Zinc doping induced differences in the surface composition, surface morphology and osteogenesis performance of the calcium phosphate cement hydration products

Materials Science & Engineering C 105 (2019) 110065

Contents lists available at ScienceDirect

Materials Science & Engineering C journal homepage: www.elsevier.com/locate/msec

Zinc doping induced differences in the surface composition, surface morphology and osteogenesis performance of the calcium phosphate cement hydration products Kun Xionga,

⁎,1

, Jing Zhangb,c,1, Yunyao Zhua, Lin Chena, Jiandong Yeb,

T

⁎

a

State Key Laboratory for Environment-friendly Energy Materials, Southwest University of Science and Technology, Mianyang 621010, China National Engineering Research Center for Tissue Restoration and Reconstruction, South China University of Technology, Guangzhou 510006, China c Medprin Institute of Technology, Guangzhou 510663, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Calcium phosphate cement Zinc Osteogenesis Hydration mechanism

In order to investigate the influence of Zn on the hydration reaction of calcium phosphate cement (CPC), the incompletely hydrated CPC tablets were kept soaking in varying zinc-containing tris-(hydroxymethyl)-aminomethane/hydrochloric acid (Zn-Tris-HCl) buffers. It was found that Zn could retard the CPC hydration, the inhibitory effect was in direct proportional to the Zn content in the Zn-Tris-HCl buffer, and overhigh concentration of Zn (≧800 μM) caused the CPC hydration products having different phase composition and surface morphology. Cell culture experimental results revealed the CPC tablets which were soaked in the Zn-Tris-HCl buffer containing relative low Zn content (≦320 μM) favored the mouse bone mesenchymal stem cells (mBMSCs) spreading. When Zn-doped CPC tablets released 10.91 to 27.15 μM of zinc ions into the cell culture medium, it greatly contributed to the improvement of the proliferation ability and the alkaline phosphatase (ALP) activity of the mBMSCs. In the same case, the expression of osteogenesis related genes such as collagen I and runt-related transcription factor 2 was remarkably up-regulated as well. However, the release of high concentration of Zn (128.58 μM) would significantly reduce the ALP activity of the mBMSCs. Therefore, Zn not only facilitates osteogenesis but also affects the CPC hydration behavior, and the CPC with suitable Zn dosage concentration has great potentials to be used for clinical bone repairing.

1. Introduction In addition to good biocompatibility, superior osteointegrity and similar inorganic components with natural bone, calcium phosphate cement (CPC) also has some unique characteristics, such as its injectability and self-hardening ability. Consequently, CPC has been considered as one of the most promising bone grafting materials for clinical application [1–8]. However, the osteogenic activity of pure CPC remains insufficient. As a key element in alkaline phosphatase (ALP), zinc (Zn) plays a great role in bone matrix mineralization [9]. In comparison to other organs, the Zn content in bone ash is relatively high [10,11]. Zn deficiency was found to cause various skeletal anomalies in fetus [12–14]. S.L. Hall et al. claimed only Zn could increase ALP specific activity, no similar effect was found for other elements, including but not limited to calcium, magnesium and manganese [15]. Therefore, Zndoped CPC has already attracted considerable research interests in the bone repairing field over the last two decades. X. Li et al., reported the

CPC containing 0.3 wt% of Zn could significantly promote new bone formation without inflammation reaction when they were implanted in the rabbit femora and tibia for 4 weeks, whereas the CPC containing no < 0.6 wt% of Zn caused serious inflammation reaction close to the implanted area [16]. The proliferation as well as the ALP activity of MC3T3-E1 were found to be remarkably improved when 10 wt% of zinc calcium phosphate was added into CPC [17]. In addition, the proliferation of human primary mesenchymal stem cells (hMSCs) was greatly promoted when Zn-containing β-TCP (Zn-β-TCP, with 0.03 mol of Zn) was added into the monetite bone cement, and the expression of Runx2 was also remarkably up-regulated [18]. The human osteoblastlike cells could significantly proliferate when 5 wt% of Zn-β-TCP was added into the CPC, whereas it caused cytotoxicity when CPC contained 10 wt% of Zn-β-TCP [19]. K. Paul et al., claimed CPC cement with 6% (w/w) Zn content could facilitate bone healing, but bone healing was remarkably delayed when CPC cement with 9% (w/w) Zn was used [20].

⁎

Corresponding authors. E-mail addresses: [email protected] (K. Xiong), [email protected] (J. Ye). 1 The first two authors contribute equally to this work. https://doi.org/10.1016/j.msec.2019.110065 Received 14 March 2018; Received in revised form 16 November 2018; Accepted 8 August 2019 Available online 08 August 2019 0928-4931/ © 2019 Elsevier B.V. All rights reserved.

Materials Science & Engineering C 105 (2019) 110065

K. Xiong, et al.

From the above, although the addition of Zn appears to improve the osteogenic performance of CPC, the optimal Zn dosage is uncertain and it varies with the change of the type of Zn carrier material. To a certain extent, Zn releasing characteristic depends on the structural stability of Zn carrier material, but Zn doping will inevitably in turn changes the original structural stability of carrier materials. It has been demonstrated that Zn doping can enhance the structural stability of calcium silicate, whereas it will reduce the structural stability of calcium phosphate as well [21–26]. Current methods for preparing Zn-doped CPC are mainly through the introduction of Zn carrier materials. Moreover, the already hardened CPC were usually to be used for the in vivo experiments in the past, the interaction between inorganic ions and CPC raw materials is easy to be neglected in this case. There are many inorganic ions in human body fluid, maybe soaking in deionized water, CPC exhibits sufficient self-hardening and anti-washout ability, while it is uncertain whether CPC can maintain the above ability or not when they are injected into body. To the best of our knowledge, the CPC hydration behavior is still not clearly understood when varying amounts of Zn were in direct added into CPC. Furthermore, it remains lack of evidences to reveal whether the variation of CPC hydration products can affect the cell behaviors or not. In this work, the incompletely hydrated CPC tablets were kept soaking in different zinc-containing tris-(hydroxymethyl)-aminomethane/hydrochloric acid (Zn-Tris-HCl) buffers for investigating the influence of Zn on CPC hydration reaction. At predetermined time intervals, the surface phase composition of the CPC hydration products as well as their surface morphology were characterized. Moreover, the cell-biological performances of varying Zn-doped CPC were evaluated, and the CPC hydration mechanism in the presence of different Zn concentration was also discussed.

Table 1 Definitions of the samples which were soaked in different Zn-Tris-HCl solutions. Sample

Ctr

S1

S2

S3

S4

S5

Zn existed in Zn-Tris-HCl (μM)

0

80

160

320

800

1600

7646857, 99.999%, Sigma-Aldrich) in the Tris-HCl buffers, and the pH value of all Zn-Tris-HCl buffers were maintained at 7.4. By following a ratio of 0.1 cm2/mL, the as-prepared incompletely hydrated CPC tablets were kept soaking in the different Zn-Tris-HCl buffers, and they were placed in a shaker (37 °C) for 1 day and 7 days, respectively. The samples which were kept soaking in the different Zn-Tris-HCl buffers were defined in Table 1. The abbreviations of the Ctr-1d, S1-1d, S2-1d, S3-1d, S4-1d and S5-1d represent the Ctr, S1, S2, S3, S4 and S5 tablets experienced 1 day of soaking in the corresponding Zn-Tris-HCl buffers. Similarly, the abbreviations of the Ctr-7d, S1-7d, S2-7d, S3-7d, S4-7d and S5-7d represent the Ctr, S1, S2, S3, S4 and S5 tablets which experienced 7 days of soaking in the corresponding Zn-Tris-HCl buffers, respectively. All the samples used for biological assessments were sterilized using γ-ray irradiation (20 kGy). 2.3. Characterizations The surface phase compositions of the CPC tablets before and after being soaked in the Zn-Tris-HCl buffers were tested by a X-ray diffractometer (XRD, X'Pert PRO, PANalytical) using a CuKα radiation source (λ = 1.541874 Å), and the final components were ascertained through the comparison between the diffraction patterns of samples and the cards of Joint Committee on Powder Diffraction Standards (JCPDS). Moreover, the surface morphology of the samples was observed by using a field-emission scanning electron microscopy (FE-SEM, Nova NanoSEM 430, FEI), and each CPC tablets was sputtered twice with gold prior to the FE-SEM observation.

2. Experimental sections 2.1. Preparation of the incompletely hydrated CPC tablet

2.4. Cell culture experiment

The CPC, deriving from the reactions between partially crystallized calcium phosphate (PCCP) and dicalcium phosphate anhydrous (DCPA), was prepared according to the method previously developed in our group [27]. Hereinto, the PCCP powders were prepared by a chemical precipitation method. Briefly, 0.15 M diammonium phosphate solution was added into 0.36 M calcium nitrate tetrahydrate solution with constant stirring until a white emulsion formed. Thereafter, the emulsion was successively centrifuged and freeze-dried. Afterward, the PCCP precursor powders experienced 2 h of calcination at 450 °C to obtain the PCCP powders. The DCPA purchased from Sinopharm Chemical Reagent Co., Ltd. were mixed with ethanol in a planetary ball mill, they were then experienced 2 h of ball milling with a speed of 400 rpm, and oven-dried at 120 °C for 12 h to obtain the DCPA powders. According to a mass ratio of 1:1, the as-prepared PCCP and DCPA powders were firstly mixed together. Secondly, deionized water was added to form a uniform paste, and the liquid/powder ratio was 0.4 mL/g. Subsequently, the above pastes were rapidly transferred into a cylindrical steel mold and pressed into a tablet (Φ12 mm × 2 mm). Soon later, the tablets were kept in a constant temperature humidity chamber (37 °C, 98%) and incubated for 1 h to ensure them having proper initial strength. At last, ethanol was used to stop the CPC hydration reaction, and the incompletely hydrated CPC tablets were obtained after experiencing a 24 h of oven-drying at 37 °C. In order to avoid absorbing the moisture, the incompletely hydrated CPC tablets were stored in an electronic moisture proof box for following use.

The primary mBMSCs (ATCC, Cat.No.CRL-12424) were subcultivated in a cell incubator at 37 °C with a 5% CO2 humidified atmosphere. As mBMSCs were almost confluent in the bottom of cell culture flasks, 0.25% trypsin/EDTA was added to make them detachment. Where after, the detached mBMSCs were collected and stored in a liquid nitrogen container. The mBMSCs after 4 passage circles were selected for the following cell culture experiments. High-glucose Dulbecco's Modified Eagle's Medium (H-DMEM, Gibco, Cat.No.11995500) with 10 vol% of fetal bovine serum (FBS, Hyclone, Cat. No. NWJ0473) was applied to culture the mBMSCs, and the culture medium was refreshed every two days. 2.5. Cell viability assessments In this study, the sterilized Ctr-7d, S1-7d, S2-7d, S3-7d, S4-7d and S5-7d tablets were chosen for performing cell-biological assessments. The above tablets were placed in 24-well culture plates (Corning Inc.), before the mBMSCs were seeded on their surfaces, serum-free H-DMEM medium was used to pre-wet them for 2 h. In this section, Ctr-7d tablet was used as control group. According to a seeding density of 6 × 104 cells/well, mBMSCs were seeded on the different CPC tablet surfaces, and 1 mL/well of H-DMEM medium with 10 vol% of FBS was added. Afterward the culture plates were transferred to a cell incubator (37 °C, 5% CO2 humidified atmosphere) and kept incubating for 1, 3, 7 days, respectively. During this period, the culture medium was refreshed every two days. After being cultured for 1 day, the samples were rinsed twice with phosphate buffer solutions (PBS). According to the manufacturer's protocol, the live mBMSCs attached on the different CPC tablet surfaces were stained using a Viability Assay Kit for Animal Live

2.2. CPC hydration experiments in the presence of varying Zn concentration In this study, the Zn-Tris-HCl buffers with series concentrations of 0 μM, 80 μM, 160 μM, 320 μM, 800 μM and 1.6 mM were prepared by the dissolution of different amounts of zinc chloride (ZnCl2, CAS: 2

Materials Science & Engineering C 105 (2019) 110065

K. Xiong, et al.

Cells (Calcein-AM, Biotium, USA), and the fluorescent images were acquired by using a fluorescence microscope equipped with a digital camera (40FL Axioskop, Zeiss, Germany). Quantitative cell viability was determined by using Cell Counting Kit-8 (CCK-8, Dojindo, Japan) assay. At predetermined time intervals, the samples were transferred into a new 24-well plate, and then 400 μL/ well of CCK-8 working solution was added to ensure the sample to be submerged. Subsequently, the plate was placed in the cell incubator for 1 h. The supernatants (100 μL/well) were extracted out and they were then transferred to a new 96-well plate, the absorbance at 405 nm was measured by using an enzyme linked immunoadsorbent assay plate reader (Varioskan Flash, Thermo Scientific, USA).

incubated at 37 °C in a 96-well plate for 15 min with the treatment of light avoidance. Afterwards 0.1 M NaOH solution (1 mL/well) was added to stop the reaction and the absorbance was read at 405 nm by using an enzyme linked immunoadsorbent assay plate reader. The ALP activity was calculated from a standard curve after normalizing to the total protein content measured by using Pierce BCA Protein Assay Kit (Thermo Scientific, USA), and the results were expressed in millimoles of p-NPP produced per minute per milligram of protein. Furthermore, after the mBMSCs were co-cultured with the extracts of the Ctr-7d, S1-7d, S2-7d, S3-7d tablets for 10 days, BCIP/NBT Substrate solution (R&D, USA) was used for ALP staining by following the protocol of the manufacturer. Briefly, the mBMSCs were rinsed twice by PBS and fixed by paraformaldehyde solution (4 vol%). 30 min later, the residual paraformaldehyde was washed off by PBS, and the ALP staining working solution (150 μL/well) was added. After 30 min of staining, the residual ALP staining working solution was removed out and the violet products were observed by inverted fluorescence microscope.

2.6. Cell attachment, morphology and cytoskeletal organization After being cultured for 24 h, removed the cell culture medium, the samples were rinsed twice with PBS and then soaked in 2.5 vol% glutaraldehyde solution for 4 h to immobilize the mBMSCs. Graded ethanol (100 vol%, 95 vol%, 90 vol%, 80 vol%, 70 vol%, 50 vol% and 30 vol%) were used for dehydration of the mBMSCs which attached on the different CPC tablet surfaces, and they were naturally dried at room temperature. The attachment and the morphology of the mBMSCs seeded on the different CPC tablet surfaces were observed by SEM (Quanta 200, FEI, USA). In addition, cultured 24 h later, all the tablets were removed out and the culture plates were rinsed with PBS solutions. Subsequently, the formaldehyde solution (4 vol%, 100 μL/well) was added to immobilize the mBMSCs which attached on the culture plates (20 min). Afterward, Triton X-100 solution (0.1 vol%) were added to increase the permeability of cell membrane (5 min). In this case, the cytoskeletal organization of the mBMSCs was investigated by labeling their F-actin with cell navigator™ F-actin labeling kit (AAT Bioquest, USA), which was strictly performed according to the kit protocol. Moreover, the mBMSCs were counterstained with the DAPI staining solutions (Beyotime, China) for visualizing their nucleus. Fluorescence images were obtained using an inverted fluorescence microscope (Eclipsc Ti-U, Nikon, Japan).

2.8. Quantitative real-time polymerase chain reaction (qRT-PCR) According to a seeding density of 2 × 105 cells/well, the mBMSCs were separately seeded on the Ctr-7d, S4-7d, S2-7d and S3-7d tablets surfaces. Culturing 7 days later, total RNA was isolated from the treated mBMSCs by applying a HiPure Total RNA Micro Kit (Magen, China), and they were detected by using Nanodrop 2000 (Thermo Scientific, USA). 1.0 μg isolated RNA was reversed transcribed into complementary DNA (cDNA) by using the iScript cDNA Synthesis Kit (BioRad, USA) according to the manufacturer's instructions. Subsequently, 1 μL cDNA mixed with 10 μL of SsoAdvanced SYBR Green supermix (Bio-Rad, USA), and the primer concentration was 200 nM. The qRTPCR analysis was performed by using Bio-Rad Chromo4 (Bio-Rad, USA) on markers of type I collagen (COL-I), runt-related transcription factor 2 (Runx2) and osteopontin (OPN). In this section, Glyceraldehyde 3phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. Primer sequences for GAPDH, COL-I, OPN and Runx2 were listed in Table 2. All experiments were performed in triplicate and the final data were analyzed by using Opticon Monitor 3 software.

2.7. Alkaline phosphatase (ALP) activity assay and ALP staining According to a seeding density of 3 × 105 cells/well, the mBMSCs were seeded on the different CPC tablet surfaces, and the mBMSCs seeded on the Ctr-7d tablet surface were considered as the control group. In this study, the osteogenic induction culture medium (1 mL/ well), which contained the H-DMEM with 10 vol% FBS, the sodium βglycerophosphate (10 mM), the dexamethasone (0.1 μM) and the vitamin C (50 mg/mL), was added to culture the mBMSCs. Osteogenic induction culture medium was refreshed every other day. After being separately cultured for 7, 10, and 14 days, the samples were transferred to a new 24-well plate and gently rinsed three times with cold PBS. Soon after, the lysis buffer (400 μL/well), which consisted of the TrisHCl solution (pH = 7.4, 10 mM), the Triton X-100 solution (0.1 vol%) and the magnesium chloride solution (0.5 mM), was added to make mBMSCs lysis (4 °C, 2 h). After being sonicated for 20 s and centrifuged at 3000 rpm for 5 min (4 °C), the lysate was obtain. Subsequently, the lysate (20 μL/well) was mixed with 5 mM of p-nitrophenyl phosphate (p-NPP, Sigma-Aldrich) solution (200 μL/well), and they were

2.9. Test of the released Zn At predetermined time intervals, the refreshed culture media were collected and they were digested by boiling them with concentrated nitric acid. Subsequently, the released Zn content were tested by inductively coupled plasma atomic emission spectroscopy (ICP-AES, Optima 5300DV, Perkin Elmer, USA).

2.10. Statistical analysis Quantitative data were presented as mean ± standard deviation and statistical analyses were performed using a one-way analysis of variance (one-way ANOVA). A comparison between the two means was made by using the turkey's test, with statistical significance set at P < 0.05.

Table 2 Primers used for RT-PCR analysis. Target gene

Forward primer sequence (5′–3′)

Reverse primer sequence (5′–3′)

GAPDH Col-I Runx-2 OPN

TGTGTCCGTCGTGGATCTGA ATGCCGCGACCTCAAGATG CACTGGCGGTGCAACAAGA TGCAAACACCGTTGTAACCAAAAGC

TTGCTGTTGAAGTCGCAGGAG TGAGGCACAGACGGCTGAGTA TTTCATAACAGCGGAGGCATTTC TGCAGTGGCCGTTTGCATTTCT

3

Materials Science & Engineering C 105 (2019) 110065

K. Xiong, et al.

Table 3 The 2θ angle of the HA diffraction peaks along the (002) and (004) plane direction (°). Sample

Ctr-7d

S1-7d

S2-7d

S3-7d

S4-7d

S5-7d

2θ(002) 2θ(004)

25.8184 53.1324

25.8528 53.1440

25.8651 53.1666

25.8703 53.1545

25.8451 53.1399

25.8411 53.1460

(2d(hkl)·Sinθ = λ), it indicates that Zn can constrain the c-face growth of HA crystals. As reported by N. Kanzaki et al. [24], it was octahedral coordination between Ca atoms and oxygen (O) atoms in the HA lattice, whereas it was tetrahedral coordination between Zn atoms and O atoms, this structural mismatch made Zn exhibit a inhibitory effect on c-face growth of HA crystals. Thus, the reduced d-spacing of HA along the (002) and (004) plane direction suggested Zn atoms had already entered into c-face of HA crystals, so the hydration products which belonged to S1-7d, S2-7d, S3-7d, S4-7d and S5-7d were not pure HA but Zn-doped HA. In addition, the XRD patterns of S4-7d and S5-7d showed that there were still remnants of DCPA on their surface. Moreover, besides Zn-doped HA and DCPA, the scholzite phase calcium zinc phosphate hydrate (CaZn2(PO4)2·2H2O, JCPDS card no. 029-1412), anorthic zinc hydrogen phosphate hydrate (Zn3(PO3(OH))3·3H2O, JCPDS card no. 01-078-0081) and orthorhombic zinc hydrogen phosphate hydrate ((ZnHPO4)2·3H2O, JCPDS card no. 039-0707) also could be found on the surface of S5-7d. As shown in Fig. 2(a), hair-like white flocs formed when the incompletely hydrated CPC tablets were soaked in the Zn-Tris-HCl solution. Furthermore, the XRD analysis results identified the component of the white flocs was composed of zinccontaining phosphates (Fig. 2(b)). Therefore, it proved zinc ions (Zn2+) could reacted with the phosphate ions which dissolved out from the incompletely hydrated CPC tablets, and then resulted in formation of various zinc phosphate precipitates. 3.2. Surface morphology of the CPC hydration products Fig. 3(a) shows the morphology of the hydration product of Ctr-1d, many flaky crystals closely assemble into a petals-like shape. With the prolongation of soaking time, the surface of Ctr-7d was covered by many tiny crystals (Fig. 3(b)). According to the XRD analysis results, the above tiny crystals are HA. Although flaky crystals also was found on the S5-1d tablet surface, its quantity was significantly less than that of Ctr-1d, and they seemed to only form on the surface of some relative large particles (Fig. 3(c)). There were only DCPA and HA diffraction peaks in the XRD pattern of S5-1d (Fig. 1), so the above large particle probably was DCPA. Unlike the Ctr-7d, obviously fewer tiny crystals were observed on the S5-7d tablet surface, and DCPA remained incompletely dissolved despite soaking time extended to 7 days (Fig. 3(d)), which was consistent with the XRD analysis results (Fig. 1).

Fig. 1. XRD patterns of the incompletely CPC tablets after being kept soaking in different Zn-Tris-HCl solutions for 1 day and 7 days.

3. Results 3.1. Surface phase composition of the CPC hydration products

3.3. The viability, attachment and spreading behavior of the mBMSCs As displayed in Fig. 1, after being soaked in different Zn-Tris-HCl solutions for 1 day, the surface compositions of the CPC tablets were composed of HA (JCPDS card no. 009-0432) and DCPA (JCPDS card no. 009–0080), but their main crystal phase differed. For Ctr-1d, S1-1d, S21d, S3-1d and S4-1d, HA was their main crystal phase, whereas the predominant component of S5-1d was DCPA, so it suggested Zn had the ability to retard the CPC hydration. The DCPA diffraction peaks disappeared in the XRD pattern of Ctr-7d, all the diffraction peaks were in good agreement with that of HA (JCPDS card no. 009-0432), S1-7d, S27d and S3-7d had similar XRD patterns like Ctr-7d, but a minor difference could be observed among the formed HA crystals. As presented in Table 3, the HA diffraction peaks along the (002) and (004) plane direction possessed a larger diffraction angle in the presence of Zn. According to the data calculated by the Bragg Formula

After being cultured for 7 days, all of the mBMSCs which were cultured on the Ctr-7d, S1-7d, S2-7d, S3-7d, S4-7d and S5-7d tablets surface, respectively, exhibited good proliferation (Fig. 4). However, by comparing with that of the mBMSCs cultured on the Ctr-7d tablet surface, the proliferation ability of the mBMSCs which were cultured on the S1-7d, S2-7d, S3-7d, S4-7d and S5-7d tablets surface was significantly enhanced. In addition, Fig. 5 also proved the live mBMSCs (green fluorescence) attached on the S1-7d, S2-7d, S3-7d, S4-7d and S57d tablets surface were obviously more. Nevertheless, as presented in Fig. 6, the mBMSCs attached on the surface of the S4-7d and S5-7d tablets did not spread well (the cells which red arrows directed), their cytoskeleton almost had no expansion and most of them showed an ellipsoidal shape with several small filopodia, whereas the mBMSCs that attached on the Ctr-7d, S1-7d, S2-7d and S3-7d surface possessed a 4

Materials Science & Engineering C 105 (2019) 110065

K. Xiong, et al.

Fig. 2. The optical micrograph (a) and XRD pattern (b) of the white flocs.

tablet surface was considered as the control group. After being cultured on the different Zn-doped CPC tablets surface for 7 days, there were no significant ALP activity differences between the mBMSCs. When culturing time prolonged to 10 days, the ALP activities of the mBMSCs separately cultured on the S1-7d, S2-7d and S3-7d tablet surface were remarkably higher than the control group, but the ALP activity of the mBMSCs cultured on the S5-7d tablet surface was significantly lower than the control group even if culturing time continued to extending to 14 days. Nevertheless, the mBMSCs cultured on the S1-7d, S2-7d, S37d, S4-7d tablets surfaces had no significant ALP activity differences with the control group at day 14. The ALP staining images of the mBMSCs cultured with the extracts of the Ctr-7d, S1-7d, S2-7d and S37d tablets were shown in Fig. 8(b). After the Ctr-7d extracts were used to culture the mBMSCs for 10 days, they only secreted a few ALP (purple color), whereas more ALP were secreted by the mBMSCs when they were cultured with the extracts of S1-7d, S2-7d and S3-7d, it further confirmed the extracts of S1-7d, S2-7d and S3-7d could contribute to the stimulation of the ALP activity of the mBMSCs. Moreover,

bigger size (the cells which white arrows directed), and their cytoskeleton also fully expanded. More interestingly, under the same cell culture condition, all the mBMSCs attached on the cell culture plates could spread well, which exhibited more evident stress fibers, well-defined actin containing microfilaments and fully expanded cytoplasmic meshwork (Fig. 7). Thus, it suggested that the inorganic ions (including Zn2+) which released from the Ctr-7d, S1-7d, S2-7d, S3-7d, S4-7d and S5-7d tablets had no direct effects on the spreading of the mBMSCs. In fact, Zn doping induced differences in the surface morphology and the surface roughness probably will affect the spreading of the mBMSCs. 3.4. The ALP activity, ALP staining and osteogenesis related gene expressions of the mBMSCs ALP activity is thought to be a sign of osteogenic differentiation at the early stage. As shown in Fig. 8 (a), the ALP activity of the mBMSCs promoted with the prolongation of culturing time. At predetermined time intervals, the ALP activity of the mBMSCs cultured on the Ctr-7d

Fig. 3. SEM images of the surface morphology of the (a) Ctr-1d, (b) Ctr-7d, (c) S5-1d and (d) S5-7d tablets. 5

Materials Science & Engineering C 105 (2019) 110065

K. Xiong, et al.

(2)

3H3 PO4 + 5Ca (OH)2 → Ca5 (PO4 )3 OH + 9 H2 O

(3)

In comparison with the Ca atoms, the Zn atoms have a stronger bonding to the phosphate anions [28]. As a result, the phosphate anions released from DCPA and PCCP that prefer to bonding to Zn2+. Thus, the retardation mechanism of the Zn on the hydration of the CPC can be deduced as the following, Zn2+ firstly hinder the reactions described in the Eqs. (1) and (2), thereby further inhibit the happening of the reaction described in the Eq. (3), so it also explains why less Zn-doped HA and more residue DCPA exist in the S4-7d and S5-7d tablets. Furthermore, Y. Leng, et al. [29], reported the type of the formed zinc phosphate precipitates was closely associated with the Zn/(Zn + Ca) molar ratio in the solution, Zn-doped HA would form when the Zn/(Zn + Ca) molar ratio was no > 1:5, and it still maintained the HA lattice structure in this case, as the Zn/(Zn + Ca) molar ratio ranged from 1:5 to 3:5, the obtained products changed from Zn-doped HA into amorphous HA and CaZn2(PO4)2·2H2O, whereas (Ca, Zn)HPO4·2H2O and CaZn2(PO4)2·2H2O would form when the Zn/(Zn + Ca) molar ratio continued to increasing to 4:5. Therefore, based on the findings of Leng, it can easily ascertain the prerequisite that formation of Zn-doped HA crystals, and it also explains why formation of various zinc phosphate precipitates in the CPC hydration process (Fig. 2). In the PCCP+DCPA cement system, for ensuring the hydration reaction to be not seriously hindered, the safety Zn dosage concentration should be no > 320 μM. As far as we know, the released Zn is able to promote the bone regeneration ability, but fast release of Zn will lead to in vitro cytotoxicity and in vivo inflammatory response as well [16,19,30]. So in consideration of safety, besides the Zn dosage, the Zn releasing behavior is also a critical factor. In the present study, the lattice stability of the Zn-doped HA was found to decline with the increase of Zn doping amount, which caused Zn to be easier released from the Zn-doped HA. In fact, Fig. 9 had proved the Zn release rate was really in proportional to the dosage concentration of Zn. Different amounts of zinc sulfate were added to cell culture medium by Liang, et al. [31] for investigating the Zn stimulatory effect, it was found that Zn exhibited optimal stimulatory effect on the proliferation of MC3T3-E1 cells when its concentration approached 50 μM, whereas the stimulatory effect gradually diminished when the Zn concentration stayed within the range from 50 to 130 μM, and it would cause cytotoxicity when the Zn concentration exceeded 130 μM. In this study, the mBMSCs proliferating ability was found to be remarkably improved even if the Zn concentration approached 103.3 μM (Fig. 4), but the same concentration of Zn had a remarkable inhibitory effect on ALP activity (Fig. 8(a)). Our findings indicated 10.91–27.15 μM of Zn could contribute to the promotion of the ALP activity of the mBMSCs as well as the up-regulation of the

Fig. 4. Proliferation of the mBMSCs after being cultured on the surface of various Zn-doped CPC tablets for 1, 3, 7 days, respectively. (n = 4) *The S1-7d, S2-7d, S3-7d, S4-7d and S5-7d compared with Ctr-7d (control group). Hereinto, *P < 0.05, **P < 0.01, and ***P < 0.001.

as compared to the control group, the mBMSCs which were separately cultured on the surfaces of S1-7d, S2-7d and S3-7d tablets also showed significant up-regulated expressions of osteogenesis related genes such as the Col-I and Runx-2 (Fig. 8(c)). As depicted in Fig. 9, S1-7d had a relative stable Zn releasing curve. At each time intervals, the amount of Zn which released from S1-7d to cell culture medium was almost the same. The S2-7d and S3-7d exhibited a stable Zn releasing trend as well. However, the release of Zn from the S4-7d and S5-7d tablets was not constant at the same time intervals, it reached the maximum at day 10 and afterward slightly decreased at day 12. In this study, the maximum release of Zn belonged to the S5-7d tablet, which released about 128.58 μM of Zn to cell culture medium at day 10. 4. Discussion Our experimental results demonstrate the CPC hydration will be retarded in the presence of no < 800 μM of Zn, which leads to CPC hydration products having varying surface composition and surface morphology. It has already reported that the hydration mechanism of the PCCP+DCPA cement system is in fact a acid-base neutralization reaction, and the reaction equations are listed below [27],

5CaHPO4 (DCPA) + H2 O → Ca5 (PO4 )3 OH + 2H3 PO4

PCCP + H2 O → Ca5 (PO4 )3 OH + Ca (OH)2

(1)

Fig. 5. The live staining fluorescence images of the mBMSCs after being cultured on the surface of various Zn-doped CPC tablets for 1 day. 6

Materials Science & Engineering C 105 (2019) 110065

K. Xiong, et al.

Fig. 6. The SEM images of mBMSCs which attached on the surface of different Zn-doped CPC tablets. (After being cultured for 1 day). Fig. 7. The merged fluorescence images of 4′,6-diamidino-2-phenylindole (nucleus, blue), F-actin (cytoskeleton, green) of the mBMSCs attached on the cell culture plates. (After being co-cultured with various Zndoped CPC tablets for 1 day). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

incompletely hydrated CPC tablets soaking in varying Zn-Tris-HCl buffers. The CPC hydration reaction was found to be retarded in the presence of Zn, and the inhibitory effect was in direct proportional to the Zn dosage concentration. Since the serious retarding effect of overhigh concentration of Zn on the CPC hydration reaction, the phase composition and the surface morphology of the final hydration products varied, which thereby affected the spreading behavior of the mBMSCs. Moreover, it was found that the Zn release rate was also in proportional to the Zn dosage concentration, the safety Zn dosage concentration should be no > 320 μM. When Zn-doped CPC tablets released 10.9127.15 μM of Zn, it could facilitate the improvement of the proliferation ability and the ALP activity of the mBMSCs, the expressions of the osteogenesis related genes (such as Col-I and Runx2) were significantly

osteogenesis related genes expression. Col-I is not only recognized as a osteoblastic primary gene product during bone matrix formation, but it is also the abundant extracellular matrix protein in bone [32]. As the earliest transcription factor for osteogenic differentiation, Runx-2 is able to activate the expressions of multiple late stage osteogenic-related genes [33]. Therefore, as compared to Zn-free CPC, the up-regulated expressions of Col-I and Runx-2 in the presence of 10.91–27.15 μM of Zn proved that the addition of proper amounts of Zn could facilitate the promotion of the osteogenesis performances of the CPC.

5. Conclusion The Zn-doped CPC were successfully prepared by keep the 7

Materials Science & Engineering C 105 (2019) 110065

K. Xiong, et al.

Fig. 8. (a) ALP activity of the mBMSCs after being cultured on the surface of different Zn-doped CPC tablets for 7, 10, 14 days, respectively; (b) ALP staining images of the mBMSCs after being cultured with the extracts of different Zn-doped CPC tablets (S1-7d, S2-7d and S3-7d) for 10 days; (c) osteogenesis related gene (ColeI, Runx2 and OPN) expression of the mBMSCs cultured for 7 days on the different Zn-doped CPC (S1-7d, S2-7d and S3-7d) tablet surfaces. (n = 4) *The S1-7d, S2-7d, S3-7d, S4-7d and S5-7d compared with Ctr-7d (control group). Hereinto, *P < 0.05, **P < 0.01, and ***P < 0.001.

[2]

[3]

[4]

[5]

[6]

[7]

Fig. 9. Concentration of Zn released from various Zn-doped CPC tablets into cell culture medium at predetermined time intervals.

[8]

up-regulated as well. Therefore, the CPC with suitable Zn dosage concentration is promising to be used for stimulating the bone regeneration.

[10]

Acknowledgements

[11]

[9]

This work is financially supported by National Natural Science Foundation of China (Grant no. 51172074, 51402247), Research and Innovation Team Funding of Sichuan Education Department (no. 16zd1104), Open Project of State Key Laboratory Cultivation Base for Nonmetal Composites and Functional Materials (no. 15zxt101), Longshan Academic Talent Research Supporting Program of SWUST (no. 17LZX676, no. 18LZX533, no. 18LZXT02).

[12] [13] [14]

[15] [16]

References [1] T. Bian, K. Zhao, Q. Meng, H. Jiao, Y. Tang, J. Luo, Preparation and properties of

[17]

8

calcium phosphate cement/small intestinal submucosa composite scaffold mimicking bone components and Haversian microstructure, Mater. Lett. 212 (2018) 73–77. A. Lode, C. Heiss, G. Knapp, J. Thomas, B. Nies, M. Gelinsky, M. Schumacher, Strontium-modified premixed calcium phosphate cements for the therapy of osteoporotic bone defects, Acta Biomater. 65 (2018) 475–485. C. Mellier, F.-X. Lefevre, F. Fayon, V. Montouillout, C. Despas, M. Le Ferrec, F. Boukhechba, A. Walcarius, P. Janvier, M. Dutilleul, O. Gauthier, J.-M. Bouler, B. Bujoli, A straightforward approach to enhance the textural, mechanical and biological properties of injectable calcium phosphate apatitic cements (CPCs): CPC/ blood composites, a comprehensive study, Acta Biomater. 62 (2017) 328–339. R. O’Neill, H.O. McCarthy, E.B. Montufar, M.P. Ginebra, D.I. Wilson, A. Lennon, N. Dunne, Critical review: injectability of calcium phosphate pastes and cements, Acta Biomater. 50 (2017) 1–19. G. Qiu, Z. Shi, H.H.K. Xu, B. Yang, M.D. Weir, G. Li, Y. Song, J. Wang, K. Hu, P. Wang, L. Zhao, Bone regeneration in minipigs via calcium phosphate cement scaffold delivering autologous bone marrow mesenchymal stem cells and plateletrich plasma, J. Tissue Eng. Regen. Med. 12 (2018) E937–E948. M. Roozbahani, M. Alehosseini, M. Kharaziha, R. Emadi, Nano-calcium phosphate bone cement based on Si-stabilized alpha-tricalcium phosphate with improved mechanical properties, Materials Science & Engineering C-Materials for Biological Applications 81 (2017) 532–541. S. Wang, S. Zhang, Y. Wang, X. Sun, K. Sun, Reduced graphene oxide/carbon nanotubes reinforced calcium phosphate cement, Ceram. Int. 43 (2017) 13083–13088. J. Zhang, W. Liu, O. Gauthier, S. Sourice, P. Pilet, G. Rethore, K. Khairoun, J.M. Bouler, F. Tancret, P. Weiss, A simple and effective approach to prepare injectable macroporous calcium phosphate cement for bone repair: syringe-foaming using a viscous hydrophilic polymeric solution, Acta Biomater. 31 (2016) 326–338. N.R. Calhoun, J.C. Smith Jr., K.L. Becker, The role of zinc in bone metabolism, Clin. Orthop. Relat. Res. (1974) 212–234 10.1097/00003086-197409000-00084. L. Fong, K. Tan, C. Tran, J. Cool, M.A. Scherer, R. Elovaris, P. Coyle, B.K. Foster, A.M. Rofe, C.J. Xian, Interaction of dietary zinc and intracellular binding protein metallothionein in postnatal bone growth, Bone 44 (2009) 1151–1162. P. Habibovic, J.E. Barralet, Bioinorganics and biomaterials: bone repair, Acta Biomater. 7 (2011) 3013–3026. W. Hickory, R. Nanda, F.A. Catalanotto, Fetal skeletal malformations associated with moderate zinc deficiency during pregnancy, J. Nutr. 109 (1979) 883–891. L.S. Hurley, S.H. Tao, Alleviation of teratogenic effects of zinc deficiency by simultaneous lack of calcium, Am. J. Phys. 222 (1972) 322–325. I.-S. Kwun, Y.-E. Cho, R.-A.R. Lomeda, H.-I. Shin, J.-Y. Choi, Y.-H. Kang, J.H. Beattie, Zinc deficiency suppresses matrix mineralization and retards osteogenesis transiently with catch-up possibly through Runx 2 modulation, Bone 46 (2010) 732–741. S.L. Hall, H.P. Dimai, J.R. Farley, Effects of zinc on human skeletal alkaline phosphatase activity in vitro, Calcif. Tissue Int. 64 (1999) 163–172. X. Li, Y. Sogo, A. Ito, H. Mutsuzaki, N. Ochiai, T. Kobayashi, S. Nakamura, K. Yamashita, R.Z. LeGeros, The optimum zinc content in set calcium phosphate cement for promoting bone formation in vivo, Materials Science & Engineering CBiomimetic and Supramolecular Systems 29 (2009) 969–975. S. Horiuchi, M. Hiasa, A. Yasue, K. Sekine, K. Hamada, K. Asaoka, E. Tanaka,

Materials Science & Engineering C 105 (2019) 110065

K. Xiong, et al.

[18]

[19]

[20]

[21] [22] [23] [24]

[25]

composition, J. Am. Ceram. Soc. 96 (2013) 691–696. [26] H. Zreiqat, Y. Ramaswamy, C. Wu, A. Paschalidis, Z. Lu, B. James, O. Birke, M. McDonald, D. Little, C.R. Dunstan, The incorporation of strontium and zinc into a calcium-silicon ceramic for bone tissue engineering, Biomaterials 31 (2010) 3175–3184. [27] X. Wang, J. Ye, Y. Wang, Hydration mechanism of a novel PCCP plus DCPA cement system, Journal of Materials Science-Materials in Medicine 19 (2008) 813–816. [28] N. Kanzaki, K. Onuma, G. Treboux, S. Tsutsumi, A. Ito, Effect of impurity on twodimensional nucleation kinetics: case studies of magnesium and zinc on hydroxyapatite (0001) face, J. Phys. Chem. B 105 (2001) 1991–1994. [29] F. Ren, R. Xin, X. Ge, Y. Leng, Characterization and structural analysis of zincsubstituted hydroxyapatites, Acta Biomater. 5 (2009) 3141–3149. [30] A. Ito, K. Ojima, H. Naito, N. Ichinose, T. Tateishi, Preparation, solubility, and cytocompatibility of zinc-releasing calcium phosphate ceramics, J. Biomed. Mater. Res. 50 (2000) 178–183. [31] D. Liang, M. Yang, B. Guo, J. Cao, L. Yang, X. Guo, Zinc upregulates the expression of Osteoprotegerin in mouse osteoblasts MC3T3-E1 through PKC/MAPK pathways, Biol. Trace Elem. Res. 146 (2012) 340–348. [32] Y. Sasano, J.X. Zhu, S. Kamakura, S. Kusunoki, I. Mizoguchi, M. Kagayama, Expression of major bone extracellular matrix proteins during embryonic osteogenesis in rat mandibles, Anat. Embryol. 202 (2000) 31–37. [33] J. Huang, L. Zhao, L. Xing, D. Chen, MicroRNA-204 regulates Runx2 protein expression and mesenchymal progenitor cell differentiation, Stem Cells 28 (2010) 357–364.

Fabrications of zinc-releasing biocement combining zinc calcium phosphate to calcium phosphate cement, J. Mech. Behav. Biomed. Mater. 29 (2014) 151–160. G. Cama, S. Nkhwa, B. Gharibi, A. Lagazzo, R. Cabella, C. Carbone, P. Dubruel, H. Haugen, L. Di Silvio, S. Deb, The role of new zinc incorporated monetite cements on osteogenic differentiation of human mesenchymal stem cells, Mater. Sci. Eng. C 78 (2017) 485–494. K. Ishikawa, Y. Miyamoto, T. Yuasa, A. Ito, M. Nagayama, K. Suzuki, Fabrication of Zn containing apatite cement and its initial evaluation using human osteoblastic cells, Biomaterials 23 (2002) 423–428. K. Paul, B.Y. Lee, C. Abueva, B. Kim, H.J. Choi, S.H. Bae, B.T. Lee, In vivo evaluation of injectable calcium phosphate cement composed of Zn- and Si-incorporated betatricalcium phosphate and monocalcium phosphate monohydrate for a critical sized defect of the rabbit femoral condyle, Journal of Biomedical Materials Research Part B-Applied Biomaterials 105 (2017) 260–271. A. Bigi, E. Foresti, M. Gandolfi, M. Gazzano, N. Roveri, Inhibiting effect of zinc on hydroxylapatite crystallization, J. Inorg. Biochem. 58 (1995) 49–58. L. Courtheoux, J. Lao, J.M. Nedelec, E. Jallot, Controlled bioactivity in zinc-doped sol-gel-derived binary bioactive glasses, J. Phys. Chem. C 112 (2008) 13663–13667. D.B. Jaroch, D.C. Clupper, Modulation of zinc release from bioactive sol-gel derived SiO2-CaO-ZnO glasses and ceramics, J. Biomed. Mater. Res. A 82A (2007) 575–588. N. Kanzaki, K. Onuma, G. Treboux, S. Tsutsumi, A. Ito, Inhibitory effect of magnesium and zinc on crystallization kinetics of hydroxyapatite (0001) face, J. Phys. Chem. B 104 (2000) 4189–4194. K. Xiong, H. Shi, J. Liu, Z. Shen, H. Li, J. Ye, Control of the dissolution of Ca and Si ions from CaSiO3 bioceramic via tailoring its surface structure and chemical

9