A morphological and genetic comparison of Septifer bilocularis, Mytilisepta virgata and Brachidontes variabilis (Bivalvia: Mytiloidea) from Hong Kong and erection of the Mytiliseptiferinae sub-fam. nov.

Journal Pre-proof A morphological and genetic comparison of Septifer bilocularis, Mytilisepta virgata and Brachidontes variabilis (Bivalvia: Mytiloidea) from Hong Kong and erection of the Mytiliseptiferinae sub-fam. nov. Brian Morton, Priscilla T.Y Leung, Jiehong Wei, Gabriel Y. Lee

PII: DOI: Reference:

S2352-4855(19)30764-9 https://doi.org/10.1016/j.rsma.2019.100981 RSMA 100981

To appear in:

Regional Studies in Marine Science

Received date : 4 October 2019 Revised date : 29 November 2019 Accepted date : 5 December 2019 Please cite this article as: B. Morton, P.T.Y. Leung, J. Wei et al., A morphological and genetic comparison of Septifer bilocularis, Mytilisepta virgata and Brachidontes variabilis (Bivalvia: Mytiloidea) from Hong Kong and erection of the Mytiliseptiferinae sub-fam. nov.. Regional Studies in Marine Science (2019), doi: https://doi.org/10.1016/j.rsma.2019.100981. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier B.V.

Journal Pre-proof

1

A morphological and genetic comparison of Septifer bilocularis, Mytilisepta virgata and Brachidontes variabilis (Bivalvia: Mytiloidea) from Hong Kong and erection of the Mytiliseptiferinae sub-fam. nov.

1

Brian Morton, 2Priscilla T.Y Leung, 2Jiehong Wei and 2Gabriel Y. Lee

pro of

1

School of Biological Sciences, The University of Hong Kong, Hong Kong SAR, China.

2

State Key Laboratory of Marine Pollution, City University of Hong Kong, Hong

Kong SAR, China E-mail address: [email protected]

Mytiliseptiferinae

: Mytiliseptiferinae sub-fam. nov.

lP

Running heads: Brian Morton et al.

re-

Key words : Shell morphology; gene sequencing; Brachidontinae; Septiferinae; origin of the

This is a comparative study of two extant, umbonally septate, marine, Mytiloidea - the Indo-West Pacific coral associated Septifer bilocularis and the rocky intertidal Mytilisepta virgata with the non-septate, also intertidal, Brachidontes variabilis.

urn a

Mytilisepta virgata has most recently been associated genetically with the Brachidontinae and this study examines the anatomical and genetic case for this. The three species share many mytiloid characteristics including an heteromyarian shell form that equips them for life within crevices and a radially and bifurcatingly ribbed, or lirate, shell. Only the two septiferines possess an interior umbonal septum in each valve with an anterior adductor muscle located between them. And only the septiferines possess an accessory posterior adductor muscle.

Jo

It is concluded that S. bilocularis should be retained within the Septiferinae, as

currently accepted, whereas M. virgata, though genetically (but not morphologically) linked with representatives of the Brachidontinae, should be included in its own new subfamily – the Mytiliseptiferinae - herein proposed. It thus appears that the two septate mytilids have evolved separately from a common ancestor but, today, share ancestral features of a radially and

bifurcatingly ribbed, septate shell and the possession of accessory posterior adductor muscles. How the septum of M. virgata has been formed is described.

Journal Pre-proof

2

1. INTRODUCTION Some of the many representatives of the Mytiloidea are among the most conspicuous marine (and freshwater) bivalves and species of Mytilus are especially obvious on rocky intertidal shores in northern boreal waters and are of commercial value. As a consequence, there are a large number of published research papers on

pro of

them (Gosling, 1992). Studies upon all other mytiloideans, especially from warmer waters, are sparse (Soot-Ryen, 1955; Morton, 1973, 1977, 1980; Morton and Puljas, 2017), although because of their commercial value also, species of Perna have received more attention (Choo, 1974) as has the invasive freshwater Limnoperna fortunei (Dunker, 1857) (Boltovskoy, 2015) but not the Asian freshwater Sinomytilus harmandi (Rochebrune, 1882) (Morton and Dinesen, 2010; Morton et al., 2019). Noncommercial taxa such as representatives of the Arcuatulinae (Morton, 1980) and

re-

Dacrydinae (Mattson and Warén, 1977) and other small inconspicuous speciessuch as Modiolarca subpicta (Cantraine, 1835) (Morton and Dinesen, 2011), the circumboreal, adventitious crypt building, Crenella decussata (Montagu, 1808) (Morton et

lP

al., 2016) have received only basic attention. New mytiloid species are still being discovered, Ockelmann and Cedhagen (2019) describing Modiolus cimbricus as new, living inside little nests of grains, and endemic to the Danish Kattegat-Skagerrak. In the warmer waters of the Indo-West Pacific, species of Septifer Récluz,

urn a

1848 and its initially designated sub-genus Mytilisepta (Habe, 1951) (now elevated to generic status [Récluz, 1848; Huber, 2010]), replace Mytilus as the dominant intertidal band of zoning mussels (Morton and Morton, 1983) and co-occur with subtidal corals, respectively. Morton (1991a), however, reported upon an unusual molluscan fouling community dominated by S. virgata (=M. virgata) (Wiegmann, 1837) in a seawater outfall discharging into Victoria Harbour, Hong Kong. Such species have no known commercial value and, as a consequence, they too remain little studied except in Hong

Jo

Kong where Lee and Morton (1985) included them in a review of the known local mytiloidean taxa. Here too, Morton (1995) examined the population dynamics of M. virgata and Ong Che and Morton (1992) related the changes in structure and variations in abundance of the macro-invertebrate community associated with the species to seasonal changes in climate within the, now, Cape d’Aguilar Marine Reserve while Seed and Brotohadikusomo (1994) studied the spatial variation in the molluscan community associated with M. virgata in the same location. Iwasaki

Journal Pre-proof

3

(1995) compared the rocky intertidal communities associated with the vertically contiguous Septifer (Mytilisepta) virgata and Hormomya mutabilis (Gould, 1861) in Japan. In the upper M. virgata bed, crustaceans and bivalves were dominant in terms of both numbers of individuals and biomass whereas the lower H. mutabilis bed supported virtually no epizoans or mobile fauna. The H. mutabilis bed contained a much greater amount of sediment than the M. virgata one, and the biomass of six of

pro of

the nine species dominant in the latter was negatively correlated with this.

These basic studies on M. virgata were complemented by others, both ecological and physiological, on the species both in Hong Kong and elsewhere. For example, Seed and Lee (1995) showed how in Hong Kong, M. virgata is the prey of the shell-crushing crab Eriphia laevimana smithii Guérin, 1832 (=Eriphia sebana [Shaw and Nodder, 1803]) while Liu and Morton B (1994) examined the species’ temperature tolerances on the exposed rocky shores of Cape d’Aguilar. Momoshima

re-

et al. (1985) reported upon the radioactive and stable cobalt concentrations in the species from the Kyushu Islands, Japan, showing that M. virgata had a tendency to concentrate cobalt with growth and age whereas Mytilus edulis Linnaeus, 1758 did

lP

not. Wang and Dei (1999) examined the factors affecting trace element uptake in M. virgata. Sze and Lee (1995) demonstrated that Perna viridis (Linnaeus, 1758) depurates copper by producing large amounts of pallial mucus whereas M. virgata lacks this ability. Subsequently, Seed and Richardson (1999) compared the same two

urn a

species in relation to the differing evolutionary traits they illustrate and later recompared the two to ascertain their relative values as environmental biomonitors and chronometers of environmental change (Seed and Richardson, 2003). A second species of Septifer, that is, S. bilocularis (Linnaeus, 1758), the type species of the genus, also occurs in Hong Kong where it is associated with coral heads, both living and dead, in the oceanic eastern, subtidal, waters of Hong Kong

Jo

(Dudgeon and Morton, 1982). Here it is a superficial nestler on such scleractinians and is not associated intimately with the gallery communities within the corals (Morton et al., 1991). There is little else written about this species except for taxonomic studies that will be described and discussed although Albayrak and Çağlar (2006) record that it has been identified as an alien invader of the Mediterranean Sea. Pelseneer (1911) illustrated the internal anatomy of S. bilocularis (plate VI, figs 6 & 10) and S. excisus (Wiegmann, 1837) (plate VI, figs 7, 8 & 9), but did not recognise the presence of accessory posterior accessory adductor muscles. This

Journal Pre-proof

4

distinctive anatomical feature was later elaborated upon by Yonge and Campbell (1968) in relation to the evolution of the heteromyarian form in the Bivalvia and species of Septifer and the unrelated Dreissena polymorpha (Pallas, 1771) (Dreissenidae) in particular. As will be described and discussed, recent genetic evidence (Trovant et al., 2015; Gerdol et al., 2017; Combosch et al., 2017) suggests that M. virgata should not

pro of

be included in the Septiferinae Scarlato and Starobogatov, 1979 but is, instead, a member of the Brachidontinae F. Nordsieck, 1969. Representatives of this subfamily from the tropical and warm-temperate southwestern Atlantic have been studied genetically by Trovant et al. (2016). Brachidontes variabilis (Krauss, 1848) is intertidally common in Hong Kong but details of its morphology have never been studied. This study, therefore, compares this member of the Brachidontinae with the two species of Septifer identified above (and as currently taxonomically recognised),

re-

in terms of morphology and the DNA sequences of COI, H3, 18S and 28S, to determine if such a re-location for species of Mytilisepta is valid and, if so, how can

lP

this be explaned in adaptive and evolutionary terms. 2. MATERIALS AND METHODS

2.1. The species Individuals of M. virgata and S. bilocularis were obtained from the exposed rocky intertidal of Shelter Island and dead subtidal coral heads both in the north-

urn a

eastern waters of Hong Kong, that is Mirs Bay, respectively, in November 2018. Individuals of B. variabilis were obtained from the rocky intertidal of Tai Tam Bay on Hong Kong Island, Hong Kong SAR, China. Voucher specimens of S. bilocularis and M. virgata collected from Hong Kong have been deposited in the collections of the Natural History Museum, London, and have the registration numbers and NHMUK 20180060 (S. bilocularis) and NHMUK 20180059 (M. virgata). For B. variabilis, see

Jo

Morton (1988).

All three species were examined alive and dissected as preserved specimens to

illustrate aspects of their morphology. Other individuals were fixed in 95% ethanol for subsequent genetic analysis.

2.2. PCR amplification and sequencing

Journal Pre-proof

5

Total genomic DNA was isolated from either adductor muscle or mantle tissue using TaKaRa MiniBEST universal genomic DNA extraction kit v5.0 (Takara Bio Inc.), following the manufacturer’s instructions. Fragments of cytochrome c oxidase subunit I (COI), 18S rRNA, 28S rRNA and histone 3 (H3) were amplified by polymerase chain reactions. In all cases, PCR amplification and sequencing were performed in a total volume of 50 μl, containing 0.4 μl (5 U/μl) of Ex Taq (Takara

pro of

Bio. Inc.), 5.0 μl of corresponding 10X Taq buffer, 2.0 μl (Approximately 100 ng/μl) template DNA, 0.3 μl (10 nmol/μl) of corresponding forward and reverse primers, 4 μL of dNTP mixture (2.5 mM each) and 38 μl ddWater. PCR cycling condition was: denaturing at 95o for 7 min, followed by 35 cycles of denaturing at 95o for 40 s, annealing at 48o for 30 s, elongation at 70o for 1 min, and a final elongation at 70o for 7 min. Information of the primers used is summarized in Table 1. PCR products were checked by agarose gel electrophoresis and sent for gel purification and sequencing

re-

by the company Tech Dragon Ltd. Sequences were assembled using contig sorter plugin in Geneious v. 11.1.5 (Biomatters Ltd).

lP

2.3 Alignment, saturation test and phylogenetic analyses

To clarify placements of the members of Mytiliseptiferinae sub-fam. nov., we reconstructed a phylogenetic tree with a dataset derived from Morton et al. (in press) with additional sequences obtained for representatives of the Brachidontinae and

urn a

Mytiliseptiferinae (Table 2). Sequences of COI, H3, 18S and 28S were amplified from two M. virgata specimens. Sequence alignments of all genes were performed with MAFFT v7 (Katoh and Standley, 2013) plugin using the default setting in Geneious v. 11.1.5 (Biomatters Ltd). External gaps and missing sequences in some of the species were treated as missing data in the phylogenetic analyses. After MAFFT alignment, fragments of COI and H3 were aligned with the Muscle method (Edgar,

Jo

2004) based on a corresponding amino acid in MEGA7 (Kumar et al., 2016). All alignment files were first proofread manually to correct for any obvious misalignments. The ambiguous regions of 18S rRNA and 28S rRNA alignments were then removed using online Gblocks v0.91b with default parameter (Castresana, 2000; Dereeper

et

al.,

http://phylogeny.lirmm.fr/phylo_cgi/one_task.cgi?task_type=gblocks).

2008;

Journal Pre-proof

6

Substitution saturation of each gene was tested by a method described previously (Xia et al., 2003) in DAMBE v.7.0.28 (Xia and Lemey, 2009; Xia, 2018). Levels of substitution saturation of 18S rRNA and 28S rRNA were tested using cured alignment files generated by online Gblocks v0.91b (Castresana, 2000; Dereeper et al., 2008). Levels of substitution saturation of COI and H3 were tested on the three codon positions. Saturated genes or positions were excluded from the subsequent

pro of

phylogenetic analyses. Concatenated file of all the included fragments was generated for phylogenetic analyses using SequenceMatrix v1.7.8 (Vaidya et al., 2011). The result of the test carried out using the method of Xia et al., 2003 showed substitution saturation of the third codon position of COI (Table S1) and which were thus excluded from subsequent phylogenetic analyses. A total of 3172 bp concatenated matrix (1st codon position of COI, 221; 2nd codon position of COI, 221; 18S rRNA, 1622; 28S rRNA, 771; 1st codon position of H3, 113; 2nd codon position of H3, 112;

re-

3rd codon position of H3, 112) was used for the phylogenetic analyses. Best-fit partitions and substitution models of each gene were selected by partitionfinder v2.1.1 (Guindon et al., 2010; Lanfear et al., 2016) using Akaike information criterion

lP

(Posada and Buckley, 2004). 18S rRNA, 28S rRNA and each codon positions of COI and H3 were treated as one subset for partition and model selections. Best-fit partitions and models for the phylogenetic analyses are shown in Table S2. A maximum likelihood (ML) tree was reconstructed in IQ-TREE v1.6.6 using

urn a

best-fit partitions and models (Nguyen et al., 2015). Bootstrapping values were estimated with 1000 bootstrap replicates using the standard non-parametric bootstrap method (Nguyen et al., 2015). Bayesian inference (BI) trees were reconstructed in MrBayes v3.2 (Ronquist et al., 2012). Two independent Monte Carlo Markov Chain runs with one cold and three heated chains were performed for 1,000,000 generations, sampling every 100 generations and discarding the first 25% of samples as burn-in.

Jo

Sufficient convergences of runs were estimated by summary statistics implemented in MrBayes v3.2 (Estimated Sample Size [ESS] > 200, Potential Scale Reduction Factor [PSRF] approximated to 1; Ronquist et al., 2012). The phylogenetic trees were visualized using FigTree v1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/).

3. RESULTS 3.1. Taxonomy of the extant Septiferinae and Brachidontinae

Journal Pre-proof

7

There are a number of species included in the as currently recognised Septiferinae and which, for the purposes of this study, include S. bilocularis and M. virgata both of which occur throughout the Indo-West Pacific (Wang et al. 1988; Qi, 2004; Zheng et al., 2013). Some authors, however, for example Coan and Valentich Scott (2012), regard Mytilisepta as a junior synonym of Septifer. In addition to the above two species, some authors, for example Yang et al. (2013, 2017) also record S.

pro of

excisus from Chinese waters while Qi (2004) added S. pulcher Wang, 1983 and S. xishaensis Wang, 1983 (= S. rudis Dall et al., 1938 [Huber, 2010]) and Xu and Zhang (2008) added S. keenae Nomura, 1936 (originally described from Japan as S. keeni by Nomura [1936] but accepted as M. keenae by Huber [2010]) to this number. The umbonal septum of S. excisus, however, resembles closely that of M. virgata (Yang et al., 2013, p. 166) and, indeed, other authors only record S. bilocularis and M. virgata from Chinese waters (Zhang, 2008), although Yang et al. (2013, 2017) add S. excisus

re-

to these specifically from the South China Sea.

In addition to S. bilocularis, S. excisus and M. virgata, S. keenae is also recorded from Japanese waters (Habe, 1977).

lP

From the coasts of the north-eastern Pacific, Pilsbry and Raymond (1898) and Coan et al. (2000) record Septifer bifurcatus (Conrad, 1837) (accepted as M. bifurcata (Conrad, 1837) [Huber, 2010]). According to Coan and Valentich-Scott (2012), the range of this species extends down into the intertidal waters of Baja California Sur,

urn a

Mexico. Septifer zeteki Hertlein and Strong, 1946 also occurs in Baja California Sur, but its range extends further south into South America. Other nominal species of Septifer recorded from the tropical Pacific and accepted as valid include S. cumingii Récluz, 1848, S. huttoni (Cossmann, 1916), S. ramulosus (Viader, 1951), S. rudis, S. rufolineatus (E.A. Smith, 1911) and S. torquatus (P. Marshall, 1918) (Huber, 2010), but there is no significant literature about any of these.

Jo

Species of Brachidontes are notoriously variable in overall shell form and Lee and Ó Foighil (2004, 2005) have shown that B. exustus actually comprises a complex of four cryptic species. With regard to Brachidontes variabilis, earlier neighbour joining, minimum evolution and maximum parsimony trees based on partial mitochondrial DNA sequences of 16S-rDNA and cytochrome oxidase (COI) genes revealed three monophyletic clades. That is, B. pharaonis sensu lato from the Mediterranean and Red Seas, B. variabilis from the Indian Ocean and B. variabilis from the western Pacific Ocean. The three clades have not, however, been

Journal Pre-proof

8

differentiated by malacologists employing conventional morphology (Terranova et al., 2007). Sará et al. (2008), moreover, considered B. pharaonis to be a Lessepsian invader into the Mediterranean Sea.

3.2. Anatomy Representatives of the Mytiloidea show a high degree of uniformity in terms

pro of

of their shell mineralogy and structure such that, with only a few possessing a middle layer of nacreous aragonite, notably, for example, Mytilus californianus Conrad, 1837 and Modiolus modiolus (Linnaeus, 1758), virtually all the other mytiloid taxa investigated by Taylor et al. (1969), including S. bilocularis, had shells comprising two layers, that is, an outer layer of nacreous aragonite and an inner layer typically of either nacreous, prismatic or complex crossed-lamellar aragonite.

Species of Septifer (and Mytilisepta) are characterised by a strongly triangular,

re-

heteromyarian, shell, which is equivalve, ventrally flattened and dorsally peaked. Representatives of these (as currently accepted) genera are also characterised by irregularly bifurcated radial ribs or lirae (Habe, 1951) that confers them with greater compressive strength (Taylor and Layman, 1972). The shells of both species here

lP

under study are also characterised by a periostracum of the typical mytiloid form (Beedham, 1958) categorised as ‘very thick’ (S. bilocularis = 36µm; M. virgata = 60µm; Harper, 1997) that protects the underlying calcareous component of the shell from environmental and biotic agents of dissolution including chemically drilling

urn a

predators (Harper and Skelton, 1993). The shells S. bilocularis and M. virgata have been described by Morton (2019, figs 4, 5 and 6) and both are characterised most distinctively by an apical internal umbonal septum in each valve and between which is inserted the anterior adductor muscle first described in detail by Yonge and Campbell (1968). They are also characterised by unique accessory posterior adductor muscles (Morton, 2019)

Jo

Below is a brief summary of the shell characteristics of the two septiferines

here under study.

Septifer bilocularis

The shell of S. bilocularis (in Hong Kong) is up to 40 mm in length and 24 mm in height. It is also thick, ovally elongate, dorsally peaked and ventrally concave with terminal beaks and a rounded posterior margin. The blue green shell valves are

Journal Pre-proof

9

characterised by a thick periostracum that covers fine radially divaricating lirae. Internally, each valve has an apical umbonal septum, which the anterior adductor muscle is located between (Fig. 1).

Mytilisepta virgata The shell of M. virgata grows up to length (in Hong Kong) of 60 mm (Morton, 1995)

pro of

and is more solid and squatter in overall form than S. bilocularis. The shell is covered with a purple-black periostracum that is typically eroded extensively anteriorly. In this species, the sculpture is of thicker radial ribs rather than lirae as in S. bilocularis but which are also divaricating and has distinct commarginal growth lines. Internally too each valve possesses an apical umbonal septum between which the anterior adductor muscle is located (Fig. 1).

re-

Brachidontes variabilis

Although the anatomies of other brachidontines have been studied, for example B. darwinianus (Orbigny, 1846) and B. solisianus (Orbigny, 1846), from Brazil (Avelar

lP

and Narchi, 1984a, b), and both being morphologically highly variable (Tanaka and Alves de Magalhães, 1999). Similarly, B. erosus (Lamarck, 1819) from Australia and B. puniceus (Gmelin, 1791) from the Cape Verde Islands have been described morphologically (Morton, 1991b, 2012), but B. variabilis has not.

urn a

The shell of B. variabilis (Fig. 1) grows up to a maximum length of 22 mm and a height of ~15 mm in Hong Kong (Morton 1988). Because it inhabits a wide variety of hard intertidal habitats in Hong Kong (and elsewhere), the shell is highly variable in form (as its specific name suggests), some individuals being squat, others taller. Such variability appears characteristic of many brachidontines, for example B. exustus (Linnaeus, 1758) (Seed, 1980). Brachidontes variabilis

is roundly

Jo

heteromyarian, especially anteriorly, and slightly concave ventrally whereas the posterior margin is inflated but also rounded. The umbones are terminal and the antero-dorsal margin is varyingly steep. The shell features of B. variabilis are illustrated in Figure 2 and these should

be compared with those of S. bilocularis illustrated in Morton et al. (2019, fig. 3C) wherein it is seen that the dorso-ventral height (a---b) of the shell is low (compared to S. bilocularis [Fig. 1] especially) as in M. virgata (Fig. 1) possibly because both of these species are the inhabitants of rocky intertidal crevices the former on wave-

Journal Pre-proof

10

exposed shores, the latter on more protected ones. The maximum dorso-ventral height of the shell is also situated mid antero-posteriorly and in a similar location to that of S. bilocularis. The subtended angle of the antero-dorsal shell margin is ~60o and is thus, generally, narrower than in S. bilocularis particularly (~80o) and closer to M. virgata (70o) probably again because both the latter species occupy intertidal rock crevices (Fig. 2A).

pro of

Other features of the shell of B. variabilis are illustrated in Figure 2B-E). When seen from the dorsal aspect, the ligament (Fig. 2B, L) is relatively short. From the ventral aspect the location of the small byssal notch (Fig. 2C, BN) and gape is situated just anterior to the greatest central left-right widths of the shell (x---y) whereas that of M. virgata is located more anteriorly and there is no obvious such gape in S. bilocularis (Morton, 2019, fig. 5). When seen from the anterior and posterior aspects, the greatest left and right shell width (x---y) of B. variabilis (Fig.

re-

2D and E) is situated more dorsally than in S. bilocularis and M. virgata (Morton, 2019, fig. 4) but is most similar to the latter species again because they both inhabitat intertidal rock crevices.

lP

The final developmental stage of all mytiloids, the dissoconch, is formed by the juvenile individual and becomes the permanent shell of the adult. This shell phase in the Mytiloidea is typified by dysodont hinge teeth (Ockelmann, 1995). All three of the mytilids discussed herein have such dysodont teeth, which are weakly present

urn a

antero-ventrally and postero-dorsally in the two septiferines but more obviously functional in the same localities in B. variabilis. The hinge plates of the left shell valves of S. bilocularis and M. virgata are illustrated in Figure 3A and B (see also Morton, 2019, fig. 7) and both valves of B. variabilis are shown in Figure 3C and C1). In the two septiferines there are simple hinge teeth associated with the septum as earlier described by Morton (2019). The

Jo

hinge area of B. variabilis, which has never been described, is characterised by a single hinge tooth (HT) in the left valve and a complementary socket (S) in the right. Ventral to these structures are a few antero-ventral dysodont teeth (AVDT) and others are located posterior (PVDT) to the ligament (L). Unlike the two septiferines (as currently defined), the anterior adductor muscle scar (AAM) of B. variabilis is posteriorly somewhat distant from the hinge plate but all three possess anterior pedal retractor muscle scars (APRM) situated antero-dorsally and, thus, partially hidden by the ligament.

Journal Pre-proof

11

3.3. phylogenetic analyses The phylogenetic tree constructed from the concatenated dataset is shown in Figure 4. The ML and BI trees resulted from the concatenated dataset of the four genes resolved nearly identical topologies with good supported nodes. Only one

pro of

disagreement was noted for the placement of an outgroup member, Pinna muricata. The phylogenetic tree depicted two major clades among the analysed species of the Mytiloidea.

Clade

A

contains

Xenostrobus,

Limnoperna,

Sinomytilus,

the

Bathymodiolinae, Lithophaginae clade 1 and Modiolinae. Clade B contains the Brachidontinae, Lithophaginae clade 2, Mytilinae, Musculinae, Septiferinae and Mytiliseptiferinae sub-fam. nov. (herein described). Sinomytilus harmandi and L. fortunei were well supported (Posterior Probability [PP] =1; Bootstrap [BS]

re-

value=100) sister species and linked with the Lithophaginae clade 1, clade A (Morton et al., 2019). These two species are sister to Leiosolenus lima (Lamy, 1919) and Leiosolenus mucronatus (Philippi, 1846) and supported by a PP value of 0.99 and a BS value of 79 (Fig. 4). Septifer bilocularis and S. excisus were resolved as representatives

lP

of a sister genus in the sub-family Musculinae, being supported by a high PP value of 0.99 but a lower BS value of 69. Species of Perumytilus and Austromytilus form a monophyletic clade (PP=0.99, BS=78), being well supported (PP=1, BS=100, Hills and Bull [1993] and Alfaro and Holder [2006]) as sister to species of Mytilisepta.

urn a

Representative of the southern lineage of P. purpuratus (Lamarck, 1819) is placed as sister to A. rostratus (Dunker, 1857). The support value for this sister relationship is, however, only supported by moderate and relatively lower values of PP and a moderate BS value of 69 (PP=0.89, BS=53, respectively Hills and Bull [1993] and Alfaro and Holder [2006]).

Jo

4. DISCUSSION

Species of Septifer and Mytilisepta are currently assigned to their own

subfamily, the Septiferinae Scarlato and Starobogatov, 1979 (Mytilidae), although Amler (1999) elevated this to familial status. Species assigned to Septifer date from the end of the Triassic, that is, >200 million years ago (mya) to the Recent (SootRyen, 1969; Coan et al., 2000). The fossil record for Mytilisepta is from the end of the Cretaceous to the Recent, that is, about the last 65 million years to the Recent. Species

Journal Pre-proof

12

of the as currently recognised Brachidontinae have a Jurassic fossil history (145-200 mya) (Soot-Ryen., 1969). As will be discussed, therefore, there does not seem to be a fossil record that suggests why the anatomically near-identical representatives of the Septiferinae and Mytiliseptiferiinae have evolved quite so separately. Morton (2015) showed that each phylogenetic lineage of the Mytiloidea has an uniquely correlated relationship between the pericardium and its contained organs, the

pro of

heart and pericardial glands, and the posterior byssal and pedal retractor musculature. In all the studied species of the Mytilidae, the pericardium is situated anterior to the posterior byssal and pedal retractor muscles – the latter typically small, the former aligned in a row of either one or more units. There are six of these for example in Mytilus galloprovincialis Lamarck, 1819 (Morton, 2015). In S. bilocularis and M. virgata there are approximately four and six pairs of posterior byssal retractor muscle blocks, respectively, whereas in B. variabilis there is only one large block that can be

re-

divided into two closely packed units. Regardless, all three taxa belong to Morton’s Category 2 in that the pericardium and its associated organs are situated anterior to the posterior byssal retractor muscle blocks. Because the heteromyarian shells of the three

lP

species here under study are broadly similar, albeit differing in overall detail, that is, tall (S. bilocularis), relatively elongate (M. virgata and B. variabilis), the pericardium is oriented horizontally and, therefore, all three species can be assigned as

urn a

representatives of the Mytilidae (Morton, 2015).

4.1. The genetic evidence

Until recently, the classification of the Bivalvia at the family level using mainly shell characters (Bouchet et al., 2010) concluded that the Mytilidae comprised eight sub-families including the Septiferinae as originally defined by Scarlato and Starobogatov (1979). Such a classification was broadly accepted by Morton (2015) on

Jo

the basis of internal anatomical characteristics and Giribet and Wheeler (2002) based on combined morphology and DNA sequence data, which have defined the integrity of the Mytiloidea within the Pteriomorphia. As have Bieler et al. (2010) and Carter et al. (2011)

Earlier, however, Matsumoto (2003), had suggested, on the basis of gene-

sequencing data, that M. (as Septifer) virgata was somewhat distinct from S. excisus but still united within the Mytilidae. Subsequently, Trovant et al. (2015), again using DNA evidence showed that M. virgata and M. bifurcata from the western and eastern

Journal Pre-proof

13

Pacific, respectively, were genetically different from S. bilocularis also from the western Pacific. Again on genetic evidence, Gerdol et al. (2017) removed M. virgata from the Mytilinae and relocated it in the Brachidontinae. Combosch et al. (2017) using a 5-gene Sanger-based approach suggested that M. virgata was most closely related to Brachidontes exustus (Linnaeus, 1758) and included, generally, within the Mytilidae. Most recently, Liu et al. (2018) using both mitochondrial and nuclear

pro of

genes, have argued that S. excisus is most closely related to species of Modiolus, Mytilus edulis Linnaeus, 1758, Perna viridis Linnaeus, 1758 and Musculista senhausia (Benson, 1842) and more distantly related to species of Brachidontes but, again, still placed within the Mytilinae.

Our study agrees with this close relationship between members of the Brachidontinae and Mytilisepta and further resolves a closer relationship between Mytilisepta and a monophyletic clade formed by representatives of Austromytilus and

re-

Perumytilus (Brachidontinae). Mytilisepta is, however, distinguished morphologically from species of the Brachidontinae by the presence of umbonal septa with an anterior adductor muscle inserted upon and between them. Species of Austromytilus and

lP

Perumytilus do not possess an umbonal septum (Trovant et al., 2015), thereby further supporting the arguments presented herein that species of Mytilisepta, based on their distinct shell morphologies, should be placed in their own subfamily – the

urn a

Mytiliseptinae sub-fam. nov. (See description in the Appendix).

4.2. Origin of the accessory posterior adductor muscle But what is the origin of the uniquely septiferine character of the accessory posterior adductor musculature? Yonge (1947) and Morton (1958) suggested that the Bivalvia evolved from a univalve ‘limpet like’ ancestor in which the dorsal conical shell became separated left and right by an antero-posterior division, the resulting

Jo

two, possibly unequal, valves being cross-connected by a posteriorly aligned ligament and anterior and posterior adductor muscles. These, in turn, were derived from ancestral pallial retractor muscles. Associated with this radical change in body form, the left and right array of, possibly four, pedal retractor muscles were also reduced to paired anterior and posterior pedal retractor muscles. Such evolutionary changes resulted in a creature similar to the primitive bivalve Fordilla (Pojeta and Runnegar, 1976) and which Morton and Yonge (1964, fig. 14 described and illustrated would look like anatomically assuming an earliest protobranch ancestry. See Cope (2000),

Journal Pre-proof

14

however, for a more recent interpretation of bivalve evolution. If the above scenario is broadly correct, however, then, in the case of species of Septifer and Mytilisepta, the evolution of the heteromyarian form (resulting in the greater expansion of the postero-dorsal region of the shell) has resulted in extra pallial retractor muscles being modified and cross-united to form an accessory posterior adductor musculature. Again because of the adoption of the heteromyarian form, the

pro of

pedal retractor muscles (PRM) of the burrowing ancestor now function as posterior byssal retractor muscles (PBRM) and in all three mytilids herein investigated, the true posterior pedal retractor muscles, typical of most mytiloideans and B. variabilis (this study) are now reduced to either vestigial fibres (M. virgata) or are absent (S. bilocularis.

Morton (2019) argued that the true bivalve adductor muscles were derived (in evolutionary terms) from cross-connected pallial retractor muscles. Similarly, such an

re-

hypothesis may also explain the evolution of the unique posterior accessory adductor muscles in representatives of the Septiferinae and, now, the Mytiliseptiferinae. Because of their separate fossil records highlighted above, that is a difference of >100

lP

million years, there is the possibility of either convergent or parallel evolution between the genera that distinguish these two septate sub-families. Herein, therefore, the systematic separation of the Mytiliseptiferinae from the Septiferinae (as currently defined) and genetic association with the Brachidontinae

urn a

(again as currently defined) is remarkable. This is because species of the two former taxa are morphologically virtually identical in that they share a similar external sculpture, an apical septum in each valve and between which is situated the anterior adductor muscle. But, equally significantly, they both possess unique accessory posterior adductor muscles. Another septate mytilid, the freshwater S. harmandi, does not possess an anterior adductor muscle (Morton and Dinesen 2010). Closely similar

Jo

to S. harmandi is Ciboticola lunata (Hedley, 1902), an Australian marine species that lives attached to shells of the Arcidae in the shallow waters of Queensland. This, unstudied, species apparently has ‘a small internal septum reduced to a groove’ (Lamprell and Healy 1998, p. 86; fig. 189). But whether it possesses an anterior adductor muscle is unknown as is nothing else about it. Genetically, S. bilocularis and S. excisus are associated with the Mytilinae while M. virgata is associated with the Brachidontinae. This is also remarkable because although B. variabilis has a similar external sculpture to M. virgata (but more

Journal Pre-proof

15

similar to S. bilocularis) in no other significant morphological respects are they similar – the characters that define the Mytiliseptiferinae not being matched by any known putative representative of the Brachidontinae. It seems possible that the septa of representatives of the Septiferinae and the Mytiliseptiferinae have evolved from the exaggerated growth of a brachidontine hinge plate (see below) that has incorporated the anterior adductor muscle onto it (Fig. 5A

pro of

and B). This would have the effect of improving the efficiency of anterior adduction by reducing shear (from about 55o to zero), that is, the anterior adductor muscle (AAM) is now oriented perpendicular to the opposed septa (SE) instead of being aligned at an angle by being inserted directly onto the concave shell valves themselves. Similarly, the location of the posterior adductor muscle between the shell valves of B. variabilis also results in shear (c---d, of about 50o). In this case, therefore, the accessory posterior adductor muscle of M. virgata helps to overcome this shear by

re-

creating a valve-closing force additional to that of the posterior adductor muscle alone.

Sinomytilus harmandi.

lP

4.3. Origins of the shell septum of the Mytiliseptiferinae (and Septiferinae) and

The internal antero-ventral shell valve margins, left and right, of representatives of the Septiferinae (and now the Mytiliseptiferinae) are characterised

urn a

by a septum between which is located the anterior adductor muscle (Fig. 3A and B). A similar shell septum is seen in the freshwater S. harmandi (Morton et al. 2019, fig. 3A). These same authors showed, however, that S. harmandi is closely related to the similarly freshwater L. fortunei and both are located in the Limnoperninae – distinct from the Septiferinae (as formerly defined). Arguing for a separate evolution of the septa in these taxa.

Jo

This study identifies how the shell septa of the Mytiliseptiferinae and S. harmandi are formed but in different ways. Illustrated are the hinge plates of M. virgata and B. variabilis (Fig. 6A and B, respectively). The left shell valve of the latter has a hinge plate upon which is situated an hinge tooth that fits into a socket on the right. Inward expansion of the hinge plate of B. variabilis and the relocation onto it of the anterior adductor muscle creates the septum of M. virgata. Conversely, ingowth of the antero-ventral region of the aseptate and hinge plate-lacking shell of L. fortunei in association with the loss of the anterior adductor muscle in S. harmandi

Journal Pre-proof

16

(Fig. 6, C and D) results in the formation of a septum which does not possess such a muscle. Such an anatomical similarity might be regarded as an example of convergent evolution between representatives of the Mytiliseptiferinae (and Septiferinae) and S. harmandi. The fact, however, that they are formed in two different ways and because in the former the left and right septa accommodate the anterior adductor muscle

pro of

between them to reduce shear, as described above (Fig. 5), whereas neither is the case for S. harmandi, convergence can be discounted.

Rather, the situation in S. harmandi seems to be related more to the extreme reduction in the anterior umbonal terminus of the shell, including the loss of the anterior adductor muscle. An ingrowth of the shell here perhaps only strengthens it at a location where, unlike in L. fortunei, it is intimately associated with a firm attachment to its chosen hard substratum in fluvial waters.

re-

Finally if, originally, representatives of both the Septiferinae and Mytiliseptiferinae have evolved from a brachidontine ancestor, species of Mytilisepta have retained a close genetic link with it, whereas those of Septifer have diverged

lP

from it, albeit genetically but not morphologically. But it still does not explain the common evolution of the accessory posterior adductor muscle in the two subfamilies, except if, as hypothesised above, in both, their function is to reduce shear and thereby improve the efficacy of shell valve adduction – possibly to enhance protection against

Appendix

urn a

both adverse physical factors and predation in their respective habitats.

The Mytiliseptiferinae sub-fam. nov. Species of the monogeneric Mytiliseptiferinae, that is, Mytilisepta (Habe, 1951) typically have an adult shell length >60 mm, solid, coloured and shiny, equivalve and inequilateral. Ventrally flattened or concave with a byssal notch. Often distorted and

Jo

highly eroded anteriorly (due to the cryptic lifestyle) obscuring the underlying shell sculpturing. Anteriorly acutely pointed, posteriorly expanded and dorsally flared and, thereby, trigonal and heteromyarian in overall form. Shell with a thick periostracum covering the shell sculpture of posteriorly bifurcated radial ribs, or lirae, which confers upon them greater compressive strength, and distinct commarginal growth lines. Juvenile shells with byssal setae distributed postero-ventrally: less obvious with age. Internally nacreous and coloured with obvious muscle attachment scars.:

Journal Pre-proof

17

Characteristically, the posterior adductor and byssal retractor muscle scars are dorsally overlain by the scars of accessory adductor muscles. Scars of the posterior pedal retractor muscles are absent. Pallial line thickened posteriorly, narrow ventrally. Ligament internal, stout and opisthodetic. Most distinctively, there is an anterior umbonal septum in each valve and between which the anterior adductor muscle is located. Species of the similarly

pro of

monogeneric Septiferinae, that is, species of Septifer, also possess an accessory posterior adductor musculature and an internal anterior umbonal septum but upon which the disposition of hinge teeth differ from those species of the Mytiliseptiferinae. In S. bilocularis, for example, there are two, non-dysodont, hinge teeth anterior to the anterior adductor muscle in the left valve and these interlock with three more in the right valve Conversely, in M. virgata, for example, the umbonal septum is relatively larger, approximately S-shaped along its internal margin, and

re-

there is a single dysodont tooth in the left valve that is positioned beneath the adductor muscle making this antero-ventral-most region of the shell swollen. The tooth fits into a socket on the right valve similarly making the same region of this one

lP

swollen (Morton, 2019, fig. 7).

Appendix

The Mytiliseptiferinae sub-fam. nov.

urn a

Herein, a new sub-family, the Mytiliseptiferinae, is described based upon the morphological data obtained for Mytilisepta virgata (Wiegmann, 1837) by Morton (2019) and the phylogenetic arrangement of the Mytiloidea proposed in this study both of which provide sufficient information to justify this decision. Below is the description of this new mytiloid sub-family. The name Mytilisepta as a subgenus of Septifer Récluz, 1848, with M. virgata

Jo

(originally Tichogonia Wiegmann, 1837) as the type species, was erected by Habe (1951) and elevated to generic status by Huber (2010).

Mytiliseptiferinae sub-fam. nov. Morton (this study) Type genus: Mytilisepta Habe, 1951

Journal Pre-proof

18

Type species by original designation: Mytilisepta virgata Habe, 1951 (Genera of Japanese shells 1, 53) (Morton, 2019: figs 1, 2B, 3A & C, 4B, 5B, 6B, 7B, 8B, 9, 10B, 11, 12B, 13B)

Composition. The new sub-family includes a number of intertidal and shallow subtidal species from the Western Indo-Pacific Ocean (identified herein) specifically

pro of

from the central coast of Japan to Western Australia. Plus M. bifurcata from the west coast of Central North America down to Baja California (Coan and Valentich-Scott, 2012).

Diagnosis. Representatives of the Mytiliseptiferinae sub-fam. nov., can be separated from species of the Septiferinae by a superfical shell ornamentation of fine divaricating radial ribs. They can also, as described herein, be separated on genetic

re-

grounds.

Description of the shell. The shells of Mytilisepta virgata from the intertidal of Hong

lP

Kong were measured by Morton (1995) and here they attain a length of 60 mm and are equivalve, anteriorly pointed, and roundly inflated posteriorly. The umbones are located antero-ventrally. The outer sculpture is composed of stout radial and divaricating ribs, covered with a dark periostracum, which is typically eroded

urn a

especially antero-dorsally. Hinge plate in the form of a septum located anteriorly with a single hinge tooth located on that of the left valve and which is inserted into a socket on the right. Ligament opisthodetic, sunken between weak resilifers. Secondary ligament of fused periostracum connecting the two valves anterior and posterior to the ligament. The pallial line scar is thick posteriorly becoming thinner ventrally and antero-ventrally. Pallial sinus absent. Scars of the adductor muscles visible with the

Jo

posterior larger and the anterior smaller and located between the two apical septa. A characteristic accessory posterior adductor muscle covers the posterior adductor muscle and the posterior byssal retractor muscles. There is no posterior pedal retractor muscle and a small anterior pedal retractor muscle is inserted dorsally and close to the septum on each valve.

Internal morphology.

Journal Pre-proof

19

Short, sensory, siphons. Filibranch ctenidia with a ciliation of Type B(I) (Atkins 1937), non-plicate, and thus with food grooves situated dorsally and ventrally of both dorso-ventrally aligned demibranchs. Extendable labial palps with simple lips and mouth. Stomach of type III and Section I of the types elucidated by Purchon (1957) and Dinamani (1967), respectively. The mantle margins fuse left and right by the inner folds only, this being type A (Yonge, 1982). Foot well developed with a

pro of

ventral and vertically-aligned byssal groove, and a byssal gland producing a stout array of byssal threads. Dioecious (Morton, 1995). Like many other mytiloids, the outer demibranchs of all three species are some three or four filaments shorter at their anterior ends than the inner ones (Fankboner, 1971) and the ctenidial-labial palp junctions are all of Category I (Stasek, 1963).

Remarks

re-

The herein systematic separation of the Mytiliseptiferinae from representatives of the Septiferinae (as currently defined) and genetic association with the Brachidontinae (again as currently defined) is remarkable. This is because species of

lP

the two former taxa are morphologically virtually identical in that they share a similar external sculpture, an apical septum in each valve and between which is situated the anterior adductor but equally significantly they both possess unique accessory posterior adductor muscles. Genetically, S. bilocularis and S. excisus are associated

urn a

with the Mytilinae while M. virgata is associated with the Brachidontinae. This is also remarkable because although B. variabilis has a similar external sculpture of radially bifurcating lirae to M. virgata in no other significant morphological respects are they similar, the unique characters that define the Mytiliseptiferinae not being matched by the Brachidontinae. REFERENCES

Jo

Albayrak, S., Çağlar, S. 2006. On the presence of Siphonaria belcheri Hanley, 1858 [Gastropoda: Siphonariidae] and Septifer bilocularis (Linnaeus, 1758) [Bivalvia: Mytilidae] in the Iskenderun Bay (SE Turkey). Aq. Invas. 1, 292-294.

Amler, M.R.W., 1999. Synoptical classification of fossil and Recent Bivalvia. Geol. Palaeontol. 33, 237–248.

Journal Pre-proof

20

Atkins, D. 1937. On the ciliary mechanisms and interrelationships of lamellibranchs. Part III. Types of lamellibranch gills and their food currents. Quart. J. Microsc. Sci. 79, 375–421. Avelar, W.E.P., Narchi, W. 1984a. Anatomia functionel de Brachidontes darwinianus darwinianus (Orbigny, 1846) (Mollusca: Bivalvia). Universidade de São Paulo, Museo de Zoologia, Papéis Avulsos de Zoologia 35(27), 331-359 + 3 plates.

pro of

Avelar, W.E.P., Narchi, W. 1984b. Functional anatomy of Brachidontes solisianus (Orbigny, 1846) (Bivalvia, Mytilidae). Universidade de São Paulo, Boletim de Zoologia 8, 215-237.

Beedham, G.E. 1958. Observations on the non-calcareous component of the shell of the Lamellibranchia. Quart. J. Microsc. Sci. 99, 341-357.

Bieler, R., Carter, J.G., Coan, E.V. 2010. Classification of bivalve families. In:

Malacologia 52(2), 1-184.

re-

Bouchet, P., Rocroi, J.P. (Eds), pp. 113-133. Nomenclator of bivalve families.

Boltovskoy, D. ed. 2015. Limnoperna fortunei: the ecology, distribution and control of a swiftly spreading invasive fouling mussel. Invading Nature - Springer

lP

Series in Invasion Ecology. Volume 10. Cham, Switzerland: Springer International Publishing. pp. i-xxxi + 476. Bouchet, P., Rocroi, J.-P., Bieler, R., Carter, J.G., Coan, E.V. 2010. Nomenclator of bivalve families with a classification of bivalve families. Part 1. Nomenclator of

urn a

bivalve names of the family group and above. Part 2. Classification of bivalve families. Malacologia 52 (2), 1–184 Castresana, J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol, 17(4), 540-552. Carter, J.G., Altaba, C.R., Anderson, L.C., Araujo, R., Biakov, A.S., Bogan, A.E., Campbell, D.C., Campbell, M., Jin-hua, C., Cope, J.C.W., Delvene, G.,

Jo

Dijkstra, H.H., Zong-jie, F., Gardner, R.N., Gavrilova, V.A., Goncharova, I.A., Harries, P.J., Hartman, J.H., Hautmann, M., Hoeh, W.R., Hylleberg, J., Bao-yu, J., Johnston, P., Kirkendale, L., Kleeman, K., Hoppka, J., Kriz, J., Machado, D., Malchus, N., Márquez-Aliaga, A., Masse, J.P., McRoberts, C.A., Middelfart, P.U., Mitchell, S., Nevesskaja, L.A., Özer, S., Pojeta, J., Polubotko, I.V., Pons, J.M., Popov, S., Sánchez, T., Sartori, A.F., Scott, R.W., Sey, II., Signorelli, J.H., Silantiev, V.V., Skelton, P.W., Thomas, S., Waterhouse, J.B., Wingard, G.L.,

Journal Pre-proof

21

Yancey, T. 2011. A synoptical classification of the Bivalvia (Mollusca). Paleont. Contr. 4, 1–47. Choo, P.S. 1974. Preliminary studies on the culture of the mussel, Mytilus viridis, Linnaeus (Mollusca, Mytilidae) in Penang. Malaysian Agric. J. 49, 514-524. Coan, E.V., Valentich-Scott, P. 2012. Bivalve seashells of tropical West America: marine bivalve mollusks from Baja California to Northern Peru. Santa Barbara

pro of

Museum of Natural History Monographs, California.

Colgan, D.J., Ponder, W.F., Eggler, P.E. 2000. Gastropod evolutionary rates and phylogenetic relationships assessed using partial 28S rDNA and histone H3 sequences. Zool. Scr. 29, 29-63.

Coan, E.V., Valentich-Scott, P., Bernard, F.R. 2000. Bivalve seashells of western North America: marine bivalve molluscs from Arctic Alaska to Baja California. Santa Barbara Museum of Natural History Monographs, California.

re-

Combosch, D.J., Collins, T.M., Glover, E.A., Graf, D.L., Harper, E.M., Healy, J.M., Bieler, R.B., 2017. A family-level tree of life for bivalves based on a Sangersequencing approach. Mol. Phylogenet. Evol. 107, 191–208.

lP

Cope, J.C.W. 2000. A new look at early bivalve phylogeny. In Harper E.M, Crame J.A. and Taylor J.D. eds The Evolutionary Biology of the Bivalvia. The Geological Society of London. Special Publications 177, 81-95.

Dereeper, A., Guignon, V., Blanc, G., Audic, S., Buffet, S., Chevenet, F., Claverie,

urn a

J.M. 2008. Phylogeny. fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 36 (Supplement 2), W465-W469. Dinamani, P. 1967. Variation in the stomach structure of the Bivalvia. Malacologia 5, 225–268.

Dudgeon, D., Morton, B. 1982. Coral associated Mollusca of Tolo Harbour, Hong Kong. In Morton B. and Tseng C.K. eds Proceedings of the First International Marine Biological Workshop: The Marine Flora and Fauna of Hong Kong and

Jo

southern China, Hong Kong, 1980. Hong Kong: Hong Kong University Press, pp. 627-650.

Edgar, R.C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32(5), 1792-1797.

Fankboner, P.V. 1971. The ciliary currents associated with feeding, digestion and sediment removal in Adula (Botula) falcata Gould 1851. Biol. Bull. 140, 28–45.

Journal Pre-proof

22

Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294–299. Gerdol, M., Fujii, Y., Hasan, I., Koike, T., Shimojo, S., Spazzalli, F., Yamamoto, K., Ozeki, Y., Pallavicini, A., Fujita, H. 2017. The purplish bifurcate mussel Mytilisepta virgata gene expression atlas reveals a remarkable tissue functional

pro of

specialization. BMC Genomics 18, 590. http://dx.doi.org/10.1186/s12864-0174012-z

Giribet, G., Wheeler, W. 2002. On bivalve phylogeny: a high level analysis of the Bivalvia (Mollusca) based on combined morphology and DNA sequence data. Invert. Biol. 121(4), 271-324.

Giribet, G., Carranza, S., Baguna, J., Riutort, M., Ribera, C. 1996. First molecular evidence for the existence of a Tardigrada + Arthropoda clade. Mol. Biol. Evol.

re-

13, 76-84.

Gosling, E.M. ed. 1992. The mussel Mytilus. Amsterdam: Elsevier Science Publishers B.V.

lP

Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O. 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst. Biol 59(3), 307321.

urn a

Habe, T. 1951. Genera of Japanese Shells. Vol. 1, 1-96; Vol. 2, 97-186. [No identified publisher].

Habe, T. 1977. Systematics of Mollusca in Japan. Bivalvia and Scaphopoda. Tokyo: Hokuryukan.

Harper, E.M. 1997. The molluscan periostracum: an important constraint in bivalve evolution. Palaeontology 40, 71-97.

Jo

Harper, E.M., Skelton, P.W. 1993. A defensive value of the thickened periostracum in the Mytiloidea. The Veliger 36, 36-42.

Huber, M. 2010. Compendium of bivalves. A full-color guide to 3,300 of the world’s marine bivalves. A status on Bivalvia after 250 years of research. Hackenheim: ConchBooks.

Iwasaki, K. 1995. Comparison of mussel bed community between two intertidal mytilids Septifier virgata and Hormomya mutabilis. Mar. Biol. 123, 109–119. Kartavtsev, Y.P., Sharina, S.N., Chichvarkhin, A.Y., Chichvarkhina, O.V.,

Journal Pre-proof

23

Masalkova, N.A., Lutaenko, K.A., Oliveira, C. 2018. Genetic divergence of mussels (Mollusca, Mytilidae) based on the 28S rRNA, 18S rRNA, and H3 nuclear gene sequences. Russ. J. Genet. 54, 652-669. Kenchington, E., Landry, D., Bird, C.J. 1995. Comparison of taxa of the mussel Mytilus (Bivalvia) by analysis of the nuclear small-subunit rRNA gene sequence. Can. J. Fish. Aquat. Sci. 52, 2613-2620.

pro of

Katoh, K., Standley, D.M. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol Evol. 30(4), 772-780.

Kumar, S., Stecher, G., Tamura, K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33(7), 1870-1874. Lamprell, K., Healy, J. 1998. Bivalves of Australia, Vol. 2. Backhuys, Leiden. Lanfear, R., Frandsen, P.B., Wright, A.M., Senfeld, T., Calcott, B. 2016.

re-

PartitionFinder 2: new methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol. Biol. Evol. 34(3), 772-773.

lP

Lee S.Y. and Morton B. 1985. The Hong Kong Mytilidae. In Morton B. and. Dudgeon D eds Proceedings of the Second International Workshop on the Malacofauna of Hong Kong and southern China, Hong Kong, 1983. Hong Kong: Hong Kong University Press, pp. 49-76.

urn a

Lee, T., Ó Foighil, D. 2004. Hidden Floridian biodiversity: mitochondrial and nuclear gene trees reveal four cryptic species within the scorched mussel, Brachidontes exustus, species complex. Mol. Ecol. 13(10), 3527-3542. Lee, T., Ó Foighil. D. 2005. Placing the Floridian marine genetic disjunction into a regional evolutionary context using the scorched mussel, Brachidontes exustus, species complex. Evolution 59(10), 2139-2158.

Jo

Liu, J., Liu, H., Zhang, H. 2018. Phylogeny and evolutionary radiation of the marine mussels (Bivalvia: Mytilidae) based on mitochondrial and nuclear genes. Mol. Phylogenet. Evol. 126, 233–240.

Liu, J., Li, Q., Kong, L.F., Chen, J., Zheng, X. D., Yu, R.H. 2011. COI-based DNA barcoding in Mytilidae species (mollusca: bivalvia). Acta Hydrobiol. Sinica 35, 874-881. (In Chinese) Liu, J.H., Morton, B. 1994. The temperature tolerances of Tetraclita squamosa (Crustacea: Cirripedia) and Septifer virgata (Bivalvia: Mytilidae) on a

Journal Pre-proof

24

subtropical rocky shore in Hong Kong. J. Zool., Lond. 234, 325-339. Lorion, J., Kiel, S., Faure, B., Kawato, M., Ho, S.Y., Marshall, B., Tsuchida, S., Miyazaki, J.I. Fujiwara, Y. 2013. Adaptive radiation of chemosymbiotic deepsea mussels. Proc. R. Soc. B. 280, 20131243. Matsumoto, M. 2003. Phylogenetic analysis of the subclass Pteriomorphia (Bivalvia) from mtDNA COI sequences. Mol. Phylogenet. Evol. 27, 429-440.

pro of

Mattson, S., Warén, A. 1977. Dacrydium ockelmanni sp.n. (Bivalvia, Mytilidae) from western Norway. Sarsia 63, 1-6.

Metzger, M. J., Paynter, A.N., Siddall, M.E., & Goff, S.P. 2018. Horizontal transfer of retrotransposons between bivalves and other aquatic species of multiple phyla. Proc. Natl. Acad. Sci. U.S.A. 115, E4227-E4235.

Momoshima, N., Shiki, A., Takashima, Y., Maki, T., Koriyama, M., Shimozono, S., Imamura, H., Nakamata, K. 1985. Radioactive and stable cobalt concentrations

re-

in mussel in Kyushu islands, Japan. Radioisotopes 34(5), 257-61 [in Japanese]. Morton, B. 1973. Some aspects of the biology, population dynamics and functional morphology of Musculista senhausia Benson (Bivalvia: Mytilacea). Pacific Sci.

lP

28, 19-33.

Morton, B. 1977. The biology and functional morphology of Modiolus metcalfei Hanley 1844 (Bivalvia: Mytilacea) from the Singapore mangrove. Malacologia 16, 500-518.

urn a

Morton, B. 1980. The biology and some aspects of the functional morphology of Arcuatula elegans (Mytilacea: Crenellinae). In. Proceedings of the First International Workshop on the Malacofauna of Hong Kong and Southern China, Hong Kong, 1977. (Ed. B. Morton). Hong Kong University Press, Hong Kong. pp.331-345.

Morton, B. 1988. The population dynamics and reproductive cycle of Brachidontes

Jo

variabilis (Bivalvia: Mytilidae) in a Hong Kong mangrove. Malacol. Rev. 21, 1-9.

Morton, B. 1991a. A molluscan fouling community dominated by Septifer virgata (Bivalvia: Mytilidae) in Hong Kong. Malacol. Rev 24, 115-118.

Morton, B. 1991b. The biology of Brachidontes erosus (Bivalvia: Mytilidae) in Princess Royal Harbour, Albany, Western Australia. In. Proceedings of the Third International Marine Biological Workshop: the Marine Flora and Fauna of Albany, Western Australia, 1988. (Eds. F.E. Wells, D.I. Walker, H.

Journal Pre-proof

25

Kirkham, R. Lethbridge). Western Australian Museum, Perth. pp. 693-712. Morton, B. 1995. The population dynamics and reproductive cycle of Septifer virgata (Bivalvia: Mytilidae) on an exposed rocky shore in Hong Kong. J. Zool., Lond. 235, 485-500. Morton, B. 2012. A significant and un-appreciated intertidal mytiloidean genus: the biology and functional morphology of Brachidontes puniceus (Bivalvia:

pro of

Mytilidae) from the Cape Verde Islands. African J. Mar. Sci. 34, 71-80. Morton, B. 2015. The evolution, adaptive radiation and classification of the Mytiloidea (Bivalvia): clues from the pericardial - posterior byssal retractor muscles complex. Molluscan Res. 35, 1-19.

Morton, B. 2019. The biology and functional morphology of Septifer bilocularis and Mytilisepta virgata (Bivalvia; Mytiloidea) from corals and the exposed rocky shores, respectively, of Hong Kong. Regional Stud. Mar. Sci. 25,

re-

https://doi.org/10.1016/j.rsma.2018.100454.

Morton, B., Dinesen, G. 2010. Colonization of Asian freshwaters by the Mytilidae (Bivalvia): and a comparison of Sinomytilus harmandi from the Tonle-Sap

lP

River, Phnom Penh, Cambodia, with Limnoperna fortunei. Molluscan Res. 30, 57-72.

Morton, B., Dinesen, G.E. 2011. The biology and functional morphology of Modiolarca subpicta (Bivalvia: Mytilidae: Musculinae), epizoically symbiotic

urn a

with Ascidiella aspersa (Urochordata: Ascidiacea), from the Kattegat, Northern Jutland, Denmark. J. Mar. Biol. Ass. UK. 91, 1637-1649. Morton, B., Morton, J. 1983. The Sea Shore Ecology of Hong Kong. Hong Kong: Hong Kong University Press.

Morton, B., Puljas, S. 2017. Aspects of the biology and functional morphology of Mytilaster minimus (Bivalvia: Mytiloidea: Mytilidae) from the intertidal dinaric

Jo

karst of Croatia (Adriatic Sea). J. Mar. Biol. Ass. U.K. 96, 1347–1361. Morton, B., Dinesen, G.E., Ockelmann, K.W. 2016. Functional morphology, biology, sexual strategy and life history trait of the circum-boreal, adventitious cryptbuilding, Crenella decussata (Bivalvia: Mytiloidea: Crenellidae). J. Mar. Biol. Ass. UK. 96, 1597-1616.

Morton, B., Dudgeon, D., Lee, S.Y., Bacon-Shone, J., Leung, T.C. 1991. Hong Kong's scleractinian coral gallery communities. Asian Mar. Biol. 8, 103-115.

Journal Pre-proof

26

Morton, B., Leung, P.T.Y., Wei, W.H., Lee, G.Y. 2019. The origins and relationships of Asian freshwater Mytiloidea (Bivalvia). A morphological and genetic comparison of Sinomytilus harmandi, Limnoperna fortunei and Septifer bilocularis. Molluscan Res. (In press) Morton, J.E. 1958. Molluscs. London, Hutchison University Library. Morton, J.E., Yonge, C.M. 1964. Classification and structure of the Mollusca. In

pro of

Wilbur K.M and Yonge C.M. eds Physiology of Mollusca 1. New York: Academic Press, pp. 1-58.

Nguyen, L.T., Schmidt, H.A., von Haeseler, A., Minh, B.Q. 2014. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 32(1), 268-274.

Nomura, S. 1936. A new species of the genus Septifer from Japan (S. keeni). Venus 6(4), 205-208.

Center, Spec. Publ. 15, 85-88.

re-

Ockelmann, K. 1995. Ontogenetic characters of mytilaceans. Phuket Mar. Biol.

Ockelmann K.W., Cedhagen, T. 2019 Modiolus cimbricus sp. nov. (Bivalvia:

556, 1–13.

lP

Mytilidae) endemic in the Kattegat-Skagerrak. European J. European Taxon.

Ong Che, R.G., Morton, B. 1992. Structure and seasonal variations in abundance of the macro-invertebrate community associated with Septifer virgata (Bivalvia:

urn a

Mytilidae) at Cape d’Aguilar, Hong Kong. Asian Mar. Biol. 9, 217-233. Owada, M. 2007. Functional morphology and phylogeny of the rock-boring bivalves Leiosolenus and Lithophaga (Bivalvia: Mytilidae): a third functional clade. Mar. Biol. 150, 853-860.

Owada, M. 2015. Functional phenotypic plasticity of the endolithic mytilid Leiosolenus curtus (Lischke, 1874)(Bivalvia: Mytilidae). Molluscan Res. 35,

Jo

188-195.

Pascual, S., Villalba, A., Abollo, E., Garci, M., González, A.F., Nombela, M., Posada, D., Guerra, A. 2010. The mussel Xenostrobus securis: a well-established alien invader in the Ria de Vigo (Spain, NE Atlantic). Biol. Invasions, 12, 2091-2103. Passamaneck, Y.J., Schander, C., Halanych, K.M. 2004. Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences. Mol. Phylogenet. Evol. 32, 25-38. Pelseneer, P. 1911. Les lamellibranches de l’ expédition du Siboga. Partie

Journal Pre-proof

27

anatomique. Siboga Exped. Monog. 53a, 1-125. Pilsbry, H.A., Raymond, W.J. 1898. Note on Septifer bifurcatus Conrad. Nautilus 12(6), 69-71. Plazzi, F., Ceregato, A., Taviani, M., Passamonti, M. 2011. A molecular phylogeny of bivalve mollusks: ancient radiations and divergences as revealed by mitochondrial genes. PLoS One, 6, e27147.

pro of

Posada, D., Buckley, T.R. 2004. Model selection and model averaging in phylogenetics: advantages of Akaike information criterion and Bayesian approaches over likelihood ratio tests. Syst. biol. 53, 793-808.

Pojeta, J., Runnegar, B. 1974. Fordilla troyensis and the earliest history of pelecypod mollusks. American Sci. 62, 706-711.

Purchon, R.D. 1957. The stomach in the Filibranchia and Pseudolamellibranchia. Proc. Zool. Soc. London 129, 27-60.

re-

Qi, Z. ed. (2004) Seashells of China. Beijing, China Ocean Press. pp. i-v + 391 + plates 1-193.

Récluz, C.A. 1848. Description d'un nouveau genre de coquille bivalve nommé

lP

Septifère (Septifer). Rev. Zool., Soc. Cuv. 11, 275-279. Ronquist, F., Teslenko, M., Van Der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Huelsenbeck, J.P. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 61(3), 539-542.

urn a

Sará, G., Romano, C., Mazzola, A. 2008. A new lessepsian species in the western Mediterranean (Brachidontes pharaonis Bivalvia: Mytilidae): density, resource allocation and biomass. Mar. Biodiv. Rec. 1, e8. Scarlato, O.A., Starobogatov, Ya.I. 1979. General evolutionary patterns and the system of the class Bivalvia. Trudy Zoologicheskogo Instituta AN SSSR 80, 5– 38. (In Russian).

Jo

Seed, R. 1980. A note on the relationship between shell shape and life habits in Geukensia demissa and Brachidontes exustus (Mollusca: Bivalvia). J. Moll. Stud. 46(3), 293-299.

Seed, R., Brotohadikusumo, N.A. 1994. Spatial variation in the molluscan fauna associated with Septifer virgata (Bivalvia: Mytilidae) at Cape d’Aguilar, Hong Kong. In Morton B. ed Proceedings of the Third International Workshop on the Malacofauna of Hong Kong and southern China, Hong Kong, 1992. Hong Kong: Hong Kong University Press, pp. 427-444.

Journal Pre-proof

28

Seed, R., Lee, S.Y. 1995. Mechanical and behavioural aspects of predation in two contrasting species of predatory crabs, Eriphia laevimana smithii (Xanthidae) and Thalamita danae (Portunidae). In Morton B, Xu Gongzhao, Zou Renlin, Pan Jinpei, Cai Guoxiong eds Proceedings of the Second International Conference on the Marine Biology of the South China Sea, Guangzhou, China, 1993. Beijing: World

Publishing Corporation, pp. 16-26.

pro of

Seed, R., Richardson, C.A. 1999. Evolutionary traits in Perna viridis (Linnaeus) and Septifer virgata (Wiegmann) (Bivalvia: Mytilidae). J. Exp. Mar. Biol. Ecol. 239, 273-287.

Seed, R., Richardson, C.A. 2003. Mussels: catalysts to understanding change on rocky shores. In Morton B. ed Perspectives on Marine Environmental Change in Hong Kong and Southern China, 1977-2001. Proceedings of an International

University Press, pp. 409-432.

re-

Workshop’s Reunion Conference, Hong Kong 2001. Hong Kong: Hong Kong

Sharma, P.P., Zardus, J.D., Boyle, E.E., González, V.L., Jennings, R.M., McIntyre, E., Wheeler, W.C., Etter, R.J., Giribet, G. 2013. Into the deep: a phylogenetic

lP

approach to the bivalve subclass Protobranchia. Mol. Phylogenet. Evol. 69, 188204.

Simões, M.G., Kowalewski, M. 1998. Shell beds as palaeoecological puzzles: a case study from the Upper Permian from the Paraná Basin, Brazil. Facies 38, 175-

urn a

196.

Simões, M.G., Matos, S.A., Anelli, L.E., Rohn, R., Warren, L.V., David, J.M. 2015. A new Permian bivalve-dominated assemblage in the Rio do Rasto Formation, Paraná Basin, Brazil: faunal turnover driven by regional-scale environmental changes in a vast epeiric sea. J. South Amer. Earth Sci. 64, 14-26. Soot-Ryen, T. 1953. Choromytilus, a new genus in the Mytilidae. Rev. Soc. Malacol.

Jo

“Carlos de la Torre” 8(3), 121-122. Soot-Ryen, T. 1955. A report on the family Mytilidae (Pelecypoda). Rep. Allan Hancock Pacif. Exped. 20, 1-175.

Journal Pre-proof

29

Soot-Ryen, T. 1969. Superfamily Mytilacea Rafinesque, 1815. In Moore R.C. ed Treatise on Invertebrate Paleontology. Part N, Mollusca 6, Bivalvia 1 (of 3). Lawrence, Kansas: Geological Society of America Inc. and University of Kansas Press, pp. N271-N280. Stasek, C.R. 1963. Synopsis and discussion of the association of ctenidia and labial palps in the bivalved Mollusca. The Veliger 6, 91–97.

pro of

Sze, P.W.C., Lee, S.Y. 1995. The potential role of mucus in the depuration of copper from the mussels Perna viridis (L.) and Septifer virgata (Wiegmann). Mar. Pollut. Bull. 31, 390-393.

Tanaka, M.O., Alves de Magalhães, C. 1999. Morphometric species recognition in Brachidontes darwinianus and Brachidontes solisianus (Bivalvia: Mytilidae). The Veliger 42(3), 267-274.

Taylor, J.D., Layman, M. 1972. The mechanical properties of bivalve (Mollusca) shell

re-

structures. Palaeontologia 15, 73-87.

Taylor, J.D., Kennedy, W.J., Hall, A. 1969. The shell structure and mineralogy of the Bivalvia. Introduction. Nuculacae-Trigonacae. Bull. Brit. Mus. Nat. Hist. (Zool.)

lP

Suppl. 3, 1–125.

Terranova, M.S., Brutto, S.L., Arculeo, M., Mitton, J.B. 2007. A mitochondrial phylogeography of Brachidontes variabilis (Bivalvia: Mytilidae) reveals three cryptic species. J. Zool. Syst. Evol. Res. 45(4), 289-298.

urn a

Thubaut, J., Puillandre, N., Faure, B., Cruaud, C., Samadi, S. 2013. The contrasted evolutionary

fates

of

deep-sea

chemosynthetic

mussels

(Bivalvia,

Bathymodiolinae). Ecol. Evol. 3, 4748-4766. Trovant, B., Orensanz, J.M.(L)., Ruzzante, D.E., Stotz, W., Néstor, G.B. 2015. Scorched mussels (Bivalvia: Mytilidae: Brachidontinae) from the temperate coasts of South America: phylogenetic relationships, trans-Pacific connections

Jo

and the footprints of Quaternary glaciations. Mol. Phylogenet. Evol. 82, 60–74. Trovant, B., Basso, N.G.,

Orensanz, J.M., Lessa, E.P., Dincao, F.,. Ruzzante, D.E.

2016. Scorched mussels (Brachidontes spp., Bivalvia: Mytilidae) from the tropical and warm-temperate southwestern Atlantic: the role of the Amazon River in their speciation. Ecol. Evol. 6(6): 1778–1798.

Tsubaki, R., Kameda, Y., Kato, M. 2011. Patterns and process of diversification in an ecologically diverse epifaunal bivalve group Pterioidea (Pteriomorphia, Bivalvia). Mol. Phylogenet. Evol. 58, 97-104.

Journal Pre-proof

30

Uliano-Silva, M., Americo, J.A., Costa, I., Schomaker-Bastos, A., de Freitas Rebelo, M., Prosdocimi, F. 2016. The complete mitochondrial genome of the golden mussel Limnoperna fortunei and comparative mitogenomics of Mytilidae. Gene, 577, 202-208. Vaidya, G., Lohman, D.J., Meier, R. 2011. SequenceMatrix: concatenation software

information. Cladistics 27(2), 171-180.

pro of

for the fast assembly of multi-gene datasets with character set and codon

Wang, R. Chief writer. 1988. Coloured Illustrations of Aquatic Mollusks in China. Zhejiang Publishing House of China.

Wang W.-X., Dei, R.C.H. 1999. Factors affecting trace element uptake in the black mussel Septifer virgata. Mar. Ecol. Prog. Ser. 186, 161-172.

Wilson, B.R. 1979. A revision of Queensland lithophagine mussels (Bivalvia, Mytilidae, Lithophaginae). Rec. Aust. Mus. 32, 435–489.

re-

Wright, M.M., Francis, L. 1984. Predator deterrence by flexible shell extensions of the horse mussel Modiolus modiolus. The Veliger 27, 140-42. Xia, X. 2018. DAMBE7: New and improved tools for data analysis in molecular

lP

biology and evolution. Mol. Biol. Evol. 35(6), 1550-1552. Xia, X., Lemey, P. 2009. Assessing substitution saturation with DAMBE. The phylogenetic handbook: a practical approach to DNA and protein phylogeny 2, 615-630.

urn a

Xia, X., Xie, Z., Salemi, M., Chen, L., Wang, Y. 2003. An index of substitution saturation and its application. Mol. Phylog. Evol. 26(1), 1-7. Xu, F., Zhang, S. eds. 2008. An illustrated bivalve fauna of China Seas. Beijing: Science Press.

Yang, W. et al. 2013. Color Atlas of Mollusca from the South China Sea. China: Huayu Nature Book Trade Co. Ltd.

Jo

Yang, W. et al. 2017. Color Atlas of Economic Molluscs from the South China Sea. China: Huayu Nature Book Trade Co. Ltd.

Yonge, C.M. 1947. The pallial organs in the aspidobranch Gastropoda and their evolution throughout the Mollusca. Phil. Trans. Roy. Soc. Ser. B 232, 443–518.

Yonge, C.M. 1982. Mantle margins with a revision of siphonal types in the Bivalvia. J. Molluscan Stud. 48, 102-103.

Journal Pre-proof

31

Yonge, C.M., Campbell, J.I. 1968. On the heteromyarian condition in the Bivalvia with special reference to Dreissena polymorpha and certain Mytilacea. Trans. Roy. Soc. Edinburgh 68, 21–43 Zhang, S. 2008. Atlas of Marine Mollusks in China. China: Ocean Press. Zheng, X., Qu, X., Zeng, X., Li, Q. 2013. Atlas of Aquatic Molluscs in China. China:

pro of

Qingdao Publishing House.

ABBREVIATIONS USED IN THE FIGURES Anterior adductor muscle scar

AVDT

Antero-ventral dysodont teeth

APRM

Anterior pedal retractor muscle scar

BN

Byssal notch

HT

Hinge teeth

L

Ligament

PAM

Posterior adductor muscle scar

PBRM

Posterior byssal retractor muscle scar

PDDT

Postero-dorsal dysodont teeth

PPRM

Posterior pedal retractor muscle

PR(I)

Prodissoconch I

PR(II)

Prodissoconch II

SE

Septum

lP

urn a

U

re-

AAM

Umbo

Legends for figures

Fig. 1. Photographs, from top to bottom, of the external and internal features of the right shell valves of Septifer bilocularis, Mytilisepta virgata and Brachidontes

Jo

variabilis. Also shown are the anterior and internal umbonal septa of Septifer bilocularis and Mytilisepta virgata.

Fig. 2. A, A diagrammatic illustration of the interior shell architecture of Brachidontes variabilis. The shell is also illustrated from the B, dorsal, C, ventral, D, posterior and E, anterior aspects (a---b indicates the positions of the greatest shell heights and x---y represents the greatest shell widths, respectively). Also indicated is the angle subtended at the umbones between the ventral and antero-dorsal shell margin. (For abbreviations see page ?).

Journal Pre-proof

32

Fig. 3. The anterior apical septa of the left shell valves of A, Septifer bilocularis and B Mytilisepta virgata. The anterior ends of the left (C1) and right (C2) shell valves of Brachidontes variabilis. (For abbreviations see page ?). Fig. 4. Phylogenetic relationships (BI tree) between members of the Mytiloidea based on concatenated sequences of COI, 18S rRNA, 28S rRNA and H3 genes. The tree is rooted by Lima lima (Linnaeus, 1758). Solid spots on a node denote good

pro of

support for both BI (PP≥95) and ML (BP≥70). Hollow spots on a node denote either good support for BI (PP≥95) but poor support for ML (BS <70) or good support for ML (BS≥70) but poor support for BI (PP<95). Nodes with no annotation denote poor support for both BI (PP<95) and ML (ML＜70). Annotations related to the taxa and clades are modified after Liu et al. (2018). Fig. 5. Transverse sections through the shells of A, Brachidontes variabilis and B, Mytilisepta virgata. The illustration shows how the location of the anterior

re-

adductor muscle between the shell valves of B. variabilis results in shear (a---b, of about 55o) whereas the apical septa of M. virgata reduces adductor shear (to 0o). Similarly, the location of the posterior adductor muscle between the shell

lP

valves of B. variabilis also results in shear (c---d, of about 50o) whereas the additional force created by the accessory posterior adductor muscle in M. virgata helps the posterior adductor muscle in overcoming this. (For abbreviations see page ?).

urn a

Fig. 6. The hinge plates of A, Mytilisepta virgata; B, Brachidontes variabilis; C, Sinomytilus harmandi and D, Limnoperrna fortunei. The illustration shows how the septum of M. virgata has been created by inward expansion of the hinge plate of B. variabilis (large open arrow) and the relocation on it of the anterior adductor muscle. In contrast, the illustration also shows how the septum of S. harmandi has been created by ingowth of the antero-ventral region of the

Jo

aseptate and hinge plate-lacking shell of L. fortunei (small open arrow) and the loss of the anterior adductor muscle of the former. (For abbreviations see page ?).

Jo

urn a

lP

re-

pro of

Journal Pre-proof

Jo

urn a

lP

re-

pro of

Journal Pre-proof

Jo

urn a

lP

re-

pro of

Journal Pre-proof

urn a

lP

re-

pro of

Journal Pre-proof

1/100

Modiolus modiolus

Modiolus auriculatus Modiolus rumphii Xenostrobus atratus Xenostrobus securis Terua arcuatilis 0.99/69 Terua pacifica 1/70 Nypamodiolus simpsoni 1/100 Vulcanidas insolatus 0.99/92 0.94/68 Bathymodiolus azoricus Bathymodiolus septemdierum 0.96/59 Idas washingtonius 1/100 Clade B Gigantidas mauritanicus Gigantidas taiwanensis 1/77 1/91 Bathymodiolus manusensis 1/94 1/100 Bathymodiolus aduloides Benthomodiolus geikotsucola 1/100 Benthomodiolus lignocola 1/100 Sinomytilus harmandi Limnoperna fortunei Leiosolenus lima 1/69 1/100 Leiosolenus mucronatuss 0.98/78 Leiosolenus curtus Septifer excisus 1/100 1/100 Septifer bilocularis2 0.99/69 1/100 Septifer bilocularis1 0.56/48

1/100

1/100

Jo

0.99/59

Musculista senhousia Musculus niger Perna viridis 1/100 Mytilus edulis Trichomya hirsuta 1/100 1/100 Hormomya sinensis 1/86 Brachidontes variabilis 1/100 Geukensia demissa Ischadium recurvum 0.90/69 1/100 Mytilisepta virgata2 1/100 Mytilisepta virgata1 Mytilisepta bifurcata2 1/100 0.98/86 Mytilisepta bifurcata1 1/82 0.89/53 Austromytilus rostratus Clade A Perumytilus purpuratus (Southern lineage) 1/78 Perumytilus purpuratus (Northern lineage) 1/100 Lithophaga antillarum Lithophaga lithophaga 1/100 Lithophaga teres Isognomon ephippium 1/100

1/100

0.98/65

0.72/52

1/100

1/99

Pinna muricata

Lima lima 0.05

Modiolinae Xenostrobus

Bathymodiolinae

Limnoperninae Lithophaginae clade 1 Septiferinae Musculinae Mytilinae Brachidontinae Mytiliseptiferinae Sub-fam. nov. Austromytilus & Perumytilus Lithophaginae clade 2 Saccostrea sp. Crassostrea angulata

Outgroups

Jo

urn a

lP

re-

pro of

Journal Pre-proof

Jo

urn a

lP

re-

pro of

Journal Pre-proof

Journal Pre-proof

33

Table 1. The list of primers used in this study. Abbreviation of gene Primer LCO1490

COI

Sequence (5'→3')

Reference

GGTCAACAAATCATAAAGATATTGG

Folmer et al. (1994)

H3

TACCTGGTTGATCCTGCCAGTAG

18S 4R

GAATTACCGCGGCTGCTGG

18S 5F

GCGAAAGCATTTGCCAAGAA

18S 9R

GATCCTTCCGCAGGTTCACCTAC

W28S_F

CTAGTAATGGCGAATGAAGC

W28S_R

AAACAAATGCTGAAATAACAC

H3F H3R

ATGGCTCGTACCAAGCAGACVGC ATATCCTTRGGCATRATRGTGAC

re-

28S rRNA

18S 1F

lP

18S rRNA

pro of

HCO2198 TAAACTTCAGGGTGACCAAAAAATCA

Giribet et al. (1996)

This study

Colgan et al. (2000)

Table 2. List of species and accession numbers of sequences used in this study. Species

COI

urn a

Subfamily Brachiodontinae

18S rRNA

28S rRNA

H3

Reference

Brachidontes variabilis

KX258464

KY081327

KY081350

KY081374

Liu et al. (2018)

Hormomya sinensis

KY081292

KY081329

KY081352

KY081376

Liu et al. (2018)

Ischadium recurvum

KT959378

-

AY622007

-

Lee & Foighil (2004) Aguilar et al. (unpublished)

Geukensia demissa

MH012213

L33450

AY145405

-

Kenchington et al. (1995) Passamaneck et al. (2004) Metzger et al. (2018)

Bathymodiolus azoricus

AY649795

AY649822

AY781148

KF720621

Thubaut et al. (2013) and therein

Bathymodiolus aduloides

HF545118

-

HF545036

HF545128

Lorion et al. (2013)

Bathymodiolus manusensis

GU966637

KF611718

GU966642

KF720618

Lorion et al. (2013),

Jo

Subfamily Bathymodiolinae

Bathymodiolus septemdierum

Thubaut et al. (2013) and therein HF545111

-

HF545031

HF545132

Lorion et al. (2013)

Benthomodiolus geikotsucola

HF545103

-

HF545023

HF545149

Lorion et al. (2013)

Benthomodiolus lignocola

AY275545

AF221648

AY781131

KF720596

Thubaut et al. (2013) and therein

Gigantidas maritanicus

FJ890502

KF611712

FJ890504

KF720609

Thubaut et al. (2013) and therein

Journal Pre-proof

34

Gigantidas taiwanensis

GU966638

KF611711

GU966641

KF720608

Idas washingtonius

AY275546

AF221645

AY781146

-

Thubaut et al. (2013) and therein

Nypamodiolus simpsoni

KF611695

KF611731

KF611700

KF720594

Thubaut et al. (2013) and therein

Terua arcuatilis

FJ937033

KF611719

GU065879

KF720619

Thubaut et al. (2013) and therein

Terua pacifica

HF545115

-

HF545040

HF545161

Lorion et al. (2013)

Vulcanidas insolatus

FJ767936

KF611704

FJ767937

KF720601

Thubaut et al. (2013) and therein

Limnoperna fortunei

NC_028706

KY829083

-

-

Sinomytilus harmandi

MK642885

MK629443

MK629448

MK642882

Uliano-Silva et al. (2016), Kartavtsev et al. (2018) Morton et al. (2019, in press)

Leiosolenus limba

KY081294

KY081331

KY081354

KY081378

Liu et al. (2018)

Leiosolenus mucronata

KY081297

KY081333

KY081357

KY081381

Liu et al. (2018)

Leiosolenus curtus

AB076944

AB201235

AB103123

LC004203

KX713397

KX713550

-

-

KY081358

KY081382

Matsumoto (2003) Owada (2007, 2015) Combosch et al. (2017) Giribet and Wheeler (2002) Plazzi et al. (2011) Liu et al. (2018)

Lorion et al. (2013) and therein

Subfamily Lithophaginae

Lithophaga lithophaga

KX713308 AF120644

AF120530

-

KY081334

Modiolus auriculatus

KY081298

KY081336

KY081360

KY081384

Liu et al. (2018)

Modiolus modiolus

FJ890501

KF611701

EF526455

KF720595

Liu et al. (2018)

Modiolus rumphii

KC429094

KC429330

KC429423

KC429165

Sharma et al. (2013)

lP

Lithophaga antillarum

pro of

Subfamily Limnoperninae

Liu et al. (2018)

Lithophaga teres

re-

Subfamily Modiolinae

Subfamily Musculinae Musculus senhousia

KY081303

-

KY081365

KY081389

Musculus niger

KX713481

KX713316

KX713404

-

Combosch et al. (2017)

Perna viridis

KY081304

KY081342

KY081366

-

Liu et al. (2018)

Mytilus edulis

KC429095

KC429331

KC429424

KC429166

Sharma et al. (2013)

Trichomya hirsuta

KX713503

-

KX713436

KX713583

Combosch et al. (2017)

Mytilisepta virgata 1

MK642883

MK629439

MK629444

MK642878

This study

Mytilisepta virgata 2

MK642884

MK629440

MK629445

MK642879

This study

Mytilisepta bifurcata 1

-

KJ453814

KJ453830

-

Trovant et al. (2014)

Mytilisepta bifurcata 2

-

KJ453815

KJ453831

-

Trovant et al. (2014)

-

MK629441

MK629446

MK642880

Morton et al. (2019, in press)

-

MK629442

MK629447

MK642881

Morton et al. (2019, in press)

KY081306

KY081344

KY081368

KY081391

Liu et al. (2018)

urn a

Subfamily Mytilinae

Subfamily Mytiliseptiferinae

Subfamily Septiferinae

Jo

Septifer bilocularis Septifer bilocularis Septifer excisus

Genus Austromytilus and Perumytilus Austromytilus rostratus

KJ453835

KJ453812

KJ453829

-

Trovant et al. (2014)

Perumytilus purpuratus 1

KJ453884

KJ453818

KJ598047

-

Trovant et al. (2014)

Perumytilus purpuratus 2

KJ453839

KJ453821

KJ453825

-

Trovant et al. (2014)

GQ480323

AB594348

AB594397

-

Liu et al. (2011),

Genus Xenostrobus Xenostrobus atratus

Journal Pre-proof

Xenostrobus securis

35 Tsubaki, Kameda, & Kato (2011) Pascual et al. (2010)

FJ949108

FJ949123

-

-

Crassostrea angulata

KY081307

KY081345

KY081369

KY081392

Liu et al. (2018)

Isognomon ephippium

KY081310

KY081348

KY081372

KY081394

Liu et al. (2018)

Pinna muricata

KY081311

KY081349

KY081373

KY081395

Liu et al. (2018)

Saccostrea sp.

KY081308

KY081346

KY081370

KY081393

Liu et al. (2018)

Lima lima

KC429101

KC429339

KC429434

KC429174

Combosch et al. (2017)

Jo

urn a

lP

re-

pro of

Outgroups

Journal Pre-proof

Jo

urn a

lP

re-

pro of

Declaration of Interest File The authors declare that they have no Conflict of Interest

36

Journal Pre-proof

Jo

urn a

lP

re-

pro of

Brian Morton: Conceptualization, Writing original draft, Reviewing and Editing, Priscilla Leung: Supervision, Methodology, Data collection and analysis, Data curation, Jiehong Wei: Data collection and analysis, Visualization. Gabriel Y. Lee: Visualisation, Software, preparation.

37