A DNAzyme sensor based on target-catalyzed hairpin assembly for enzyme-free and non-label single nucleotide polymorphism genotyping

Talanta 167 (2017) 630–637

Contents lists available at ScienceDirect

Talanta journal homepage: www.elsevier.com/locate/talanta

A DNAzyme sensor based on target-catalyzed hairpin assembly for enzymefree and non-label single nucleotide polymorphism genotyping Huiyan Xu, Qiwang Wu, Hong Shen

MARK

⁎

Institute of Microanalytical Systems, Department of Chemistry, Zhejiang University, Hangzhou 310058, China

A R T I C L E I N F O

A BS T RAC T

Keywords: SNP genotyping DNAzyme sensor Target-catalyzed hairpin assembly Microfluidic Chemiluminescence

Single nucleotide polymorphisms (SNPs) are widely existed in human genome and associated with many diseases. Traditional PCR-based methods for SNP genotyping require protein enzyme, precise control of temperature and removal of resultant products, making the whole process labor intensive and time consuming. Although G-quadruplex DNAzyme-based assays provide many advantages over traditional approaches, the relatively low catalytic activity of DNAzyme becomes an unfavorable factor in its application process. Therefore, amplification of DNAzyme for further determination is of great desire in bioanalysis. In this work, we have developed an enzyme-free and non-label DNAzyme sensor for SNP genotyping based on target-catalyzed hairpin assembly (CHA) for DNAzyme amplification. The proposed sensor, carried out on microfluidic chemiluminescence (CL) assay, can sensitively discriminate rs242557 hotspot-SNP, the A/G single-nucleotide variation on human chromosome associated with Alzheimer's disease, with an absolute detection limit of 0.3 fmol.

1. Introduction Genetic variants that regulate gene expression levels influence human disease risk. Single nucleotide polymorphisms (SNPs) are the most abundant forms of genetic variations in the human genome [1]. When SNP occurs, both structure and function of the encoded protein are changed which often lead to common diseases [2]. Therefore, sensitive SNP genotyping is crucial in clinical diagnosis, mutational analysis and gene therapy [3]. It is found rs242557 hotspot SNP [4] increases microtubule associated protein tau level that connected with a series of brain pathologies, especially Alzheimer's disease [5], a most common form of dementia that affecting up to 30 million patients worldwide. Recently in bioanalytical chemistry, particularly for nucleic acid analysis, DNAzyme with its attractive horseradish peroxidase-like activity is expected to be a promising reporter in virtue of its outstanding merits of simple synthesis and excellent thermal stability [6]. Not only can DNAzyme catalyze H2O2-mediated oxidation of 2,2′azinobis(3-ethylbenzothiazoline)−6-sulfonic acid (ABTS) or 3,3′,5,5′tetramethylbenzidinesulfate (TMB) for colorimetric assay, but it can stimulate the emission of luminescence in the presence of luminol for

chemiluminescence assay as well. But apart from that, the modest catalytic activity of DNAzyme, as compared to protein enzyme horseradish peroxidase [7], may lead to inferior sensitivity with large compromising consumption of sample and reagent, especially in ABTS or TMB facilitated colorimetric assay, let along the possibility of colorimetric products decay [7,8]. From this point of view, signalamplified detection is expected to provide a feasible way to improve the DNAzyme-catalyzed nucleic acid assay. Signal amplification is a key component in ultrasensitive bioanalysis for detecting trace amount of nucleic acid target. Up to date, many amplification approaches for nucleic acid determination have been developed, including polymerase chain reaction (PCR) [9], ligase chain reaction (LCR) [10], rolling circle amplification (RCA) [11], loopmediated isothermal amplification (LAMP) [12], strand displacement amplification (SDA) [13,14] and so on. Nevertheless, no matter how high the sensitivity of those methods, they inevitably suffer from the inherent drawbacks. For example, classical thermal-cycling approaches, like PCR and LCR, often require highly purified nucleic acid samples in order to sustain the activity of the polymerase [15]; isothermal nucleic acid amplification based on the template replication, such as RCA, SDA and LAMP, increases the risk of cross-contamination

Abbreviation: AF, amplification factor; CL, chemiluminescence; CHA, target-catalyzed hairpin assembly; DF, differential factor; HCR, hybridization chain reaction; LAMP, loopmediated isothermal amplification; LCR, ligase chain reaction; N-PAGE, native polyacrylamide gel electrophoresis; PMT, photomultiplier tube; RCA, rolling circle amplification; S/B, signal/background ratio; SDA, strand displacement amplification; SNP, single nucleotide polymorphism; TN, normal target DNA; TM, mutant target DNA; T-α, target DNA designed for strategy-α; T-β, target DNA designed for strategy-β; TR, reference target DNA for acyclic system ⁎ Corresponding author. E-mail address: [email protected] (H. Shen). http://dx.doi.org/10.1016/j.talanta.2017.03.001 Received 28 November 2016; Received in revised form 24 February 2017; Accepted 2 March 2017 Available online 06 March 2017 0039-9140/ © 2017 Elsevier B.V. All rights reserved.

Talanta 167 (2017) 630–637

H. Xu et al.

Buffer3. Luminol was totally dissolved in DMSO and then diluted to the required concentration with Buffer4. The real DNA sample was prepared by collecting human fresh saliva to make a 1:5 dilution in Tris-HCl buffer (pH=7.4), then centrifuged at 3000 rpm for 1 min and filtered through 0.22 µm filtration membrane before use.

and might result in the false-positive outputs [16]. More to the point, most of those approaches are protein enzyme-dependent, making them susceptible to the assay condition as well as bring challenges for their further applications. A key feature of nucleic acid circuits for molecular amplification is that they do not need perishable protein enzymes. DNA circuit-based amplification, such as hybridization chain reaction (HCR) [17], entropy-driven catalytic hybridization [18] and catalyzed hairpin assembly (CHA) [19], etc., have attracted much attention nowadays in virtue of their inherently modular, easy to scale up and protein enzymefree. Even though such amplifications, from the perspective of detection, can achieve signal enhancement via strand displacement reaction, the concerned optical signal readout technique based on such as AuNPs aggregation [20] and/or FRET between fluorophore and quencher [21] may cause some other problems besides the tedious molecular modification procedure. For instance, photo-induced electron transfer between nucleobase and probe might cause the fluorescence quenching [22], and labeling with various fluorescent and quenching molecules may even affect the target binding properties of the oligonucleotide molecule [23]. Therefore, simplify the assay process via high sensitive non-label nucleic acid detection is particularly desirable. In order to overcome the weaknesses of either protein enzymeinvolved or labeling procedure needed for sensitive analyzing trace amount of nucleic acid target, in this work, benefiting from the DNAcircuit amplification based on target-catalyzed hairpin assembly, a simple enzyme-free and non-label DNAzyme sensor was developed for sensitive rs242557 SNP genotyping. In experiment, in the absence of target DNA trigger, the two fuel DNA hairpins (H1 and H2) with partially complementary nucleotide sequences could not open their loops to hybridize due to the thermodynamic barriers. But once triggered by the target DNA, such fuel DNA hairpins could open consecutively and to hybridize each other in facilitating the formation of DNAzyme for chemiluminescence determination. The sensor, carried out via DNA-circuit DNAzyme amplification and on efficient microfluidic chemiluminescence assay, obtained the performance of high detection throughput, low sample consumption and high sensitivity for SNP genotyping with reasonably good differentiating factor (DF) and signal amplification factor (AF), which showed a great potential for clinical diagnose in future.

2.2. Apparatus and instruments All the nucleotide acid incubation experiments were conducted in a PCR reactor (K640, Hangzhou Jingge Scientific Instrument Co. Ltd, Hangzhou, China). The Soret band of hemin and DNAzyme were recorded by a UV–Vis spectrophotometer (Shanghai Spectrum SP-756PC, Shanghai, China). The polyacrylamide gel electrophoresis (PAGE) was performed in an electrophoresis apparatus (DYCZ-24DN, Beijing LiuYi Instrument Factory, Beijing, China) and the electrophoretogram was visualized under the visible light gel transilluminator (BlueShield 501, Xiamen Zeesan Biotech Co. Ltd., Xiamen, China) for photographing. The chemiluminescent performance of the sensor was investigated by using a home-made μFIA-CL system (see Fig. 1) which was consisted of a dual flow path syringe pump (PHD/2000, Harvard Apparatus, Holliston, MA, USA) for CL reagents (luminol and H2O2) introduction, a 25 μL syringe pump coupled with a 6-port multiposition valve (SP-SV system, Kloehn Co. Ltd., Las Vegas, MA, USA) for injecting quantitative volumes of different DNAzyme samples, a photomultiplier tube (PMT) (Hamamatsu Photonics China Co. Ltd., Beijing, China) for CL signal collection and a double spiral-channel microchip for step-wise mixing of CL reagents and DNAzyme solution. In addition, the microchip was similar as that of previous report with 20 cm length channel and 3 μL interior volumes. Both of the microchip and PMT were enclosed in a dark box. 2.3. CHA procedure Fuel DNA H1 and H2 were first diluted to the required concentration in Buffer2 and separately heated at 95 °C for 10 min, followed by slowly annealing to room temperature to ensure the formation of hairpin structure. Then, 20 μL of target DNA in Buffer1 was mixed with the same volumes of H1 and H2 solutions for CHA reaction at 37 °C for 1 h. After that, 20 μL of hemin solution was added and incubated at 37 °C for another 1 h. In a typical experiment, the final concentrations of H1 and H2 were 300 nM and 450 nM, respectively; and the concentrations of hemin and H2O2 were 0.5 μM and 650 mM, respectively.

2. Experimental 2.1. Reagents and materials

2.4. Chemiluminescence assay Magnesium chloride, potassium chloride, hydrogen peroxide, H2O2 (30%), hydrochloric acid, tris (hydroxymethyl) aminomethane (Tris), hemin, Triton X-100 and dimethylsulfoxide (DMSO) were obtained from Shanghai Chemical Reagent Co., Ltd. (Shanhai, China). Luminol was purchased from Aladdin Ind. Co.(Shanghai, China). All chemicals were at least of analytical grade and used without further purification. The water used throughout was deionized and doubly-distilled. The buffer solutions used were listed as follows, Buffer1 (5 mM KCl in 50 mM Tris-HCl, pH 7.4), Buffer2 (1 M MgCl in 50 mM Tris-HCl, pH 7.4), Buffer3 (2% DMSO and 0.1% Triton-X 100 in 50 mM Tris-HCl, pH 7.4), Buffer4 (1% DMSO in 25 mM Tris-HCl, pH 9.0). The ssDNA oligonucleotides were synthesized by Invitrogen Biotechnology Co. Ltd. (Shanghai, China) and their names and sequences are listed in Table 1. The bold portion was the putative PW17 DNAzyme sequence as referred to our previous work [24]. The thermodynamic parameters (ΔG° and melting temperature) of the correct folding or hybridized DNA were evaluated via on-line software at NUPACK (http://www.nupack.org) and DINAMelt. (http://mfold.rit. albany.edu/?q=DINAMelt). Fluorescent dye GeneFinder was bought from Xiamen Zeesan Biotech Co. Ltd. (Xiamen, China). The DNA stock solution (100 μM) was obtained by dissolving the oligonucleotide in distilled water and was stored at −20 °C before use. Hemin (5 mM) was prepared in DMSO and stored in the darkness at −20 °C as stock solution, then diluted to the required concentration with

As illustrated in Fig. 1, 650 mM H2O2 and 0.5 mM luminol solutions were continuously introduced into the microchip by the syringe pump (via inlet 1, 2 respectively) and mixed in the first spiral channel. 2 μL of sample solution preceding 18 μL of Buffer4 was injected into the microchip (via inlet 3) by the SP-SV system, and catalyzed the luminol-H2O2 reaction in the second spiral channel, where the CL signal could be detected. Unless otherwise stated, CL assay results were based on peak height for the following experiments and each value reported was the mean of three experiments ± SD. The CL signal/background ratio (S/B) of sample solution vs. blank solution was used to evaluate the DNAzyme sensor performance. The comparison of background-deducted CL responses between TN and TM was applied for evaluating SNP genotyping differentiating factor (DF) of the sensor. 2.5. Non-denaturing PAGE The reaction mixtures of the proposed approaches were analyzed in 18% native PAGE experiment with 1×TBE buffer (89 mM Tris-boric acid – 0.2 mM EDTA, pH 8.3). Specifically, 4 μL of each target DNA sample solution mixed with 2 μL of loading buffer were loaded on the gel and run at room temperature (100 V) for 2.5 h. The samples were 631

Talanta 167 (2017) 630–637

H. Xu et al.

Table 1 Name and sequence of the oligonucleotides.

Red character: mutant or possible mismatched base site. Character with thick underline: toehold domain of H1 or H2. Green and italic character: putative DNAzyme domain of H2. Character with highlight yellow background: breathing site of H2 hairpin with mismatch base pair(s).

nanotechnology, DNA circuit-based amplification by means of targetcatalyzed hairpin assembly was applied for rs242557 SNP genotyping. The experiment process underwent a three step pathway, as refer to Fig. 2. First, the normal target gene segment TN, other than its mutant variant TM (see Table 1), triggered the toehold-mediated strand displacement reaction with the fuel DNA H1 to open the hairpin structure and form T∙H1 complex. Next, in the presence of second fuel DNA H2, the intermediate T∙H1 could further trigger another toehold-mediated strand displacement reaction and form H1/H2 complex, resulting in the unbound G-rich domain of H2 contributing to generate DNAzyme for determination. Meanwhile, the released TN from the above reaction could cycle again to hybrid with fuel DNA H1 and facilitate the DNA-circuit based amplification repeatedly.

staining with GeneFinder and visualized under a visible light gel transilluminator for photographing. 3. Results and discussion Commonly available approaches for DNA genotyping include Sanger sequencing, single base primer extension and high resolution melt temperature analysis [25], etc. Here, as a new achievement of DNA

3.1. Choice of the DNA strand for applicable strategy design For the proposed CHA process, the choice of DNA strands, including target DNA (T) and fuel DNAs (H1 and H2), is significantly contributed to the DNA circuit-based amplification and the SNP genotyping. Going by past experience, kinetics of toehold-mediated strand displacement is highly dependent on toehold to adjust strand displacement rate [26]; and successful SNP discrimination is usually achieved when the nucleotide in question is in toehold region [21]. As regards to sequences of the present DNA strands, two preset conditions were determined based on previous works. First, 21mernucleotide (nt) obtained from the sequence of rs242557 gene, the common primer length in DNA sequencing, was specified as the length

Fig. 1. μFIA-CL system for DNAzyme-based CL detection. SP, syringe pump; SV, sixport multiposition valve; W, waste; PMT, photo multiplier tube; inlet 1 and 2, for introduction of luminol and H2O2 solutions, respectively; inlet 3, for introduction of DNAzyme sample solution; outlet 4, for release of waste.

632

Talanta 167 (2017) 630–637

H. Xu et al.

Fig. 2. The choice of DNA strands for strategy design. In strategy-α, T, H1, H2 are designated as T-α, H1-α, H2-α; in strategy-β, T, H1, H2 are designated as T-β, H1-β, H2-β, DNA strand (from 5′), putative DNAzyme forming G-rich DNA domain, mutant or possible mismatched base site. respectively;

of the target DNA. Then, the putative mismatch site of H1 DNA, corresponding to rs242775 hotspot mutant site, was assigned in the toehold region adjacent the hairpin stem domain [21]. According to such two preset conditions, the proposed CHA could be theoretically reducible to two strategies (Strategy-α and Strategy-β) detailed as follows. Specifically started from the hotspot SNP site, the target DNA (T-α) had more nucleotides elongated on 5′ side in Strategy-α, with the sequence 5′-GGCTTCGCCCAGGGTGCACCA as illustrated in Fig. 2. Accordingly, H1 and H2 had the sequences of H1-α and H2-α detailed in Table 1, respectively. But for Strategy-β, the target DNA (T-β) had more nucleotides on 3′ side from the hotspot SNP site with the DNA sequence of 5′-AGGGTGCACCAGGACACGGTT as illustrated in Fig. 2 as well, while H1 and H2 were designated as H1-β and H2-β detailed in Table 1, respectively. Despite above two strategies had been theoretically speculated to be suitable for the proposed DNA-circuits amplification, further calculation by NUPACK simulation software, as referred to our previous works [27], suggested the designed DNA strand H2-β could form intramolecular 4 base pairs in its toehold domain and most of those bonds were relatively stable (equilibrium probability ca. 70%) as illustrated in Fig. 3. That was obviously more stable than H2-α, having just 2 weakstrength base-pairs (equilibrium probability ca. 30%) in its toehold domain. Such simulations suggested the proposed toehold-mediated strand displacements were more likely to be disturbed by the secondary structure of H2-β than that of H2-α. So H2-α would be more applicable for the proposed sensor; and Strategies-α was finally chosen for further experiment. The target DNA T-α, fuel DNAs H1-α and H2-α were simplified as T, H1 and H2, respectively thereafter.

The present toehold-mediated DNA-circuit amplification is primarily dependent on two consecutive reactions of T with H1, and H2 with intermediate T∙H1. It is reasonable believed that the reaction rate k2 > k1 ought to be necessary (see in Fig. 2) for fast consuming T∙H1, lest it accumulated to impede SNP discrimination. In addition, as the kinetics of strand displacement reaction showed an exponential dependence of the toehold length [26], fuel DNA H1 is designed to have a shorter toehold length than that of H2, specifically, 2 nt less as referred to previous report [21]. The optimum H1 was chosen by comparing a series of H1 DNA strands with the toehold length varied from 4 nt to 8 nt (see Table 1). By calculation the equilibrium distribution of two strands (1 μM of TN or TM with 1 μM of H1) via NUPACK software, the theoretical conversion ratio of both target DNA TN and TM could be predicted as shown in Figs. S1-S5 in the Supplementary Material. The overall summary illustrated in Fig. 4 indicated the conversion ratio of either TN or TM increased with the elongation of the toehold length, and such increasing trend could be divided into two phases. First, as H1 toehold extended from 4 nt to 6 nt, the gap of conversion ratio between TN and TM (71% vs. 6% of enhancement) enlarged. Then, once H1 toehold increased from 6 nt to 8 nt, compared with the remarkable 66% conversion ratio increase of TM, the 6% conversion ratio increase of TN was trivial; so the gap of two conversion ratios narrowed instead. On the basis of above theoretical calculation, further CL assay also demonstrated the similar influence of the H1 toehold length on target DNA discrimination. As shown in Fig. 5, the CL response of TM gradually increased with the H1 toehold elongation. However, despite the CL response of TN increased significantly when H1 toehold increased from

Fig. 3. Intramolecular secondary structure and stability of the designed H2-α and H2-β.

Fig. 4. TN and TM conversion ratios toward various toehold lengths of H1.

633

Talanta 167 (2017) 630–637

H. Xu et al.

Fig. 7. CL response of the target DNA with or without H2 breathing site modification. TN 20 nM, TM 20 nM.

being a major challenge, we tried to improve the present toeholdmediated strand displacement reaction in two ways. Firstly, because breathing sites of hairpin could modulate the hairpin stem to unfold occasionally and cause the nonspecific binding between H1 and H2 [28], we tried to introduce a few mismatched base pairs at breathing sites of the H2 (H2-b1 and H2-b2) as listed in Table 1, modifying the chance of hairpin unfolding. Specifically, H1 remained unchanged and H2 was introduced one or two base pairs at breathing sites, the overall H2 stability evaluated by ΔG increased from −20.73 kcal/ mol to −23.31 and −24.21 kcal/mol, respectively (see Fig. 6); and the CL assay results demonstrated the proposed CL response on blank sample was indeed reduced. But unfortunately, it was also found the signal of target DNA sample was reduced simultaneously (see Fig. 7), resulting in the S/B ratio relatively unimproved. Secondly, our previous work had demonstrated that appropriate addition of Mg2+ to K+-containing buffer in DNAzyme assay helped stabilizing Watson-Crick base-pair and reducing nonspecific dehybridization of “pre-caged” G-rich domain to suppress background signal [27]. Here, we tried further to improve S/B ratio via optimizing Mg2+ and K+ concentrations in buffer solution. By means of univariate approach (see Fig. 8), as K+ concentration was at optimum 1.25 mM, both sample and background responses decreased with the increase of Mg2+ concentration; and the S/B ratio peaked at Mg2+0.5 M. On the other hand, as Mg2+ concentration remained at 0.5 M, both sample and background responses increased with the increase of K+ concentration, while the sensor S/B ratio peaked at K+1.25 mM. Thus, the optimal cation condition was chosen 0.5 M of Mg2+ with 1.25 mM of K+. More intriguingly, it was also found such optimum cation concentration also helped to achieved better DF value for rs242557 SNP genotyping.

Fig. 5. Comparison of CL response for H1 toehold length optimization. TN 20 nM, TM 20 nM.

4 to 6 nt, the trend reversal appeared as the toehold varied from 6 to 8 nt. So for the sake of better DF value, H1 with 6 nt toehold coupled H2 with 8 nt toehold were finally chosen for this work. 3.2. Background interference suppression Based on past experience, background signal caused by nonspecific or “no target-catalyzed” strand displacement product is the most trouble problem in strand displacement amplification technology [28], which may reduce the specificity of amplification methodology and compromise the analytical performance. So far, some approaches have been applied to control the strand displacement kinetics and expected to decrease the product of no target-catalyzed strand displacement, including using toehold exchange process [26], insertion spacer between toehold and displacement domain [29] and introduction of mismatched base pairs into the “breathing sites” of the hairpin substrates [28], etc. For present CHA-based DNAzyme sensor, even though sensitive CL responses could be obtained from both blank and the target DNA sample, high CL background of the blank sample was apparently not favorable for good S/B ratio and low detection limit. Therefore, as “no target-catalyzed” H1/H2 hybridization considered

Fig. 6. Intramolecular structure stabilities of H2 before and after the breathing site modification.

634

Talanta 167 (2017) 630–637

H. Xu et al.

Fig. 8. The impact of K+ and Mg2+ concentrations on CL response and S/B ratio. TN 20 nM, TM 20 nM.

As can be seen, varying the proportions of DNA H1 and H2 represents an additional way to influence the consecutive reaction rates, which would affect the DNA circuit-based amplification and the SNP genotyping. Also, by means of univariate approach, the optimum H1/H2 DNA composition condition had been investigated, as shown in Fig. 9. In the condition of 20 nM target DNA (TN or TM), 300 nM of H1 coupled with 450 nM of H2 achieved the best SNP DF result. 3.3. Mechanism verification of the sensing strategy Despite it is still difficult to predict the kinetics of DNA circuitbased amplification from the perspective of nucleotide sequence, some key points concerning mechanism of the sensing strategy had been verified by following N-PAGE and spectroscopic experiments. As shown in Fig. 10, H1 exhibiting higher electrophoretic mobility than H2 (Lane 1 vs. Lane 2) agreed well with the fact that H1 contained less base numbers than H2. When H1 mixed with H2, despite the folding (hairpin) structures of both H1 and H2 would effectively blocked their full hybridization, a tiny amount of H1/H2 hybridization could still be found (Lane 3) due to the inevitable small proportions of thermodynamic-equilibrium unfolding transition of H1 and H2. And such phenomenon of circuit leakage in the absence of target TN led to the background signal of the sensor [21]. Furthermore, from Lane 4 to Lane 8, the gradually brightening H1/H2 complex band demonstrated the H1/H2 complex amount was correlated with the addition TN amount, demonstrating the feasibility of target-catalyzed H1/H2 hybridization for releasing pre-caged G-rich domain of DNA H2. In addition, the result of the spectroscopic experiment also verified structurally the G-quadruplex formation during the reaction process.

Because the binding of hemin to G-quadruplex DNA can be characterized by the red shift and hyperchromicity of the Soret band of hemin [27], we compared hemin Soret band before and after the addition of target DNA TN or TM to investigate hemin/G-quadruplex DNA interaction. As shown in Fig. 11, compared with the Soret band of hemin with a characteristic absorption peak at 397 nm (trace a), the addition of TM in hemin/H1/H2 mixed solution just induced a slight hyperchromicity and red shift of the Soret band (trace c vs. b and c vs. a), indicating only a tiny amount of G-quadruplex DNA formed due to the thermodynamic-equilibrium unfolding transition of H1 and the H1/H2 hybridization. But the addition of TN in hemin/H1/H2 mixed solution induced a significant hyperchromicity and red shift effect on the Soret band (trace d vs. b and d vs. a) suggested the marked amount of

Fig. 9. Impact of hairpin H1/H2 ratio on CL assay response and DF value.

Fig. 11. UV–vis absorption spectra of hemin and hemin complexes in CHA system.

Fig. 10. Electrophoretogram images of the assay system. H1 (3 μM); (2) H2 (4.5 μM); (3)~(8) H1+H2 (3 μM+4.5 μM) +TN (0, 30, 100, 300, 500, 1000 nM, respectively).

635

Talanta 167 (2017) 630–637

H. Xu et al.

hemin/G-quadruplex DNA complex formation.

3.4. Analytical figures of merit After a series of parameter optimizations related to S/B ratio of the CL assay by means of univariate approach (detailed in Figs. S6-Fig.S11 in the Supplementary Material), the performance of the developed DNAzyme sensor was characterized by the SNP DF value, linearity of the calibration curves, detection limit, etc. Under final optimized conditions: pH 9.0, total incubation time 60 min, 0.5 μM of hemin solution, 0.5 mM of luminol solution, 650 mM of H2O2 solution and 100 μL/min of CL reagent flow rate, given 2 μL of sample solution consumption for each assay of 20 nM target DNA, the DFs were obtained in the range of 10–15 for TN against TM. The CL responses over the rs242557gene concentration ranging from 0.25 to 250 nM was obtained as shown in Fig. S12 in the Supplementary Material, with a regression equation of ΔI=5.25 C+13.09 (r2=0.996), when C was the concentration of TN in the range of 0.25–25 nM and I referred to the CL intensity (mV). The absolute detection limit reached 0.3 fmol according to 3σ principle. Besides the differentiating factor, the sensor evaluation also required the calculation of amplification factor (AF), an essential indicator of the DNA circuit-based amplification. Specifically, the AF was determined by taking an acyclic approach as control, in which a reference target DNA (TR) with partial complementary sequence of H2 (see Table 1) was used to trigger the open of H2 hairpin directly for the DNAzyme formation. Similar to circuit-based cyclic reaction system having 300 nM H1 and 450 nM H2 for hairpin assembly triggered by various concentrations of TN; in proposed acyclic system, 450 nM H2 hairpin was opened via directly hybridizing to various concentrations of TR. TN, TR concentrations and other experimental conditions of both cyclic and acyclic systems were kept the same. The AFs, calculated as the cyclicto-acyclic ratio of the CL assay (background-deducted CL response) were higher than 16 (ca. 16.8–27) when TN and TR concentrations ranged between 10 and 20 nM, as shown in Fig. 12. In order to demonstrate the feasibility of the sensor for practical application, we also tested target rs242557 DNA in real sample (1:5 diluted saliva) as refer to previous publication [30]. As shown in

Fig. 13. SNP genotyping of target DNA in buffer and in real sample.

Fig. 13, despite a slight decrease of CL response and DF value for target DNAs (TN vs. TM) had been obtained in real samples as compared with those from samples in Tris-HCl buffer, which most likely be ascribed to the interference of biomolecules (especially proteins) from real saliva solution, the results were still very comparable for those analyses being conducted without special sample pretreatment. Moreover, the addition standard recoveries of the target DNAs (TN) were 86.4%～95.9% (n=12), indicating the potential of the developed sensor for biological sample applications. 4. Conclusion Benefiting from the DNA-circuit amplification based on targetcatalyzed hairpin assembly, a protein enzyme-free and non-label DNAzyme sensor for rs242557 hotspot-SNP genotyping has been developed. After the study on strategic design and experimental optimization, the sensor, carried out on microfluidic chemiluminescence assay, showed the advantage of automation, high detection throughput, low sample consumption and high sensitivity for SNP genotyping, which offer a great potential for clinical diagnose in future. Acknowledgement This work is supported by the National Science Foundation of China (No. 21227007); the Zhejiang Provincial Natural Science Foundation of China (No. LY16B050004); and the Interdisciplinary Seed Research Fund of Zhejiang University (No. JCZZ-2013010). Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at doi:10.1016/j.talanta.2017.03.001. References [1] L. Kruglya, D.A. Nickerson, Variation is the spice of life, Nat. Genet. 27 (2001) 234–236. [2] J.N. Hirschhorn, M.J. Daly, Genome-wide association studies for common diseases and complex traits, Nat. Rev. Genet. 6 (2005) 95–108. [3] A. Syvänen, Accessing genetic variation: genotyping single nucleotide polymorphisms, Nat. Rev. Genet. 2 (2001) 930–942. [4] 〈http://www.ncbi.nlm.nih.gov/snp/?term=rs242557〉 (CAAAGCAGTTGGCTTCGCCCAGGGT[A/G] CACCA GGACACGGTTTTGGCTCTGT). [5] A.J. Myers, M. Kaleem, L. Marlowe, The H1c haplotype at the MAPT locus is associatedwith Alzheimer's disease, Hum. Mol. Genet 14 (2005) 2399–2404. [6] J. Kosman, B. Juskowiak, Peroxidase-mimicking DNAzymes for biosensing applications: a review, Anal. Chim. Acta 707 (2011) 7–17. [7] D. Kong, J. Xu, H. Shen, Positive effects of ATP on G-quadruplex-hemin DNAzymemediated reactions, Anal. Chem. 82 (2010) 6148–6153. [8] Y. Du, B. Li, S. Guo, Z. Zhou, M. Zhou, E. Wang, S. Dong, G-Quadruplex-based

Fig. 12. Comparison of the CL response between TN and TR for AF determination. H1 300 nM, H2 450 nM.

636

Talanta 167 (2017) 630–637

H. Xu et al.

[9] [10] [11]

[12]

[13]

[14]

[15] [16]

[17] [18] [19] [20]

Anal. Biochem. 457 (2014) 19–23. [21] C. Li, Y. Li, X. Xu, X. Wang, Y. Chen, X. Yang, F. Liu, N. Li, Fast and quantitative differentiation of single-base mismatched DNA by initial reaction rate of catalytic hairpin assembly, Biosens. Bioelectron. 60 (2014) 57–63. [22] M. Torimura, S. Kurata, K. Yamada, T. Yokomaku, Y. Kamagata, T. Kanagawa, R. Kurane, Fluorescence-quenching phenomenon by photo induced electron transfer between a fluorescent dye and a nucleotide base, Anal. Sci. 17 (2001) 155–160. [23] M. Choi, M. Yoon, J. Baeg, J. Kim, Label-free dual assay of DNA sequences and potassium ions using an aptamer probe and a molecular light switch complex, Chem. Commun. 47 (2009) 7419–7421. [24] H. Shen, B. Zhang, H. Xu, Y. Sun, Q. Wu, H. Shen*, Y. Liu, Microfluidic-based Gquadruplex ligand displacement assay for alkaloid anticancer drug screening, J. Pharm. Biomed. Anal. 134 (2017) 333–339. [25] J. Neo, K. Aw, M. Uttamchandani, Visual SNP genotyping using asymmetric PCR and split DNA enzymes, Analyst 136 (2011) 1569–1572. [26] D. Zhang, E. Winfree, Control of DNA strand displacement kinetics using toehold exchange, J. Am. Chem. Soc. 131 (2009) )17303–)17314. [27] Q. Wu, H. Shen, H. Shen, Y. Sun, L. Song, Study on sensing strategy and performance of a microfluidic chemiluminescence aptazyme sensor, Talanta 150 (2016) 531–538. [28] Y. Zhang, Y. Yan, W. Chen, W. Cheng, S. Li, X. Ding, D. Li, H. Wang, H. Ju, S. Ding, A simple electrochemical biosensor for highly sensitive and specific detection of microRNA based on mismatched catalytic hairpin assembly, Biosens. Bioelectron. 68 (2015) 343–349. [29] A.J. Genot, D.Y. Zhang, J. Bath, A.J. Turberfield, Remote toehold: a mechanism for flexible control of DNA hybridization kinetics, J. Am. Chem. Soc. 133 (2011) 2177–2182. [30] A. Zheng, J. Li, J. Wang, X. Song, G. Chen, H. Yang, Enzyme-free signal amplification in the DNAzyme sensor via target-catalyzed hairpin assembly, Chem. Commun. 48 (2012) 3112–3114.

DNAzyme for colorimetric detection of cocaine: using magnetic nanoparticles as the separation and amplification element, Analyst 136 (2011) 493–497. K.B. Mullis, F.A. Faloona, Specific synthesis of DNA in vitro via a polymerasecatalyzed chain reaction, Methods Enzymol. 155 (1987) 335–350. F. Barany, Genetic disease detection and DNA amplification using cloned thermostable ligase, Proc. Natl. Acad. Sci. USA 88 (1991) 189–193. A.T. Christian, M.S. Pattee, C.M. Attix, B.E. Reed, K.J. Sorensen, J.D. Tucker, Detection of DNA point mutations and mRNA expression levels by rolling circle amplification in individual cells, Proc. Natl. Acad. Sci. 98 (2001) 14238–14243. T. Notomi, H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino, T. Hase, Loop-mediated isothermal amplification of DNA, Nucleic Acids Res 28 (2000) (e63-e63). G.T. Walker, M.C. Little, J.G. Nadeau, D.D. Shank, Isothermal in vitro amplification of DNA by a restriction enzyme/DNA polymerase system, Proc. Natl. Acad. Sci. 89 (1992) 392–396. G.T. Walker, M.S. Fraiser, J.L. Schram, M.C. Little, J.G. Nadeau, D.P. Malinowski, Strand displacement amplification—an isothermal, in vitro DNA amplification technique, Nucleic Acids Res. 20 (1992) 1691–1696. H. Deng, Z. Gao, Bioanalytical applications of isothermal nucleic acid amplification techniques, Anal. Chim. Acta 853 (2015) 30–45. B. Zou, Y. Ma, H. Wu, G. Zhou, Ultrasensitive DNA detection by cascade enzymatic signal amplification based on Afu flap endonuclease coupled with nicking endonuclease, Angew. Chem. Int. Ed. 50 (2011) 7395–7398. R.M. Dirks, N.A. Pierce, Triggered amplification by hybridization chain reaction, Proc. Nal. Acad. Sci. 101 (2004) 15275–15278. D.Y. Zhang, A.J. Turberfield, B. Yurke, E. Winfree, Engineering entropy-driven reactions and networks catalyzed by DNA, Science 318 (2007) 1121–1125. P. Yin, H.M. Choi, C.R. Calvert, N.A. Pierce, Programming biomolecular selfassembly pathways, Nature 451 (2008) 318–322. C. Ma, W. Wang, A. Mulchandani, C. Shi, A simple colorimetric DNA detection by target-induced hybridization chain reaction for isothermal signal amplification,

637