang and Cynader, 2011). In addition to its well-studied function in protein palmitoylation, other roles of ZDHHC17 are just beginning
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
to be appreciated, including the mediation of Mg2+ transport (Goytain et al., 2008), regulation of Ca2+ channel functions (Hines et al., 2010) and activation of c-Jun N-terminus kinase (JNK) pathways (Harada et al., 2003). Moreover, ZDHHC17 is responsible for palmitoylation of large conductance calcium- and voltage-activated potassium (BK) channels, which controls membrane potential and calcium influx (Tian et al., 2010). However, the roles and molecular mechanisms of ZDHHC17 in neuronal development and function are not yet fully understood. We used zdhhc17 morpholino (MO) in zebrafish and zdhhc17specific siRNA in NSCs and PC12 cells to demonstrate that ZDHHC17 regulates spinal motor neuron (SMN) axonal formation in vivo, axonal growth in vitro, NSC differentiation, and PC12 neurite outgrowth. Collectively, our results show that ZDHHC17 is a neuron-intrinsic factor for axon growth that is crucial for the TrkA–tubulin interaction, which regulates signal transmission, including ERK1/2 phosphorylation. 2. Material and methods 2.1. Zebrafish maintenance and treatment The zebrafish strains AB was maintained and bred according to standard procedures. We used the Esen zebrafish culture system (Esen environ science, Beijing, China) to control the temperature and the day–night cycles. All embryos were maintained at 28.5 °C without crowding (5–10 embryos/mL). Larval movements stimulated by the touch response test were quantified using the ImageJ manual tracking plugins (National Institutes of Health, Bethesda, MD, USA).
195
PC12 is a cell line derived from a pheochromocytoma of the rat adrenal medulla. Their embryonic origin is the neural crest, which contains a mixture of neuroblastic cells and eosinophilic cells. PC12 cells were maintained in DMEM plus 10% horse serum, 5% fetal calf serum (FCS) and antibiotics at 37 °C with 5% CO2 and 95% air. For differentiation, neuronal growth factor (NGF, Invitrogen) was added at 50 ng/mL under the serum conditions. Neurite outgrowth was visible 3 days later. For protein expression and zdhhc17 RNAi, the transfection of expression plasmids and pSuper-zdhhc17 siRNA was carried out using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. 2.4. Immunoprecipitation and immunoblotting Cells were washed once in PBS and lysed 30 min at 4 °C in IP buffer (0.5% Nonidet P-40, 500 mM Tris·HCl (pH 7.4), 20 mM EDTA, 10 mM NaF, 2 mM benzamidine, and a mixture of protease inhibitors) and centrifuged 15 min, 13,000 rpm at 4 °C. The supernatants were incubated with adequate antibody(1 μg) at 4 °C overnight and incubated 2–4 h at 4 °C with anti-protein A-coupled Sepharose beads. The proteins were then eluted and analyzed by Western blotting as described previously (Zhao et al., 2011). The primary antibodies were as follows: For Western blotting: anti-ERK1/2 (1:2000, Cell Signaling Technology), anti-p-ERK1/2 (1:2000, Cell Signaling Technology), anti-p38 (1:1000, Cell Signaling Technology), anti-p-p38 (1:1000, Cell Signaling Technology), anti-JNK (1:1000, Cell Signaling Technology), anti-p-JNK (1:1000, Cell Signaling Technology) and anti-β-actin (1:2000, Sigma). For immunoprecipitation: anti-TrkA (Abcam), anti-tubulin (Santa Cruz Biotechnology) and anti-GFP (Santa Cruz Biotechnology).
2.2. Reverse transcription polymerase chain reaction (RT-PCR) Total RNA was isolated using an RNeasy kit (Qiagen, USA) according to the manufacturer's instructions. During this process, total RNA was treated with DNaseI. First-strand cDNA synthesis was carried out using Reverse Transcription System (Promega, USA), following the manufacturer's protocol. PCR was performed with Premix Taq mixture (Invitrogen, USA). β-Actin was used as an internal control. The PCR products were separated on 1.2% agarose gel by electrophoresis, stained with ethidium bromide and visualized under the ultraviolet light. The primers' sequences and the sizes of amplified products were shown in Table 1. 2.3. Cell culture and transfection All reagents for cell cultures were purchased from Invitrogen. For primary NSC culture, brains were removed from Kun Ming mouse (KM strain) embryos at E12.5. After washing and resuspension, cells were seeded at 2 × 105 cells/mL in Dulbecco's modified Eagle's medium (DMEM)/F12 (1:1) medium supplemented with 2% B27 (Gibco BRL) plus 100 U/mL penicillin, 100 U/mL streptomycin, and basic fibroblast growth factor (bFGF, 20 ng/mL; R&D Systems, USA). The cells were cultured at 37 °C in a humidified atmosphere of 5% CO2 and 95% air. For NSC differentiation, the neurospheres were transferred into differentiation medium containing 2% fetal bovine serum (FBS) without growth factors and cultured for 7 days.
2.5. Constructs and mutagenesis Zdhhc17 siRNA primers were annealed and inserted into the HindIII/ BglII sites of the pSUPER vector (Oligo Engine). The primers used to generate zdhhc17 siRNA were as follows. Complementary oligonucleotides: 5′-GATCCCCGGAGATACAAGCACTTTAATTCAAGAGATTAAAGTGCTTGT ATCTCCTTTTTGGAAA-3′, and 5′-AGCTTTTCCAAAAAGGAGATACAAGCAC TTTAATCTCTTGAATTAAAGTGCTTGTATCTCCGGG-3′ (corresponding to nucleotides 2039–2057 of mouse zdhhc17 mRNA). The primers used to generate scrambled siRNA (control siRNA) were as follows: 5′GATCCCCGATAAGAACAGCGGCTATATTCAAGAGATATAGCCGCTGTTCT TATCTTTTTA-3′ and 5′-AGCTTAAAAAGATAAGAACAGCGGCTATATCTCT TGAATATAGCCGCTGTTCTTATCGGGGATCGGG-3′. Zebrafish full-length zdhhc17 cDNA was amplified using 5′CGCGGATCCATGGCGGACGCTCTGGTTGGATATG-3′ forward and 5′CCGCTCGAGCACCAGCTGGTATCCTGAGCCGGAC-3′ reverse primers and cloned into pCS2-GFP expression vectors using BamHI and XhoI restriction sites included in the primers (underlined). Mouse full-length zdhhc17 cDNA was amplified with 5′-CCCAAGC TTATGCAGCGGGAGGAGGGATTTAACA-3′ forward and 5′-CTAGTCTA GACTACACAAGCTGGTACCCAGATCC-3′ reverse primers and cloned into a pCS2+ expression vector using the HindIII and XbaI restriction sites included in the primers (underlined). Zdhhc17Δ ankyrin domain was generated by the deletion of nucleotides encoding amino acids 89–257 using an Easy Mutagenesis System (Transgen Biotech).
Table 1 Primers for RT-PCR and RNA probe synthesis. Genes
Primer sequence (5′–3′)
Danio rerio zdhhc17
Sense primer Anti-sense primer Sense primer Anti-sense primer Sense primer Anti-sense primer
Mus musculus dhhc17 Rattus norvegicus dhhc17
Product length (bp) CAAGACAAGGTCATCTCTCCA CAAATCAGCAATAAATCCCAC CATGGGTGGGTAACTGTGTAGGTG GGGCTTTCAATAGATGTTGTCGTA GGATGAGTACGATACCGAAACG TCCAAACTGAGCAGCCAAGTGG
575 352 460
196
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
Mouse full-length zdhhc17 cDNA was amplified with 5′-CCGCTCG AGATGCAGCGGGAGGAGGGATTTAACAC-3′ forward and 5′-ACGCGTCG ACCACAAGCTGGTACCCAGATCCTGAT-3′ reverse primers and cloned into a pEGFP-N1 (Clontech) expression vector using the XhoI and SalI restriction sites included in the primers (underlined). Zebrafish full-length TrkA cDNA was amplified with 5′-CGCGGAT CCATGTTCACTGTGACTGTAGTATTTCTC-3′ forward and 5′-CCGCTCG AGTACGGCAGATGTGGCAGTTGGTTTGAC-3′ reverse primers and cloned into pCS2-GFP expression vectors using BamHI and XhoI restriction sites included in the primers (underlined). All constructs were verified by DNA sequencing.
2.6. MO and mRNA injections The following translation initiation (zdhhc17MO1:5′-CAACCAGAGC GTCCGCCATCTTGCT-3′) as well as the control MO (control MO: 5′CAAaCAGAaCGTaCGCCATaTTaCT-3′) were designed by Gene Tools and injected at the one-to two-cell stage with concentration of 5.0 ng/embryo. The specificity and efficiency of ZDHHC17 knockdown in zebrafish were detected by Western blot after coinjection zdhhc17MO or control MO with GFP-tagged zdhhc17 mRNA (Supplementary Fig. 1). Mouse zdhhc17 mRNAs were transcribed from linearized pCS2 + constructs in vitro using SP6 transcriptase (Thermo Fisher) and injected 25 pg/embryo for both rescue and overexpression experiments.
2.7. Whole-mount in situ hybridization (WISH) and immunostaining Antisense digoxigenin-labeled RNA probes were synthesized with a digoxigenin RNA labeling kits (Roche).The primers' sequences that were used for antisense RNA probe synthesis were shown in Table 1. For WISH and whole-mount immunostaining, embryos were collected at different stages and carried out as described (Gonzalez-Quevedo et al., 2010). In some cases, 0.2 mM phenylthiourea (PTU) was added to prevent melanization. The primary antibodies were used as follows: znp1 (1:200, University of Oregon) and Islet1 (1:500, DSHB).
3. Results 3.1. Knockdown of zdhhc17 leads to abnormal SMN axon architecture in zebrafish Using WISH, we detected that zdhhc17 mRNA expressed from late somitogenesis onwards (Fig. 1A), although RT-PCR analysis showed that zdhhc17 is maternally expressed in the zebrafish (Fig. 1B). More interestingly, we found that the zdhhc17 transcript was highly expressed in the developing central nervous system (CNS) from the presumptive telencephalon to the caudal tip of the spinal cord. To investigate the function of ZDHHC17 during zebrafish development, we disrupted its translation using antisense MO oligonucleotides targeted against the translation initiation site. After injection of 5 ng zdhhc17 MO in one-cell stage embryos, the MO-injected embryos appeared to develop normally compared with control MO-injected siblings. Expression of zdhhc17 in the developing spinal cord prompted us to assess the motor behavior of morphant larvae using the touchresponse test. The motility of morphants was markedly lower than that of control embryos from 3 days post-fertilization (dpf) onwards (Supplementary Movies 1 and 2). In response to touch, morphant larvae moved significantly slower and swam shorter distances than control embryos (Fig. 1C and D). To identify the cause of this mobility defect, we immunolabeled the spinal neuron axonal tracts of morphants and control embryos using the motor axon marker Znp1. Znp1 immunostaining of 28-hours post-fertilization (hpf) morphants showed that SMN axons were truncated (Fig. 1E and F). This axonal tract defect was partly rescued by expression of mouse zdhhc17, which confirmed that the axonal defect of morphants was caused by zdhhc17 knockdown (Fig. 1E and F). Moreover, axogenesis of spinal neuron in zebrafish was sensitive to zdhhc17 levels, overexpression of zdhhc17 resulted in excrescent SMN axonal tracts (Fig. 1E and F). Immunolabeling with an antibody against the neuronal marker Islet1 showed no significant difference in the numbers of spinal differentiated neurons between control and morphant embryos at 22 hpf, indicating that the abnormal SMN axon architecture was not the consequence of an earlier event that affected spinal neuron generation and patterning (Fig. 1F). Taken together, these results suggest that ZDHHC17 is specifically involved in zebrafish SMN outgrowth.
2.8. Immunocytochemistry 3.2. Zdhhc17 siRNA impairs NSC differentiation For immunocytochemistry, cells were seeded on precoated glass coverslips with poly-D-lysine and fixed with 4% paraformaldehyde in PBS for 30 min at room temperature, permeabilized with 0.1% Triton X-100 for 20 min, blocked with 10% goat serum. Subsequently, cells were incubated with primary antibodies: anti-microtubule-associated protein 2 (MAP2, 1:200, EMD Millipore Corporation) and TrkA (1:100, Abcam) followed by secondary antibody (FITC-conjugated goat antimouse IgG, 1:100; Sigma-Aldrich). The cells were then counterstained with DAPI (1:1000, Invitrogen) and visualized under a fluorescence microscope.
2.9. Image and statistical analyses Images were acquired by a stereomicroscope (Olympus SZX16) for in situ hybridizations and a fluorescence microscope (Olympus IX71) for immunostaining. Images were adjusted for brightness and contrast using Image-Pro Plus 6.0 and Adobe Photoshop software. Each experiment was repeated at least three times. Statistical significance was analyzed using Student's t-tests or one-way ANOVA followed by Bonferoni's test using GraphPad Prism 5.0 software. All bar graphs were plotted as mean ± standard error of mean (S.E.M.).
To further analyze potential axonal growth defects, we isolated mouse NSCs, transfected with zdhhc17 siRNA and identified the role of ZDHHC17 during neuron differentiation. RT-PCR analysis showed that zdhhc17 mRNA was dramatically increased and maintained at a high level during neuron differentiation (Fig. 2A and B). The upregulated zdhhc17mRNA levels during neuron differentiation were extremely inhibited in zdhhc17 siRNA-treated cells compared with untreated controls (Fig. 2C and D). Inhibition of ZDHHC17 expression by siRNA did not significantly reduce the number of MAP2-positive cells (Fig. 2E). However, most of the neurons displayed severe perturbations in neurite outgrowth and failed to develop axons compared with controls (Fig. 2F and G). These results indicate that ZDHHC17 is involved in NSC differentiation, and particularly in axon outgrowth. 3.3. ZDHHC17 induces neurite outgrowth in PC12 cells We used nerve growth factor (NGF)-induced PC12 cells as a model system to gain insight into the signal transduction pathways affected by zdhhc17 and to demonstrate the loss-of-function phenotypes caused by zdhhc17 knockdown in addition to signaling defects. Mouse PC12 cells were chosen since there are no equivalent zebrafish cell lines or signal transduction pathway test kits available as there are for mammalian cells.
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
197
Fig. 1. Knockdown of zdhhc17 results in SMN axon defects in zebrafish. (A) Expression analysis of zdhhc17 in zebrafish by WISH at the indicated stages from 16 hpf to 24 hpf. Magnified view of coronal sections of the region indicated by the black arrows is showed in the black boxes in the right corner, pointing out the spinal cord. (B) RT-PCR analysis of zdhhc17 gene expression during zebrafish developmental stages ranging from 8-cell stage to 48 hpf. Bar graphs showed the relative levels of zdhhc17 mRNA expression. Amplification of β-actin served as a control to calibrate the amount of the cDNA template used in the PCR reaction. The error bars showed the standard error of the mean (S.E.M.). (C–D) Touch-response test results showed that zdhhc17 knockdown caused significant mobility defects in 3 dpf larvae. The bars represent the mean speed and distance of each larva swimming. Each bar represents the mean ± S.E.M. of at least three independent experiments.∗∗∗ denotes P b 0.001 versus control. (E) Statistical analysis of axonal length in 28 hpf morphants. Con MO: missense MO-injected group, zdhhc17MO: zdhhc17MO-injected group, zdhhc17MO + mRNA: mouse zdhhc17 mRNA rescued group. The values represent the means ± S.E.M. of at least three independent experiments. ∗∗ denotes P b 0.01, ∗∗∗ denotes P b 0.001 versus control. (F) Immunostaining analysis of 28 hpf morphants with znp1 (ventral and dorsal spinal neurons) showed that SMN axons were truncated and could be partly rescued by mouse zdhhc17, whereas islet1 labeling (ventral and dorsal spinal neurons) showed no difference in the quantity of spinal differentiated neurons at 22 hpf. Con MO: missense MO-injected group, zdhhc17MO: zdhhc17MO-injected group, zdhhc17MO + mRNA: mouse zdhhc17 mRNA rescued group, zdhhc17 mRNA: zdhhc17 mRNA overexpressed group. White triangles indicate truncated axons. White arrows showed excrescent branches of axons. Abbreviations: RB, Rohon–Beard neurons; MN, motor neurons. Scale bar: 100 μm.
RT-PCR analysis showed that, during NGF-induced neurite growth in PC12 cells, zdhhc17 mRNA exhibited basal expression in non-induced cells and was significantly increased in the first day of NGF induction and maintained following the differentiation stage (Fig. 3A and B). This result indicates that zdhhc17 upregulation might be a differentiation-related event and could be involved in neurite growth. Next, we investigated the role of ZDHHC17 in neurite growth. After transfection with zdhhc17-specific siRNA, the zdhhc17 mRNA level was evidently downregulated (Fig. 3C and D) and fewer cells had neurites compared to control cells (Fig. 3E). These effects were abrogated in zdhhc17 rescue experiments (Fig. 3E). In addition, zdhhc17 overexpressing cells had more and longer neurites per cell, suggesting that ZDHHC17 had a significant effect on neuritogenesis (Fig. 3E and F). All of these results were consistent with our observations of SMN axon outgrowth in zebrafish and during NSC differentiation, indicating that ectopic and inhibited zdhhc17 PC12 cells are an appropriate model for
assessing the cellular and molecular consequences of the zdhhc17 phenotype in vivo and in NSCs.
3.4. ERK1/2 activation is involved in ZDHHC17-induced neurite outgrowth We next turned our attention to finding out the signal pathway responsible for ZDHHC17-induced neurite outgrowth. Signaling through mitogen-activated protein kinase (MAPK) classes has been shown to play a critical role in neuronal differentiation (Fig. 4A and B) (Cowley et al., 1994). Our results demonstrated that ZDHHC17 promoted ERK1/2 phosphorylation and activity in NGF induced PC12 cells (Fig. 4C). Notably, this effect was dependent on the ankyrin domain of ZDHHC17, because ZDHHC17Δ did not clearly upregulate ERK1/2 phosphorylation as observed with wild-type ZDHHC17 (Fig. 4D). Conversely, ZDHHC17 had no influence on the phosphorylation of p38 and JNK (Supplementary Fig. 2).
198
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
Fig. 2. The role of ZDHHC17 during neuron differentiation in NSCs in vitro. (A–B) RT-PCR analysis of zdhhc17 mRNA expression during NSC differentiation. The bar graphs showed that the relative levels of zdhhc17 mRNA was significantly increased and maintained at 1, 3, 5, and 7 days after induction (B). Amplification of β-actin served as a control to calibrate the amounts of cDNA template used in the PCR reactions. The values represent the means ± S.E.M. of at least three independent experiments. * denotes P b 0.05; ** denotes P b 0.01 versus control. (C–D) The RT-PCR analysis of zdhhc17 mRNA expression in zdhhc17 siRNA-treated NSCs. Quantification of zdhhc17 mRNA levels was dramatically repressed in zdhhc17 siRNA-treated cells after differentiation induction (D). Amplification of β-actin served as a control to calibrate the amounts of cDNA template used in the PCR reactions. Each bar represents mean ± S.E.M. of at least three independent experiments. ∗∗ denotes P b 0.01 versus control. (E–G) Immunostaining of MAP2-positive cells differentiated from NSCs for 5 days showed that neurite outgrowth was defected in zdhhc17 siRNA-treated cells (F,G) whereas there was no effect on the quantity of MAP2-positive cells (E,F). Each bar represents the mean ± S.E.M. of three independent experiments. Not significant (ns) versus control. Scale bar: 50 μm.
3.5. ZDHHC17 promotes formation of the TrkA-tubulin module Since ZDHHC17 does not have a canonical kinase domain, we further attempted to clarify whether TrkA and cAMP-dependent protein kinase A (PKA), possible upstream kinases in the ERK1/2 signaling pathway, are involved (Mitchell et al., 2012; Obara et al., 2004). Coimmunoprecipitation experiments revealed that ZDHHC17 was associated with TrkA but not PKA (Fig. 5A). Indeed, ZDHHC17 was
linked to the trafficking capabilities of the TrkA. In zdhhc17 siRNAtreated induced PC12 cells, the TrkA-positive endosomes exhibited perinuclear localization rather than peripheral localization as observed in control cells (Fig. 5B). In contrast, ZDHHC17 increased TrkA recycling and could rescue the observed endosomal abnormalities (Fig. 5B). Thus, these results suggest that the abnormalities in endosomal dynamics might contribute to the dysregulation of receptor signaling in the endocytic pathway.
Fig. 3. Neurite outgrowth deficiencies in zdhhc17 siRNA-treated PC12 cells. (A–B) RT-PCR analysis of zdhhc17 mRNA expression during differentiation of PC12 cells induced by NGF. Quantification levels of zdhhc17 mRNA were significantly increased and maintained at 1, 3, 5, and 7 days after induction (B). Amplification of β-actin served as a control to calibrate the amount of cDNA template used in the PCR reactions. Each bar represents mean ± S.E.M. of at least three independent experiments. ∗ denotes P b 0.05; ** denotes P b 0.01 versus control. (C–D) RT– PCR analysis of zdhhc17 mRNA expression in zdhhc17 siRNA-treated PC12 cells. The bar graphs indicated that the expression of zdhhc17 mRNA was dramatically repressed in zdhhc17 siRNA-treated PC12 cells after differentiation (D). Amplification of β-actin served as a control to calibrate the amount of cDNA template used in the PCR reactions. Each bar represents mean ± S.E.M. of at least three independent experiments. ∗∗ denotes P b 0.01 versus control. (E–F) NGF-induced PC12 cells transfected with zdhhc17 siRNA showed defects in neurite outgrowth, whereas the mouse zdhhc17 mRNA overexpressed group exhibits more and longer neurite branches. Control: scrambled siRNA-transfected group, zdhhc17siRNA: zdhhc17 siRNAtransfected group, zdhhc17 siRNA + mRNA: mouse zdhhc17 mRNA-rescued group, zdhhc17 mRNA: mouse zdhhc17 mRNA overexpressed group. Each bar represents the mean ± S.E.M. of three independent experiments. ∗ denotes P b 0.05; ∗∗ denotes P b 0.01; not significant (ns) versus control.
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
199
Fig. 4. Zdhhc17 influences ERK1/2 phosphorylation during neurite outgrowth. (A–B) Western blot analysis showed that molecules of the MAPK signaling pathway were required for neuronal differentiation in PC12 cells. The levels of p-ERK1/2, p-p38, and p-JNK were significantly upregulated in NGF-induced PC12 cells. β-Actin served as a loading control. Values represent mean ± S.E.M. of three independent experiments. (C) Western blot analysis showed that the level of p-ERK1/2 was downregulated after zdhhc17 knockdown in NGF-induced PC12 cells, whereas zdhhc17 overexpression promoted ERK1/2 phosphorylation. The bar graphs clarified the relative level of (p-ERK1/2)/(t-ERK1/2) expression for at least three independent experiments. Values represent mean ± S.E.M. ∗ denotes P b 0.05; ∗∗ denotes P b 0.01; not significant (ns) versus control. (D) The affect of ZDHHC17 on ERK1/2 phosphorylation in NGF-induced PC12 cells required the ankyrin domain. Western blot analysis of p-ERK1/2 and t-ERK1/2 showed that ZDHHC17Δ overexpression did not upregulate the ERK1/2 phosphorylation level compared to wild-type ZDHHC17. The bar graphs showed the relative level of (p-ERK1/2)/(t-ERK1/2) expression for at least three independent experiments. Values represent mean ± S.E.M. ∗∗∗ denotes P b 0.001; not significant (ns) versus control.
The accumulation of TrkA in zdhhc17 siRNA-treated cells might be related to altered transport of these endosomes. Several lines of evidences suggest that TrkA-positive endosome traffics along microtubules, and TrkA also affects microtubule dynamics (Moises et al., 2007). Indeed, consistent with TrkA recycling dysfunction, we observed abnormal downregulated of TrkA–tubulin complex formation in zdhhc17siRNA -treated induced PC12 cells (Fig. 5C and D). This was also detected in zebrafish with co-injection of zdhhc17MO and TrkAGFP (Fig. 5E) as well as in zdhhc17 siRNA-treated differentiated NSCs (Fig. 5F). Moreover, the association between TrkA and tubulin, as assessed by coimmunoprecipitation, was exceedingly enhanced in the presence of ZDHHC17 (Fig. 5G). Therefore, these results indicate that
ZDHHC17 recruits TrkA and tubulin to form a trafficking module for TrkA recycling and signal transmission during neurite formation.
4. Discussion While the role of ZDHHC17 as a PAT is well established, its involvements in other mechanisms of the neural system are just beginning to be appreciated. Here, we report that ZDHHC17 possesses a novel mechanism that regulates axon outgrowth both in vivo and in vitro. ZDHHC17 regulates neuronal signal transmission and axonal transport by promoting TrkA–tubulin interaction.
200
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
Fig. 5. ZDHHC17 is required for TrkA–tubulin complex formation. (A) ZDHHC17 associated with TrkA but not PKA in PC12 cells, as TrkA was present in the GFP-ZDHHC17 immunoprecipitates obtained using an anti-GFP antibody. (B) TrkA-positive endosomes were distributed in the periphery of the cytoplasm in control PC12 cells (Ba). In zdhhc17 siRNA-treated cells, the TrkA-positive endosomes were localized in perinuclear areas (Bb) and could be rescued by increased ZDHHC17 expression (Bc). Overexpression of ZDHHC17 could upregulate TrkA recycling (Bd). Scale bar: 20 μm. (C–D) ZDHHC17 is crucial for TrkA–tubulin complex formation in NGF-induced PC12 cells. Values and error bars represent the mean ± S.E.M. of at least three independent experiments. ∗∗ denotes P b 0.01; ∗∗∗ denotes P b 0.001; not significant (ns) versus control. (E) Coimmunoprecipitation analysis of TrkA–tubulin complex formation in zebrafish. The bar graphs showed abnormally downregulation of the TrkA–tubulin complex formation in zebrafish with co-injection of zdhhc17MO and TrkA-GFP. Values represent mean ± S.E.M. of at least three independent experiments. ∗ denotes P b 0.05 versus control. (F) Coimmunoprecipitation analysis of TrkA–tubulin complex formation in zdhhc17 siRNAtreated differentiated NSCs. The bar graphs demonstrated that the TrkA–tubulin module formation was decreased in zdhhc17 siRNA-treated differentiated NSCs. Each bar represents the mean ± S.E.M. of at least three independent experiments. ∗ denotes P b 0.05 versus control. (G) Coimmunoprecipitation analysis of TrkA–tubulin complex formation in ZDHHC17 overexpression PC12 cells. ZDHHC17 overexpression dramatically promoted TrkA–tubulin complex formation in PC12 cells. The bar graphs indicated the potential binding ability of TrkA–tubulin complex formation for at least three independent experiments. Values represent mean ± S.E.M. ∗ denotes P b 0.05 versus control.
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
Many DHHC proteins have recently emerged as critical modulators of neuronal function, and their disruptions are linked to neurodevelopmental and neuropsychiatric conditions (el-Husseini Ael and Bredt, 2002; Fukata and Fukata, 2010). There are 23 putative mammalian DHHC proteins, and hundreds of proteins have been identified as their substrates (Fukata et al., 2006b; Tsutsumi et al., 2008). Moreover, most of them share substrates, making it challenging to investigate the direct roles of DHHC proteins in vivo. For example, some of the previous observations in vitro are not consistent with the changes in ZDHHC17 −/− mice, such as the palmitoylation level of huntingtin (HTT) (Singaraja et al., 2011). It is possible that the loss of ZDHHC17 activity in ZDHHC17 −/− mice will be compensated by other DHHC proteins, such as ZDHHC13, as they are closely related in mice. Interestingly, ZDHHC17 is the most highly conserved of all 23 DHHC proteins (88% identity, human-zebrafish), but ZDHHC13 appears to have significantly diverged in non-mammalian vertebrates (Young et al., 2012a). Thus, using zebrafish as a model could reveal some unexpected roles for ZDHHC17 in vivo. From a neurodevelopmental point of view, we found that ZDHHC17 is necessary for appropriate SMN axon architecture in zebrafish. The similar results are also found in the work showing a regulatory role of ZDHHC17 on axon outgrowth during NSC and PC12 cell differentiation. We found that zdhhc13 expression level was extremely low or undetectable in NSCs and PC12 cells (Supplementary Fig. 3). Other studies have also demonstrated roles of the DHHC family for axon and dendrite formation during neural development. In ZDHHC5 −/− NSCs, there was little evidence of neuron differentiation (Li et al., 2011). Furthermore, overexpression of ZDHHC7 induced neurite elongation in N2A cells (Fukata and Fukata, 2010). Thus, these investigations into how DHHC proteins regulate axogenesis or axon outgrowth may identify new mechanisms associated with several neurological disorders. Our results demonstrate that ZDHHC17 possesses a novel function that might be unique within the DHHC family. During axon outgrowth, ZDHHC17–TrkA–tubulin forms a trafficking module for TrkA recycling and ERK activation. Moreover, the ankyrin domain of ZDHHC17, which is important for protein–protein interaction and signaling (Huang et al., 2009), is likely involved in this module assembly as ZDHHC17Δ did not clearly upregulate ERK1/2 phosphorylation. As reported previously, ZDHHC17 acts as a PAT that catalyzes palmitoylation, and PSD-95 and GAP-43 were identified as its substrates in vitro (Fukata et al., 2004; Huang et al., 2004; Tsutsumi et al., 2008). This suggests that the palmitoylation role of ZDHHC17 could also contribute to axogenesis during neuron differentiation. Altered palmitoylation and interaction profiles of ZDHHC17 protein substrates, as well as activation of MAPK pathways, have been noted in the pathogenesis of several diseases (Bandyopadhyay et al., 2010; Goytain et al., 2008; Yanai et al., 2006; Yang and Cynader, 2011). Thus, we propose that the different functions of ZDHHC17 could be systematically connected and directly or indirectly contribute to axon outgrowth in neurons. Additional studies regarding the relationship between ZDHHC17 substrates and signaling pathway activation may help to elucidate the role of ZDHHC17 during neural development. Axon outgrowth is a highly complex process that must be precisely orchestrated through a number of neuron-intrinsic properties. It is becoming increasingly apparent that balanced TrkA activation and positioning regulate successful axon outgrowth (Campenot, 2009; MacInnis et al., 2003; Riccio et al., 1997). In this study, we observed an obvious change in the trafficking capabilities of TrkA receptors in zdhhc17 siRNA-treated cells. Generally, this change involved an abnormal distribution of early and recycling endosomes (Cabeza et al., 2012). Increasing evidence has recently highlighted the importance of endocytic trafficking in regulating the activity and distribution of developmental signaling pathways (Fassier et al., 2010; Piddini and Vincent, 2003). During axon outgrowth, long-lasting activation of a number of signaling pathways depends on TrkA receptor recycling (Chen et al., 2005). Indeed, these endosomal distribution abnormalities could reflect changes
201
in the Rab-GTPases and motor activity. Accordingly, we found that the interaction between TrkA and tubulin was impaired in zdhhc17 siRNAtreated cells. Moreover, TrkA also affects microtubule dynamics during the stabilization of outgrowing neurites (Pryor et al., 2012). Therefore, our results suggest that by regulating the interaction between TrkA and tubulin, ZDHHC17 is specifically involved in both axonal transport and the organization of the microtubule network in developing neurons. 5. Conclusions Our results demonstrate that ZDHHC17 is a neuron-intrinsic factor that is crucial for axon growth in vivo and in vitro via a mechanism independent on its PAT activity. Moreover, we find that ZDHHC17 regulates the TrkA–tubulin complex formation specifically. Our results extend the function of ZDHHC17 during neural development and provide a framework, which fully understand the roles of DHHC family members and further explain disease processes that involved with DHHC protein dysfunction. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.mcn.2015.07.005. Acknowledgments This work was supported by funding from the National Natural Science Foundation of China (no. 31440056 and 31271289), Ministry of Education of China (no. 20110131110036), Natural Science Foundation of Shandong Province (no. 2012GSF11842 and ZR2010HQ022) and Shandong University (no. 2012JC006). References Akiyama, H., Tojima, T., Kamiguchi, H., 2012. Mechanisms of neuronal growth cone navigation. Seikagaku 84, 848–853. Auer, M., Schweigreiter, R., Hausott, B., Thongrong, S., Holtje, M., Just, I., Bandtlow, C., Klimaschewski, L., 2012. Rho-independent stimulation of axon outgrowth and activation of the ERK and Akt signaling pathways by C3 transferase in sensory neurons. Front. Cell. Neurosci. 6, 43. Bandyopadhyay, S., Chiang, C.-Y., Srivastava, J., Gersten, M., White, S., Bell, R., Kurschner, C., Martin, C.H., Smoot, M., Sahasrabudhe, S., 2010. A human MAP kinase interactome. Nat. Methods 7, 801–805. Cabeza, C., Figueroa, A., Lazo, O.M., Galleguillos, C., Pissani, C., Klein, A., Gonzalez-Billault, C., Inestrosa, N.C., Alvarez, A.R., Zanlungo, S., Bronfman, F.C., 2012. Cholinergic abnormalities, endosomal alterations and up-regulation of nerve growth factor signaling in Niemann–Pick type C disease. Mol. Neurodegener. 7, 11. Campenot, R.B., 2009. NGF uptake and retrograde signaling mechanisms in sympathetic neurons in compartmented cultures. Results Probl. Cell Differ. 48, 141–158. Chen, Z.Y., Ieraci, A., Tanowitz, M., Lee, F.S., 2005. A novel endocytic recycling signal distinguishes biological responses of Trk neurotrophin receptors. Mol. Biol. Cell 16, 5761–5772. Cheng, P.L., Poo, M.M., 2012. Early events in axon/dendrite polarization. Annu. Rev. Neurosci. 35, 181–201. Cowley, S., Paterson, H., Kemp, P., Marshall, C.J., 1994. Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells. Cell 77, 841–852. Doyle, J.P., Dougherty, J.D., Heiman, M., Schmidt, E.F., Stevens, T.R., Ma, G., Bupp, S., Shrestha, P., Shah, R.D., Doughty, M.L., 2008. Application of a translational profiling approach for the comparative analysis of CNS cell types. Cell 135, 749–762. el-Husseini Ael, D., Bredt, D.S., 2002. Protein palmitoylation: a regulator of neuronal development and function. Nat. Rev. Neurosci. 3, 791–802. Euteneuer, S., Yang, K.H., Chavez, E., Leichtle, A., Loers, G., Olshansky, A., Pak, K., Schachner, M., Ryan, A.F., 2013. Glial cell line-derived neurotrophic factor (GDNF) induces neuritogenesis in the cochlear spiral ganglion via neural cell adhesion molecule (NCAM). Mol. Cell. Neurosci. 54, 30–43. Fassier, C., Hutt, J.A., Scholpp, S., Lumsden, A., Giros, B., Nothias, F., Schneider-Maunoury, S., Houart, C., Hazan, J., 2010. Zebrafish atlastin controls motility and spinal motor axon architecture via inhibition of the BMP pathway. Nat. Neurosci. 13, 1380–1387. Franze, K., 2013. The mechanical control of nervous system development. Development 140, 3069–3077. Frey, D., Laux, T., Xu, L., Schneider, C., Caroni, P., 2000. Shared and unique roles of CAP23 and GAP43 in actin regulation, neurite outgrowth, and anatomical plasticity. J. Cell Biol. 149, 1443–1454. Fukata, Y., Fukata, M., 2010. Protein palmitoylation in neuronal development and synaptic plasticity. Nat. Rev. Neurosci. 11, 161–175. Fukata, M., Fukata, Y., Adesnik, H., Nicoll, R.A., Bredt, D.S., 2004. Identification of PSD-95 palmitoylating enzymes. Neuron 44, 987–996.
202
W. Shi et al. / Molecular and Cellular Neuroscience 68 (2015) 194–202
Fukata, Y., Bredt, D.S., Fukata, M., 2006a. Protein Palmitoylation by DHHC Protein Family. Fukata, Y., Iwanaga, T., Fukata, M., 2006b. Systematic screening for palmitoyl transferase activity of the DHHC protein family in mammalian cells. Methods 40, 177–182. Gonzalez-Quevedo, R., Lee, Y., Poss, K.D., Wilkinson, D.G., 2010. Neuronal regulation of the spatial patterning of neurogenesis. Dev. Cell 18, 136–147. Goytain, A., Hines, R.M., Quamme, G.A., 2008. Huntingtin-interacting proteins, HIP14 and HIP14L, mediate dual functions, palmitoyl acyltransferase and Mg2 + transport. J. Biol. Chem. 283, 33365–33374. Harada, T., Matsuzaki, O., Hayashi, H., Sugano, S., Matsuda, A., Nishida, E., 2003. AKRL1 and AKRL2 activate the JNK pathway. Genes Cells 8, 493–500. Heiman, M., Schaefer, A., Gong, S., Peterson, J.D., Day, M., Ramsey, K.E., Suárez-Fariñas, M., Schwarz, C., Stephan, D.A., Surmeier, D.J., 2008. A translational profiling approach for the molecular characterization of CNS cell types. Cell 135, 738–748. Hines, R.M., Kang, R., Goytain, A., Quamme, G.A., 2010. Golgi-specific DHHC zinc finger protein GODZ mediates membrane Ca2+ transport. J. Biol. Chem. 285, 4621–4628. Huang, K., Yanai, A., Kang, R., Arstikaitis, P., Singaraja, R.R., Metzler, M., Mullard, A., Haigh, B., Gauthier-Campbell, C., Gutekunst, C.-A., 2004. Huntingtin-interacting protein HIP14 is a palmitoyl transferase involved in palmitoylation and trafficking of multiple neuronal proteins. Neuron 44, 977–986. Huang, K., Sanders, S., Singaraja, R., Orban, P., Cijsouw, T., Arstikaitis, P., Yanai, A., Hayden, M.R., El-Husseini, A., 2009. Neuronal palmitoyl acyl transferases exhibit distinct substrate specificity. FASEB J. 23, 2605–2615. Langhorst, M.F., Jaeger, F.A., Mueller, S., Sven Hartmann, L., Luxenhofer, G., Stuermer, C.A., 2008. Reggies/flotillins regulate cytoskeletal remodeling during neuronal differentiation via CAP/ponsin and Rho GTPases. Eur. J. Cell Biol. 87, 921–931. Li, Y., Martin, B.R., Cravatt, B.F., Hofmann, S.L., 2011. DHHC5 palmitoylates flotillin-2 and is rapidly degraded on induction of neuronal differentiation in cultured cells. J. Biol. Chem. Li, S., Leshchyns'ka, I., Chernyshova, Y., Schachner, M., Sytnyk, V., 2013. The neural cell adhesion molecule (NCAM) associates with and signals through p21-activated kinase 1 (Pak1). J. Neurosci. 33, 790–803. MacInnis, B.L., Senger, D.L., Campenot, R.B., 2003. Spatial requirements for TrkA kinase activity in the support of neuronal survival and axon growth in rat sympathetic neurons. Neuropharmacology 45, 995–1010. Mitchell, D.J., Blasier, K.R., Jeffery, E.D., Ross, M.W., Pullikuth, A.K., Suo, D., Park, J., Smiley, W.R., Lo, K.W.-H., Shabanowitz, J., 2012. Trk activation of the ERK1/2 kinase pathway stimulates intermediate chain phosphorylation and recruits cytoplasmic dynein to signaling endosomes for retrograde axonal transport. J. Neurosci. 32, 15495–15510. Moises, T., Dreier, A., Flohr, S., Esser, M., Brauers, E., Reiss, K., Merken, D., Weis, J., Kruttgen, A., 2007. Tracking TrkA's trafficking: NGF receptor trafficking controls NGF receptor signaling. Mol. Neurobiol. 35, 151–159.
Obara, Y., Labudda, K., Dillon, T.J., Stork, P.J., 2004. PKA phosphorylation of Src mediates Rap1 activation in NGF and cAMP signaling in PC12 cells. J. Cell Sci. 117, 6085–6094. Piddini, E., Vincent, J.P., 2003. Modulation of developmental signals by endocytosis: different means and many ends. Curr. Opin. Cell Biol. 15, 474–481. Pryor, S., McCaffrey, G., Young, L.R., Grimes, M.L., 2012. NGF causes TrKA to specifically attract microtubules to lipid rafts. PLoS One 7, e35163. Riccio, A., Pierchala, B.A., Ciarallo, C.L., Ginty, D.D., 1997. An NGF-TrkA-mediated retrograde signal to transcription factor CREB in sympathetic neurons. Science 277, 1097–1100. Singaraja, R.R., Huang, K., Sanders, S.S., Milnerwood, A.J., Hines, R., Lerch, J.P., Franciosi, S., Drisdel, R.C., Vaid, K., Young, F.B., Doty, C., Wan, J., Bissada, N., Henkelman, R.M., Green, W.N., Davis, N.G., Raymond, L.A., Hayden, M.R., 2011. Altered palmitoylation and neuropathological deficits in mice lacking HIP14. Hum. Mol. Genet. 20, 3899–3909. Tian, L., McClafferty, H., Jeffries, O., Shipston, M.J., 2010. Multiple palmitoyltransferases are required for palmitoylation-dependent regulation of large conductance calcium- and voltage-activated potassium channels. J. Biol. Chem. 285, 23954–23962. Tsutsumi, R., Fukata, Y., Fukata, M., 2008. Discovery of protein-palmitoylating enzymes. Pflugers Arch. - Eur. J. Physiol. 456, 1199–1206. Yanai, A., Huang, K., Kang, R., Singaraja, R.R., Arstikaitis, P., Gan, L., Orban, P.C., Mullard, A., Cowan, C.M., Raymond, L.A., Drisdel, R.C., Green, W.N., Ravikumar, B., Rubinsztein, D.C., El-Husseini, A., Hayden, M.R., 2006. Palmitoylation of huntingtin by HIP14 is essential for its trafficking and function. Nat. Neurosci. 9, 824–831. Yang, G., Cynader, M.S., 2011. Palmitoyl acyltransferase zD17 mediates neuronal responses in acute ischemic brain injury by regulating JNK activation in a signaling module. J. Neurosci. 31, 11980–11991. Ye, T., Fu, A.K., Ip, N.Y., 2012. Cyclin-dependent kinase 5 in axon growth and regeneration. Int. Rev. Neurobiol. 105, 91–115. Young, F.B., Butland, S.L., Sanders, S.S., Sutton, L.M., Hayden, M.R., 2012a. Putting proteins in their place: palmitoylation in Huntington disease and other neuropsychiatric diseases. Prog. Neurobiol. 97, 220–238. Young, F.B., Franciosi, S., Spreeuw, A., Deng, Y., Sanders, S., Tam, N.C., Huang, K., Singaraja, R.R., Zhang, W., Bissada, N., Kay, C., Hayden, M.R., 2012b. Low levels of human HIP14 are sufficient to rescue neuropathological, behavioural, and enzymatic defects due to loss of murine HIP14 in Hip14−/− mice. PLoS One 7 e36315. Zhao, S., Yuan, Q., Hao, H., Guo, Y., Liu, S., Zhang, Y., Wang, J., Liu, H., Wang, F., Liu, K., Ling, E.A., Hao, A., 2011. Expression of OCT4 pseudogenes in human tumours: lessons from glioma and breast carcinoma. J. Pathol. 223, 672–682.