- Email: [email protected]
Zebrafish Abcb4 is a potential efflux transporter of microcystin-LR
Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc
Zebrafish Abcb4 is a potential efflux transporter of microcystin-LR Xing Lu a, Yong Long b, Rongze Sun a, Bolan Zhou b, Li Lin a, Shan Zhong a,⁎, Zongbin Cui b,⁎ a b
Department of Genetics, School of Basic Medical Science, Wuhan University, Wuhan 430071, Hubei, China The Key Laboratory of Aquatic Biodiversity and Conservation of Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, Hubei, China
a r t i c l e
i n f o
Article history: Received 30 July 2014 Received in revised form 19 August 2014 Accepted 21 August 2014 Available online 1 September 2014 Keywords: Abcb4 Efflux transporter Microcystin-LR Detoxification
a b s t r a c t Microcystin-LR (MC-LR) is one of the most common microcystins (MCs), which are hepatotoxic and released into a water body during a period of cyanobacterial blooms. These toxicants can be accumulated in aquatic animals and transferred along the food chain and thus pose adverse effects on aquatic environment and public health. Zebrafish Abcb4 is reported to mediate the cellular efflux of ecotoxicologically relevant compounds including galaxolide, tonalide and phenanthrene; however, it remains unclear whether Abcb4 functions in the detoxification of MC-LR. Here, we demonstrated the role of zebrafish Abcb4 in cellular efflux of MC-LR. Transcripts of zebrafish abcb4 were detected in all of adult tissues examined. MC-LR was able to induce the expression of abcb4 gene and overexpression of Abcb4 significantly decreased the cytotoxicity and accumulation of MC-LR in LLC-PK1 cells and developing embryos. In contrast, overexpression of an Abcb4-G1177D mutant abolished its transporter function but not substrate binding activity, and sensitized LLC-PK1 cells and developing embryos to this cyanobacterial toxin. Moreover, ATPase activity in developing embryos can be induced by MC-LR. Thus, zebrafish Abcb4 plays crucial roles in cellular efflux of MC-LR and is a potential molecular marker for the monitoring of cyanobacteria contamination in the aquatic environment. © 2014 Elsevier Inc. All rights reserved.
1. Introduction ATP-binding cassette (ABC) transporters are the largest and most ancient transmembrane proteins found in all organisms from prokaryotes to mammals (Higgins, 1992). ABC transporters are classified according to their amino acid sequences and the organization of functional domains, including hydrophilic ATP-binding domains (also called nucleotide-binding domains, NBDs) and hydrophobic transmembrane domains (TMDs). P-glycoprotein (ABCB1, MDR1) is a highly conserved, phosphorylated and glycosylated protein that functions as a cellular efflux pump for actively transporting a wide range of endogenous organic cation metabolites and exogenous compounds, such as structurally diverse chemotherapeutic drugs and other xenobiotics in an ATP-dependent manner (Chin et al., 1989; Kroetz et al., 2003; Aller et al., 2009). Human P-glycoprotein encoded by MDR gene was initially found in human lung cancer cell lines and this transmembrane protein (170-kDa) is composed of two symmetric and homologous halves, each consists of six transmembrane domains and an ATP binding motif (Cole et al., 1992; Salama et al., 2006). The globally accelerated eutrophication and increased cyanobacterial blooms in aquatic environment have produced a wide variety of natural toxins, including lipopolysaccharides, neurotoxins, and ⁎ Corresponding authors. E-mail addresses: [email protected] (X. Lu), [email protected] (Y. Long), [email protected] (R. Sun), [email protected] (B. Zhou), [email protected] (L. Lin), [email protected] (S. Zhong), [email protected] (Z. Cui).
http://dx.doi.org/10.1016/j.cbpc.2014.08.005 1532-0456/© 2014 Elsevier Inc. All rights reserved.
hepatotoxins (Backer et al., 2013) that are dispersed into the water during or on the senescence of cyanobacterial blooms (Malbrouck and Kestemont, 2006). These cyanobacterial toxins are resistant to biodegradation (Ho et al., 2012) and can directly or indirectly pose a serious threat to aquatic organisms and cause long-term health effects on humans and animals through drinking contaminated water and the food chain. In freshwater systems, microcystins (MCs) are the most common monocyclic heptapeptides (Chorus and Bartram, 1999). To date, more than 80 MCs have been identified and most of them are highly toxic (Ame et al., 2009). Among various structural variants of MCs, microcystin-LR (MC-LR) is the most common and toxic microcystin congeners that contain two variable L-amino acides leucine and arginine (Organization, 2003). Zebrafish (Danio rerio) are widely accepted as an excellent vertebrate model for the research of developmental biology, genetics, toxicology and various human diseases (Spitsbergen and Kent, 2003; Hill et al., 2005; Huang et al., 2012). Two P-glycoprotein genes that are designated as abcb4 and abcb5 have been identified in the genome of zebrafish and zebrafish Abcb4 can act as a cellular toxicant transporter and protect embryos against toxic chemicals such as galaxolide, tonalide and phenanthrene (Fischer et al., 2013). However, little is known about whether zebrafish Abcb4 functions in the detoxification of cyanobacterial toxins such as MC-LR. In this study, we detected the tissue-specific expression of zebrafish Abcb4, investigated its transcriptional responses to MC-LR, and evaluated its roles in cellular efflux of MC-LR in LLC-PK1 cells and zebrafish embryos.
36
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
2. Materials and methods
2.5. Efflux assays
2.1. Chemicals
Transporter activities of zebrafish Abcb4 and Abcb4-G1177D in LLCPK1 cells were measured by using the rhodamine 123 efflux assay as previously described (Long et al., 2011c). Activities of Abcb4 and Abcb4-G1177D in zebrafish embryos were detected as previously described (Fischer et al., 2013). Briefly, exposure solutions were prepared in embryo medium containing 0.5 μM of rhodamine 123 and variable concentrations of MC-LR (0.01–10 μg/L). Normal embryos or embryos overexpressing Abcb4, Abcb4-G1177D or GFP were cultured in exposure solutions at 28 °C in the dark for 1 h. After washed at least three times with embryo medium, embryos were sonicated in hypotonic buffer (10 mM KCl, 1.5 mM MgCl2, 10 mM Tris HCl, pH = 7.4) and the supernatants were collected after a brief centrifuging and transferred into a 96-well microplate in the dark for subsequent fluorescence determination. The fluorescence was measured using a microplate reader (Spectra-Max M5, Molecular Devices, USA) at 595 nm excitation and 530 nm emission wavelengths.
Analytical grade reagent microcystin-LR (MC-LR, CAS#: 101043-372) was purchased from Aqua-Standard Technologies Inc., USA. Rhodamine 123 (Rh-123), cyclosporin A, MTT, and dimethyl sulfoxide (DMSO) were obtained from Sigma-Aldrich. MC-LR was dissolved in Milli Q water. Stock solutions of other chemicals were freshly prepared in DMSO. Final concentration of DMSO in exposure media did not exceed 0.2%.
2.2. Zebrafish maintenance and MC-LR treatments The AB strain of zebrafish (Danio rerio) was maintained and reared according to standard protocols (Westerfield, 2000). Collection of eggs and culture of embryos were performed as in our previous study (Long et al., 2011a; Gu et al., 2013). Embryos were staged according to hour post-fertilization (hpf). To examine whether MC-LR induces transcriptional expression of zebrafish abcb4, stock solution of MC-LR was diluted with embryo medium to the desired concentration before use. Embryos were treated from 24 to 96 hpf in embryo medium containing serial dilutions of MC-LR (0.01–10 μg/L). One hundred embryos were used for each treatment and culture solutions were changed once after treatment for 12 h. Hatching, survival and abnormal rates were calculated at the corresponding stages of developing embryos. 2.3. Cloning of zebrafish abcb4 cDNA and plasmid construction To obtain the coding sequence of abcb4 gene from zebrafish, two PCR-primers abcb4-F1 (5′- CATCGCGGCCGCGCCACCATGGGCAAGAAA TCCAAACTCAAAG -3′) and abcb4-R1 (5′- CGGATATCTCACTTGTCATCGT CGTCCTTGTAGTCGTGGCTCATCTGTGAGGTGACAAG -3′) were designed according to the data in GenBank (JQ014001) and two restriction sites (underlined) for NotI and EcoRV were added for subcloning purpose. A kozak sequence in the forward primer was introduced around the translation initiation codon to improve the expression of abcb4 gene in cells and developing embryos. Total mRNA was isolated from zebrafish intestine and reverse transcription was performed to obtain cDNA templates. The full length of zebrafish abcb4 CDS was subcloned into the overexpression vector pT2/CMV•SV40-Neo to generate pT2/ CMV-Abcb4•SV40-Neo. The abcb4 cDNA was Flag-tagged at the carboxyl terminus. The pT2/CMV-GFP was used as a control vector. A dominant negative vector pT2/CMV-Abcb4 (G1177D) •SV40-Neo was generated by site-specific mutation (Zheng et al., 2004) with PCR primers abcb4-F2/R2 in Table S1.
2.4. LLC-PK1 cell lines LLC-PK1 cells (ATCC: CRL-101™) were cultured in M199 medium supplemented with 3% fetal bovine serum (FBS), 100 units/mL penicillin and 100 μg/mL streptomycin at 37 °C under 5% CO2 humidified atmosphere. To obtain Abcb4-overexpressing LLC-PK1 cells, cells at an initial density of 3 × 105 cells per 35 mm dish were co-transfected with an optimal ratio of pCMV-SB11 (0.5 μg), pT2/CMV-Abcb4•SV40-Neo (2 μg) and XtremeGENE HP DNA Transfection Reagent (Roche) following manufacturer's instructions. At 24 h after transfection, cells were selected in medium containing 200 μg/mL of G418 for two weeks. The Abcb4overexpressing cell colonies were picked up, expanded and maintained in medium containing 100 μg/mL of G418. The Abcb4-G1177Doverexpressing cells were obtained following the same protocol and pT2/CMV •SV40-Neo was used as the control vector.
2.6. RNA extraction and real-time PCR Total RNA was extracted from 30 to 50 developing zebrafish embryos using TRIZOL reagent (Invitrogen) according to the manufacturer's instructions. RNA quality was assessed with agarose gel electrophoresis and UV spectrophotometry and considered satisfactory for use if the Abs260/Abs280 ratio was between 1.9 and 2.1. First-strand cDNA for each RNA sample was synthesized using the RevertAid™ First Strand cDNA Synthesis Kit from Fermentas. Real-time PCR (qPCR) was performed with the SYBR Green Realtime PCR Master Mix (BioRad) and the CFX Real-Time PCR Detection System (BioRad). 18S ribosomal RNA and β-actin gene were used as internal references for evaluation of tissue-specific and MC-LR-induced abcb4 expression, respectively (McCurley and Callard, 2008). Primers used for abcb4 (abcb4-F3/R3), 18S RNA and β-actin were designed with the Primer Premier 5.0 software and listed in Table S1. The qPCR was performed with RNA extracts from three different zebrafish embryo batches and all reactions were run in triplicate. The expression of abcb4 in tissues was normalized to 18S (Normalized abcb4 mRNA level = 105 × 2 [Ct 18s − Ct abcb4]). The MC-LR-induced abcb4 expression was calculated using the 2−ΔΔCt method as described in our previous study (Long et al., 2011d). 2.7. Whole-mount in situ hybridization A fragment of abcb4 cDNA was amplified with PCR primers abcb4F4/R4 (Table S1) and then subcloned into the Sal I/Not I site of pBluescript SK vector for subsequent in vitro synthesis of RNA probes. The recombinant plasmid was linearized with Sal I or Not I. Anti-sense and sense RNA probes labeled with digoxigenin-UTP (Roche) were transcribed with T7 or T3 RNA polymerases, respectively. Wholemount in situ hybridization (WISH) of zebrafish embryos at indicated stages was performed as described previously (Thisse and Thisse, 2008). Images were taken under a stereomicroscope from Zeiss. Later stage embryos for WISH were treated with 0.003% phenylthiourea (PTU) from Sigma-Aldrich to inhibit the pigmentation. 2.8. Cytotoxicity assays The viability of LLC-PK1 cells was measured with MTT assays after exposure to MC-LR. Briefly, cells transfected with Abcb4, Abcb4G1177D and empty vectors were seeded in 96-well plates at a density of 2 × 105 cells/well in 100 μL medium and cultured for 48 h before treatment. The medium was then removed and replaced with the same volume of medium containing serial dilutions of MC-LR (0.5– 50 μg/mL) for 48 h. Cells for MTT assays must be ensured in the exponential phase; 10 μL of MTT solution was added to each well and
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
37
incubated at 37 °C for 4 h. The formazan salts were dissolved in 100 μL of DMSO and plates were shaken for 5 min on a plate shaker to ensure adequate solubility. Absorbance of each well was read at 540 nm with a microplate reader. Viability was expressed as percentage of the corresponding control. All the experiments were performed at least three times. 2.9. Microinjection and acute toxicity test Embryos at one-cell stage were microinjected with 150 pg/embryo of pT2/CMV-Abcb4, pT2/CMV-Abcb4-G1177D or pT2/CMV-GFP. The success of microinjection was confirmed by GFP expression in more than 90% of pT2/CMV-GFP-injected embryos at 8 hpf. At 24 hpf, embryos without abnormal phenotypes were selected and treated with 50 μg/L MC-LR from 24 to 96 hpf. Toxicity assays for MC-LR were independently performed three times. The medium containing MC-LR was replaced and dead embryos were removed once every 12 h for the calculation of death rates. 2.10. Western blotting and immunofluorescence staining Western blotting of Abcb4 or Abcb4-G1177D proteins in LLC-PK1 cells and subcellular localization detection of Flag-tagged Abcb4 or Abcb4-G1177D in LLC-PK1 cells were performed following our previous protocol (Mo et al., 2010; Wang et al., 2012). Briefly, Abcb4- or Abcb4G1177D-expressing LLC-PK1 cells were fixed with 4% paraformaldehyde and blocked with PBS containing 10% goat serum for 1 h. Cells were incubated with anti-Flag antibody (1:200, Sigma) for 1 h at room temperature and then with FITC-conjugated secondary antibody (antimouse IgG, 1:1000, Molecular Probes). Cells were stained with DAPI and then imaged under a confocal microscope (LSM 710, Carl Zeiss). 2.11. High performance liquid chromatography Abcb4-expressing LLC-PK1 cells were treated with 10 μg/mL of MCLR, washed three times with PBS and collected at 5, 15, 30, 60, 90, 120, 150 and 180 min after treatment. Zebrafish embryos injected with pT2/CMV-Abcb4, pT2/CMV-Abcb4-G1177D or pT2/CMV-GFP were exposed to 5 μg/L of MC-LR, washed three times with embryo medium and collected at 1, 6, 12, 24 and 48 h after treatment. Quantification of the microcystin-LR was measured by high performance liquid chromatography (HPLC) as described previously (Hyenstrand et al., 2001). 2.12. Detection of ATPase activity Embryos at 96-hpf stage were exposed to variable concentrations of (0.05–1000 μg/L) MC-LR for 40 min at 37 °C. ATPase activity was then detected by measuring inorganic phosphate liberation as previously described (Fischer et al., 2013).
Fig. 1. Transcriptional expression of zebrafish abcb4 gene in adult tissues. Brain, eyes, gills, intestine, liver, muscle, ovaries or testes from three individuals were collected for total RNA isolation and subjected to qRT-PCR analysis. Heart or kidney from ten individuals were pooled and used for total RNA isolation and subjected to qRT-PCR analysis. Values are given as mean ± standard deviations (n = 3).
detected in testis, kidney, heart, and brain. These findings suggest that zebrafish Abcb4 plays crucial roles in physiological functions of some adult tissues or organs such as intestine and liver. 3.2. Effects of MC-LR on zebrafish development and Abcb4 expression We first explored the effects of MC-LR on the hatching, survival and abnormal rates of developing embryos at 96 hpf. As shown in Fig. 2A, hatching rate of larval zebrafish obviously decreased with the increase of MC-LR concentrations. Abnormal rates of embryos at 96 hpf increased from 1.13% to 4.36% with the increase of MC-LR concentrations (Supplementary Fig. 1A). However, exposure to 10 μg/L of MC-LR had no lethal effects on embryos at 96 hpf (Supplementary Fig. 1B). Thus, MC-LR is toxic to zebrafish development. Next, transcriptional responses of zebrafish abcb4 to MC-LR were analyzed with qPCR in developing embryos. As shown in Fig. 2B, expression of abcb4 gene from 12 to 96 hpf was significantly induced (p b 0.05) by 0.01 to 10 μg/L of MC-LR and the induction rate was 1.41, 1.79 and 2.08, respectively. Moreover, we performed WISH assays to determine tissue-specific responses of abcb4 expression to MC-LR. Consistent with the qPCR results, expression of abcb4 in intestines of embryos after treatment with 0.01 μg/L of MC-LR from 24 to 96 hpf was significantly induced in comparison with that in the untreated control (Fig. 2C). 3.3. Zebrafish Abcb4 functions in cellular detoxification of MC-LR
2.13. Statistical analysis Data were expressed as means ± standard deviation (SD). Student's t test or one-way analysis of variance (ANOVA) followed by a Duncan's post-hoc test was performed using the SPSS version 15.0 for windows (SPSS Inc., Chicago, IL, USA) to determine the significant difference (p b 0.05) among different treatments. 3. Results 3.1. Transcriptional expression of abcb4 gene in adult tissues of zebrafish Transcriptional expression of zebrafish abcb4 in adult tissues was examined with qPCR. As shown in Fig. 1, the transcription of zebrafish abcb4 mainly occurred in intestine and liver followed by muscle, gill, eye and ovary, and relatively low levels of abcb4 transcripts were
To address the physiological roles of elevated Abcb4 expression, we examined the effects of Abcb4 and its dominant negative form on the survival of developing embryos exposed to MC-LR. The dominant negative form of zebrafish Abcb4 (Abcb4-G1177D) was generated by site-specific mutation to abolish its ATP hydrolysis and transporter function without effects on the substrate binding activity as described previously (Ren et al., 2004; Frelet and Klein, 2006). Previous study has demonstrated 50 μg/L of MC-LR can kill 40% embryos from blastula stage up to the end of embryonic development (Malbrouck and Kestemont, 2006). Therefore, acute toxicity assays were performed with embryos exposed to 50 μg/L of MC-LR. In addition, developing embryos injected with 150 pg/embryo of pT2/CMV-Abcb4 or pT2/ CMV-Abcb4-G1177D showed no abnormal phenotypes at 96 hpf, implying that overexpressed Abcb4 or Abcb4-G1177D has little side effect on developing embryos. To reduce experimental variations, injected
38
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
Fig. 2. Effects of MC-LR on the hatching and abcb4 expression of zebrafish embryos. (A) Hatching rate of 96-hpf embryos exposed to MC-LR at indicated concentrations. (B) Total RNAs of 96-hpf embryos exposed to 0.01–10 μg/L of MC-LR were extracted for qRT-PCR. (C) Embryos treated with 0.01 μg/L of MC-LR from 24 to 96 hpf were subjected to WISH analysis of induced abcb4 expression, respectively. CK represents the untreated control. Black arrows point to intestine. All values are expressed as mean ± standard deviation (n = 3). Significant differences are indicated by ⁎p b 0.05 and ⁎⁎p b 0.01.
embryos without abnormal phenotypes at 24 hpf were selected for subsequent toxicity assays. As shown in Fig. 3A, the death rate of Abcb4expressing embryos at 96 hpf was significantly lower than that of GFP-expressing embryos (p b 0.05), while the death rate of Abcb4G1177D-expressing embryos was significantly higher than that of GFP-expressing embryos (p b 0.05). These data suggest that zebrafish Abcb4 is able to protect developing embryos from toxic effects of MCLR. Next, MTT assays were utilized to examine effects of zebrafish Abcb4 on the survivability of pig kidney-derived LLC-PK1 cells after exposure to MC-LR. When compared with those of empty vector-transfected (CTRL) and Abcb4-G1177D-expressing cells, survival rate of zebrafish
Abcb4-expressing cells was improved by 1.77- to 5.83-fold after exposure to MC-LR at concentrations of 25–50 μg/mL (Fig. 3B). Moreover, the sensitivity of Abcb4-G1177D-expressing cells to MC-LR was the same as that of CTRL (Fig. 3B). Thus, zebrafish Abcb4 is able to improve the survivability of LLC-PK1 cells exposed to toxic MC-LR. 3.4. Zebrafish Abcb4 promotes the excretion of MC-LR in developing embryos To dissect cellular mechanisms underlying the roles of zebrafish Abcb4 in detoxification of MC-LR, we first investigated the effect of zebrafish Abcb4 on the accumulation of MC-LR in developing embryos.
Fig. 3. Zebrafish Abcb4 plays crucial roles in cellular detoxification of MC-LR. (A) Death rate of 96-hpf embryos expressing GFP, Abcb4 or Abcb4-G1177D was monitored after treatment with 50 μg/L of MC-LR. (B) Survival rate of LLC-PK1 cells expressing Abcb4 or Abcb4-G1177D, and transfected with empty vectors (CTRL) was determined with MTT assays after exposure to MC-LR at indicated concentrations for 24 h. Values are expressed as mean ± standard deviation (n = 3). Significant differences are indicated by ⁎p b 0.05 and ⁎⁎p b 0.01.
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
39
Fig. 4. Zebrafish Abcb4 is involved in the excretion of MC-LR in developing embryos. (A) Contents of MC-LR in embryos expressing GFP, Abcb4 and Abcb4-G1177D at the indicated exposure time points. (B) Contents of Rh-123 in embryos expressing GFP, Abcb4 and Abcb4-G1177D after being exposed to MC-LR at indicated concentrations. Values are expressed as means ± standard deviations (n = 3). Significant differences are indicated by ⁎p b 0.05 and ⁎⁎p b 0.01.
As shown in Fig. 4A, contents of MC-LR accumulated in Abcb4overexpressing embryos were significantly lower than those in GFPand Abcb4-G1177D-expressing embryos and dropped with the increase of exposure time by an average of 58.3% after treatment with 5 μg/L of MC-LR for 48 h. Moreover, contents of MC-LR in Abcb4-G1177Dexpressing embryos were higher than that in GFP-expressing embryos (an average increase of 1.1-fold). Thus, zebrafish Abcb4 is able to promote the excretion of MC-LR accumulated in developing embryos. Since rhodamine 123 (Rh-123) is known to serve as an excellent fluorescent substrate of Abcb4 protein, we next performed rhodamine 123 efflux assays to examine the effects of MC-LR on the efflux of fluorescent dye in developing embryos. As shown in Fig. 4B, Rh-123 amounts accumulated in GFP-, Abcb4-G1177D- and Abcb4-expressing embryos markedly increased with the increase of MC-LR concentrations and the accumulation of Rh-123 in Abcb4-expressing embryos was significantly lower than those in GFP- and Abcb4-G1177D-expressing embryos after treatment with 0.1–10 μg/L of MC-LR. In addition, Rh123 levels accumulated in Abcb4-G1177D-expressing embryos were significantly higher than that in GFP-expressing embryos after treatment with 1 and 10 μg/L of MC-LR. These findings indicate that MC-LR functions as a novel competitive substrate of zebrafish Abcb4 to inhibit the cellular efflux of Rh-123 in developing embryos. 3.5. Zebrafish Abcb4 plays a role in the detoxification of MC-LR in LLC-PK1 cells We examined the functions of zebrafish Abcb4 in LLC-PK1 cells. Cells were transfected with empty vector (CTRL) or plasmids expressing Cterminal Flag-tagged Abcb4 and Abcb4-G1177D. After selection with G418 for two weeks, three stable cell lines were obtained. Western blotting analysis demonstrated that zebrafish Abcb4 or Abcb4-G1177D are effectively expressed under the control of CMV promoter in stable cell lines (Fig. 5A). Abcb4 and Abcb4-G1177D expressed in these cells were mainly located at the plasma membrane after immunofluorescence staining (Fig. 5B). Obviously, these cells are suitable for functional analysis of zebrafish Abcb4. Rh-123 efflux assays were performed to detect the excretion of Rh123 in LLC-PK1 cells. As shown in Fig. 5C, the cellular accumulation of Rh-123 in Abcb4-expressing cells was significantly lower than that in the CTRL- and Abcb4-G1177D-expressing cells after treatment with 1–10 μM Rh-123 for 30 min. Levels of Rh-123 accumulated in Abcb4expressing cells remained stably low after exposure to 2 μM Rh-123 for 15–180 min, while those in control or Abcb4-G1177D-expressing cells significantly increased in a time-dependent manner (Fig. 5D).
Moreover, Rh-123 amounts accumulated in Abcb4-expressing cells significantly increased after exposure to 2 μM Rh-123 for 30–180 min and were inhibited by cyclosporin A in a dose-dependent manner (Fig. 5E). These data suggest that zebrafish Abcb4 functions in the efflux of rhodamine 123 accumulated in LLC-PK1 cells. Next, we investigated the effects of MC-LR on the accumulation of Rh-123 in the CTRL-, Abcb4- and Abcb4-G1177D-expressing LLC-PK1 cells. As shown in Fig. 6A, Rh-123 amounts accumulated in CTRL-, Abcb4-G1177D- and Abcb4-expressing cells markedly increased with the increase of MC-LR concentrations and the accumulation of Rh-123 in Abcb4-expressing cells was significantly lower than those in CTRL- and Abcb4-G1177D-expressing embryos after treatment with 10–50 μg/mL of MC-LR. However, Rh-123 levels in Abcb4-G1177Dexpressing cells were similar to those in CTRL cells after treatment with MC-LR. These data indicate that zebrafish Abcb4 is able to promote the efflux of Rh-123 in LLC-PK1 cells and MC-LR can compete with Rh123 and thus limit the cellular efflux of Rh-123. We further assessed the effects of Abcb4 and Abcb4-G1177D on the excretion of MC-LR in LLC-PK1 cells. As shown in Fig. 6B, MC-LR contents in Abcb4-overexpressing cells exposed to 10 μg/mL of MC-LR were significantly lower than those in CTRL cells and the difference increased in a time-dependent manner with an average of 40.9%. However, contents of MC-LR in Abcb4-G1177D-overexpressing cells were almost the same as those in CTRL cells at all time points. Thus, zebrafish Abcb4 is able to promote the excretion of MC-LR in LLC-PK1 cells. 3.6. Detection of ATPase activity Since the efflux function of ABC transporters needs the consumption of ATP energy, levels of inorganic phosphate (Pi) were examined to monitor the hydrolysis of ATP in developing embryos exposed to MCLR. As shown in Fig. 7, Pi levels increased after exposure to 0.05 to 1000 μg/L of MC-LR and the maximal Pi levels were detected in developing embryos after exposure to 10 μg/L of MC-LR. This finding suggests that the hydrolysis of ATP is involved in the efflux of MC-LR. 4. Discussion Microcystins (MCs) are the most common monocyclic heptapeptides produced by various members of the cyanobacteria genera, such as Microcystis, Oscillatoria and Anabaena species (Chorus et al., 2000). These cyanobacterial toxins are synthesized in large quantities under particular temperature and favorable light conditions (Jacoby et al., 2000) and released into water during the collapse of a bloom.
40
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
Fig. 5. Zebrafish Abcb4 functions in transport of Rh-123 out of LLC-PK1 cells. (A) Western blot analysis of Flag-tagged Abcb4 or Abcb4-G1177D in stably transfected LLC-PK1 cells and the control cells (CTRL) transfected with empty vectors. The β-actin was used as a loading control. (B) Green signals under the confocal microscope indicate that foreign Abcb4 or Abcb4-G1177D molecules are localized on plasma membrane of LLC-PK1 cells. (C) Fluorescence intensities in LLC-PK1 cells expressing Abcb4 or Abcb4-G1177D and the control (CTRL) after treatment with Rh-123 for 30 min at indicated concentrations. (D) Fluorescence intensities in LLC-PK1 cells expressing Abcb4 or Abcb4-G1177D and the control (CTRL) after treatment with 2 μM Rh-123 for indicated time periods. (E) Fluorescence intensities in Abcb4-expressing LLC-PK1 cells after treatment with cyclosporin A for indicated time periods. Cells were incubated in medium containing 2 μM Rh-123 and different concentrations of cyclosporin A. Data are expressed as means ± standard deviations (n = 3). Significant differences are indicated by ⁎p b 0.05 and ⁎⁎p b 0.01. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Unfortunately, most of MCs widely distributed in aquatic environment are highly toxic and degraded at an extremely slow rate due to their unique chemical structure and are found to continually accumulate in biological food chains (Saitou et al., 2003). Toxicological effects of MCs not only lead to damages of water environment, but also cause
significant economic losses in aquaculture (Magalhaes et al., 2003; Pavagadhi et al., 2013). In addition, it has already been shown that human illnesses, such as gastroenteritis and related diseases, allergic and irritation reactions, and liver diseases (Gupta et al., 2003), are attributed to cyanobacterial toxins. These toxic MCs are primarily
Fig. 6. MC-LR is a potential efflux substrate of zebrafish Abcb4 in LLC-PK1 cells. (A) Effects of Abcb4 on the accumulation of Rh-123. Stable cell lines were exposed to 2 μM Rh-123 and 5–50 μg/mL of MC-LR for 24 h. (B) Effects of Abcb4 on the excretion of MC-LR. Stable cell lines were exposed to 10 μg/mL of MC-LR for 5 to 180 min. Values are expressed as means ± standard deviations (n = 3). Significant differences are indicated by ⁎p b 0.05 and ⁎⁎p b 0.01.
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
Fig. 7. ATP hydrolysis is involved in the efflux of MC-LR in zebrafish embryos. ATPase activities were shown by Pi levels in 96-hpf embryos after exposure to MC-LR at indicated concentrations. Values are expressed as means ± standard deviations (n = 3). Significant differences are indicated by ⁎p b 0.05.
accumulated in the liver and mediated by organic anion transporters, such as members of the OATP superfamily which are highly expressed in hepatocytes (Fischer et al., 2005). Upon entry into cells, MCs specially bind to and inhibit protein phosphatases 1 and 2A (PP-1 and PP2A) (MacKintosh et al., 1990) and can increase the formation of reactive oxygen species (ROS) (Nong et al., 2007; Jiang et al., 2013), thereby influencing the regulation of cellular protein phosphorylation and finally cause loss of liver architecture, dysfunction and necrosis (Cazenave et al., 2006). P-glycoproteins are versatile efflux transporters for a wide range of substrates with broad specificity, including endo- and exogenous hydrophobic amphipathic compounds such as physiological metabolites, therapeutic drugs and toxic xenobiotics (Sharom, 2011). So far, functions of MRP subfamily proteins in aquatic organisms are well characterized. Our previous studies have revealed that zebrafish Abcc1 (Long et al., 2011a), Abcc2 (Long et al., 2011d) and Abcc5 (Long et al., 2011b) play vital roles in efficient detoxification of heavy metals. Zebrafish Abcb4 has been demonstrated to function as a cellular toxicant transporter, which can extrude a variety of toxic compounds including galaxolide, tonalide and phenanthrene (Fischer et al., 2013), so it may play an important role in cellular protection against xenobiotics. Nevertheless, whether zebrafish Abcb4 can function as detoxification of MC-LR remains largely unknown. In this study, we have elucidated roles of zebrafish Abcb4 as an efflux transporter of MC-LR both in LLC-PK1 cells and developing embryos. Several lines of evidence from this study have shown that zebrafish Abcb4 plays an important role in cellular efflux of MCs. First, zebrafish Abcb4 is an ortholog of mammalian P-glycoproteins that are highly conserved during evolution (Fleming et al., 2013). Second, zebrafish Abcb4 expressed in LLC-PK1 cells has exhibited a strong activity in efflux of Rh123 and MC-LR. Third, an Abcb4 inhibitor cyclosporin A is able to abolish the efflux activity of zebrafish Abcb4. Fourth, a dominant negative form of zebrafish Abcb4 (Abcb4-G1177D) that is generated by mutation in the ATP hydrolysis and transport function domain as described in other ABC transporters (Frelet and Klein, 2006) totally lost the efflux activity. Therefore, zebrafish Abcb4, like its mammalian counterparts, functions in the detoxification of various toxicants and is likely involved in tissue defense. In this study, we have demonstrated that zebrafish Abcb4 is able to protect developing embryos and LLC-PK1 cells from toxic effects of MC-LR by promoting the cellular excretion of MC-LR. Meanwhile, the efflux of MC-LR in zebrafish embryos needs energy from the ATP hydrolysis. Moreover, MC-LR is able to compete with Rh-123, a well-known substrate of P-glycoproteins, and inhibit the cellular efflux of Rh-123 in developing embryos and LLC-PK1 cells. Furthermore, we have noticed
41
that the transcriptional expression of zebrafish abcb4 gene was highly induced by 0.01–10 μg/L of MC-LR in developing embryos. However, we could not exclude the involvement of other ABC family members in the detoxification, since the induction rate of abcb4 gene was about two-fold by MC-LR. It has been shown that enhanced activity of glutathione (GSH) catalyzed by glutathione S-transferases (GSTs) is associated with the microcystin-LR resistance (Li et al., 2014) and the conjugation of water-soluble toxic compounds with GSH finally serves as high-affinity substrates of MRPs for efflux (Cole et al., 1994; Enayati et al., 2005). In addition, the P-glycoprotein expression can be significantly induced by three-fold in gills of Jenynsia multidentata exposed to microcystin-LR (Ame et al., 2009), suggesting that the p-glycoprotein may function as a defense against MC-LR exposure. Taken together, we have demonstrated that zebrafish Abcb4 functions as an efflux transporter of MC-LR in zebrafish and LLC-PK1 cells. Considering the wide distribution of MCs in the environment, further studies are needed to reveal the interaction of Abcb4 with its broad substrates and elucidate molecular mechanisms underlying the transport and detoxification of various toxicants. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.cbpc.2014.08.005. Acknowledgments We thank all other members in Dr. Cui's laboratory for helpful suggestions and technical assistance. This work was supported by the National Natural Science Foundation of China (Grant No. 31172395) and the Key Technologies Research and Development Program of China (Grant No. 2013BAI12B01-3). References Aller, S.G., Yu, J., Ward, A., Weng, Y., Chittaboina, S., Zhuo, R., Harrell, P.M., Trinh, Y.T., Zhang, Q., Urbatsch, I.L., Chang, G., 2009. Structure of P-glycoprotein reveals a molecular basis for poly-specific drug binding. Science 323, 1718–1722. Ame, M.V., Baroni, M.V., Galanti, L.N., Bocco, J.L., Wunderlin, D.A., 2009. Effects of microcystin-LR on the expression of P-glycoprotein in Jenynsia multidentata. Chemosphere 74, 1179–1186. Backer, L.C., Landsberg, J.H., Miller, M., Keel, K., Taylor, T.K., 2013. Canine cyanotoxin poisonings in the United States (1920s–2012): review of suspected and confirmed cases from three data sources. Toxins (Basel) 5, 1597–1628. Cazenave, J., Bistoni Mde, L., Zwirnmann, E., Wunderlin, D.A., Wiegand, C., 2006. Attenuating effects of natural organic matter on microcystin toxicity in zebra fish (Danio rerio) embryos — benefits and costs of microcystin detoxication. Environ. Toxicol. 21, 22–32. Chin, J.E., Soffir, R., Noonan, K.E., Choi, K., Roninson, I.B., 1989. Structure and expression of the human MDR (P-glycoprotein) gene family. Mol. Cell. Biol. 9, 3808–3820. Chorus, I., Bartram, J., 1999. Toxic Cyanobacteria in Water: A Guide to their Public Health Consequences, Monitoring and Management. Spon Press. Chorus, I., Falconer, I.R., Salas, H.J., Bartram, J., 2000. Health risks caused by freshwater cyanobacteria in recreational waters. J. Toxicol. Environ. Health B Crit. Rev. 3, 323–347. Cole, S.P., Sparks, K.E., Fraser, K., Loe, D.W., Grant, C.E., Wilson, G.M., Deeley, R.G., 1994. Pharmacological characterization of multidrug resistant MRP-transfected human tumor cells. Cancer Res. 54, 5902–5910. Cole, S.P.C., Bhardwaj, G., Gerlach, J.H., Mackie, J.E., Grant, C.E., Almquist, K.C., Stewart, A.J., Kurz, E.U., Duncan, A.M.V., Deeley, R.G., 1992. Overexpression of a transporter gene in a multidrug-resistant human lung-cancer cell-line. Science 258, 1650–1654. Enayati, A.A., Ranson, H., Hemingway, J., 2005. Insect glutathione transferases and insecticide resistance. Insect Mol. Biol. 14, 3–8. Fischer, S., Kluver, N., Burkhardt-Medicke, K., Pietsch, M., Schmidt, A.M., Wellner, P., Schirmer, K., Luckenbach, T., 2013. Abcb4 acts as multixenobiotic transporter and active barrier against chemical uptake in zebrafish (Danio rerio) embryos. BMC Biol. 11. Fischer, W.J., Altheimer, S., Cattori, V., Meier, P.J., Dietrich, D.R., Hagenbuch, B., 2005. Organic anion transporting polypeptides expressed in liver and brain mediate uptake of microcystin. Toxicol. Appl. Pharmacol. 203, 257–263. Fleming, A., Diekmann, H., Goldsmith, P., 2013. Functional characterisation of the maturation of the blood–brain barrier in larval zebrafish. PLoS One 8, e77548. Frelet, A., Klein, M., 2006. Insight in eukaryotic ABC transporter function by mutation analysis. FEBS Lett. 580, 1064–1084. Gu, Q., Yang, X., He, X., Li, Q., Cui, Z., 2013. Generation and characterization of a transgenic zebrafish expressing the reverse tetracycline transactivator. J. Genet. Genom. 40, 523–531. Gupta, N., Pant, S.C., Vijayaraghavan, R., Rao, P.V.L., 2003. Comparative toxicity evaluation of cyanobacterial cyclic peptide toxin microcystin variants (LR, RR, YR) in mice. Toxicology 188, 285–296.
42
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
Higgins, C.F., 1992. ABC transporters: from microorganisms to man. Annu. Rev. Cell Biol. 8, 67–113. Hill, A.J., Teraoka, H., Heideman, W., Peterson, R.E., 2005. Zebrafish as a model vertebrate for investigating chemical toxicity. Toxicol. Sci. 86, 6–19. Ho, L., Tang, T., Monis, P.T., Hoefel, D., 2012. Biodegradation of multiple cyanobacterial metabolites in drinking water supplies. Chemosphere 87, 1149–1154. Huang, P., Zhu, Z., Lin, S., Zhang, B., 2012. Reverse genetic approaches in zebrafish. J. Genet. Genom. 39, 421–433. Hyenstrand, P., Metcalf, J.S., Beattie, K.A., Codd, G.A., 2001. Effects of adsorption to plastics and solvent conditions in the analysis of the cyanobacterial toxin microcystin-LR by high performance liquid chromatography. Water Res. 35, 3508–3511. Jacoby, J.M., Collier, D.C., Welch, E.B., Hardy, F.J., Crayton, M., 2000. Environmental factors associated with a toxic bloom of Microcystis aeruginosa. Can. J. Fish. Aquat. Sci. 57, 231–240. Jiang, J., Shan, Z., Xu, W., Wang, X., Zhou, J., Kong, D., Xu, J., 2013. Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L. PLoS One 8, e84768. Kroetz, D.L., Pauli-Magnus, C., Hodges, L.M., Huang, C.C., Kawamoto, M., Johns, S.J., Stryke, D., Ferrin, T.E., DeYoung, J., Taylor, T., Carlson, E.J., Herskowitz, I., Giacomini, K.M., Clark, A.G., 2003. Sequence diversity and haplotype structure in the human ABCB1 (MDR1, multidrug resistance transporter) gene. Pharmacogenetics 13, 481–494. Li, W., Chen, J., Xie, P., He, J., Guo, X., Tuo, X., Zhang, W., Wu, L., 2014. Rapid conversion and reversible conjugation of glutathione detoxification of microcystins in bighead carp (Aristichthys nobilis). Aquat. Toxicol. 147, 18–25. Long, Y., Li, Q., Cui, Z., 2011a. Molecular analysis and heavy metal detoxification of ABCC1/ MRP1 in zebrafish. Mol. Biol. Rep. 38, 1703–1711. Long, Y., Li, Q., Li, J., Cui, Z., 2011b. Molecular analysis, developmental function and heavy metal-induced expression of ABCC5 in zebrafish. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 158, 46–55. Long, Y., Li, Q., Wang, Y.H., Cui, Z.B., 2011c. MRP proteins as potential mediators of heavy metal resistance in zebrafish cells. Comp. Biochem. Physiol. C 153, 310–317. Long, Y., Li, Q., Zhong, S., Wang, Y.H., Cui, Z.B., 2011d. Molecular characterization and functions of zebrafish ABCC2 in cellular efflux of heavy metals. Comp. Biochem. Physiol. C 153, 381–391. MacKintosh, C., Beattie, K.A., Klumpp, S., Cohen, P., Codd, G.A., 1990. Cyanobacterial microcystin-LR is a potent and specific inhibitor of protein phosphatases 1 and 2A from both mammals and higher plants. FEBS Lett. 264, 187–192. Magalhaes, V.F., Marinho, M.M., Domingos, P., Oliveira, A.C., Costa, S.M., Azevedo, L.O., Azevedo, S.M.F.O., 2003. Microcystins (cyanobacteria hepatotoxins) bioaccumulation in fish and crustaceans from Sepetiba Bay (Brasil, RJ). Toxicon 42, 289–295.
Malbrouck, C., Kestemont, P., 2006. Effects of microcystins on fish. Environ. Toxicol. Chem. 25, 72–86. McCurley, A.T., Callard, G.V., 2008. Characterization of housekeeping genes in zebrafish: male–female differences and effects of tissue type, developmental stage and chemical treatment. BMC Mol. Biol. 9, 102. Mo, S., Wang, L., Li, Q., Li, J., Li, Y., Thannickal, V.J., Cui, Z., 2010. Caveolin-1 regulates dorsoventral patterning through direct interaction with β-catenin in zebrafish. Dev. Biol. 344, 210–223. Nong, Q., Komatsu, M., Izumo, K., Indo, H.P., Xu, B., Aoyama, K., Majima, H.J., Horiuchi, M., Morimoto, K., Takeuchi, T., 2007. Involvement of reactive oxygen species in Microcystin-LR-induced cytogenotoxicity. Free Radic. Res. 41, 1326–1337. Organization, W.H., 2003. Guidelines for Safe Recreational Water Environments: Coastal and Fresh Waters. World Health Organization. Pavagadhi, S., Gong, Z., Balasubramanian, R., 2013. Toxicological implications of microcystins for zebrafish embryos in the presence of other environmental pollutants. Environ. Toxicol. Chem. 32, 1574–1581. Ren, X.Q., Furukawa, T., Haraguchi, M., Sumizawa, T., Aoki, S., Kobayashi, M., Akiyama, S., 2004. Function of the ABC signature sequences in the human multidrug resistance protein 1. Mol. Pharmacol. 65, 1536–1542. Saitou, T., Sugiura, N., Itayama, T., Inamori, Y., Matsumura, M., 2003. Degradation characteristics of microcystins by isolated bacteria from Lake Kasumigaura. J. Water Supply Res. Technol. AQUA 52, 13–18. Salama, N.N., Yang, Z.P., Bui, T., Ho, R.J.Y., 2006. MDR1 haplotypes significantly minimize intracellular uptake and transcellular P-gp substrate transport in recombinant LLCPK1 cells. J. Pharm. Sci. 95, 2293–2308. Sharom, F.J., 2011. The P-glycoprotein multidrug transporter. Essays Biochem. 50, 161–178. Spitsbergen, J.M., Kent, M.L., 2003. The state of the art of the zebrafish model for toxicology and toxicologic pathology research—advantages and current limitations. Toxicol. Pathol. 31 (Suppl.), 62–87. Thisse, C., Thisse, B., 2008. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 3, 59–69. Wang, E., Li, J., Yang, G., Zhong, S., Liu, T., 2012. Impact of 4HPR on the expression of E-Cad in human bladder transitional epithelial cancer cells T24. J. Huazhong Univ. Sci. Technol. Med. Sci. 32, 237–241. Westerfield, M., 2000. The Zebrafish Book. University of Oregon press. Zheng, L., Baumann, U., Reymond, J.L., 2004. An efficient one-step site-directed and sitesaturation mutagenesis protocol. Nucleic Acids Res. 32, e115.
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc
Zebrafish Abcb4 is a potential efflux transporter of microcystin-LR Xing Lu a, Yong Long b, Rongze Sun a, Bolan Zhou b, Li Lin a, Shan Zhong a,⁎, Zongbin Cui b,⁎ a b
Department of Genetics, School of Basic Medical Science, Wuhan University, Wuhan 430071, Hubei, China The Key Laboratory of Aquatic Biodiversity and Conservation of Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, Hubei, China
a r t i c l e
i n f o
Article history: Received 30 July 2014 Received in revised form 19 August 2014 Accepted 21 August 2014 Available online 1 September 2014 Keywords: Abcb4 Efflux transporter Microcystin-LR Detoxification
a b s t r a c t Microcystin-LR (MC-LR) is one of the most common microcystins (MCs), which are hepatotoxic and released into a water body during a period of cyanobacterial blooms. These toxicants can be accumulated in aquatic animals and transferred along the food chain and thus pose adverse effects on aquatic environment and public health. Zebrafish Abcb4 is reported to mediate the cellular efflux of ecotoxicologically relevant compounds including galaxolide, tonalide and phenanthrene; however, it remains unclear whether Abcb4 functions in the detoxification of MC-LR. Here, we demonstrated the role of zebrafish Abcb4 in cellular efflux of MC-LR. Transcripts of zebrafish abcb4 were detected in all of adult tissues examined. MC-LR was able to induce the expression of abcb4 gene and overexpression of Abcb4 significantly decreased the cytotoxicity and accumulation of MC-LR in LLC-PK1 cells and developing embryos. In contrast, overexpression of an Abcb4-G1177D mutant abolished its transporter function but not substrate binding activity, and sensitized LLC-PK1 cells and developing embryos to this cyanobacterial toxin. Moreover, ATPase activity in developing embryos can be induced by MC-LR. Thus, zebrafish Abcb4 plays crucial roles in cellular efflux of MC-LR and is a potential molecular marker for the monitoring of cyanobacteria contamination in the aquatic environment. © 2014 Elsevier Inc. All rights reserved.
1. Introduction ATP-binding cassette (ABC) transporters are the largest and most ancient transmembrane proteins found in all organisms from prokaryotes to mammals (Higgins, 1992). ABC transporters are classified according to their amino acid sequences and the organization of functional domains, including hydrophilic ATP-binding domains (also called nucleotide-binding domains, NBDs) and hydrophobic transmembrane domains (TMDs). P-glycoprotein (ABCB1, MDR1) is a highly conserved, phosphorylated and glycosylated protein that functions as a cellular efflux pump for actively transporting a wide range of endogenous organic cation metabolites and exogenous compounds, such as structurally diverse chemotherapeutic drugs and other xenobiotics in an ATP-dependent manner (Chin et al., 1989; Kroetz et al., 2003; Aller et al., 2009). Human P-glycoprotein encoded by MDR gene was initially found in human lung cancer cell lines and this transmembrane protein (170-kDa) is composed of two symmetric and homologous halves, each consists of six transmembrane domains and an ATP binding motif (Cole et al., 1992; Salama et al., 2006). The globally accelerated eutrophication and increased cyanobacterial blooms in aquatic environment have produced a wide variety of natural toxins, including lipopolysaccharides, neurotoxins, and ⁎ Corresponding authors. E-mail addresses: [email protected] (X. Lu), [email protected] (Y. Long), [email protected] (R. Sun), [email protected] (B. Zhou), [email protected] (L. Lin), [email protected] (S. Zhong), [email protected] (Z. Cui).
http://dx.doi.org/10.1016/j.cbpc.2014.08.005 1532-0456/© 2014 Elsevier Inc. All rights reserved.
hepatotoxins (Backer et al., 2013) that are dispersed into the water during or on the senescence of cyanobacterial blooms (Malbrouck and Kestemont, 2006). These cyanobacterial toxins are resistant to biodegradation (Ho et al., 2012) and can directly or indirectly pose a serious threat to aquatic organisms and cause long-term health effects on humans and animals through drinking contaminated water and the food chain. In freshwater systems, microcystins (MCs) are the most common monocyclic heptapeptides (Chorus and Bartram, 1999). To date, more than 80 MCs have been identified and most of them are highly toxic (Ame et al., 2009). Among various structural variants of MCs, microcystin-LR (MC-LR) is the most common and toxic microcystin congeners that contain two variable L-amino acides leucine and arginine (Organization, 2003). Zebrafish (Danio rerio) are widely accepted as an excellent vertebrate model for the research of developmental biology, genetics, toxicology and various human diseases (Spitsbergen and Kent, 2003; Hill et al., 2005; Huang et al., 2012). Two P-glycoprotein genes that are designated as abcb4 and abcb5 have been identified in the genome of zebrafish and zebrafish Abcb4 can act as a cellular toxicant transporter and protect embryos against toxic chemicals such as galaxolide, tonalide and phenanthrene (Fischer et al., 2013). However, little is known about whether zebrafish Abcb4 functions in the detoxification of cyanobacterial toxins such as MC-LR. In this study, we detected the tissue-specific expression of zebrafish Abcb4, investigated its transcriptional responses to MC-LR, and evaluated its roles in cellular efflux of MC-LR in LLC-PK1 cells and zebrafish embryos.
36
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
2. Materials and methods
2.5. Efflux assays
2.1. Chemicals
Transporter activities of zebrafish Abcb4 and Abcb4-G1177D in LLCPK1 cells were measured by using the rhodamine 123 efflux assay as previously described (Long et al., 2011c). Activities of Abcb4 and Abcb4-G1177D in zebrafish embryos were detected as previously described (Fischer et al., 2013). Briefly, exposure solutions were prepared in embryo medium containing 0.5 μM of rhodamine 123 and variable concentrations of MC-LR (0.01–10 μg/L). Normal embryos or embryos overexpressing Abcb4, Abcb4-G1177D or GFP were cultured in exposure solutions at 28 °C in the dark for 1 h. After washed at least three times with embryo medium, embryos were sonicated in hypotonic buffer (10 mM KCl, 1.5 mM MgCl2, 10 mM Tris HCl, pH = 7.4) and the supernatants were collected after a brief centrifuging and transferred into a 96-well microplate in the dark for subsequent fluorescence determination. The fluorescence was measured using a microplate reader (Spectra-Max M5, Molecular Devices, USA) at 595 nm excitation and 530 nm emission wavelengths.
Analytical grade reagent microcystin-LR (MC-LR, CAS#: 101043-372) was purchased from Aqua-Standard Technologies Inc., USA. Rhodamine 123 (Rh-123), cyclosporin A, MTT, and dimethyl sulfoxide (DMSO) were obtained from Sigma-Aldrich. MC-LR was dissolved in Milli Q water. Stock solutions of other chemicals were freshly prepared in DMSO. Final concentration of DMSO in exposure media did not exceed 0.2%.
2.2. Zebrafish maintenance and MC-LR treatments The AB strain of zebrafish (Danio rerio) was maintained and reared according to standard protocols (Westerfield, 2000). Collection of eggs and culture of embryos were performed as in our previous study (Long et al., 2011a; Gu et al., 2013). Embryos were staged according to hour post-fertilization (hpf). To examine whether MC-LR induces transcriptional expression of zebrafish abcb4, stock solution of MC-LR was diluted with embryo medium to the desired concentration before use. Embryos were treated from 24 to 96 hpf in embryo medium containing serial dilutions of MC-LR (0.01–10 μg/L). One hundred embryos were used for each treatment and culture solutions were changed once after treatment for 12 h. Hatching, survival and abnormal rates were calculated at the corresponding stages of developing embryos. 2.3. Cloning of zebrafish abcb4 cDNA and plasmid construction To obtain the coding sequence of abcb4 gene from zebrafish, two PCR-primers abcb4-F1 (5′- CATCGCGGCCGCGCCACCATGGGCAAGAAA TCCAAACTCAAAG -3′) and abcb4-R1 (5′- CGGATATCTCACTTGTCATCGT CGTCCTTGTAGTCGTGGCTCATCTGTGAGGTGACAAG -3′) were designed according to the data in GenBank (JQ014001) and two restriction sites (underlined) for NotI and EcoRV were added for subcloning purpose. A kozak sequence in the forward primer was introduced around the translation initiation codon to improve the expression of abcb4 gene in cells and developing embryos. Total mRNA was isolated from zebrafish intestine and reverse transcription was performed to obtain cDNA templates. The full length of zebrafish abcb4 CDS was subcloned into the overexpression vector pT2/CMV•SV40-Neo to generate pT2/ CMV-Abcb4•SV40-Neo. The abcb4 cDNA was Flag-tagged at the carboxyl terminus. The pT2/CMV-GFP was used as a control vector. A dominant negative vector pT2/CMV-Abcb4 (G1177D) •SV40-Neo was generated by site-specific mutation (Zheng et al., 2004) with PCR primers abcb4-F2/R2 in Table S1.
2.4. LLC-PK1 cell lines LLC-PK1 cells (ATCC: CRL-101™) were cultured in M199 medium supplemented with 3% fetal bovine serum (FBS), 100 units/mL penicillin and 100 μg/mL streptomycin at 37 °C under 5% CO2 humidified atmosphere. To obtain Abcb4-overexpressing LLC-PK1 cells, cells at an initial density of 3 × 105 cells per 35 mm dish were co-transfected with an optimal ratio of pCMV-SB11 (0.5 μg), pT2/CMV-Abcb4•SV40-Neo (2 μg) and XtremeGENE HP DNA Transfection Reagent (Roche) following manufacturer's instructions. At 24 h after transfection, cells were selected in medium containing 200 μg/mL of G418 for two weeks. The Abcb4overexpressing cell colonies were picked up, expanded and maintained in medium containing 100 μg/mL of G418. The Abcb4-G1177Doverexpressing cells were obtained following the same protocol and pT2/CMV •SV40-Neo was used as the control vector.
2.6. RNA extraction and real-time PCR Total RNA was extracted from 30 to 50 developing zebrafish embryos using TRIZOL reagent (Invitrogen) according to the manufacturer's instructions. RNA quality was assessed with agarose gel electrophoresis and UV spectrophotometry and considered satisfactory for use if the Abs260/Abs280 ratio was between 1.9 and 2.1. First-strand cDNA for each RNA sample was synthesized using the RevertAid™ First Strand cDNA Synthesis Kit from Fermentas. Real-time PCR (qPCR) was performed with the SYBR Green Realtime PCR Master Mix (BioRad) and the CFX Real-Time PCR Detection System (BioRad). 18S ribosomal RNA and β-actin gene were used as internal references for evaluation of tissue-specific and MC-LR-induced abcb4 expression, respectively (McCurley and Callard, 2008). Primers used for abcb4 (abcb4-F3/R3), 18S RNA and β-actin were designed with the Primer Premier 5.0 software and listed in Table S1. The qPCR was performed with RNA extracts from three different zebrafish embryo batches and all reactions were run in triplicate. The expression of abcb4 in tissues was normalized to 18S (Normalized abcb4 mRNA level = 105 × 2 [Ct 18s − Ct abcb4]). The MC-LR-induced abcb4 expression was calculated using the 2−ΔΔCt method as described in our previous study (Long et al., 2011d). 2.7. Whole-mount in situ hybridization A fragment of abcb4 cDNA was amplified with PCR primers abcb4F4/R4 (Table S1) and then subcloned into the Sal I/Not I site of pBluescript SK vector for subsequent in vitro synthesis of RNA probes. The recombinant plasmid was linearized with Sal I or Not I. Anti-sense and sense RNA probes labeled with digoxigenin-UTP (Roche) were transcribed with T7 or T3 RNA polymerases, respectively. Wholemount in situ hybridization (WISH) of zebrafish embryos at indicated stages was performed as described previously (Thisse and Thisse, 2008). Images were taken under a stereomicroscope from Zeiss. Later stage embryos for WISH were treated with 0.003% phenylthiourea (PTU) from Sigma-Aldrich to inhibit the pigmentation. 2.8. Cytotoxicity assays The viability of LLC-PK1 cells was measured with MTT assays after exposure to MC-LR. Briefly, cells transfected with Abcb4, Abcb4G1177D and empty vectors were seeded in 96-well plates at a density of 2 × 105 cells/well in 100 μL medium and cultured for 48 h before treatment. The medium was then removed and replaced with the same volume of medium containing serial dilutions of MC-LR (0.5– 50 μg/mL) for 48 h. Cells for MTT assays must be ensured in the exponential phase; 10 μL of MTT solution was added to each well and
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
37
incubated at 37 °C for 4 h. The formazan salts were dissolved in 100 μL of DMSO and plates were shaken for 5 min on a plate shaker to ensure adequate solubility. Absorbance of each well was read at 540 nm with a microplate reader. Viability was expressed as percentage of the corresponding control. All the experiments were performed at least three times. 2.9. Microinjection and acute toxicity test Embryos at one-cell stage were microinjected with 150 pg/embryo of pT2/CMV-Abcb4, pT2/CMV-Abcb4-G1177D or pT2/CMV-GFP. The success of microinjection was confirmed by GFP expression in more than 90% of pT2/CMV-GFP-injected embryos at 8 hpf. At 24 hpf, embryos without abnormal phenotypes were selected and treated with 50 μg/L MC-LR from 24 to 96 hpf. Toxicity assays for MC-LR were independently performed three times. The medium containing MC-LR was replaced and dead embryos were removed once every 12 h for the calculation of death rates. 2.10. Western blotting and immunofluorescence staining Western blotting of Abcb4 or Abcb4-G1177D proteins in LLC-PK1 cells and subcellular localization detection of Flag-tagged Abcb4 or Abcb4-G1177D in LLC-PK1 cells were performed following our previous protocol (Mo et al., 2010; Wang et al., 2012). Briefly, Abcb4- or Abcb4G1177D-expressing LLC-PK1 cells were fixed with 4% paraformaldehyde and blocked with PBS containing 10% goat serum for 1 h. Cells were incubated with anti-Flag antibody (1:200, Sigma) for 1 h at room temperature and then with FITC-conjugated secondary antibody (antimouse IgG, 1:1000, Molecular Probes). Cells were stained with DAPI and then imaged under a confocal microscope (LSM 710, Carl Zeiss). 2.11. High performance liquid chromatography Abcb4-expressing LLC-PK1 cells were treated with 10 μg/mL of MCLR, washed three times with PBS and collected at 5, 15, 30, 60, 90, 120, 150 and 180 min after treatment. Zebrafish embryos injected with pT2/CMV-Abcb4, pT2/CMV-Abcb4-G1177D or pT2/CMV-GFP were exposed to 5 μg/L of MC-LR, washed three times with embryo medium and collected at 1, 6, 12, 24 and 48 h after treatment. Quantification of the microcystin-LR was measured by high performance liquid chromatography (HPLC) as described previously (Hyenstrand et al., 2001). 2.12. Detection of ATPase activity Embryos at 96-hpf stage were exposed to variable concentrations of (0.05–1000 μg/L) MC-LR for 40 min at 37 °C. ATPase activity was then detected by measuring inorganic phosphate liberation as previously described (Fischer et al., 2013).
Fig. 1. Transcriptional expression of zebrafish abcb4 gene in adult tissues. Brain, eyes, gills, intestine, liver, muscle, ovaries or testes from three individuals were collected for total RNA isolation and subjected to qRT-PCR analysis. Heart or kidney from ten individuals were pooled and used for total RNA isolation and subjected to qRT-PCR analysis. Values are given as mean ± standard deviations (n = 3).
detected in testis, kidney, heart, and brain. These findings suggest that zebrafish Abcb4 plays crucial roles in physiological functions of some adult tissues or organs such as intestine and liver. 3.2. Effects of MC-LR on zebrafish development and Abcb4 expression We first explored the effects of MC-LR on the hatching, survival and abnormal rates of developing embryos at 96 hpf. As shown in Fig. 2A, hatching rate of larval zebrafish obviously decreased with the increase of MC-LR concentrations. Abnormal rates of embryos at 96 hpf increased from 1.13% to 4.36% with the increase of MC-LR concentrations (Supplementary Fig. 1A). However, exposure to 10 μg/L of MC-LR had no lethal effects on embryos at 96 hpf (Supplementary Fig. 1B). Thus, MC-LR is toxic to zebrafish development. Next, transcriptional responses of zebrafish abcb4 to MC-LR were analyzed with qPCR in developing embryos. As shown in Fig. 2B, expression of abcb4 gene from 12 to 96 hpf was significantly induced (p b 0.05) by 0.01 to 10 μg/L of MC-LR and the induction rate was 1.41, 1.79 and 2.08, respectively. Moreover, we performed WISH assays to determine tissue-specific responses of abcb4 expression to MC-LR. Consistent with the qPCR results, expression of abcb4 in intestines of embryos after treatment with 0.01 μg/L of MC-LR from 24 to 96 hpf was significantly induced in comparison with that in the untreated control (Fig. 2C). 3.3. Zebrafish Abcb4 functions in cellular detoxification of MC-LR
2.13. Statistical analysis Data were expressed as means ± standard deviation (SD). Student's t test or one-way analysis of variance (ANOVA) followed by a Duncan's post-hoc test was performed using the SPSS version 15.0 for windows (SPSS Inc., Chicago, IL, USA) to determine the significant difference (p b 0.05) among different treatments. 3. Results 3.1. Transcriptional expression of abcb4 gene in adult tissues of zebrafish Transcriptional expression of zebrafish abcb4 in adult tissues was examined with qPCR. As shown in Fig. 1, the transcription of zebrafish abcb4 mainly occurred in intestine and liver followed by muscle, gill, eye and ovary, and relatively low levels of abcb4 transcripts were
To address the physiological roles of elevated Abcb4 expression, we examined the effects of Abcb4 and its dominant negative form on the survival of developing embryos exposed to MC-LR. The dominant negative form of zebrafish Abcb4 (Abcb4-G1177D) was generated by site-specific mutation to abolish its ATP hydrolysis and transporter function without effects on the substrate binding activity as described previously (Ren et al., 2004; Frelet and Klein, 2006). Previous study has demonstrated 50 μg/L of MC-LR can kill 40% embryos from blastula stage up to the end of embryonic development (Malbrouck and Kestemont, 2006). Therefore, acute toxicity assays were performed with embryos exposed to 50 μg/L of MC-LR. In addition, developing embryos injected with 150 pg/embryo of pT2/CMV-Abcb4 or pT2/ CMV-Abcb4-G1177D showed no abnormal phenotypes at 96 hpf, implying that overexpressed Abcb4 or Abcb4-G1177D has little side effect on developing embryos. To reduce experimental variations, injected
38
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
Fig. 2. Effects of MC-LR on the hatching and abcb4 expression of zebrafish embryos. (A) Hatching rate of 96-hpf embryos exposed to MC-LR at indicated concentrations. (B) Total RNAs of 96-hpf embryos exposed to 0.01–10 μg/L of MC-LR were extracted for qRT-PCR. (C) Embryos treated with 0.01 μg/L of MC-LR from 24 to 96 hpf were subjected to WISH analysis of induced abcb4 expression, respectively. CK represents the untreated control. Black arrows point to intestine. All values are expressed as mean ± standard deviation (n = 3). Significant differences are indicated by ⁎p b 0.05 and ⁎⁎p b 0.01.
embryos without abnormal phenotypes at 24 hpf were selected for subsequent toxicity assays. As shown in Fig. 3A, the death rate of Abcb4expressing embryos at 96 hpf was significantly lower than that of GFP-expressing embryos (p b 0.05), while the death rate of Abcb4G1177D-expressing embryos was significantly higher than that of GFP-expressing embryos (p b 0.05). These data suggest that zebrafish Abcb4 is able to protect developing embryos from toxic effects of MCLR. Next, MTT assays were utilized to examine effects of zebrafish Abcb4 on the survivability of pig kidney-derived LLC-PK1 cells after exposure to MC-LR. When compared with those of empty vector-transfected (CTRL) and Abcb4-G1177D-expressing cells, survival rate of zebrafish
Abcb4-expressing cells was improved by 1.77- to 5.83-fold after exposure to MC-LR at concentrations of 25–50 μg/mL (Fig. 3B). Moreover, the sensitivity of Abcb4-G1177D-expressing cells to MC-LR was the same as that of CTRL (Fig. 3B). Thus, zebrafish Abcb4 is able to improve the survivability of LLC-PK1 cells exposed to toxic MC-LR. 3.4. Zebrafish Abcb4 promotes the excretion of MC-LR in developing embryos To dissect cellular mechanisms underlying the roles of zebrafish Abcb4 in detoxification of MC-LR, we first investigated the effect of zebrafish Abcb4 on the accumulation of MC-LR in developing embryos.
Fig. 3. Zebrafish Abcb4 plays crucial roles in cellular detoxification of MC-LR. (A) Death rate of 96-hpf embryos expressing GFP, Abcb4 or Abcb4-G1177D was monitored after treatment with 50 μg/L of MC-LR. (B) Survival rate of LLC-PK1 cells expressing Abcb4 or Abcb4-G1177D, and transfected with empty vectors (CTRL) was determined with MTT assays after exposure to MC-LR at indicated concentrations for 24 h. Values are expressed as mean ± standard deviation (n = 3). Significant differences are indicated by ⁎p b 0.05 and ⁎⁎p b 0.01.
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
39
Fig. 4. Zebrafish Abcb4 is involved in the excretion of MC-LR in developing embryos. (A) Contents of MC-LR in embryos expressing GFP, Abcb4 and Abcb4-G1177D at the indicated exposure time points. (B) Contents of Rh-123 in embryos expressing GFP, Abcb4 and Abcb4-G1177D after being exposed to MC-LR at indicated concentrations. Values are expressed as means ± standard deviations (n = 3). Significant differences are indicated by ⁎p b 0.05 and ⁎⁎p b 0.01.
As shown in Fig. 4A, contents of MC-LR accumulated in Abcb4overexpressing embryos were significantly lower than those in GFPand Abcb4-G1177D-expressing embryos and dropped with the increase of exposure time by an average of 58.3% after treatment with 5 μg/L of MC-LR for 48 h. Moreover, contents of MC-LR in Abcb4-G1177Dexpressing embryos were higher than that in GFP-expressing embryos (an average increase of 1.1-fold). Thus, zebrafish Abcb4 is able to promote the excretion of MC-LR accumulated in developing embryos. Since rhodamine 123 (Rh-123) is known to serve as an excellent fluorescent substrate of Abcb4 protein, we next performed rhodamine 123 efflux assays to examine the effects of MC-LR on the efflux of fluorescent dye in developing embryos. As shown in Fig. 4B, Rh-123 amounts accumulated in GFP-, Abcb4-G1177D- and Abcb4-expressing embryos markedly increased with the increase of MC-LR concentrations and the accumulation of Rh-123 in Abcb4-expressing embryos was significantly lower than those in GFP- and Abcb4-G1177D-expressing embryos after treatment with 0.1–10 μg/L of MC-LR. In addition, Rh123 levels accumulated in Abcb4-G1177D-expressing embryos were significantly higher than that in GFP-expressing embryos after treatment with 1 and 10 μg/L of MC-LR. These findings indicate that MC-LR functions as a novel competitive substrate of zebrafish Abcb4 to inhibit the cellular efflux of Rh-123 in developing embryos. 3.5. Zebrafish Abcb4 plays a role in the detoxification of MC-LR in LLC-PK1 cells We examined the functions of zebrafish Abcb4 in LLC-PK1 cells. Cells were transfected with empty vector (CTRL) or plasmids expressing Cterminal Flag-tagged Abcb4 and Abcb4-G1177D. After selection with G418 for two weeks, three stable cell lines were obtained. Western blotting analysis demonstrated that zebrafish Abcb4 or Abcb4-G1177D are effectively expressed under the control of CMV promoter in stable cell lines (Fig. 5A). Abcb4 and Abcb4-G1177D expressed in these cells were mainly located at the plasma membrane after immunofluorescence staining (Fig. 5B). Obviously, these cells are suitable for functional analysis of zebrafish Abcb4. Rh-123 efflux assays were performed to detect the excretion of Rh123 in LLC-PK1 cells. As shown in Fig. 5C, the cellular accumulation of Rh-123 in Abcb4-expressing cells was significantly lower than that in the CTRL- and Abcb4-G1177D-expressing cells after treatment with 1–10 μM Rh-123 for 30 min. Levels of Rh-123 accumulated in Abcb4expressing cells remained stably low after exposure to 2 μM Rh-123 for 15–180 min, while those in control or Abcb4-G1177D-expressing cells significantly increased in a time-dependent manner (Fig. 5D).
Moreover, Rh-123 amounts accumulated in Abcb4-expressing cells significantly increased after exposure to 2 μM Rh-123 for 30–180 min and were inhibited by cyclosporin A in a dose-dependent manner (Fig. 5E). These data suggest that zebrafish Abcb4 functions in the efflux of rhodamine 123 accumulated in LLC-PK1 cells. Next, we investigated the effects of MC-LR on the accumulation of Rh-123 in the CTRL-, Abcb4- and Abcb4-G1177D-expressing LLC-PK1 cells. As shown in Fig. 6A, Rh-123 amounts accumulated in CTRL-, Abcb4-G1177D- and Abcb4-expressing cells markedly increased with the increase of MC-LR concentrations and the accumulation of Rh-123 in Abcb4-expressing cells was significantly lower than those in CTRL- and Abcb4-G1177D-expressing embryos after treatment with 10–50 μg/mL of MC-LR. However, Rh-123 levels in Abcb4-G1177Dexpressing cells were similar to those in CTRL cells after treatment with MC-LR. These data indicate that zebrafish Abcb4 is able to promote the efflux of Rh-123 in LLC-PK1 cells and MC-LR can compete with Rh123 and thus limit the cellular efflux of Rh-123. We further assessed the effects of Abcb4 and Abcb4-G1177D on the excretion of MC-LR in LLC-PK1 cells. As shown in Fig. 6B, MC-LR contents in Abcb4-overexpressing cells exposed to 10 μg/mL of MC-LR were significantly lower than those in CTRL cells and the difference increased in a time-dependent manner with an average of 40.9%. However, contents of MC-LR in Abcb4-G1177D-overexpressing cells were almost the same as those in CTRL cells at all time points. Thus, zebrafish Abcb4 is able to promote the excretion of MC-LR in LLC-PK1 cells. 3.6. Detection of ATPase activity Since the efflux function of ABC transporters needs the consumption of ATP energy, levels of inorganic phosphate (Pi) were examined to monitor the hydrolysis of ATP in developing embryos exposed to MCLR. As shown in Fig. 7, Pi levels increased after exposure to 0.05 to 1000 μg/L of MC-LR and the maximal Pi levels were detected in developing embryos after exposure to 10 μg/L of MC-LR. This finding suggests that the hydrolysis of ATP is involved in the efflux of MC-LR. 4. Discussion Microcystins (MCs) are the most common monocyclic heptapeptides produced by various members of the cyanobacteria genera, such as Microcystis, Oscillatoria and Anabaena species (Chorus et al., 2000). These cyanobacterial toxins are synthesized in large quantities under particular temperature and favorable light conditions (Jacoby et al., 2000) and released into water during the collapse of a bloom.
40
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
Fig. 5. Zebrafish Abcb4 functions in transport of Rh-123 out of LLC-PK1 cells. (A) Western blot analysis of Flag-tagged Abcb4 or Abcb4-G1177D in stably transfected LLC-PK1 cells and the control cells (CTRL) transfected with empty vectors. The β-actin was used as a loading control. (B) Green signals under the confocal microscope indicate that foreign Abcb4 or Abcb4-G1177D molecules are localized on plasma membrane of LLC-PK1 cells. (C) Fluorescence intensities in LLC-PK1 cells expressing Abcb4 or Abcb4-G1177D and the control (CTRL) after treatment with Rh-123 for 30 min at indicated concentrations. (D) Fluorescence intensities in LLC-PK1 cells expressing Abcb4 or Abcb4-G1177D and the control (CTRL) after treatment with 2 μM Rh-123 for indicated time periods. (E) Fluorescence intensities in Abcb4-expressing LLC-PK1 cells after treatment with cyclosporin A for indicated time periods. Cells were incubated in medium containing 2 μM Rh-123 and different concentrations of cyclosporin A. Data are expressed as means ± standard deviations (n = 3). Significant differences are indicated by ⁎p b 0.05 and ⁎⁎p b 0.01. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Unfortunately, most of MCs widely distributed in aquatic environment are highly toxic and degraded at an extremely slow rate due to their unique chemical structure and are found to continually accumulate in biological food chains (Saitou et al., 2003). Toxicological effects of MCs not only lead to damages of water environment, but also cause
significant economic losses in aquaculture (Magalhaes et al., 2003; Pavagadhi et al., 2013). In addition, it has already been shown that human illnesses, such as gastroenteritis and related diseases, allergic and irritation reactions, and liver diseases (Gupta et al., 2003), are attributed to cyanobacterial toxins. These toxic MCs are primarily
Fig. 6. MC-LR is a potential efflux substrate of zebrafish Abcb4 in LLC-PK1 cells. (A) Effects of Abcb4 on the accumulation of Rh-123. Stable cell lines were exposed to 2 μM Rh-123 and 5–50 μg/mL of MC-LR for 24 h. (B) Effects of Abcb4 on the excretion of MC-LR. Stable cell lines were exposed to 10 μg/mL of MC-LR for 5 to 180 min. Values are expressed as means ± standard deviations (n = 3). Significant differences are indicated by ⁎p b 0.05 and ⁎⁎p b 0.01.
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
Fig. 7. ATP hydrolysis is involved in the efflux of MC-LR in zebrafish embryos. ATPase activities were shown by Pi levels in 96-hpf embryos after exposure to MC-LR at indicated concentrations. Values are expressed as means ± standard deviations (n = 3). Significant differences are indicated by ⁎p b 0.05.
accumulated in the liver and mediated by organic anion transporters, such as members of the OATP superfamily which are highly expressed in hepatocytes (Fischer et al., 2005). Upon entry into cells, MCs specially bind to and inhibit protein phosphatases 1 and 2A (PP-1 and PP2A) (MacKintosh et al., 1990) and can increase the formation of reactive oxygen species (ROS) (Nong et al., 2007; Jiang et al., 2013), thereby influencing the regulation of cellular protein phosphorylation and finally cause loss of liver architecture, dysfunction and necrosis (Cazenave et al., 2006). P-glycoproteins are versatile efflux transporters for a wide range of substrates with broad specificity, including endo- and exogenous hydrophobic amphipathic compounds such as physiological metabolites, therapeutic drugs and toxic xenobiotics (Sharom, 2011). So far, functions of MRP subfamily proteins in aquatic organisms are well characterized. Our previous studies have revealed that zebrafish Abcc1 (Long et al., 2011a), Abcc2 (Long et al., 2011d) and Abcc5 (Long et al., 2011b) play vital roles in efficient detoxification of heavy metals. Zebrafish Abcb4 has been demonstrated to function as a cellular toxicant transporter, which can extrude a variety of toxic compounds including galaxolide, tonalide and phenanthrene (Fischer et al., 2013), so it may play an important role in cellular protection against xenobiotics. Nevertheless, whether zebrafish Abcb4 can function as detoxification of MC-LR remains largely unknown. In this study, we have elucidated roles of zebrafish Abcb4 as an efflux transporter of MC-LR both in LLC-PK1 cells and developing embryos. Several lines of evidence from this study have shown that zebrafish Abcb4 plays an important role in cellular efflux of MCs. First, zebrafish Abcb4 is an ortholog of mammalian P-glycoproteins that are highly conserved during evolution (Fleming et al., 2013). Second, zebrafish Abcb4 expressed in LLC-PK1 cells has exhibited a strong activity in efflux of Rh123 and MC-LR. Third, an Abcb4 inhibitor cyclosporin A is able to abolish the efflux activity of zebrafish Abcb4. Fourth, a dominant negative form of zebrafish Abcb4 (Abcb4-G1177D) that is generated by mutation in the ATP hydrolysis and transport function domain as described in other ABC transporters (Frelet and Klein, 2006) totally lost the efflux activity. Therefore, zebrafish Abcb4, like its mammalian counterparts, functions in the detoxification of various toxicants and is likely involved in tissue defense. In this study, we have demonstrated that zebrafish Abcb4 is able to protect developing embryos and LLC-PK1 cells from toxic effects of MC-LR by promoting the cellular excretion of MC-LR. Meanwhile, the efflux of MC-LR in zebrafish embryos needs energy from the ATP hydrolysis. Moreover, MC-LR is able to compete with Rh-123, a well-known substrate of P-glycoproteins, and inhibit the cellular efflux of Rh-123 in developing embryos and LLC-PK1 cells. Furthermore, we have noticed
41
that the transcriptional expression of zebrafish abcb4 gene was highly induced by 0.01–10 μg/L of MC-LR in developing embryos. However, we could not exclude the involvement of other ABC family members in the detoxification, since the induction rate of abcb4 gene was about two-fold by MC-LR. It has been shown that enhanced activity of glutathione (GSH) catalyzed by glutathione S-transferases (GSTs) is associated with the microcystin-LR resistance (Li et al., 2014) and the conjugation of water-soluble toxic compounds with GSH finally serves as high-affinity substrates of MRPs for efflux (Cole et al., 1994; Enayati et al., 2005). In addition, the P-glycoprotein expression can be significantly induced by three-fold in gills of Jenynsia multidentata exposed to microcystin-LR (Ame et al., 2009), suggesting that the p-glycoprotein may function as a defense against MC-LR exposure. Taken together, we have demonstrated that zebrafish Abcb4 functions as an efflux transporter of MC-LR in zebrafish and LLC-PK1 cells. Considering the wide distribution of MCs in the environment, further studies are needed to reveal the interaction of Abcb4 with its broad substrates and elucidate molecular mechanisms underlying the transport and detoxification of various toxicants. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.cbpc.2014.08.005. Acknowledgments We thank all other members in Dr. Cui's laboratory for helpful suggestions and technical assistance. This work was supported by the National Natural Science Foundation of China (Grant No. 31172395) and the Key Technologies Research and Development Program of China (Grant No. 2013BAI12B01-3). References Aller, S.G., Yu, J., Ward, A., Weng, Y., Chittaboina, S., Zhuo, R., Harrell, P.M., Trinh, Y.T., Zhang, Q., Urbatsch, I.L., Chang, G., 2009. Structure of P-glycoprotein reveals a molecular basis for poly-specific drug binding. Science 323, 1718–1722. Ame, M.V., Baroni, M.V., Galanti, L.N., Bocco, J.L., Wunderlin, D.A., 2009. Effects of microcystin-LR on the expression of P-glycoprotein in Jenynsia multidentata. Chemosphere 74, 1179–1186. Backer, L.C., Landsberg, J.H., Miller, M., Keel, K., Taylor, T.K., 2013. Canine cyanotoxin poisonings in the United States (1920s–2012): review of suspected and confirmed cases from three data sources. Toxins (Basel) 5, 1597–1628. Cazenave, J., Bistoni Mde, L., Zwirnmann, E., Wunderlin, D.A., Wiegand, C., 2006. Attenuating effects of natural organic matter on microcystin toxicity in zebra fish (Danio rerio) embryos — benefits and costs of microcystin detoxication. Environ. Toxicol. 21, 22–32. Chin, J.E., Soffir, R., Noonan, K.E., Choi, K., Roninson, I.B., 1989. Structure and expression of the human MDR (P-glycoprotein) gene family. Mol. Cell. Biol. 9, 3808–3820. Chorus, I., Bartram, J., 1999. Toxic Cyanobacteria in Water: A Guide to their Public Health Consequences, Monitoring and Management. Spon Press. Chorus, I., Falconer, I.R., Salas, H.J., Bartram, J., 2000. Health risks caused by freshwater cyanobacteria in recreational waters. J. Toxicol. Environ. Health B Crit. Rev. 3, 323–347. Cole, S.P., Sparks, K.E., Fraser, K., Loe, D.W., Grant, C.E., Wilson, G.M., Deeley, R.G., 1994. Pharmacological characterization of multidrug resistant MRP-transfected human tumor cells. Cancer Res. 54, 5902–5910. Cole, S.P.C., Bhardwaj, G., Gerlach, J.H., Mackie, J.E., Grant, C.E., Almquist, K.C., Stewart, A.J., Kurz, E.U., Duncan, A.M.V., Deeley, R.G., 1992. Overexpression of a transporter gene in a multidrug-resistant human lung-cancer cell-line. Science 258, 1650–1654. Enayati, A.A., Ranson, H., Hemingway, J., 2005. Insect glutathione transferases and insecticide resistance. Insect Mol. Biol. 14, 3–8. Fischer, S., Kluver, N., Burkhardt-Medicke, K., Pietsch, M., Schmidt, A.M., Wellner, P., Schirmer, K., Luckenbach, T., 2013. Abcb4 acts as multixenobiotic transporter and active barrier against chemical uptake in zebrafish (Danio rerio) embryos. BMC Biol. 11. Fischer, W.J., Altheimer, S., Cattori, V., Meier, P.J., Dietrich, D.R., Hagenbuch, B., 2005. Organic anion transporting polypeptides expressed in liver and brain mediate uptake of microcystin. Toxicol. Appl. Pharmacol. 203, 257–263. Fleming, A., Diekmann, H., Goldsmith, P., 2013. Functional characterisation of the maturation of the blood–brain barrier in larval zebrafish. PLoS One 8, e77548. Frelet, A., Klein, M., 2006. Insight in eukaryotic ABC transporter function by mutation analysis. FEBS Lett. 580, 1064–1084. Gu, Q., Yang, X., He, X., Li, Q., Cui, Z., 2013. Generation and characterization of a transgenic zebrafish expressing the reverse tetracycline transactivator. J. Genet. Genom. 40, 523–531. Gupta, N., Pant, S.C., Vijayaraghavan, R., Rao, P.V.L., 2003. Comparative toxicity evaluation of cyanobacterial cyclic peptide toxin microcystin variants (LR, RR, YR) in mice. Toxicology 188, 285–296.
42
X. Lu et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 35–42
Higgins, C.F., 1992. ABC transporters: from microorganisms to man. Annu. Rev. Cell Biol. 8, 67–113. Hill, A.J., Teraoka, H., Heideman, W., Peterson, R.E., 2005. Zebrafish as a model vertebrate for investigating chemical toxicity. Toxicol. Sci. 86, 6–19. Ho, L., Tang, T., Monis, P.T., Hoefel, D., 2012. Biodegradation of multiple cyanobacterial metabolites in drinking water supplies. Chemosphere 87, 1149–1154. Huang, P., Zhu, Z., Lin, S., Zhang, B., 2012. Reverse genetic approaches in zebrafish. J. Genet. Genom. 39, 421–433. Hyenstrand, P., Metcalf, J.S., Beattie, K.A., Codd, G.A., 2001. Effects of adsorption to plastics and solvent conditions in the analysis of the cyanobacterial toxin microcystin-LR by high performance liquid chromatography. Water Res. 35, 3508–3511. Jacoby, J.M., Collier, D.C., Welch, E.B., Hardy, F.J., Crayton, M., 2000. Environmental factors associated with a toxic bloom of Microcystis aeruginosa. Can. J. Fish. Aquat. Sci. 57, 231–240. Jiang, J., Shan, Z., Xu, W., Wang, X., Zhou, J., Kong, D., Xu, J., 2013. Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L. PLoS One 8, e84768. Kroetz, D.L., Pauli-Magnus, C., Hodges, L.M., Huang, C.C., Kawamoto, M., Johns, S.J., Stryke, D., Ferrin, T.E., DeYoung, J., Taylor, T., Carlson, E.J., Herskowitz, I., Giacomini, K.M., Clark, A.G., 2003. Sequence diversity and haplotype structure in the human ABCB1 (MDR1, multidrug resistance transporter) gene. Pharmacogenetics 13, 481–494. Li, W., Chen, J., Xie, P., He, J., Guo, X., Tuo, X., Zhang, W., Wu, L., 2014. Rapid conversion and reversible conjugation of glutathione detoxification of microcystins in bighead carp (Aristichthys nobilis). Aquat. Toxicol. 147, 18–25. Long, Y., Li, Q., Cui, Z., 2011a. Molecular analysis and heavy metal detoxification of ABCC1/ MRP1 in zebrafish. Mol. Biol. Rep. 38, 1703–1711. Long, Y., Li, Q., Li, J., Cui, Z., 2011b. Molecular analysis, developmental function and heavy metal-induced expression of ABCC5 in zebrafish. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 158, 46–55. Long, Y., Li, Q., Wang, Y.H., Cui, Z.B., 2011c. MRP proteins as potential mediators of heavy metal resistance in zebrafish cells. Comp. Biochem. Physiol. C 153, 310–317. Long, Y., Li, Q., Zhong, S., Wang, Y.H., Cui, Z.B., 2011d. Molecular characterization and functions of zebrafish ABCC2 in cellular efflux of heavy metals. Comp. Biochem. Physiol. C 153, 381–391. MacKintosh, C., Beattie, K.A., Klumpp, S., Cohen, P., Codd, G.A., 1990. Cyanobacterial microcystin-LR is a potent and specific inhibitor of protein phosphatases 1 and 2A from both mammals and higher plants. FEBS Lett. 264, 187–192. Magalhaes, V.F., Marinho, M.M., Domingos, P., Oliveira, A.C., Costa, S.M., Azevedo, L.O., Azevedo, S.M.F.O., 2003. Microcystins (cyanobacteria hepatotoxins) bioaccumulation in fish and crustaceans from Sepetiba Bay (Brasil, RJ). Toxicon 42, 289–295.
Malbrouck, C., Kestemont, P., 2006. Effects of microcystins on fish. Environ. Toxicol. Chem. 25, 72–86. McCurley, A.T., Callard, G.V., 2008. Characterization of housekeeping genes in zebrafish: male–female differences and effects of tissue type, developmental stage and chemical treatment. BMC Mol. Biol. 9, 102. Mo, S., Wang, L., Li, Q., Li, J., Li, Y., Thannickal, V.J., Cui, Z., 2010. Caveolin-1 regulates dorsoventral patterning through direct interaction with β-catenin in zebrafish. Dev. Biol. 344, 210–223. Nong, Q., Komatsu, M., Izumo, K., Indo, H.P., Xu, B., Aoyama, K., Majima, H.J., Horiuchi, M., Morimoto, K., Takeuchi, T., 2007. Involvement of reactive oxygen species in Microcystin-LR-induced cytogenotoxicity. Free Radic. Res. 41, 1326–1337. Organization, W.H., 2003. Guidelines for Safe Recreational Water Environments: Coastal and Fresh Waters. World Health Organization. Pavagadhi, S., Gong, Z., Balasubramanian, R., 2013. Toxicological implications of microcystins for zebrafish embryos in the presence of other environmental pollutants. Environ. Toxicol. Chem. 32, 1574–1581. Ren, X.Q., Furukawa, T., Haraguchi, M., Sumizawa, T., Aoki, S., Kobayashi, M., Akiyama, S., 2004. Function of the ABC signature sequences in the human multidrug resistance protein 1. Mol. Pharmacol. 65, 1536–1542. Saitou, T., Sugiura, N., Itayama, T., Inamori, Y., Matsumura, M., 2003. Degradation characteristics of microcystins by isolated bacteria from Lake Kasumigaura. J. Water Supply Res. Technol. AQUA 52, 13–18. Salama, N.N., Yang, Z.P., Bui, T., Ho, R.J.Y., 2006. MDR1 haplotypes significantly minimize intracellular uptake and transcellular P-gp substrate transport in recombinant LLCPK1 cells. J. Pharm. Sci. 95, 2293–2308. Sharom, F.J., 2011. The P-glycoprotein multidrug transporter. Essays Biochem. 50, 161–178. Spitsbergen, J.M., Kent, M.L., 2003. The state of the art of the zebrafish model for toxicology and toxicologic pathology research—advantages and current limitations. Toxicol. Pathol. 31 (Suppl.), 62–87. Thisse, C., Thisse, B., 2008. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 3, 59–69. Wang, E., Li, J., Yang, G., Zhong, S., Liu, T., 2012. Impact of 4HPR on the expression of E-Cad in human bladder transitional epithelial cancer cells T24. J. Huazhong Univ. Sci. Technol. Med. Sci. 32, 237–241. Westerfield, M., 2000. The Zebrafish Book. University of Oregon press. Zheng, L., Baumann, U., Reymond, J.L., 2004. An efficient one-step site-directed and sitesaturation mutagenesis protocol. Nucleic Acids Res. 32, e115.