- Email: [email protected]
Zr61Ti2Cu25Al12 metallic glass for potential use in dental implants: Biocompatibility assessment by in vitro cellular responses
Materials Science and Engineering C 33 (2013) 2113–2121
Contents lists available at SciVerse ScienceDirect
Materials Science and Engineering C journal homepage: www.elsevier.com/locate/msec
Zr61Ti2Cu25Al12 metallic glass for potential use in dental implants: Biocompatibility assessment by in vitro cellular responses Jing Li a, Ling-ling Shi b, Zhen-dong Zhu b, Qiang He b, Hong-jun Ai a,⁎, Jian Xu b,⁎⁎ a b
School of Stomatology, China Medical University, 117 Nanjing North Sreet, Shenyang, 110002, China Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang, 110016, China
a r t i c l e
i n f o
Article history: Received 23 November 2012 Accepted 15 January 2013 Available online 20 January 2013 Keywords: Cytotoxicity Biocompatibility Osteoblast Metallic glass Zirconium
a b s t r a c t In comparison with titanium and its alloys, Zr61Ti2Cu25Al12 (ZT1) bulk metallic glass (BMG) manifests a good combination of high strength, high fracture toughness and lower Young's modulus. To examine its biocompatibility required for potential use in dental implants, this BMG was used as a cell growth subtract for three types of cell lines, L929 fibroblasts, human umbilical vein endothelial cells (HUVEC), and osteoblast-like MG63 cells. For a comparison, these cell lines were in parallel cultured and grown also on commercially pure titanium (CP-Ti) and Ti6–Al4–V alloy (Ti64). Cellular responses on the three metals, including adhesion, morphology and viability, were characterized using the SEM visualization and CCK-8 assay. Furthermore, real-time RT-PCR was used to measure the activity of integrin β, alkaline phosphatase (ALP) and type I collagen (COL I) in adherent MG63 cells. As indicated, in all cases of three cell lines, no significant differences in the initial attachment and viability/proliferation were found between ZT1, CP-Ti, and Ti64 until 5 d of incubation period. It means that the biocompatibility in cellular response for ZT1 BMG is comparable to Ti and its alloys. For gene expression of integrin β, ALP and COL I, mRNA level from osteoblast cells grown on ZT1 substrates is significantly higher than that on the CP-Ti and Ti64. It suggests that the adhesion and differentiation of osteoblasts grown on ZT1 are even superior to those on the CP-Ti and Ti64 alloy, then promoting bone formation. The good biocompatibility of ZT1 BMG is associated with the formation of zirconium oxide layer on the surface and good corrosion-resistance in physiological environment. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Chemically similar to titanium, zirconium as an endosseous implant exhibits good biocompatibility, as indicated by both in vitro [1,2] and in vivo assessments [3]. Even if considering the inevitability of metal ions release during biocorrosion, toxicity of Zr ions is acknowledged to be minimal due to the lack of combination with biomolecules [4]. However, in the absence of prominent advantages in mechanical properties and corrosion resistance, whether the Zr and its alloys are adequate as biomedical implants remains inconclusive [5]. In contrast to the conventional crystalline metals, metallic glasses (or amorphous alloys) manifest substantially uniform microstructure, without defects such as dislocation and grain boundary. Periodic atomic ordering arrangement in metallic glass only occurs in shortrange rather than in long-range like crystalline solids. Consequently, glassy/amorphous alloys exhibit many unique properties, such as high yield strength, large elastic strain (~ 2%) and excellent corrosion resistance. In the light of these attractive features, a considerable attention is paid to the potential of Zr-based bulk metallic glasses ⁎ Corresponding author. Tel.: +86 24 22891420. ⁎⁎ Corresponding author. Tel.: +86 24 23971950; fax: +86 24 23971215. E-mail addresses: [email protected] (H. Ai), [email protected] (J. Xu). 0928-4931/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.msec.2013.01.033
(BMGs) as biomedical implants [6–9]. Recently, a new Zr-based BMG, Zr61Ti2Cu25Al12 (designated as ZT1 hereafter), was developed [10,11]. In comparison with the previously-developed BMGs, this alloy is not only chemically free from the toxic elements such as nickel, cobalt and beryllium, but also has unique mechanical properties such as low Young's modulus (E = 83 GPa) and high fracture toughness (KJIC = 130 MPa√m). In this sense, it is of interest if such an “amorphous Zr” can be a candidate material for the endosseous implants or hard-tissue prostheses. Currently, titanium and its alloys, commercially pure Ti (CP-Ti) and Ti–6Al–4V (Ti64) as the representative, have been widely used in clinic, including usage of bone plates, screws, and pins for oral and maxillofacial reconstruction as well as dental root implants [12–14]. However, significant mismatch in Young's modulus of Ti (E = 110 GPa) with that of the bone (10–30 GPa) yields a “stress shielding effect” [15,16]. This has been identified as a major reason for implant failure [17]. From the materials perspective, for most crystalline metals, reduction of the modulus is usually accompanied by a sacrifice in strength. As noticed, Young's modulus of the ZT1 BMG is about 20% lower than that of Ti and its alloys, more proximal to that of the bone, together with a large elastic strain limit. It is expected to reduce the stress shielding effect, then to prevent osteolysis under loading service.
2114
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
As well documented [18], the biocompatibility of a material is straightforward related to cell response on contact with the implant surface. Cell adhesion, spreading and proliferation on the implant surface are essential events for differentiation of bone cells before bone tissue formation. In the present work, biocompatibility of the ZT1 BMG was assessed by in vitro cytotoxicity testing. To this end, three representative cell lines are selected, including the mouse fibroblasts L929 [19,20], human umbilical vein endothelial cells (HUVEC) [21,22], and osteoblast-like MG63 cells [23–27]. These differentiated cell lines are widely used for in vitro biocompatibility evaluation of materials. In addition, gene expressions of three differentiation proteins/ markers from MG63, integrin β, alkaline phosphate (ALP) and type I collagen (COL I) were investigated to evaluate cell differentiation. For purpose of comparison, CP-Ti and Ti64 are investigated in parallel as their cytocompatibility has been well understood and due to their maturated clinical application as typical dental implant materials.
For the L929 fibroblast, a RPMI 1640(Gibco BRL) supplemented with 10% FBS (TBD, Tianjin, China) was used as culture medium. All cultures were performed under a humidified 5% CO2 air atmosphere at 37 °C. The medium was changed every 2–3 days. Primary cultures were subcultured with trypsin-EDTA solution (0.05% trypsin, 0.25% EDTA) after reaching 70%–80% confluence. For subculture, metallic disks were sterilized with exposure to UV radiation for 1 h on both sides before using them as cellular growth support. 2.4. Cell morphology observation After incubation for 2, 4, and 6 h, non-adherent cells were removed by rinsing in phosphate buffer solution (PBS). The cells attached on the surface of disks were then fixed with 4% formaldehyde. The samples with fixed cell were washed with distilled water, and dehydrated using a gradation series of ethanol/distilled water mixtures. With critical point drying and gold coating, morphology of cells on the disks was observed using a scanning electron microscopy (SEM; LEO Supra 35, Heidenheim, Germany).
2. Materials and methods 2.5. Cell viability 2.1. Materials fabrication To fabricate the Zr61Ti2Cu25Al12 BMG samples, master alloy ingots with the nominal composition of Zr61Ti2Cu25Al12 (in atomic percentage, or Zr–25Cu–12Al–2Ti in weight percentage) were prepared by arc melting. Elemental pieces with purity higher than 99.9% were used as starting materials. The ingot was re-melted, and then cast into a copper mold to form cylindrical rods of 6 mm in diameter and about 60 mm in length. Amorphous feature of as-cast rod samples was characterized by using X-ray diffraction (XRD). The thermal, elastic and mechanical properties of this BMG were presented elsewhere [10,11]. As-cast BMG rods were cut into disk of about 2-mm thickness. For the CP-Ti and Ti64 alloy (medical grade), disk samples of 6 mm in diameter and about 2 mm in thickness were taken from the as-received plates by electro-erosion cutting. The disk samples were wet-ground using silicon carbide abrasive paper until 1200 grit, then finally polished to a mirror finish with diamond paste. The samples were cleaned in an ultrasonic bath sequentially using acetone, ethanol, and double distilled water for 10 min in each solution. 2.2. Surface roughness characterization and XPS analysis The surface arithmetic average roughness parameter Sa (μm) with an area of 65 μm × 65 μm for the ZT1 disks was measured using a 3D Measuring Laser Microscope LEXT OLS4000 (Olympus, USA). Sa is the arithmetic average of 3D roughness. It was determined by taking the mean value of three individual measures for each disk. Chemical composition of the ZT1 disk surfaces was analyzed using an ESCALAB250 X-ray photoelectron spectrometer (XPS, Thermo VG, USA). The disks were examined under two conditions, as-polished and cell-cultured for 14 days. Measurements were performed with a monochromated X-ray source of Al Kα. Binding energies were calibrated using carbon contamination with a C 1s peak value of 284.6 eV. Depth profiles of sample surface were established by in situ XPS ion beam sputtering with argon. The XPS spectra were analyzed using XPSPEAK surface chemical analyses software.
Cell viability was measured by Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan) assay, resulting in the cellular conversion of the tetrazolium salt into a soluble formazan dye. The cells were cultured on three investigated materials in 96-well plates (Costar, USA) at a density of 20,000 cells cm −2. The plastic is used as control. After culturing for 4 h, 1 d, 2 d, 3 d, and 5 d, specimens with seeded cells were rinsed three times with sterile PBS, and transferred to fresh 96-well plates. Subsequently, culture medium with 10% CCK-8 was introduced to the samples in a separate volume of 0.7 ml. Then, cells were incubated for 1 h according to the instructions. Finally, colorimetric measurement of the formazan dye was performed on a spectrophotometer (NANO 2000, Thermo, USA) with an optical density reading at 450 nm. Five parallel replicates were performed. 2.6. Real time RT-PCR Gene expression of integrin β (cultured for 4 h and 1 d) and ALP (cultured for 4, 7 and 14 d), and COL I (cultured for 4, 7 and 14 d) was determined through a real-time TaqMan RT-PCR (ExicyclerTM 96, BIONEER, South Korean) assay. GADPH (Glyceraldehyde-3-phosphate dehydrogenase) was used as a housekeeping gene. The MG63 cells were cultured on three materials in 96-well plates at a density of 20,000 cells cm−2, with the cells directly cultured on plastic (polystyrene) as control. After incubation for 4 h, 1 d, 4 d, 7 d and 14 d, the medium was aspirated, and the specimens were gently rinsed with PBS three times. The viable cells were harvested using 0.25% trypsin-EDTA. The following protocol was applied: (1) mRNA extraction, a total RNA extraction kit (TianGen Biotech, Beijing, China) was used; (2) spectrophotometric quantification of RNA was achieved by measuring the absorbance with a spectrophotometer (NANO 2000, Thermo, USA); (3) reverse transcription (RT), with a TIANScript RT Kit (TIANScript cDNA first strand synthesis kit, TianGen Biotech, Beijing, China); (4) polymerase chain reaction (PCR), the resulting cDNA is then amplified using the SYBR green method (TianGen Biotech, Beijing, China). The above steps were operated strictly in accordance with the manufacturer's instructions. Primer (Sangon, Shanghai, China) sequences are listed in Table 1.
2.3. Cell cultures 2.7. Statistical analysis The HUVEC (American Type Culture Collection, Manassas, VA, USA:CRL-1730) and MG63 cells (ATCC, CRL-1427) were cultured in high-glucose Dulbecco's modified Eagle's medium (DMEM) (Gibco BRL Life Technologies, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (TBD, Tianjin, China) and 1% penicillin/streptomycin.
All testing were repeated at least three times. Data are expressed as means ± standard deviation (SDs). Statistical analysis was performed using a software named as Statistical Package for the Social Sciences (SPSS) version 14.0 (SPSS Inc. Chicago, IL, USA). Statistical comparisons
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
2115
were made by one-way ANOVA analysis for independent samples. In all statistical evaluations, p b 0.05 is considered to be statistically significant.
3. Results 3.1. Surface characterization of ZT1 BMG Fig. 1 (a) and (b) shows surface topographies observed under optical microscope for the ZT1 BMG disks of the as-polished and cultured with MG63 for 14 d, respectively. For the as-polished ZT1 disk, its surface roughness characterized by the Sa is determined to be 0.014 ± 0.005 μm, while the Sa for the disk cultured with MG63 for 14 d increases to 0.026 ± 0.004 μm. Subjected to cell cultivation, subtle increase in the surface roughness of the sample is probably caused by corrosion exposed in the cell culture medium. Fig. 2 shows XPS surveys of sample surfaces of the ZT1 BMG disks, in the cases of the as-polished and cultured with MG63 for 14 d. For the as-polished sample, primary peaks for the outermost surface are identified as the Zr 3d, Al 2s, Cu 2p, Ti 2p, O 1s and C 1s, as seen in Fig. 2. The detected C 1s peak in the spectrum results from the carbon as contaminant. Fig. 3 (a)–(d) display the XPS spectra in the two cases for the Zr 3d, Al 2s, Cu 2p and Ti 2p. As indicated, in contrast to the sample without cell culture, composition in the surface for the cultured sample is depleted in Al, Cu and Ti, besides the remaining Zr 3d XPS peaks, as seen in Fig. 3 (a). To determine the thickness of the passive film on the surface, the samples were cleaned by Ar-sputtering at several depths for XPS analysis. As the representative, Fig. 4 (a)–(d) displays the XPS spectra of the as-polished and cultured ZT1 disk after cleaning at a depth of about 2 nm. As indicated, the peaks of Zr 3d, Al 2s, Cu 2p, and Ti 2p are detected in the XPS spectra [28], when removing the “native” oxide layer away. By deconvoluting the spectra for each element at different sputtering depths, the states and distribution of alloying components at the surface layer are revealed. Depth profiles of the elements in the alloys for ZT1 before and after cell culturing are presented in Fig. 5 (a) and (b), respectively. The area under the curve in the figure represents the concentration for each species. As an approximation, the thickness of oxide films is estimated with a depth at the half of the oxygen concentration. Then, the thickness of film increases from 4 nm to 9 nm after cell culturing, as indicated by the dash lines in Fig. 5 (a) and (b). With increasing the sputtering depth, concentrations of components at metallic state gradually increases until the nominal concentrations are reached. For the as-polished samples, the outermost surface is composed of metallic Zr 0, Zr 4+, metallic Cu 0, Al 3+ and Ti 4+, as seen in Fig. 5 (a). Subjected to cell culture, the ZrO2 phase becomes predominant on the surface, indicating that the Zr is preferentially oxidized, to form the surface film, as shown in Fig. 5 (b). In addition, Cu dissolved in the oxide layer is detectable as well.
Fig. 1. Surface topographies observed with laser-scanning confocal microscope for Zr61Ti2Cu25Al12 BMG disks. (a) as-polished and (b) after culture for 14 d with MG63 cells.
Table 1 Primer sequences used in gene expression analysis with real-time PCR. Name
Sequence(5′¬3′)
Length
Tm
Size
Integrinβ F Integrinβ R Collagen type I F Collagen type I R ALP F ALP R GAPDH F GAPDH R
TGAAGGGCGTGTTGGTAGAC GCCGCACTCTCCATTGTTACT AAACATCGGATTTGGGGAACG CACATCAAGACAAGAACGAGGTAG CCGTGGAACATTCTGGATCTG CTGGTGGTCTTGGAGTGAGT GAAGGTCGGAGTCAACGGAT CCTGGAAGATGGTGATGGGAT
20 21 21 24 21 20 20 21
54.17 54.86 61.5 58.6 60.1 54.1 58.7 60.8
121 121 120 120 193 193 224 224
Fig. 2. Typical XPS surveys of the outermost surface for Zr61Ti2Cu25Al12 BMG disk before and after culture for 14 d with MG63 cell.
2116
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
Fig. 3. XPS spectra of the outermost surface for Zr61Ti2Cu25Al12 BMG disk before and after culture for 14 d with MG63 cells. (a) Zr 3d, (b) Al 2s, (c) Cu 2p, and (d) Ti 2p.
Fig. 4. XPS spectra at Ar-sputtering cleaned depth of about 2 nm for Zr61Ti2Cu25Al12 BMG disk before and after culture for 14 d with MG63 cells. (a) Zr 3d, (b) Al 2s, (c) Cu 2p, and (d) Ti 2p.
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
2117
3.2. Cell morphology in SEM observation Fig. 6 (a)–(c) illustrates SEM images of the MG63 cells attached on three investigated metal substrates after seeding for 6 h. Corresponding high-magnification images in each case are presented in Fig. 6 (d)–(f). As seen in Fig. 6 (a), the cells adhere to the ZT1 metallic glass exhibit typical polygonal morphology covered about 60%–80% of the growth area. In a high-magnification observation as shown in Fig. 6 (d), the cell spreading is quite extensive, displaying numerous pseudopodia with distinct terminal protein spots. It is indicative of good adhesion on the substrate. Moreover, overlapping of adjacent cells is visible as well, indicating the healthy growth. In contrast, the morphology of the cells grown on the CP-Ti and Ti64 substrates is similar to the case of ZT1 BMG, as well as to the findings in previous work for the identical materials [24,29]. It implies that, at least at the adhesion stage, no significant difference between amorphous Zr and crystalline Ti-based metals was found for the cellular response. Furthermore, Fig. 7 (a)–(c) and (d)–(f) shows the high-magnification SEM micrographs of morphologies of the L929 and HUVEC cell cultured for 2 h on the ZT1 BMG and the CP-Ti and Ti64, respectively. L929 cells cultured on three different materials present spindle-shaped morphology, whereas HUVEC cells show cobble-stone shape. Both of them display well-spreading and good adhesion on the three sorts of substrates, with their characteristic shapes and numerous filopodias and lamellipodias. Thus, in terms of morphologies of three cell lines, it is suggested that the ZT1 BMG manifests good adhesion ability comparable to the Ti metals.
3.3. Cell viability and proliferation
Fig. 5. Schematic illustration of states and distribution of component elements at surface layer of Zr61Ti2Cu25Al12 BMG disk as a function of sputtering depth. (a) as-polished and (b) after culture for 14 d with MG63 cells.
Fig. 8 displays dependency of cell viability characterized by optical density (OD) value on incubation periods for three cell lines. In all cases, the counted number of viable cells gradually increases with extending the incubation time. As seen in Fig. 8 (a), for the L929 cell after 4 h of incubation, OD value of ZT1 BMG is significantly higher than that of the CP-Ti and Ti64. At 1 d, OD value for the different growth surfaces is nearly identical. However, OD value at 2, 3, and 5 d for ZT1 BMG is slightly higher than that of the CP-Ti and Ti64, but no difference exists between CP-Ti and Ti64. In the case of
Fig. 6. SEM micrographs of MG63 cell morphology after culture for 6 h on (a) Zr61Ti2Cu25Al12, (b) CP-Ti and (c) Ti64. (d), (e) and (f) are high-magnification images of (a), (b) and (c), respectively.
2118
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
Fig. 7. SEM micrographs of L929 and HUVEC cell morphology after culture for 2 h of on (a) and (d) Zr61Ti2Cu25Al12 BMG, (b) and (e) CP-Ti, (c) and (f) Ti64, respectively.
HUVEC cells, there is no difference between the OD values of three metals, incubated from 4 h to 2 d, as shown in Fig. 8 (b). At 3 d, the OD value of cell growth on the Ti64 is significantly higher than those on the CP-Ti and ZT1, but no difference between the latter two groups. Nevertheless, the OD values of all materials go back to similar level at 5 d. For the MG63 cell, OD values of cell growth on ZT1 BMG incubated up to 2 d are significantly higher than those on the CP-Ti and Ti64. The OD values of all materials are similar at 3 d, whereas the OD value at 5 d for the ZT1 is significantly higher than that for two Ti metals, but no difference between the latter two groups, as shown in Fig. 8 (c). Consequently, we can conclude that, independent of the cell lines, the viability and proliferation of cell cultured on the ZT1 are completely comparable to those on the CP-Ti and Ti64. In addition, it is noteworthy that, after seeding, proliferation trends for three cell lines are substantially the same, with a unidirectional feature. They rapidly attach to the surfaces, and then the number of viable cells increases gradually, as seen at 2 d. Doubling the cell number happens at 5 d, when the disk surfaces are fully covered by proliferous cells, accompanied by cell confluence and a maximum of OD values. As indicated, no detectable difference between three metals and polystyrene as a control is present. It means that these metals have no deleterious effects on cell proliferation. Moreover, it is interesting to note that the cell proliferation rate exhibits the dependency of cell lines. Among the three cell lines, HUVEC is the fastest, while the MG63 is slowest, and the L929 is between them. In fact, it is noticed by Trentani et al. that, when grown either on TiMoZrFe alloy or on plastic control, proliferation capacity of osteoblasts is slower than that of human dermal fibroblasts [30]. 3.4. Gene expression for osteoblastic differentiation of MG63 Fig. 9 (a)–(c) illustrates gene expression of three differentiation proteins of MG63, integrin β, ALP and COL I, which are relative change evaluated by real-time RT-PCR with respect to the plastic. The mRNA levels of target genes are expressed as a normalized value with control material (polystyrene). Comparative mRNA levels were analyzed statistically by using one-way ANOVA (SPSS version 14.0). Differences were admitted when statistical significance appears at p b 0.05. As shown in Fig. 9 (a), mRNA level of integrin β at 4 h, as an early adhesive protein, is more active with respect to the level at 1 d. In addition, mRNA level of integrin β for the cells adherent on the ZT1 at
4 h is significantly higher than those on the CP-Ti and Ti64, even on the plastic. It is noteworthy that higher level of integrin β mRNA is consistent with the morphology of well-spreading phenotype of MG63 on ZT1, as seen in Fig. 6 (a) and (d), since the formation of integrin receptor plays an essential role in cell spreading and adhesion. Nevertheless, at 1 d, mRNA level of integrin β from the ZT1 BMG is comparable to that from CP-Ti, but superior to that from Ti64 alloy, as seen in Fig. 9 (a). For the ALP level, no significant difference between cells adherent of three investigated metals is present at 4 d, as shown in Fig. 9 (b). However, at the 7 d and 14 d, mRNA level of ALP from the ZT1 BMG is much higher than those from the CP-Ti and Ti64. Furthermore, mRNA level of COL I for the cells grown on ZT1 is significantly higher than those on the CP-Ti and Ti64 as well, which happens at all of three time points, as seen in Fig. 9 (c). 4. Discussion As the in vitro assessment, cellular response has been a powerful tool as preliminary assays to evaluate biocompatibility of a material that is potentially used as implant. In the current work, three cell phenotypes were selected to examine their interaction with our ZT1 BMG. It is desirable to provide more understandings for the response from relevant tissues as dental implants, and to address possible difference in cellular responses to materials [31]. Among them, fibroblasts allow us to examine the basal cytocompatibility of a biomaterial, which relates to the common cellular functions. Moreover, this phenotype is sensitive to the metal ions, as well as with high metabolic activity [31]. MG63 cells, originally isolated from a human sarcoma [32], have been widely used for immuno- and biochemical studies of cell response to metallic implant surfaces, as initially recommended by Krikpatrick and Mittermayer [33]. They share several similarities with isolated human bone-derived cells [34]. Endothelial cells, here we used HUVEC, are important in inflammation response by secreting cytokines, expressing surface adhesion molecules for attraction and attachment of leucocytes [21]. As shown in Figs. 6 and 7, in terms of morphology at the cell adhesion stage, no significant differences between the grown-on metal subtracts were found, which is irrespective of whatever cell lines were used. For the cell proliferation rates, as shown in Fig. 8, at the incubation time of 5 d, the rate for MG63 cells grown on ZT1 is higher than on CP-Ti and Ti64, whereas no difference is presented in L929 and HUVEC between ZT1 and two Ti materials.
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
Fig. 8. Cell viability/proliferation measured with CCK-8 assay of cells cultured on Zr61Ti2Cu25Al12 BMG, CP-Ti and Ti64 after 4 h, 1 d, 2 d, 3 d, and 5 d, with a control cultured on plastic. (a) L929, (b) HUVEC and (c) MG63.
Furthermore, as well documented, integrin is the most important transmembrane receptor in cell binding process [35–37], which contains two different subunits: α and β. Osteoblast interacts with the substrate through integrin receptor. The integrin forms the linkage between the extracellular matrix and the interior of the cell. In the present work, as shown in Fig. 8 (a), higher activity of integrin β is observed for the culture on ZT1 with respect to the CP-Ti and Ti64. It reflects that the ZT1 BMG is much more amenable for cell attachment in contrast to the Ti metals. ALP activity is an indicator of early osteogenic differentiation, bone formation and matrix mineralization [38,39]. COL I is the most abundant protein present in different connective tissues especially in skin and bone [40]. It not only plays a pivotal role of collagen in modulating cell growth and differentiation [41], but also serves as a basis for the mineral scaffold [42]. As indicated in Section 3.4, activity of the ALP and COL I mRNA for MG63 cells grown on ZT1 BMG is significantly
2119
Fig. 9. Quantitative analysis of Real-time PCR for MG63 cells cultured on Zr61Ti2Cu25Al12 BMG, CP-Ti, and Ti64 as well as plastic as a control at several incubation periods. Relative amounts of (a) integrin β, (b) ALP, and (c) COL I (*pb 0.05).
higher than those on both CP-Ti and Ti64. It suggests that in the sense of osseointegration, ZT1 BMG is quite promising. Further investigation using animal models to examine the bone-growth scenarios around the ZT1 prototype implant is on-going work. As well-known, good bioactivity of titanium and its alloys is in great part attributed to the formation of a passive oxide film on the metallic surface [43–45]. For the Ti64 alloy, the oxide layer that spontaneously forms upon air exposure was predominantly TiO2, and its thickness varied from 2 nm to 4 nm [45]. The CP-Ti has an oxide thickness of 2–6 nm before implantation, whereas films on implants retrieved from human tissues are two- to three-times thicker [46]. Though the cytotoxicity investigation of an alloy with high content of toxic element vanadium (Ti1.5Al25V), Eisenbarth et al. [47] found that the cell reaction is influenced only by thin titanium oxide surface
2120
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
layer and not by the composition of the bulk material. The thick (~ 100 nm) and stable oxide layer on the Ti alloy is able to shield the cell from toxic elements. In the alloy we investigated, amorphous Zr61Ti2Cu25Al12, elements Cu and Al are necessary to maintain robust glass-forming ability for fabricating the bulk material [10]. However, it is well recognized that the Cu ions are toxic [48–50]. Using MG-63 osteoblast, Hallab et al. [49] indicate that the concentrations required to decrease viability by 50% (LC50) for Cu ions are approximately in a range of 0.05– 0.3 mM, while the Al ions are moderately toxic, with a concentration range of 0.3–4.0 mM for LC50. Sun et al. [51] found little cytotoxicity of Al in ROS 17/2.8 osteoblast-like cells. The Al significantly suppressed ALP gene expression, but did not alter ALP activity in ROS cells. In addition, as indicated by Hallab et al. [52], the response of peri-implant cells such as osteoblasts, fibroblasts and lymophocytes to metal challenge is primarily determined by composition and concentration, not by cell type. On the other hand, it has been well recognized that corrosion-resistance of metallic materials in a physiological environment is a key issue for its biocompatibility, which determine the amount of undesired metal ions/corrosion products released. In the current work, we found that the oxide layer predominantly composed of zirconium oxide spontaneously forms on the surface of Zr61Ti2Cu25Al12 BMG, when it is exposed to air, together with Al0, Al2O3 and Ti0, TiO2 as trace components, as indicated in Section 3.1. During the cell culture, only subtle corrosion happened in the BMG surface, without visible surface pitting, but accompanied by an increased thickness of oxide layer up to ~9 nm. This means that the amount of cytotoxic species, such as Cu and Al ions, released from the alloy surface remains quite tolerable for cell healthy survival. As a matter of fact, Zr oxide (zirconia) possesses good biocompatibility and osseoconductivity and has been used in total hip replacement and dental implantology [53–55]. Consequently, although “toxic” elements such as Cu and Al are present in our ZT1 BMG, stable oxide layer on its surface and good corrosion resistance in physiological environment plays a role to shield the release of toxic metal ions, which provides its good biocompatibility, like TiO2 layer in the case of Ti and its alloys. Moreover, as indicated by electrochemical evaluation [56–58], Zr-based BMGs manifest good corrosion resistance under simulated physiological condition, besides lower pitting corrosion resistance in contrast to the Ti and Ti64. Furthermore, cytotoxicity through in vitro assessments for Zr-based BMGs with different chemical compositions was examined in several studies [6,9,58–61]. For a purpose of comparison, cell lines, species and phenotypes used in these studies as well as the investigated alloys Table 2 Cell lines, species, and phenotypes currently used for cytotoxicity study of various Zr-based bulk metallic glasses.
are summarized in Table 2. For the Zr58Cu22Fe8Al12 BMG, Buzzi et al. [6] found that a natural layer of zirconium oxide layer forms on the surface, with a thickness of 7–8 nm, and small amount of Cu is included in the oxide layer, or lies on the surface. Good cell growth for MC3T3 cells is observed. No difference in the cytotoxic properties is present between Fe-containing Bio 1 and Ni-containing Vit BMGs. He et al. [59] indicated that in comparison with Ti alloy, the favorable attachment of osteoblasts on the Zr-base BMG surface, which is attributed to that the BMG surface is relatively more hydrophobic than the surface of Ti alloy. They found that the Zr-based BMG provides a favorable substrate for osteoblast differentiation and matrix production, which is reflected by a higher ALP level of the cells on the Zr BMG surfaces with respect to that on the Ti alloy surface. It is in agreement with the findings in the present work, as seen in Fig. 9 (b). Using cell lines of L929 and NIH 3T3, Wang et al. [60] presented that the extracts from the LM106, LM1 and LM1b Zr-based BMGs had no cytotoxicity. Nevertheless, Cu ion release associated with pitting corrosion gives rise to a decrease proliferation rate of LM106 and LM1 in comparison with the LM1b. Recently, Huang et al. [61] showed that ternary Zr50Cu43Al7 BMG was nontoxic in terms of cytotoxicity assessment with human mesenchymal stem cells (hMSC). Compared with Ti metal, Zr50Cu43Al7 BMG had a high level of protein adsorption and better cell adhesion and cell migration. In addition, it was observed that the total ion release from the BMG sample after 1 day of immersion in cell culture medium was below 100 ppb, which is comparable to that from the Ti sample. In general, in the light of cytotoxicity assessment, it is suggested that biocompatibility of Zr-based BMGs, no matter what alloy composition is selected, is tolerable, even comparable to the Ti metals, due to the formation of Zr oxide layer on the surface. To minimize the amount of metal ion release, enhancing the pitting-corrosion resistance in physiological environment by the alloy design or surface modification remains a vital issue. Further investigations on the hemocompatibility and genotoxicity, and osseointegration by in vivo animal testing are necessary to understand the biocompatibility of Zr-based BMGs from multiple perspectives. 5. Conclusions In terms of cellular responses for three cell phenotypes, L929, HUVEC and MG63, the phenomenological behavior of cells such as attachment, adhesion, spreading and proliferation for the Zr61Ti2Cu25Al12 (ZT1) metallic glass is substantially comparable to the CP-Ti and Ti64 alloy. As indicated by osteoblast gene expression of integrin β, alkaline phosphate and type I collagen, mRNA level for the cells grown on ZT1 substrates is much higher than those on the CP-Ti and Ti64 alloy. It suggests that the adhesion and differentiation of osteoblasts grown on ZT1 are even superior to those on the CP-Ti and Ti64 alloy, therefore promoting bone formation. The good biocompatibility of ZT1 BMG is attributed to the formation of zirconium oxide layer on the surface and good corrosion-resistance in physiological environment. Further investigations on the hemocompatibility and genotoxicity, and osseointegration by in vivo animal testing are currently in progress.
Subtract alloy
Cell line
Species Phenotype
Res.
Zr58Cu22Fe8Al12 (Bio 1) Zr58.5Cu15.6Ni12.8Al10.3Nb2.8 (Vit106a) Zr55Cu30Ni5Al10 (Zr0.55Cu0.30Ni0.05Al0.10)99Y1 Zr60Nb5Cu22.5Pd5Al7.5 Zr60Nb5Cu20Fe5Al10 Zr62Cu15.5Ni12.5Al10 Zr57Cu15.4Ni12.6Al10Nb5 (LM106) Zr41Ti14Cu12Ni10Be23 (LM1) Zr44Ti11Cu10Ni10Be25 (LM1b) Zr50Cu43Al7
3T3
Mouse
Fibroblast
[6]
MC-3T3-E1 Mouse
Pre-osteoblast
[9]
NIH3T3
Fibroblast
[58]
Pre-osteoblast Fibroblast Fibroblast
[59] [60]
The authors gratefully acknowledge the stimulating discussions with Prof. H.H. Huang. This work was supported at SYNL by the National Natural Science Foundation of China under Grant Nos. 51171180 and No. 51001099.
[61]
References
Zr61Ti2Cu25Al12 (ZT1)
Mouse
MC-3T3-E1 Mouse L929 Mouse NIH3T3 Mouse
hMSC L929 HUVEC MG63
Human Mesenchymal stem Mouse Fibroblast Human Umbilical vein endothelial Human Osteoblast-like
This work
Acknowledgment
[1] E. Eisenbarth, D. Velten, M. Muller, et al., Biomaterials 25 (2004) 5705–5713. [2] L. Saldaña, A. Méndez-Vilas, L. Jiang, et al., Biomaterials 28 (2007) 4343–4354. [3] P. Thomsen, C. Larsson, L.E. Ericson, et al., J. Mater. Sci. Mater. Med. 8 (1997) 653–665. [4] T. Hanawa, Mater. Sci. Eng. C 24 (2004) 745–752.
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121 [5] J.A. Helsen, Y. Missirlis, Biological and Medical Physics, Biomedical Engineering, Biomaterials, 2010, p. 99. [6] S. Buzzi, K.F. Jin, P.J. Uggowitzer, et al., Intermetallics 14 (2006) 729–734. [7] J. Schroers, G. Kumar, T.M. Hodges, et al., JOM 61 (2009) 21–29. [8] M.D. Demetriou, A. Wiest, D.C. Hofmann, et al., JOM 62 (2010) 83–91. [9] L. Huang, Z. Cao, H.M. Meyer, et al., Acta Biomater. 7 (2011) 395–405. [10] Q. He, Y.Q. Cheng, E. Ma, J. Xu, Acta Mater. 59 (2011) 202–215. [11] Q. He, J.K. Shang, E. Ma, J. Xu, Acta Mater. 60 (2012) 4940–4949. [12] K. Yokoyama, T. Ichikawa, H. Murakami, et al., Biomaterials 23 (2002) 2459–2465. [13] L.S. Morais, G.G. Serra, C.A. Muller, et al., Acta Biomater. 3 (2007) 331–339. [14] M.G. Manda, P.P. Psyllaki, D.N. Tsipas, P.T. Koidis, J. Biomed. Mater. Res. B 89B (2009) 264–273. [15] D.R. Sumner, T.M. Turner, R. Igloria, R.M. Urban, J.O. Galante, J. Biomech. 31 (1998) 909–917. [16] B.V. Krishna, S. Bose, A. Bandyopadhyay, Acta Biomater. 3 (2007) 997–1006. [17] D.R. Sumner, J.O. Galante, Clin. Orthop. Relat. Res. 274 (1992) 202–212. [18] K. Anselme, Biomaterials 21 (2000) 667–681. [19] S. Rao, Y. Okazaki, T. Tateishi, T. Ushida, Y. Ito, Mater. Sci. Eng. C 4 (1997) 311–314. [20] M.C. Serrano, R. Pagani, M. Vallet-Regi, et al., Biomaterials 25 (2004) 5603–5611. [21] R. Tsarky, M. Kalbacova, U. Hempel, et al., Biomaterials 28 (2007) 806–813. [22] C. Treves, M. Martinesi, M. Stio, et al., J. Biomed. Mater. Res. A 92A (2010) 1623–1634. [23] O. Zinger, K. Anselme, A. Denzer, et al., Biomaterials 25 (2004) 2695–2711. [24] H.J. Kim, S.H. Kim, M.S. Kim, et al., J. Biomed. Mater. Res. A 74A (2005) 366–373. [25] L. Montanaro, C.R. Arciola, D. Campoccia, et al., Biomaterials 23 (2002) 3651–3659. [26] C. Fleury, A. Petit, F. Mwale, et al., Biomaterials 27 (2006) 3351–3360. [27] M. Amaral, A.G. Dias, P.S. Gomes, et al., J. Biomed. Mater. Res. A 87A (2008) 91–99. [28] I. Milosev, M. Metikos-Hukovic, H.H. Strehblow, Biomaterials 21 (2000) 2103–2113. [29] Barbara Nebe, L. Müller, F. Lüthen, et al., Acta Biomater. 4 (2008) 1985–1995. [30] L. Trentani, F. Pelillo, F.C. Paversi, et al., Biomaterials 23 (2002) 2863–2869. [31] J.C. Wataha, C.T. Hanks, Z. Sun, Dent. Mater. 10 (1994) 156–161. [32] A. Billiau, J.J. Cassiman, D. Willems, M. Verhelst, H. Heremans, Oncology 3 (1975) 257–272. [33] C.J. Krikpatrick, C. Mittermayer, J. Mater. Sci. Mater. Med. 1 (1990) 9–13. [34] J.M. Clover, M. Cowen, Bone 15 (1994) 585–591.
2121
[35] R.K. Sinha, R.S. Tuan, Bone 18 (1996) 451–457. [36] M.C. Siebers, P.J. ter Brugge, X.F. Walboomers, J.A. Jansen, Biomaterials 26 (2005) 137–146. [37] E. Ruoslahti, M.D. Pierschbacher, Science 238 (1987) 491–497. [38] M. Laitinen, T. Halttunen, L. Jortikka, et al., Life Sci. 64 (1999) 847–858. [39] A. Piattelli, A. Scarano, M. Corigliano, M. Piattelli, Biomaterials 17 (1996) 1443–1449. [40] A.M. Ferreira, P. Gentile, V. Chiono, G. Ciarleli, Acta Biomater. 8 (2012) 3191–3200. [41] C. Roehlecke, M. Witt, M. Kasper, et al., Cells Tissues Organs 168 (2001) 178–187. [42] U. Geissler, U. Hempel, C. Wolf, et al., J. Biomed. Mater. Res. 51 (2000) 752–760. [43] M. Ask, Lausmaa, J.B. Kasemo, Appl. Surf. Sci. 35 (1988–89) 283–301. [44] S.J. Kerber, J. Vac. Sci. Technol. 13 (1995) 2619–2623. [45] I. Milošv, M. Metikoš-Huković, Strehblow, Biomaterials 21 (2000) 2103–2113. [46] D.A. Puleo, A. Nanci, Biomaterials 20 (1999) 2311–2321. [47] E. Eisenbarth, D. Velten, L. Schenk-Meuser, et al., Biomol. Eng. 19 (2002) 243–249. [48] J.C. Wataha, P.E. Lockwood, A. Schdle, J. Biomed. Mater. Res. 52 (2000) 360–364. [49] N.J. Hallab, C. Vermes, C. Messina, et al., J. Biomed. Mater. Res. 60 (2002) 420–433. [50] J.C. Hornz, A. Lefèvre, D. Joly, H.F. Hildebrand, Biomol. Eng. 19 (2002) 103–117. [51] Z.L. Sun, J.C. Wataha, C.T. Hanks, J. Biomed. Mater. Res. 34 (1997) 29–37. [52] N.J. Hallab, S. Anderson, M. Caicedo, et al., J. Biomed. Mater. Res. A 74A (2005) 124–140. [53] M. Hisbergues, S. Vendeville, P. Vendeville, J. Biomed. Mater. Res. B 88B (2009) 519–529. [54] Y. Josset, Z. Oum'Hamed, A. Zarrinpour, et al., J. Biomed. Mater. Res. 47 (1999) 481–493. [55] R. Depprich, H. Zipprich, M. Ommerborn, et al., Head Face Med. 4 (2008) 30. [56] S. Hiromoto, A.P. Tsai, M. Sumita, T. Hanawa, Mater. Trans. 42 (2001) 656–659. [57] M.L. Morrison, Buchanan, R.V. Leon, C.T. Liu, B.A. Green, P.K. Liaw, J.A. Horton, J. Biomed. Mater. Res. 74A (2005) 430–438. [58] L. Liu, C.L. Qiu, Q. Chen, K.C. Chan, S.M. Zhang, J. Biomed. Mater. Res. A 86A (2008) 160–169. [59] W. He, A. Chuang, Z. Cao, P.K. Liaw, Metall. Mater. Trans. 41A (2010) 1726–1734. [60] Y.B. Wang, Y.F. Zheng, S.C. Wei, M. Li, J. Biomed. Mater. Res. B 96B (2010) 34–46. [61] H.H. Huang, Y.S. Sun, Y.S. Wu, C.P. Liu, P.K. Liaw, K. Wu, Intermetallics 30 (2012) 139–143.
Contents lists available at SciVerse ScienceDirect
Materials Science and Engineering C journal homepage: www.elsevier.com/locate/msec
Zr61Ti2Cu25Al12 metallic glass for potential use in dental implants: Biocompatibility assessment by in vitro cellular responses Jing Li a, Ling-ling Shi b, Zhen-dong Zhu b, Qiang He b, Hong-jun Ai a,⁎, Jian Xu b,⁎⁎ a b
School of Stomatology, China Medical University, 117 Nanjing North Sreet, Shenyang, 110002, China Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang, 110016, China
a r t i c l e
i n f o
Article history: Received 23 November 2012 Accepted 15 January 2013 Available online 20 January 2013 Keywords: Cytotoxicity Biocompatibility Osteoblast Metallic glass Zirconium
a b s t r a c t In comparison with titanium and its alloys, Zr61Ti2Cu25Al12 (ZT1) bulk metallic glass (BMG) manifests a good combination of high strength, high fracture toughness and lower Young's modulus. To examine its biocompatibility required for potential use in dental implants, this BMG was used as a cell growth subtract for three types of cell lines, L929 fibroblasts, human umbilical vein endothelial cells (HUVEC), and osteoblast-like MG63 cells. For a comparison, these cell lines were in parallel cultured and grown also on commercially pure titanium (CP-Ti) and Ti6–Al4–V alloy (Ti64). Cellular responses on the three metals, including adhesion, morphology and viability, were characterized using the SEM visualization and CCK-8 assay. Furthermore, real-time RT-PCR was used to measure the activity of integrin β, alkaline phosphatase (ALP) and type I collagen (COL I) in adherent MG63 cells. As indicated, in all cases of three cell lines, no significant differences in the initial attachment and viability/proliferation were found between ZT1, CP-Ti, and Ti64 until 5 d of incubation period. It means that the biocompatibility in cellular response for ZT1 BMG is comparable to Ti and its alloys. For gene expression of integrin β, ALP and COL I, mRNA level from osteoblast cells grown on ZT1 substrates is significantly higher than that on the CP-Ti and Ti64. It suggests that the adhesion and differentiation of osteoblasts grown on ZT1 are even superior to those on the CP-Ti and Ti64 alloy, then promoting bone formation. The good biocompatibility of ZT1 BMG is associated with the formation of zirconium oxide layer on the surface and good corrosion-resistance in physiological environment. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Chemically similar to titanium, zirconium as an endosseous implant exhibits good biocompatibility, as indicated by both in vitro [1,2] and in vivo assessments [3]. Even if considering the inevitability of metal ions release during biocorrosion, toxicity of Zr ions is acknowledged to be minimal due to the lack of combination with biomolecules [4]. However, in the absence of prominent advantages in mechanical properties and corrosion resistance, whether the Zr and its alloys are adequate as biomedical implants remains inconclusive [5]. In contrast to the conventional crystalline metals, metallic glasses (or amorphous alloys) manifest substantially uniform microstructure, without defects such as dislocation and grain boundary. Periodic atomic ordering arrangement in metallic glass only occurs in shortrange rather than in long-range like crystalline solids. Consequently, glassy/amorphous alloys exhibit many unique properties, such as high yield strength, large elastic strain (~ 2%) and excellent corrosion resistance. In the light of these attractive features, a considerable attention is paid to the potential of Zr-based bulk metallic glasses ⁎ Corresponding author. Tel.: +86 24 22891420. ⁎⁎ Corresponding author. Tel.: +86 24 23971950; fax: +86 24 23971215. E-mail addresses: [email protected] (H. Ai), [email protected] (J. Xu). 0928-4931/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.msec.2013.01.033
(BMGs) as biomedical implants [6–9]. Recently, a new Zr-based BMG, Zr61Ti2Cu25Al12 (designated as ZT1 hereafter), was developed [10,11]. In comparison with the previously-developed BMGs, this alloy is not only chemically free from the toxic elements such as nickel, cobalt and beryllium, but also has unique mechanical properties such as low Young's modulus (E = 83 GPa) and high fracture toughness (KJIC = 130 MPa√m). In this sense, it is of interest if such an “amorphous Zr” can be a candidate material for the endosseous implants or hard-tissue prostheses. Currently, titanium and its alloys, commercially pure Ti (CP-Ti) and Ti–6Al–4V (Ti64) as the representative, have been widely used in clinic, including usage of bone plates, screws, and pins for oral and maxillofacial reconstruction as well as dental root implants [12–14]. However, significant mismatch in Young's modulus of Ti (E = 110 GPa) with that of the bone (10–30 GPa) yields a “stress shielding effect” [15,16]. This has been identified as a major reason for implant failure [17]. From the materials perspective, for most crystalline metals, reduction of the modulus is usually accompanied by a sacrifice in strength. As noticed, Young's modulus of the ZT1 BMG is about 20% lower than that of Ti and its alloys, more proximal to that of the bone, together with a large elastic strain limit. It is expected to reduce the stress shielding effect, then to prevent osteolysis under loading service.
2114
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
As well documented [18], the biocompatibility of a material is straightforward related to cell response on contact with the implant surface. Cell adhesion, spreading and proliferation on the implant surface are essential events for differentiation of bone cells before bone tissue formation. In the present work, biocompatibility of the ZT1 BMG was assessed by in vitro cytotoxicity testing. To this end, three representative cell lines are selected, including the mouse fibroblasts L929 [19,20], human umbilical vein endothelial cells (HUVEC) [21,22], and osteoblast-like MG63 cells [23–27]. These differentiated cell lines are widely used for in vitro biocompatibility evaluation of materials. In addition, gene expressions of three differentiation proteins/ markers from MG63, integrin β, alkaline phosphate (ALP) and type I collagen (COL I) were investigated to evaluate cell differentiation. For purpose of comparison, CP-Ti and Ti64 are investigated in parallel as their cytocompatibility has been well understood and due to their maturated clinical application as typical dental implant materials.
For the L929 fibroblast, a RPMI 1640(Gibco BRL) supplemented with 10% FBS (TBD, Tianjin, China) was used as culture medium. All cultures were performed under a humidified 5% CO2 air atmosphere at 37 °C. The medium was changed every 2–3 days. Primary cultures were subcultured with trypsin-EDTA solution (0.05% trypsin, 0.25% EDTA) after reaching 70%–80% confluence. For subculture, metallic disks were sterilized with exposure to UV radiation for 1 h on both sides before using them as cellular growth support. 2.4. Cell morphology observation After incubation for 2, 4, and 6 h, non-adherent cells were removed by rinsing in phosphate buffer solution (PBS). The cells attached on the surface of disks were then fixed with 4% formaldehyde. The samples with fixed cell were washed with distilled water, and dehydrated using a gradation series of ethanol/distilled water mixtures. With critical point drying and gold coating, morphology of cells on the disks was observed using a scanning electron microscopy (SEM; LEO Supra 35, Heidenheim, Germany).
2. Materials and methods 2.5. Cell viability 2.1. Materials fabrication To fabricate the Zr61Ti2Cu25Al12 BMG samples, master alloy ingots with the nominal composition of Zr61Ti2Cu25Al12 (in atomic percentage, or Zr–25Cu–12Al–2Ti in weight percentage) were prepared by arc melting. Elemental pieces with purity higher than 99.9% were used as starting materials. The ingot was re-melted, and then cast into a copper mold to form cylindrical rods of 6 mm in diameter and about 60 mm in length. Amorphous feature of as-cast rod samples was characterized by using X-ray diffraction (XRD). The thermal, elastic and mechanical properties of this BMG were presented elsewhere [10,11]. As-cast BMG rods were cut into disk of about 2-mm thickness. For the CP-Ti and Ti64 alloy (medical grade), disk samples of 6 mm in diameter and about 2 mm in thickness were taken from the as-received plates by electro-erosion cutting. The disk samples were wet-ground using silicon carbide abrasive paper until 1200 grit, then finally polished to a mirror finish with diamond paste. The samples were cleaned in an ultrasonic bath sequentially using acetone, ethanol, and double distilled water for 10 min in each solution. 2.2. Surface roughness characterization and XPS analysis The surface arithmetic average roughness parameter Sa (μm) with an area of 65 μm × 65 μm for the ZT1 disks was measured using a 3D Measuring Laser Microscope LEXT OLS4000 (Olympus, USA). Sa is the arithmetic average of 3D roughness. It was determined by taking the mean value of three individual measures for each disk. Chemical composition of the ZT1 disk surfaces was analyzed using an ESCALAB250 X-ray photoelectron spectrometer (XPS, Thermo VG, USA). The disks were examined under two conditions, as-polished and cell-cultured for 14 days. Measurements were performed with a monochromated X-ray source of Al Kα. Binding energies were calibrated using carbon contamination with a C 1s peak value of 284.6 eV. Depth profiles of sample surface were established by in situ XPS ion beam sputtering with argon. The XPS spectra were analyzed using XPSPEAK surface chemical analyses software.
Cell viability was measured by Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan) assay, resulting in the cellular conversion of the tetrazolium salt into a soluble formazan dye. The cells were cultured on three investigated materials in 96-well plates (Costar, USA) at a density of 20,000 cells cm −2. The plastic is used as control. After culturing for 4 h, 1 d, 2 d, 3 d, and 5 d, specimens with seeded cells were rinsed three times with sterile PBS, and transferred to fresh 96-well plates. Subsequently, culture medium with 10% CCK-8 was introduced to the samples in a separate volume of 0.7 ml. Then, cells were incubated for 1 h according to the instructions. Finally, colorimetric measurement of the formazan dye was performed on a spectrophotometer (NANO 2000, Thermo, USA) with an optical density reading at 450 nm. Five parallel replicates were performed. 2.6. Real time RT-PCR Gene expression of integrin β (cultured for 4 h and 1 d) and ALP (cultured for 4, 7 and 14 d), and COL I (cultured for 4, 7 and 14 d) was determined through a real-time TaqMan RT-PCR (ExicyclerTM 96, BIONEER, South Korean) assay. GADPH (Glyceraldehyde-3-phosphate dehydrogenase) was used as a housekeeping gene. The MG63 cells were cultured on three materials in 96-well plates at a density of 20,000 cells cm−2, with the cells directly cultured on plastic (polystyrene) as control. After incubation for 4 h, 1 d, 4 d, 7 d and 14 d, the medium was aspirated, and the specimens were gently rinsed with PBS three times. The viable cells were harvested using 0.25% trypsin-EDTA. The following protocol was applied: (1) mRNA extraction, a total RNA extraction kit (TianGen Biotech, Beijing, China) was used; (2) spectrophotometric quantification of RNA was achieved by measuring the absorbance with a spectrophotometer (NANO 2000, Thermo, USA); (3) reverse transcription (RT), with a TIANScript RT Kit (TIANScript cDNA first strand synthesis kit, TianGen Biotech, Beijing, China); (4) polymerase chain reaction (PCR), the resulting cDNA is then amplified using the SYBR green method (TianGen Biotech, Beijing, China). The above steps were operated strictly in accordance with the manufacturer's instructions. Primer (Sangon, Shanghai, China) sequences are listed in Table 1.
2.3. Cell cultures 2.7. Statistical analysis The HUVEC (American Type Culture Collection, Manassas, VA, USA:CRL-1730) and MG63 cells (ATCC, CRL-1427) were cultured in high-glucose Dulbecco's modified Eagle's medium (DMEM) (Gibco BRL Life Technologies, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (TBD, Tianjin, China) and 1% penicillin/streptomycin.
All testing were repeated at least three times. Data are expressed as means ± standard deviation (SDs). Statistical analysis was performed using a software named as Statistical Package for the Social Sciences (SPSS) version 14.0 (SPSS Inc. Chicago, IL, USA). Statistical comparisons
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
2115
were made by one-way ANOVA analysis for independent samples. In all statistical evaluations, p b 0.05 is considered to be statistically significant.
3. Results 3.1. Surface characterization of ZT1 BMG Fig. 1 (a) and (b) shows surface topographies observed under optical microscope for the ZT1 BMG disks of the as-polished and cultured with MG63 for 14 d, respectively. For the as-polished ZT1 disk, its surface roughness characterized by the Sa is determined to be 0.014 ± 0.005 μm, while the Sa for the disk cultured with MG63 for 14 d increases to 0.026 ± 0.004 μm. Subjected to cell cultivation, subtle increase in the surface roughness of the sample is probably caused by corrosion exposed in the cell culture medium. Fig. 2 shows XPS surveys of sample surfaces of the ZT1 BMG disks, in the cases of the as-polished and cultured with MG63 for 14 d. For the as-polished sample, primary peaks for the outermost surface are identified as the Zr 3d, Al 2s, Cu 2p, Ti 2p, O 1s and C 1s, as seen in Fig. 2. The detected C 1s peak in the spectrum results from the carbon as contaminant. Fig. 3 (a)–(d) display the XPS spectra in the two cases for the Zr 3d, Al 2s, Cu 2p and Ti 2p. As indicated, in contrast to the sample without cell culture, composition in the surface for the cultured sample is depleted in Al, Cu and Ti, besides the remaining Zr 3d XPS peaks, as seen in Fig. 3 (a). To determine the thickness of the passive film on the surface, the samples were cleaned by Ar-sputtering at several depths for XPS analysis. As the representative, Fig. 4 (a)–(d) displays the XPS spectra of the as-polished and cultured ZT1 disk after cleaning at a depth of about 2 nm. As indicated, the peaks of Zr 3d, Al 2s, Cu 2p, and Ti 2p are detected in the XPS spectra [28], when removing the “native” oxide layer away. By deconvoluting the spectra for each element at different sputtering depths, the states and distribution of alloying components at the surface layer are revealed. Depth profiles of the elements in the alloys for ZT1 before and after cell culturing are presented in Fig. 5 (a) and (b), respectively. The area under the curve in the figure represents the concentration for each species. As an approximation, the thickness of oxide films is estimated with a depth at the half of the oxygen concentration. Then, the thickness of film increases from 4 nm to 9 nm after cell culturing, as indicated by the dash lines in Fig. 5 (a) and (b). With increasing the sputtering depth, concentrations of components at metallic state gradually increases until the nominal concentrations are reached. For the as-polished samples, the outermost surface is composed of metallic Zr 0, Zr 4+, metallic Cu 0, Al 3+ and Ti 4+, as seen in Fig. 5 (a). Subjected to cell culture, the ZrO2 phase becomes predominant on the surface, indicating that the Zr is preferentially oxidized, to form the surface film, as shown in Fig. 5 (b). In addition, Cu dissolved in the oxide layer is detectable as well.
Fig. 1. Surface topographies observed with laser-scanning confocal microscope for Zr61Ti2Cu25Al12 BMG disks. (a) as-polished and (b) after culture for 14 d with MG63 cells.
Table 1 Primer sequences used in gene expression analysis with real-time PCR. Name
Sequence(5′¬3′)
Length
Tm
Size
Integrinβ F Integrinβ R Collagen type I F Collagen type I R ALP F ALP R GAPDH F GAPDH R
TGAAGGGCGTGTTGGTAGAC GCCGCACTCTCCATTGTTACT AAACATCGGATTTGGGGAACG CACATCAAGACAAGAACGAGGTAG CCGTGGAACATTCTGGATCTG CTGGTGGTCTTGGAGTGAGT GAAGGTCGGAGTCAACGGAT CCTGGAAGATGGTGATGGGAT
20 21 21 24 21 20 20 21
54.17 54.86 61.5 58.6 60.1 54.1 58.7 60.8
121 121 120 120 193 193 224 224
Fig. 2. Typical XPS surveys of the outermost surface for Zr61Ti2Cu25Al12 BMG disk before and after culture for 14 d with MG63 cell.
2116
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
Fig. 3. XPS spectra of the outermost surface for Zr61Ti2Cu25Al12 BMG disk before and after culture for 14 d with MG63 cells. (a) Zr 3d, (b) Al 2s, (c) Cu 2p, and (d) Ti 2p.
Fig. 4. XPS spectra at Ar-sputtering cleaned depth of about 2 nm for Zr61Ti2Cu25Al12 BMG disk before and after culture for 14 d with MG63 cells. (a) Zr 3d, (b) Al 2s, (c) Cu 2p, and (d) Ti 2p.
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
2117
3.2. Cell morphology in SEM observation Fig. 6 (a)–(c) illustrates SEM images of the MG63 cells attached on three investigated metal substrates after seeding for 6 h. Corresponding high-magnification images in each case are presented in Fig. 6 (d)–(f). As seen in Fig. 6 (a), the cells adhere to the ZT1 metallic glass exhibit typical polygonal morphology covered about 60%–80% of the growth area. In a high-magnification observation as shown in Fig. 6 (d), the cell spreading is quite extensive, displaying numerous pseudopodia with distinct terminal protein spots. It is indicative of good adhesion on the substrate. Moreover, overlapping of adjacent cells is visible as well, indicating the healthy growth. In contrast, the morphology of the cells grown on the CP-Ti and Ti64 substrates is similar to the case of ZT1 BMG, as well as to the findings in previous work for the identical materials [24,29]. It implies that, at least at the adhesion stage, no significant difference between amorphous Zr and crystalline Ti-based metals was found for the cellular response. Furthermore, Fig. 7 (a)–(c) and (d)–(f) shows the high-magnification SEM micrographs of morphologies of the L929 and HUVEC cell cultured for 2 h on the ZT1 BMG and the CP-Ti and Ti64, respectively. L929 cells cultured on three different materials present spindle-shaped morphology, whereas HUVEC cells show cobble-stone shape. Both of them display well-spreading and good adhesion on the three sorts of substrates, with their characteristic shapes and numerous filopodias and lamellipodias. Thus, in terms of morphologies of three cell lines, it is suggested that the ZT1 BMG manifests good adhesion ability comparable to the Ti metals.
3.3. Cell viability and proliferation
Fig. 5. Schematic illustration of states and distribution of component elements at surface layer of Zr61Ti2Cu25Al12 BMG disk as a function of sputtering depth. (a) as-polished and (b) after culture for 14 d with MG63 cells.
Fig. 8 displays dependency of cell viability characterized by optical density (OD) value on incubation periods for three cell lines. In all cases, the counted number of viable cells gradually increases with extending the incubation time. As seen in Fig. 8 (a), for the L929 cell after 4 h of incubation, OD value of ZT1 BMG is significantly higher than that of the CP-Ti and Ti64. At 1 d, OD value for the different growth surfaces is nearly identical. However, OD value at 2, 3, and 5 d for ZT1 BMG is slightly higher than that of the CP-Ti and Ti64, but no difference exists between CP-Ti and Ti64. In the case of
Fig. 6. SEM micrographs of MG63 cell morphology after culture for 6 h on (a) Zr61Ti2Cu25Al12, (b) CP-Ti and (c) Ti64. (d), (e) and (f) are high-magnification images of (a), (b) and (c), respectively.
2118
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
Fig. 7. SEM micrographs of L929 and HUVEC cell morphology after culture for 2 h of on (a) and (d) Zr61Ti2Cu25Al12 BMG, (b) and (e) CP-Ti, (c) and (f) Ti64, respectively.
HUVEC cells, there is no difference between the OD values of three metals, incubated from 4 h to 2 d, as shown in Fig. 8 (b). At 3 d, the OD value of cell growth on the Ti64 is significantly higher than those on the CP-Ti and ZT1, but no difference between the latter two groups. Nevertheless, the OD values of all materials go back to similar level at 5 d. For the MG63 cell, OD values of cell growth on ZT1 BMG incubated up to 2 d are significantly higher than those on the CP-Ti and Ti64. The OD values of all materials are similar at 3 d, whereas the OD value at 5 d for the ZT1 is significantly higher than that for two Ti metals, but no difference between the latter two groups, as shown in Fig. 8 (c). Consequently, we can conclude that, independent of the cell lines, the viability and proliferation of cell cultured on the ZT1 are completely comparable to those on the CP-Ti and Ti64. In addition, it is noteworthy that, after seeding, proliferation trends for three cell lines are substantially the same, with a unidirectional feature. They rapidly attach to the surfaces, and then the number of viable cells increases gradually, as seen at 2 d. Doubling the cell number happens at 5 d, when the disk surfaces are fully covered by proliferous cells, accompanied by cell confluence and a maximum of OD values. As indicated, no detectable difference between three metals and polystyrene as a control is present. It means that these metals have no deleterious effects on cell proliferation. Moreover, it is interesting to note that the cell proliferation rate exhibits the dependency of cell lines. Among the three cell lines, HUVEC is the fastest, while the MG63 is slowest, and the L929 is between them. In fact, it is noticed by Trentani et al. that, when grown either on TiMoZrFe alloy or on plastic control, proliferation capacity of osteoblasts is slower than that of human dermal fibroblasts [30]. 3.4. Gene expression for osteoblastic differentiation of MG63 Fig. 9 (a)–(c) illustrates gene expression of three differentiation proteins of MG63, integrin β, ALP and COL I, which are relative change evaluated by real-time RT-PCR with respect to the plastic. The mRNA levels of target genes are expressed as a normalized value with control material (polystyrene). Comparative mRNA levels were analyzed statistically by using one-way ANOVA (SPSS version 14.0). Differences were admitted when statistical significance appears at p b 0.05. As shown in Fig. 9 (a), mRNA level of integrin β at 4 h, as an early adhesive protein, is more active with respect to the level at 1 d. In addition, mRNA level of integrin β for the cells adherent on the ZT1 at
4 h is significantly higher than those on the CP-Ti and Ti64, even on the plastic. It is noteworthy that higher level of integrin β mRNA is consistent with the morphology of well-spreading phenotype of MG63 on ZT1, as seen in Fig. 6 (a) and (d), since the formation of integrin receptor plays an essential role in cell spreading and adhesion. Nevertheless, at 1 d, mRNA level of integrin β from the ZT1 BMG is comparable to that from CP-Ti, but superior to that from Ti64 alloy, as seen in Fig. 9 (a). For the ALP level, no significant difference between cells adherent of three investigated metals is present at 4 d, as shown in Fig. 9 (b). However, at the 7 d and 14 d, mRNA level of ALP from the ZT1 BMG is much higher than those from the CP-Ti and Ti64. Furthermore, mRNA level of COL I for the cells grown on ZT1 is significantly higher than those on the CP-Ti and Ti64 as well, which happens at all of three time points, as seen in Fig. 9 (c). 4. Discussion As the in vitro assessment, cellular response has been a powerful tool as preliminary assays to evaluate biocompatibility of a material that is potentially used as implant. In the current work, three cell phenotypes were selected to examine their interaction with our ZT1 BMG. It is desirable to provide more understandings for the response from relevant tissues as dental implants, and to address possible difference in cellular responses to materials [31]. Among them, fibroblasts allow us to examine the basal cytocompatibility of a biomaterial, which relates to the common cellular functions. Moreover, this phenotype is sensitive to the metal ions, as well as with high metabolic activity [31]. MG63 cells, originally isolated from a human sarcoma [32], have been widely used for immuno- and biochemical studies of cell response to metallic implant surfaces, as initially recommended by Krikpatrick and Mittermayer [33]. They share several similarities with isolated human bone-derived cells [34]. Endothelial cells, here we used HUVEC, are important in inflammation response by secreting cytokines, expressing surface adhesion molecules for attraction and attachment of leucocytes [21]. As shown in Figs. 6 and 7, in terms of morphology at the cell adhesion stage, no significant differences between the grown-on metal subtracts were found, which is irrespective of whatever cell lines were used. For the cell proliferation rates, as shown in Fig. 8, at the incubation time of 5 d, the rate for MG63 cells grown on ZT1 is higher than on CP-Ti and Ti64, whereas no difference is presented in L929 and HUVEC between ZT1 and two Ti materials.
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
Fig. 8. Cell viability/proliferation measured with CCK-8 assay of cells cultured on Zr61Ti2Cu25Al12 BMG, CP-Ti and Ti64 after 4 h, 1 d, 2 d, 3 d, and 5 d, with a control cultured on plastic. (a) L929, (b) HUVEC and (c) MG63.
Furthermore, as well documented, integrin is the most important transmembrane receptor in cell binding process [35–37], which contains two different subunits: α and β. Osteoblast interacts with the substrate through integrin receptor. The integrin forms the linkage between the extracellular matrix and the interior of the cell. In the present work, as shown in Fig. 8 (a), higher activity of integrin β is observed for the culture on ZT1 with respect to the CP-Ti and Ti64. It reflects that the ZT1 BMG is much more amenable for cell attachment in contrast to the Ti metals. ALP activity is an indicator of early osteogenic differentiation, bone formation and matrix mineralization [38,39]. COL I is the most abundant protein present in different connective tissues especially in skin and bone [40]. It not only plays a pivotal role of collagen in modulating cell growth and differentiation [41], but also serves as a basis for the mineral scaffold [42]. As indicated in Section 3.4, activity of the ALP and COL I mRNA for MG63 cells grown on ZT1 BMG is significantly
2119
Fig. 9. Quantitative analysis of Real-time PCR for MG63 cells cultured on Zr61Ti2Cu25Al12 BMG, CP-Ti, and Ti64 as well as plastic as a control at several incubation periods. Relative amounts of (a) integrin β, (b) ALP, and (c) COL I (*pb 0.05).
higher than those on both CP-Ti and Ti64. It suggests that in the sense of osseointegration, ZT1 BMG is quite promising. Further investigation using animal models to examine the bone-growth scenarios around the ZT1 prototype implant is on-going work. As well-known, good bioactivity of titanium and its alloys is in great part attributed to the formation of a passive oxide film on the metallic surface [43–45]. For the Ti64 alloy, the oxide layer that spontaneously forms upon air exposure was predominantly TiO2, and its thickness varied from 2 nm to 4 nm [45]. The CP-Ti has an oxide thickness of 2–6 nm before implantation, whereas films on implants retrieved from human tissues are two- to three-times thicker [46]. Though the cytotoxicity investigation of an alloy with high content of toxic element vanadium (Ti1.5Al25V), Eisenbarth et al. [47] found that the cell reaction is influenced only by thin titanium oxide surface
2120
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121
layer and not by the composition of the bulk material. The thick (~ 100 nm) and stable oxide layer on the Ti alloy is able to shield the cell from toxic elements. In the alloy we investigated, amorphous Zr61Ti2Cu25Al12, elements Cu and Al are necessary to maintain robust glass-forming ability for fabricating the bulk material [10]. However, it is well recognized that the Cu ions are toxic [48–50]. Using MG-63 osteoblast, Hallab et al. [49] indicate that the concentrations required to decrease viability by 50% (LC50) for Cu ions are approximately in a range of 0.05– 0.3 mM, while the Al ions are moderately toxic, with a concentration range of 0.3–4.0 mM for LC50. Sun et al. [51] found little cytotoxicity of Al in ROS 17/2.8 osteoblast-like cells. The Al significantly suppressed ALP gene expression, but did not alter ALP activity in ROS cells. In addition, as indicated by Hallab et al. [52], the response of peri-implant cells such as osteoblasts, fibroblasts and lymophocytes to metal challenge is primarily determined by composition and concentration, not by cell type. On the other hand, it has been well recognized that corrosion-resistance of metallic materials in a physiological environment is a key issue for its biocompatibility, which determine the amount of undesired metal ions/corrosion products released. In the current work, we found that the oxide layer predominantly composed of zirconium oxide spontaneously forms on the surface of Zr61Ti2Cu25Al12 BMG, when it is exposed to air, together with Al0, Al2O3 and Ti0, TiO2 as trace components, as indicated in Section 3.1. During the cell culture, only subtle corrosion happened in the BMG surface, without visible surface pitting, but accompanied by an increased thickness of oxide layer up to ~9 nm. This means that the amount of cytotoxic species, such as Cu and Al ions, released from the alloy surface remains quite tolerable for cell healthy survival. As a matter of fact, Zr oxide (zirconia) possesses good biocompatibility and osseoconductivity and has been used in total hip replacement and dental implantology [53–55]. Consequently, although “toxic” elements such as Cu and Al are present in our ZT1 BMG, stable oxide layer on its surface and good corrosion resistance in physiological environment plays a role to shield the release of toxic metal ions, which provides its good biocompatibility, like TiO2 layer in the case of Ti and its alloys. Moreover, as indicated by electrochemical evaluation [56–58], Zr-based BMGs manifest good corrosion resistance under simulated physiological condition, besides lower pitting corrosion resistance in contrast to the Ti and Ti64. Furthermore, cytotoxicity through in vitro assessments for Zr-based BMGs with different chemical compositions was examined in several studies [6,9,58–61]. For a purpose of comparison, cell lines, species and phenotypes used in these studies as well as the investigated alloys Table 2 Cell lines, species, and phenotypes currently used for cytotoxicity study of various Zr-based bulk metallic glasses.
are summarized in Table 2. For the Zr58Cu22Fe8Al12 BMG, Buzzi et al. [6] found that a natural layer of zirconium oxide layer forms on the surface, with a thickness of 7–8 nm, and small amount of Cu is included in the oxide layer, or lies on the surface. Good cell growth for MC3T3 cells is observed. No difference in the cytotoxic properties is present between Fe-containing Bio 1 and Ni-containing Vit BMGs. He et al. [59] indicated that in comparison with Ti alloy, the favorable attachment of osteoblasts on the Zr-base BMG surface, which is attributed to that the BMG surface is relatively more hydrophobic than the surface of Ti alloy. They found that the Zr-based BMG provides a favorable substrate for osteoblast differentiation and matrix production, which is reflected by a higher ALP level of the cells on the Zr BMG surfaces with respect to that on the Ti alloy surface. It is in agreement with the findings in the present work, as seen in Fig. 9 (b). Using cell lines of L929 and NIH 3T3, Wang et al. [60] presented that the extracts from the LM106, LM1 and LM1b Zr-based BMGs had no cytotoxicity. Nevertheless, Cu ion release associated with pitting corrosion gives rise to a decrease proliferation rate of LM106 and LM1 in comparison with the LM1b. Recently, Huang et al. [61] showed that ternary Zr50Cu43Al7 BMG was nontoxic in terms of cytotoxicity assessment with human mesenchymal stem cells (hMSC). Compared with Ti metal, Zr50Cu43Al7 BMG had a high level of protein adsorption and better cell adhesion and cell migration. In addition, it was observed that the total ion release from the BMG sample after 1 day of immersion in cell culture medium was below 100 ppb, which is comparable to that from the Ti sample. In general, in the light of cytotoxicity assessment, it is suggested that biocompatibility of Zr-based BMGs, no matter what alloy composition is selected, is tolerable, even comparable to the Ti metals, due to the formation of Zr oxide layer on the surface. To minimize the amount of metal ion release, enhancing the pitting-corrosion resistance in physiological environment by the alloy design or surface modification remains a vital issue. Further investigations on the hemocompatibility and genotoxicity, and osseointegration by in vivo animal testing are necessary to understand the biocompatibility of Zr-based BMGs from multiple perspectives. 5. Conclusions In terms of cellular responses for three cell phenotypes, L929, HUVEC and MG63, the phenomenological behavior of cells such as attachment, adhesion, spreading and proliferation for the Zr61Ti2Cu25Al12 (ZT1) metallic glass is substantially comparable to the CP-Ti and Ti64 alloy. As indicated by osteoblast gene expression of integrin β, alkaline phosphate and type I collagen, mRNA level for the cells grown on ZT1 substrates is much higher than those on the CP-Ti and Ti64 alloy. It suggests that the adhesion and differentiation of osteoblasts grown on ZT1 are even superior to those on the CP-Ti and Ti64 alloy, therefore promoting bone formation. The good biocompatibility of ZT1 BMG is attributed to the formation of zirconium oxide layer on the surface and good corrosion-resistance in physiological environment. Further investigations on the hemocompatibility and genotoxicity, and osseointegration by in vivo animal testing are currently in progress.
Subtract alloy
Cell line
Species Phenotype
Res.
Zr58Cu22Fe8Al12 (Bio 1) Zr58.5Cu15.6Ni12.8Al10.3Nb2.8 (Vit106a) Zr55Cu30Ni5Al10 (Zr0.55Cu0.30Ni0.05Al0.10)99Y1 Zr60Nb5Cu22.5Pd5Al7.5 Zr60Nb5Cu20Fe5Al10 Zr62Cu15.5Ni12.5Al10 Zr57Cu15.4Ni12.6Al10Nb5 (LM106) Zr41Ti14Cu12Ni10Be23 (LM1) Zr44Ti11Cu10Ni10Be25 (LM1b) Zr50Cu43Al7
3T3
Mouse
Fibroblast
[6]
MC-3T3-E1 Mouse
Pre-osteoblast
[9]
NIH3T3
Fibroblast
[58]
Pre-osteoblast Fibroblast Fibroblast
[59] [60]
The authors gratefully acknowledge the stimulating discussions with Prof. H.H. Huang. This work was supported at SYNL by the National Natural Science Foundation of China under Grant Nos. 51171180 and No. 51001099.
[61]
References
Zr61Ti2Cu25Al12 (ZT1)
Mouse
MC-3T3-E1 Mouse L929 Mouse NIH3T3 Mouse
hMSC L929 HUVEC MG63
Human Mesenchymal stem Mouse Fibroblast Human Umbilical vein endothelial Human Osteoblast-like
This work
Acknowledgment
[1] E. Eisenbarth, D. Velten, M. Muller, et al., Biomaterials 25 (2004) 5705–5713. [2] L. Saldaña, A. Méndez-Vilas, L. Jiang, et al., Biomaterials 28 (2007) 4343–4354. [3] P. Thomsen, C. Larsson, L.E. Ericson, et al., J. Mater. Sci. Mater. Med. 8 (1997) 653–665. [4] T. Hanawa, Mater. Sci. Eng. C 24 (2004) 745–752.
J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121 [5] J.A. Helsen, Y. Missirlis, Biological and Medical Physics, Biomedical Engineering, Biomaterials, 2010, p. 99. [6] S. Buzzi, K.F. Jin, P.J. Uggowitzer, et al., Intermetallics 14 (2006) 729–734. [7] J. Schroers, G. Kumar, T.M. Hodges, et al., JOM 61 (2009) 21–29. [8] M.D. Demetriou, A. Wiest, D.C. Hofmann, et al., JOM 62 (2010) 83–91. [9] L. Huang, Z. Cao, H.M. Meyer, et al., Acta Biomater. 7 (2011) 395–405. [10] Q. He, Y.Q. Cheng, E. Ma, J. Xu, Acta Mater. 59 (2011) 202–215. [11] Q. He, J.K. Shang, E. Ma, J. Xu, Acta Mater. 60 (2012) 4940–4949. [12] K. Yokoyama, T. Ichikawa, H. Murakami, et al., Biomaterials 23 (2002) 2459–2465. [13] L.S. Morais, G.G. Serra, C.A. Muller, et al., Acta Biomater. 3 (2007) 331–339. [14] M.G. Manda, P.P. Psyllaki, D.N. Tsipas, P.T. Koidis, J. Biomed. Mater. Res. B 89B (2009) 264–273. [15] D.R. Sumner, T.M. Turner, R. Igloria, R.M. Urban, J.O. Galante, J. Biomech. 31 (1998) 909–917. [16] B.V. Krishna, S. Bose, A. Bandyopadhyay, Acta Biomater. 3 (2007) 997–1006. [17] D.R. Sumner, J.O. Galante, Clin. Orthop. Relat. Res. 274 (1992) 202–212. [18] K. Anselme, Biomaterials 21 (2000) 667–681. [19] S. Rao, Y. Okazaki, T. Tateishi, T. Ushida, Y. Ito, Mater. Sci. Eng. C 4 (1997) 311–314. [20] M.C. Serrano, R. Pagani, M. Vallet-Regi, et al., Biomaterials 25 (2004) 5603–5611. [21] R. Tsarky, M. Kalbacova, U. Hempel, et al., Biomaterials 28 (2007) 806–813. [22] C. Treves, M. Martinesi, M. Stio, et al., J. Biomed. Mater. Res. A 92A (2010) 1623–1634. [23] O. Zinger, K. Anselme, A. Denzer, et al., Biomaterials 25 (2004) 2695–2711. [24] H.J. Kim, S.H. Kim, M.S. Kim, et al., J. Biomed. Mater. Res. A 74A (2005) 366–373. [25] L. Montanaro, C.R. Arciola, D. Campoccia, et al., Biomaterials 23 (2002) 3651–3659. [26] C. Fleury, A. Petit, F. Mwale, et al., Biomaterials 27 (2006) 3351–3360. [27] M. Amaral, A.G. Dias, P.S. Gomes, et al., J. Biomed. Mater. Res. A 87A (2008) 91–99. [28] I. Milosev, M. Metikos-Hukovic, H.H. Strehblow, Biomaterials 21 (2000) 2103–2113. [29] Barbara Nebe, L. Müller, F. Lüthen, et al., Acta Biomater. 4 (2008) 1985–1995. [30] L. Trentani, F. Pelillo, F.C. Paversi, et al., Biomaterials 23 (2002) 2863–2869. [31] J.C. Wataha, C.T. Hanks, Z. Sun, Dent. Mater. 10 (1994) 156–161. [32] A. Billiau, J.J. Cassiman, D. Willems, M. Verhelst, H. Heremans, Oncology 3 (1975) 257–272. [33] C.J. Krikpatrick, C. Mittermayer, J. Mater. Sci. Mater. Med. 1 (1990) 9–13. [34] J.M. Clover, M. Cowen, Bone 15 (1994) 585–591.
2121
[35] R.K. Sinha, R.S. Tuan, Bone 18 (1996) 451–457. [36] M.C. Siebers, P.J. ter Brugge, X.F. Walboomers, J.A. Jansen, Biomaterials 26 (2005) 137–146. [37] E. Ruoslahti, M.D. Pierschbacher, Science 238 (1987) 491–497. [38] M. Laitinen, T. Halttunen, L. Jortikka, et al., Life Sci. 64 (1999) 847–858. [39] A. Piattelli, A. Scarano, M. Corigliano, M. Piattelli, Biomaterials 17 (1996) 1443–1449. [40] A.M. Ferreira, P. Gentile, V. Chiono, G. Ciarleli, Acta Biomater. 8 (2012) 3191–3200. [41] C. Roehlecke, M. Witt, M. Kasper, et al., Cells Tissues Organs 168 (2001) 178–187. [42] U. Geissler, U. Hempel, C. Wolf, et al., J. Biomed. Mater. Res. 51 (2000) 752–760. [43] M. Ask, Lausmaa, J.B. Kasemo, Appl. Surf. Sci. 35 (1988–89) 283–301. [44] S.J. Kerber, J. Vac. Sci. Technol. 13 (1995) 2619–2623. [45] I. Milošv, M. Metikoš-Huković, Strehblow, Biomaterials 21 (2000) 2103–2113. [46] D.A. Puleo, A. Nanci, Biomaterials 20 (1999) 2311–2321. [47] E. Eisenbarth, D. Velten, L. Schenk-Meuser, et al., Biomol. Eng. 19 (2002) 243–249. [48] J.C. Wataha, P.E. Lockwood, A. Schdle, J. Biomed. Mater. Res. 52 (2000) 360–364. [49] N.J. Hallab, C. Vermes, C. Messina, et al., J. Biomed. Mater. Res. 60 (2002) 420–433. [50] J.C. Hornz, A. Lefèvre, D. Joly, H.F. Hildebrand, Biomol. Eng. 19 (2002) 103–117. [51] Z.L. Sun, J.C. Wataha, C.T. Hanks, J. Biomed. Mater. Res. 34 (1997) 29–37. [52] N.J. Hallab, S. Anderson, M. Caicedo, et al., J. Biomed. Mater. Res. A 74A (2005) 124–140. [53] M. Hisbergues, S. Vendeville, P. Vendeville, J. Biomed. Mater. Res. B 88B (2009) 519–529. [54] Y. Josset, Z. Oum'Hamed, A. Zarrinpour, et al., J. Biomed. Mater. Res. 47 (1999) 481–493. [55] R. Depprich, H. Zipprich, M. Ommerborn, et al., Head Face Med. 4 (2008) 30. [56] S. Hiromoto, A.P. Tsai, M. Sumita, T. Hanawa, Mater. Trans. 42 (2001) 656–659. [57] M.L. Morrison, Buchanan, R.V. Leon, C.T. Liu, B.A. Green, P.K. Liaw, J.A. Horton, J. Biomed. Mater. Res. 74A (2005) 430–438. [58] L. Liu, C.L. Qiu, Q. Chen, K.C. Chan, S.M. Zhang, J. Biomed. Mater. Res. A 86A (2008) 160–169. [59] W. He, A. Chuang, Z. Cao, P.K. Liaw, Metall. Mater. Trans. 41A (2010) 1726–1734. [60] Y.B. Wang, Y.F. Zheng, S.C. Wei, M. Li, J. Biomed. Mater. Res. B 96B (2010) 34–46. [61] H.H. Huang, Y.S. Sun, Y.S. Wu, C.P. Liu, P.K. Liaw, K. Wu, Intermetallics 30 (2012) 139–143.