A new site-specific integration system for mycobacteria

ARTICLE IN PRESS Tuberculosis (2005) 85, 317–323

Tuberculosis http://intl.elsevierhealth.com/journals/tube

A new site-specific integration system for mycobacteria Jeffrey Murrya, Christopher M. Sassettib, Jonathan Moreira, James Lanea, Eric J. Rubina, a

Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Ave., Boston, MA 02115, USA b Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, 55 Lake Ave. North, S6-141, Worcester, MA 01655, USA

KEYWORDS fC31 integrase; Site-specific recombination

Summary Site-specific integration into the mycobacterial chromosome can produce stable transformants useful for understanding pathogenesis. However, gene expression can be problematic at certain sites of integration. We have used the Streptomyces fC31 integration system to integrate vector DNA into Mycobacterium smegmatis, M. bovis BCG, and M. tuberculosis through site-specific recombination. A single dominant insertion site was found in M. smegmatis, as previously reported. Three different insertion sites were found in M. bovis BCG. In M. smegmatis, integrated vectors appear to be far more stable than episomal plasmids during unselected passage in vitro, although excision products are detectable. Plasmids based on the fC31 integration system could make useful tools for the study of mycobacterial genetics. & 2005 Elsevier Ltd. All rights reserved.

Introduction Mycobacterium tuberculosis is an important pathogen that infects close to 2 billion people worldwide (WHO). Numerous genetic tools have recently become available to study M. tuberculosis and other mycobacteria. In particular, protein expression of plasmid-encoded genes can now be easily Corresponding author. Tel.: +1 617 432 3335;

fax: +1 617 432 3259. E-mail address: [email protected] (E.J. Rubin).

performed. However, stable transformation with episomal plasmids requires continuous antibiotic selection. Such selection is not practical when organisms are used for infection and, therefore, bacteria may lose plasmids as infection progresses. Two strategies have been used to produce stable expression. One is the use of homologous recombination to create stable double-crossover strains. This has proven difficult in slow-growing mycobacterium such as M. tuberculosis and M. bovis BCG, where problems have been encountered due to low levels of homologous recombination, high

1472-9792/$ - see front matter & 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.tube.2005.08.016

ARTICLE IN PRESS 318 levels of non-homologous recombination, and high levels of variation in recombination frequencies at different loci.1 An alternative method to produce chromosomal recombinants is to use site-specific recombination. This approach has three advantages. First, genes reproducibly integrate at a single site (or, at least, a limited number of sites). Any effects of the integration sites (their influence on gene expression and bacterial biology) will be equally applicable to any insertion. Second, genes are integrated in single copy, thus mitigating artifacts that can occur with multicopy plasmids. Finally, integrants are generally much more stable than episomes. Site-specific recombination has been used extensively in mycobacteria using the integrase produced by phage L5.2 This protein catalyzes the insertion of DNA into a tRNA locus and produces recombinants at high frequency. The L5 integrase has become one of the central tools in mycobacterial molecular biology. However, the integration site used by this phage has one principal drawback. This locus has proven unfavorable for transcription of integrated genes and thus, in our hands, few genes are expressed efficiently from their native promoters. Recent studies in bacterial and mammalian systems have demonstrated the usefulness of a new group of large serine recombinases for sitespecific recombination. Characterization of the integrase gene of fC31, a bacteriophage that infects Streptomyces coelicolor, has demonstrated that this enzyme catalyzes recombination between the phage attachment site (attP) and the attachment site on the bacterial chromosome (attB) independent of host factors or other phage-encoded products.3 Similar to the reaction catalyzed by the well-studied l integrase, fC31 integrase catalyzes recombination between non-identical attP and attB sites, creating the hybrid sites attR and attL (Fig. 1). In vitro studies with fC31 integrase have shown that this protein will not independently catalyze the reverse excision reaction, which would recombine attR and attL to recreate attP and attB.4 This specificity indicates that integration products created by fC31 integrase are stably maintained when no additional excision factors are present. Despite the directionality of this integration reaction, the recognition sites characteristic of the fC31 integrase contain unusually small core regions. The minimal recognition sites, which are merely 39 and 34 bp for attP and attB, respectively,5 share a 50 -TTG-30 sequence at the core region in S. coelicolor and only 50 -TT-30 in other Streptomyces species.6,7 This small core region allows variation in the recognition site specificity of

J. Murry et al.

pIJ8600 attP attBsm (F)

X attB

attBsm (R)

attP

attL

attR

attBsm (R)

Figure 1 A model illustrating the recombination event that fC31 integrase mediates between attP and attB. Arrows are used to indicate primers designed to amplify attR [primers: attP and attBsm(R)] or attB [primers: attBsm(F) and attBsm(R)] in M. smegmatis.

the fC31 integrase. Studies using S. coelicolor strains in which the standard attB site is not present have found that fC31 integrase can use alternative pseudo-attB sites to facilitate recombination.7 In addition, recent studies have demonstrated that fC31 integrase can catalyze recombination between the standard attB site and pseudo-attP sites in mammalian cells, demonstrating the diversity of organisms in which the fC31 integrase can function effectively.8 The above studies indicate that the fC31 integrase may be useful in the development of new integration vectors for use in mycobacteria. Both Streptomyces and Mycobacterium are in the same Actinomycete family and both are characterized by GC-rich genomes. This characteristic, as well as the demonstrated diversity of integration sites that have been observed with the fC31 integration system make this system attractive for the development of new mycobacterial integrating vectors. We show here that the fC31 integrase/attP system facilitates integration into both rapidly and slowly growing mycobacteria. This will most likely be useful in future genetic studies with mycobacteria.

Materials and methods Bacterial strains, growth conditions and plasmids Mycobacterium smegmatis mc2-155, M. bovis BCG Pasteur, and M. tuberculosis H37Rv were

ARTICLE IN PRESS A new site-specific integration system for mycobacteria

319

maintained by standard methods.9 When necessary apramycin was added to medium (30 mg/ml). The plasmids pIJ8600 and pIJ865510 were kindly provided by Daniel Kearns. pMV306 was obtained from Adrie Steyn. pMV306 is a derivative of pMV3612 in which the expression cassette was replaced by a multiple cloning site. pPE207 was obtained from Julian Davies.11 Plasmids were introduced into M. smegmatis, M. bovis BCG, and M. tuberculosis using standard transformation methods.12,13

70 1C for 45 s; and 70 1C for 5 min. PCR product was diluted 1/10 and 1 ml was used for the next round, using the same conditions, except with primers AP1 and attP2 and with 70 1C for 2 min at each cycle instead of the 45 s used previously. PCR products from the second round were extracted from the gel using a QIAquick kit (Qiagen). DNA sequencing was performed at the Harvard Medical School Microbiology DNA Core Facility using the attP2 primer. Sequences were aligned using ClustalW.

Amplification of M. smegmatis integration products

Results

M. smegmatis integration products were amplified using primers attP and attBsm (R). All oligonucleotides used in this study are listed in Table 1. Polymerase chain reactions (PCRs) using these primers were performed by using 1 unit of Taq, 1.5 mM MgCl2, 10% (vol/vol) DMSO, and 2 ml of a dense culture of mc2-155 pIJ8600 transformants. PCR conditions were 94 1C for 60 s; 30 cycles of 94 1C for 45 s, 60 1C for 45 s, 70 1C for 45 s; and 70 1C for 5 min. The same conditions were also used for primers attBsm (F) and attBsm (R) to amplify the attB site from non-integrated M. smegmatis genome. Products were analyzed by agarose gel electrophoresis.

BCG integration site determination Genomic DNA was extracted from apramycin resistant pIJ8600 transformants as previously described.14 Genomic DNA was cut with the restriction enzyme BsaHI and ligated to annealed adaptors A1 and A2 according to standard molecular biology methods.15 Ligation products were amplified using hot start PCR. Reactions were set up in 50 ml volumes with 1.5 mM MgCl2, primer AP1, primer attP, and 2 ml ligation products. PCR conditions were 94 1C for 5 min (1 unit of Taq was added after this step); 30 cycles of 94 1C for 45 s, 58 1C for 45 s,

Plasmid integration in mycobacteria To test whether fC31 integrase could facilitate integration into a mycobacterial genome, we used the pIJ8600 plasmid. This plasmid contains the fC31 attP, the fC31 integrase, an Escherichia coli origin of replication, and an apramycin resistance marker that allows selection in both E. coli and mycobacteria.10 M. smegmatis, M. bovis BCG, and M. tuberculosis were each electroporated with pIJ8600 and selected for resistance to apramycin. The efficiency of M. bovis BCG transformation with pIJ8600 was determined by titration of the electroporation product. Only 4 cfu/mg were obtained when pIJ8600 plasmid was electroporated into 400 ml dense electrocompetent M. bovis BCG and plated on apramycin. By contrast, 1
104 cfu/ mg were obtained when pPE207 plasmid was electroporated into 400 ml of the same preparation of dense electrocompetent M. bovis BCG. Similar numbers of transformants were obtained in M. tuberculosis, H37Rv.

Sequence determination of integration sites Santhosh and Dharmalingam previously determined the sequence for the right hybrid site (attR) for fC31 integrase mediated insertion into the

Table 1 Oligonucleotide

Sequence

attP attBsm (R) attP2 A1 A2 AP1 attBsm (F)

50 -CTCTATGGCCCGTACTGACG 50 GATCAGCTCTTTCCACCGACTC 50 -CAGAAGCGGTTTTCGGGAGTAGTG 50 -CGACCACGACCA 50 -TGGTGCTGGTGGAATAGTAGACGCTCTGA 50 -GTCCAGTCTCGCAGATGATAAGG 50 -GAAGTGCACCAGTGGCGAGAAC

ARTICLE IN PRESS 320 M. smegmatis chromosome (GenBank accession number AF199359; unpublished data). To confirm that integration occurred in M. smegmatis, the sequence determined by Santhosh and Dharmalingam was used to design primers to amplify the attR product (Fig. 1) from clones recovered from the pIJ8600 transformation. Sequences for all oligonucleotides referred to as primers or adaptors are listed in Table 1. Twelve colonies were screened by PCR and each of them generated a band of the appropriate size—approximately 400 base pairs— indicating integration had occurred at the reported attB site. The remaining portion of the attB sequence for M. smegmatis was deduced using the M. smegmatis genomic database made available by The Institute for Genomic Research (http:// www.tigr.org; Fig. 2). As there was no clear homologue for the M. smegmatis attB site in the known M. tuberculosis genome, another strategy was used to determine the insertion site in M. bovis BCG. Total genomic DNA was extracted from apramycin resistant M. bovis BCG pIJ8600 transformants, digested with BsaHI, and ligated to annealed adaptors. PCR products were amplified using hemi-nested PCR. PCR products contained clearly distinguishable bands in 9 of the 14 colonies that were screened using this method. The distinctive band identified in each of these nine samples was purified using agarose gel electrophoresis and sequenced. Sequencing results from this approach identified three plasmid/BCG attR sites. The predominant integration site found using this approach was labeled attB1 and occurred in 5 samples. The remaining two integration sites were labeled attB2 and attB3 and occurred in two samples each. Sequencing results from each attB site were used to search the M. tuberculosis genome through the TubercuList web server (http://genolist.pasteur.fr/ TubercuList/). In each case, the M. bovis BCG

Figure 2 Sequences of the attachment sites for the fC31 integrase. The Streptomyces coelicolor attB site is the natural integration site for the bacteriophage fC31. The core sequence is TT, in bold at the center of each attB and the attP. Conserved sequences in each attB site are also in bold and listed at the bottom of the alignment. Those nucleotides conserved in four of the five sequences are in lower case at the bottom of the alignment.

J. Murry et al. sample sequencing results were identical to known sequences from the M. tuberculosis genome. Using the M. tuberculosis genome, the other half of each attB site was deduced (Fig. 2). Integration sites for fC31 integrase have previously been identified in two other Actinomycete genera: Streptomyces and Kitasatospora. In each of these genera, the fC31 integrase mediates recombination in a dominant site within an ORF encoding a pirin homolog.7,16 Using M. smegmatis sequence information made available by The Institute for Genome Research, we determined that the above identified attB insertion site is located within gatA, a gene of the amidase family most likely encoding a Glu-tRNAGln amidotransferase. As determined by sequence information on TubercuList (http://genolist.pasteur.fr/TubercuList/), M. bovis BCG attB1, attB2, and attB3 sites were located within a putative dehydrogenase (Rv3829c), a possible fatty acyl-CoA reductase (Rv1543), and an unknown hypothetical protein (Rv2213a), respectively.

Stability of integration product To test for the presence of chromosomal DNA that did not contain an insertion at the attB site in apramycin resistant pIJ8600 M. smegmatis clones, primers complimentary to either side of the attB site were used (Fig. 1). PCR reactions were set up using apramycin resistant pIJ8600 M. smegmatis clones and 3 primers—attBsm (F), attBsm (R), and attP. In each reaction, two bands were seen, indicating that both attR and attB were present in each sample (Fig. 3). As each sample was generated from a single colony, these results indicated that both the integrated and excised forms of pIJ8600 were present. Similar results were seen using BCG colonies that contained pIJ8600 integrated in the attB1 BCG insertion site (data not shown). The stability of the integration product in M. smegmatis was further examined by serial passage of M. smegmatis containing pIJ8655 (a plasmid derived from pIJ860010) without the presence of apramycin. Control experiments were set up with M. smegmatis containing pMV306, an L5-based integrating plasmid carrying a hygromycin resistance marker, or pPE207, a multicopy extrachromosomal pAL5000-based plasmid carrying an apramycin resistance marker. As shown in Fig. 4, pIJ8655 was stably maintained in M. smegmatis for over 100 generations without selective pressure. Similarly, the integrating plasmid pMV306 was also stably maintained for over 100 generations. In contrast, pPE207 was consistently lost when selective pressure was removed. In one replicate culture

ARTICLE IN PRESS A new site-specific integration system for mycobacteria

321

log % control cfu

2

1

0

(Fig. 4, triangles), pPE207 was lost immediately. In the other two replicates containing pPE207 (Fig. 4; circles and squares), only 1–30% of the colony forming units (cfu) maintained the plasmid after about 100 generations (as determined by the ability to grow on plates containing apramycin).

(A)

0

50

100

0

50

100

3

log % control cfu

Figure 3 Amplification products of attB and attR from M. smegmatis pIJ8600 colonies. Each PCR reaction contained DNA from a single pIJ8600 colony. The three primers used were complimentary to both attB and attR. Those complimentary to attB—attBsm(F) and attBsm(R)—produced a 600 bp product. Those primers complimentary to attR—attP and attBsm(R)—produced a 400 bp product in samples with integrated plasmid. Lanes 1–5 contain individual M. smegmatis pIJ8600 colonies. Lane 6 contains M. smegmatis without pIJ8600.

2

1

0 (B) 3 2

In this study we used the fC31 integrase and attP to facilitate site-specific integration into M. smegmatis, M. bovis BCG, and M. tuberculosis, demonstrating that this system functions efficiently in mycobacteria. The attB sites that were found in M. smegmatis and M. bovis BCG show that the fC31 recombinase system tolerates significant sequence variation at the integration sites as expected, but they also share some conserved regions. Specifically, each site has a GGnG or GnGG motif six or seven bp to the left of the core sequence and a CCnC or CnCC motif six bp to the right of the core sequence. This is consistent with previous studies of pseudo-attB sites7 and also agrees with previous biochemical studies, which indicate that the fC31 integrase functions as a dimer.4 Despite the previously demonstrated directionality of fC31-mediated integration, we could consistently detect excised plasmid in both M. smegmatis and M. bovis BCG. There may be two explanations for this. First, the fragment containing the fC31 integrase in pIJ8600 might also encode

1 log % control cfu

Discussion

0 -1 -2 -3 -4 0

(C)

50

100

Number of Generations

Figure 4 Stability of fC31-based plasmids. M. smegmatis was transformed with the fC31-based plasmid pIJ8655 encoding apramycin resistance (A), the L5-based integrating plasmid pMV306 encoding hygromycin resistance (B), or the multicopy pAL5000-based plasmid pPE207 carrying apramycin resistance (C). These strains were serially passaged in triplicate in 7H9 Middlebrook medium without the presence of drug and regularly tittered on control LB plates with or without selective drug to measure rates of vector retention.

ARTICLE IN PRESS 322 an excisionase. Bacteriophage genomes commonly contain genes that overlap and are translated from different reading frames. In fact, the l, P22, and 16-3 phages each have overlapping int (integrase) and xis (excisionase) genes.17–19 As the fC31 attP site is located within the int promoter, there are a few hundred bps of sequence prior to the int gene included in the plasmid. Although xis genes are usually small genes, our analysis of the plasmid sequence makes the inclusion of an unidentified xis gene seem unlikely. An intriguing alternative possibility is that an endogenous M. smegmatis protein can function as an excisionase. In typical site-specific recombinase systems, the Xis protein functions as a DNA binding protein that bends the DNA to a favorable conformation and recruits the integrase to the recombination site.20 It has been proposed that excision in the fC31 recombinase system is similarly mediated by an adaptor protein that facilitates integrase-mediated excision.21 Biochemical studies with the fC31 recombinase system have demonstrated that the integrase can bind attR and attL, but it will not catalyze recombination of these sequences in vitro.4 It is possible that an endogenous M. smegmatis protein stabilizes the synaptic complex necessary for recombination, facilitating catalysis of the excision reaction. Using the fC31 integrase system for genetic engineering has several advantages. It can be used in a variety of mycobacteria (and, perhaps, other bacteria) because of its low sequence specificity. Because there seem to be multiple integration sites in M. bovis BCG (and, possibly, in M. tuberculosis as well), it is likely that some will have few effects on transcription enabling the use of native promoters. In addition, integration is relatively stable and might be useful for expressing exogenous proteins during animal infection. Finally, fC31-based constructs can be used as complements to L5-based systems as we would expect little interaction between the integrases. However, our early results do raise some concerns. First, transformation is relatively inefficient as compared to an episomal plasmid. This probably results from a low level of recombination. As we are always able to obtain recombinants this would not be likely to limit the usefulness of fC31-based vectors. Second, while we do not detect significant loss of integrants during passage, we are able to detect at least low levels of excision products. Previous studies using an L5-based integrating vector showed that this system mediated low levels of excision,22 even though serial passages in M. smegmatis in this study did not find significant instability. This raises the possibility that integrants

J. Murry et al. will eventually be lost, particularly if there is some selection against integrated DNA. In the case of the L5-based integration system, excision can be eliminated by using a strategy in which attP is provided in cis and the integrase is carried in trans. This allows stable integration even in the presence of a gene that is deleterious to the host.22 A similar strategy may also prove useful when applying the fC31 integration system in mycobacteria.

Acknowledgments We thank Daniel Kerns for providing the fC31 integrase system on the vectors pIJ8600 and pIJ8655. This work was supported in part by NIH Grants AI48704 and AI51929.

References 1. McFadden J. Recombination in mycobacteria. Mol Microbiol 1996;21:205–11. 2. Stover CK, de la Cruz VF, Fuerst TR, Burlein JE, Benson LA, Bennett LT, et al. New use of BCG for recombinant vaccines. Nature 1991;351:456–60. 3. Thorpe HM, Smith MC. In vitro site-specific integration of bacteriophage DNA catalyzed by a recombinase of the resolvase/invertase family. Proc Natl Acad Sci USA 1998;95: 5505–10. 4. Thorpe HM, Wilson SE, Smith MC. Control of directionality in the site-specific recombination system of the Streptomyces phage phiC31. Mol Microbiol 2000;38:232–41. 5. Groth AC, Olivares EC, Thyagarajan B, Calos MP. A phage integrase directs efficient site-specific integration in human cells. Proc Natl Acad Sci USA 2000;97:5995–6000. 6. Kuhstoss S, Rao RN. Analysis of the integration function of the streptomycete bacteriophage phi C31. J Mol Biol 1991;222:897–908. 7. Combes P, Till R, Bee S, Smith MC. The Streptomyces genome contains multiple pseudo-attB sites for the (phi)C31-encoded site-specific recombination system. J Bacteriol 2002; 184:5746–52. 8. Thyagarajan B, Olivares EC, Hollis RP, Ginsburg DS, Calos MP. Site-specific genomic integration in mammalian cells mediated by phage phiC31 integrase. Mol Cell Biol 2001;21:3926–34. 9. Sassetti CM, Boyd DH, Rubin EJ. Comprehensive identification of conditionally essential genes in mycobacteria. Proc Natl Acad Sci USA 2001;98:12712–7. 10. Sun J, Kelemen GH, Fernandez-Abalos JM, Bibb MJ. Green fluorescent protein as a reporter for spatial and temporal gene expression in Streptomyces coelicolor A3(2). Microbiology 1999;145:2221–7. 11. Paget E, Davies J. Apramycin resistance as a selective marker for gene transfer in mycobacteria. J Bacteriol 1996;178:6357–60. 12. Snapper SB, Melton RE, Mustafa S, Kieser T, Jacobs Jr WR. Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol Microbiol 1990;4:1911–9.

ARTICLE IN PRESS A new site-specific integration system for mycobacteria 13. Pelicic V, Jackson M, Reyrat JM, Jacobs Jr WR, Gicquel B, Guilhot C. Efficient allelic exchange and transposon mutagenesis in Mycobacterium tuberculosis. Proc Natl Acad Sci USA 1997;94:10955–60. 14. Belisle JT, Sonnenburg MG. Isolation of genomic DNA from mycobacteria. In: Parish T, Stoker NG, editors. Methods in molecular biology: mycobacteria protocols. Totowa: Humana; 1998. p. 31–44. 15. Sambrook J, Fritsch ER, Maniatis T. Molecular cloning: a laboratory manual, 2nd ed. Plainview: Cold Spring Harbor Lab. Press; 1989. 16. Choi SU, Lee CK, Hwang YI, Kinoshita H, Nihira T. Intergeneric conjugal transfer of plasmid DNA from Escherichia coli to Kitasatospora setae, a bafilomycin B1 producer. Arch Microbiol 2004;181:294–8. 17. Hoess RH, Foeller C, Bidwell K, Landy A. Site-specific recombination functions of bacteriophage lambda: DNA sequence of regulatory regions and overlapping structural genes for Int and Xis. Proc Natl Acad Sci USA 1980;77:2482–6.

323

18. Leong JM, Nunes-Duby SE, Oser AB, Lesser CF, Youderian P, Susskind MM, et al. Structural and regulatory divergence among site-specific recombination genes of lambdoid phage. J Mol Biol 1986;189:603–16. 19. Semsey S, Papp I, Buzas Z, Patthy A, Orosz L, Papp PP. Identification of site-specific recombination genes int and xis of the Rhizobium temperate phage 16-3. J Bacteriol 1999;181:4185–92. 20. Kim S, Landy A. Lambda Int protein bridges between higher order complexes at two distant chromosomal loci attL and attR. Science 1992;256:198–203. 21. Smith MC, Thorpe HM. Diversity in the serine recombinases. Mol Microbiol 2002;44:299–307. 22. Springer B, Sander P, Sedlacek L, Ellrott K, Bottger EC. Instability and site-specific excision of integration-proficient mycobacteriophage L5 plasmids: development of stably maintained integrative vectors. Int J Med Microbiol 2001; 290:669–75.