- Email: [email protected]
A novel fluorescent aptasensor based on hairpin structure of complementary strand of aptamer and nanoparticles as a signal amplification approach for ultrasensitive detection of cocaine
Biosensors and Bioelectronics 79 (2016) 288–293
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
A novel fluorescent aptasensor based on hairpin structure of complementary strand of aptamer and nanoparticles as a signal amplification approach for ultrasensitive detection of cocaine Ahmad Sarreshtehdar Emrani a,1, Noor Mohammad Danesh b,c,1, Mohammad Ramezani b, Seyed Mohammad Taghdisi d,n, Khalil Abnous e,n a
Cardiovascular Research Center, Ghaem hospital, Mashhad University of Medical Sciences, Mashhad, Iran Nanotechnology Research Center, School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran Research Institute of Sciences and New Technology, Mashhad, Iran d Targeted Drug Delivery Research Center, School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran e Pharmaceutical Research Center, School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran b c
art ic l e i nf o
a b s t r a c t
Article history: Received 3 November 2015 Received in revised form 10 December 2015 Accepted 12 December 2015 Available online 17 December 2015
Cocaine is one of the most commonly misused stimulant which could influence the central nervous system. In this study, a fluorescent aptamer-based sensor (aptasensor) was designed for sensitive and selective detection of cocaine, based on hairpin structure of complementary strand of aptamer (CS), target-induced release of aptamer (Apt) from CS and two kinds of nanoparticles, including silica nanoparticles (SNPs) coated with streptavidin and gold nanoparticles (AuNPs). The designed aptasensor acquires characteristics of AuNPs such as unique optical properties and large surface area, SNPs as amplifiers of fluorescence intensity, higher affinity of Apt toward its target relative to its CS, and finally the hairpin structure of CS that brings the fluorophore (FAM) to close proximity to the surface of SNPs. In the absence of cocaine, FAM is in close proximity to the surface of AuNPs, resulting in a weak fluorescence emission. In the presence of target, FAM comes to close proximity to the surface of SNPs because of the formation of hairpin structure of CS, leading to a very strong fluorescence emission. The fabricated fluorescent aptasensor exhibited a good selectivity toward cocaine with a limit of detection (LOD) as low as 209 pM. Moreover, the designed aptasensor was successfully utilized to detect cocaine in serum with a LOD as low as 293 pM. & 2015 Elsevier B.V. All rights reserved.
Keywords: Fluorescent aptasensor Cocaine Silica nanoparticles Hairpin structure Gold nanoparticles
1. Introduction Cocaine functions as a strong stimulant on the central nervous system. Misuse of cocaine could cause the severe side effects on human, such as anxiety, organ damage, cardiac arrest and spread of human immunodeficiency (Asturias-Arribas et al., 2014; Cai et al., 2011; Roncancio et al., 2014). The addiction to cocaine is a serious universal problem (Wren et al., 2014). Consequently, simple and sensitive methods for detection of cocaine are essential for both law enforcement and clinical diagnosis (Mokhtarzadeh et al., 2015; Shi et al., 2013). Different techniques have been applied for detection of cocaine, including radioimmunoassay, enzyme-linked immunosorbent assay (ELISA), high performance liquid chromatography (HPLC) and n
Corresponding authors. E-mail addresses: [email protected] (S.M. Taghdisi), [email protected] (K. Abnous). 1 These authors contributed equally to the work. http://dx.doi.org/10.1016/j.bios.2015.12.025 0956-5663/& 2015 Elsevier B.V. All rights reserved.
gas chromatography-mass spectrometry (GC-MS). Generally, these analytical approaches are time-consuming, expensive and require trained personnel and sophisticated instruments (Kang et al., 2011; Nguyen et al., 2012; Roncancio et al., 2014; Wren et al., 2014). Aptasensors have been broadly utilized in analytical techniques. Aptamers are artificial single-stranded DNA or RNA nucleic acids, screened by an in vitro selection process termed SELEX (systematic evolution of ligands by exponential enrichment) (Du et al., 2015; Xiang et al., 2015). They bind tightly and selectively to a vast range of heterogeneous targets, ranging from small organic molecules to whole cells (Dong et al., 2014; Zhou et al., 2014). Relative to antibodies, aptamers exhibit significant advantages, including high reproducibility, small size, low cost, high thermal stability, lack of immunogenicity and toxicity and ease of synthesis and modification (Eissa et al., 2015; Lian et al., 2015; Zhao et al., 2015; Zhou et al., 2014). Owing to these features, aptamers are promising recognition ligands for the development of various sensing platforms (Mohammad Danesh et al., 2016; Ramezani
A.S. Emrani et al. / Biosensors and Bioelectronics 79 (2016) 288–293
et al., 2015). Nowadays, gold nanoparticles (AuNPs) are broadly used in the construction of fluorescent, colorimetric and electrochemical aptasensors, due to their unique characteristics, such as chemical stability, ease of synthesis, good biocompatibility and conductivity, extremely high extinction coefficient, large surface area and unique electrical and optical properties (Benson et al., 2015; Ramezani et al., 2016; Wei et al., 2015). Recently, silica nanoparticles (SNPs) have gained noticeable attention for biomedical applications, because of their unique properties, including no toxicity, ease of production, low cost and good stability and biocompatibility. Furthermore, these nanoparticles could enhance fluorescence intensity via the principle of optical interference (Emrani et al., 2015; Li et al., 2010; Yue et al., 2014). Fluorescence has widely been utilized for analytical approaches, due to its high sensitivity and ease of recognition (Pang et al., 2015; Ramezani et al., 2016). In this study, a novel fluorescent aptasensor was developed for detection of cocaine, based on the combination of the hairpin structure of complementary strand of aptamer (CS), SNPs coated with streptavidin and AuNPs (Scheme 1). Using two kinds of nanoparticles with opposite effects on fluorophore (FAM) and the hairpin structure of CS caused a very significant difference in the fluorescence intensity of the designed aptasensor in the presence and absence of target. In this work, a 44 mer ssDNA (Ge et al., 2012), which binds to cocaine with high affinity, was utilized as targeting ligand.
289
(Storhoff et al., 1998). The prepared AuNPs solution was centrifuged at 14,000 g for 20 min at 4 °C. The supernatant was eliminated and ultrapure water was added to the nanoparticles. Concentrations of AuNPs were calculated based on extinction coefficient of 2.7 108 M 1 cm 1 at λ ¼520 nm for 13 nm AuNPs. The size, zeta potential and morphology of the synthesized AuNPs were analyzed through a particle size analyzer (Malvern, UK) and transmission electron microscopy (TEM) (CM120, Philips, Holland). 2.3. Preparation of Apt-modified AuNPs The concentration of AuNPs was measured to be 30 nM. 18 mL apt (40 mM) was added to 1 mL AuNPs (30 nM) and incubated at room temperature for 16 h. The produced Apt-modified AuNPs was stored at 4 °C. 2% agarose gel electrophoresis was used to assess the formation of Apt-modified AuNPs. 2.4. Effect of concentration of SNPs coated with streptavidin on the fluorescence intensity of CS Different concentrations of SNPs coated with streptavidin (0– 500 mg/mL final concentration) were added to 100 nM CS (100 mL final volume). After incubation for 1 h at room temperature, fluorescence intensity spectra, λEx ¼490 nm, were recorded on a Synergy H4 microplate reader (BioTek, USA). 2.5. Optimization of the concentration of Apt-modified AuNPs Increasing amounts of Apt-modified AuNPs (100 mL, 0–30 nM) in 20 mM Tris–HCl (pH 7.4) were added to 100 mL CS-SNPs coated with streptavidin conjugate (250 mg/mL) and incubated for 2 h at room temperature. Then, fluorescence spectra were measured.
2. Materials and methods 2.1. Materials The cocaine aptamer (Apt), 5′- CCATAGGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC -Thiol-3′ and its complementary strand (CS), 5′-FAMATTGAAGGATTTATCCTTGTCTCCCTATGCTTCAAT-Biotin-3′, were purchased from Bioneer (South Korea). Plasma from rat, morphine, diazepam, cocaine, propranolol, chloramphenicol, sodium citrate and Gold (III) chloride hydrate (HAuCl4) were ordered from Sigma-Aldrich (USA). SNPs coated with streptavidin were obtained from Micromod (100 nm, Germany). 2.2. Synthesis of water resuspended gold nanoparticles The classical reduction of HAuCl4 by citrate was used for synthesis of AuNPs, according to the previously published protocol
2.6. Effect of incubation time of Apt-modified AuNPs 00 mL Apt-modified AuNPs (20 nM) was added to 100 mL CSSNPs coated with streptavidin conjugate (250 mg/mL) in 20 mM Tris–HCl (pH 7.4). The mixtures were incubated at room temperature from 0–3 h. Next, fluorescence intensities, λEx ¼490 nm and λEm ¼520 nm, were recorded. 2.7. Detection performance of the developed fluorescent aptasensor The interaction of cocaine and the fabricated aptasensor was assessed by fluorescent measurement. 10 mL cocaine (20 nM) was added to a mixture containing 100 mL CS-SNPs coated with streptavidin conjugate (250 mg/mL) and 100 mL Apt-modified
(a) a b (b)
Complementary strand
AuNPs
Aptamer
SNPs coated with streptavidin
FAM
Target
Biotin
Scheme 1. Schematic illustration of cocaine detection based on fluorescent assay. In the presence of cocaine, the fluorophore (FAM) comes to close proximity to the surface of SNPs because of the formation of hairpin structure of CS, resulting in a very strong fluorescence emission. In the absence of target, Apt-modified AuNPs/CS-SNPs coated with streptavidin complex remains intact, leading to a weak fluorescence emission.
290
A.S. Emrani et al. / Biosensors and Bioelectronics 79 (2016) 288–293
AuNPs (20 nM). After incubation for 40 min at room temperature, fluorescence emission spectra were measured. 2.8. Quantitative analysis of cocaine based on fluorescent measurement Different amounts of cocaine (0–40 nM) were added to the mixtures containing Apt-modified AuNPs (20 nM) and CS-SNPs coated with streptavidin conjugate (250 mg/mL) and incubated for 40 min at room temperature. Finally, fluorescence intensities were recorded. 2.9. Selectivity of the developed aptasensor The specificity was evaluated in the presence of 20 nM diazepam, morphine, propranolol, cocaine and chloramphenicol. 2.10. Detection of cocaine in serum sample To evaluate the function of the designed aptasensor in serum, increasing concentrations of cocaine (0–40 nM) were spiked into rat serum. Proteins of serum were sedimented by adding 125 mL cold acetonitrile to 50 mL serum with gentle mixing. The samples were incubated at 4 °C for 1 h. The mixtures were centrifuged at 9500 g for 10 min at 4 °C. The supernatants were collected and the fluorescence intensities were measured.
3. Results and discussion 3.1. Sensing mechanism of the fluorescent aptasensor The presented fluorescent aptasensor is based on target-induced release of Apt from CS, hairpin structure of CS, SNPs coated with streptavidin as the amplifiers of fluorescence intensity and AuNPs as fluorescence quenchers. SNPs coated with streptavidin bind to FAM and biotin-labeled CS using the strong interaction of streptavidin with biotin with a dissociation constant (Kd) of around 10 14 M. FAM and biotin-labeled CS on the surface of SNPs coated with streptavidin attaches to the Apt-modified AuNPs by binding to Apt. So, fluorescence is quenched because of the close proximity of the AuNPs and fluorophore (FAM), as AuNPs are well-known fluorescence quenchers (Emrani et al., 2016; Shi et al., 2013). The principle of the designed aptasensor has been depicted in Scheme 1. In the absence of cocaine, Apt-modified AuNPs/CS-SNPS coated with streptavidin complex remains intact, leading to a weak fluorescence emission. In the presence of cocaine, FAM and biotin labeled-CS leaves the Apt-modified AuNPs and CS forms a hairpin structure (Fig. S1). It has been approved that aptamer interacts with its corresponding target with a greater binding constant relative to its complementary strand (Wu et al., 2015; Yang et al., 2014). The hairpin structure of CS causes the fluorophore comes to a very close proximity to the surface of SNPs coated with streptavidin, resulting in a significant increase of fluorescent intensity because of well-known SNPs enhancing fluorescence properties.
Fig. 1. (a) TEM image of prepared AuNPs. (b) Agarose gel electrophoresis of Aptmodified AuNPs. Lane 1: DNA ladder, Lane2: Apt-modified AuNPs, Lane 3: Apt (from left to right, respectively).
3.2. AuNPs characterization Particle size and zeta potential of AuNPs were 13.3 nm (polydispersity 0.387) and 35.1 mV, respectively. The TEM image verified a well-dispersed AuNPs with a diameter of about 13 nm (Fig. 1(a)), which was consistent with the result of particle size analyzer.
3.3. Gel retardation assay The production of Apt-modified AuNPs was confirmed by gel retardation assay. As shown in Fig. 1(b), the band of Apt-modified AuNPs was retarded compared to Apt band.
A.S. Emrani et al. / Biosensors and Bioelectronics 79 (2016) 288–293
291
maximum fluorescence intensity, confirming the maximum conjugation of CS with SNPs coated with streptavidin occurred at this concentration. 3.4.2. Optimum concentration of Apt-modified AuNPs To determine the optimum concentration of Apt-modified AuNPs for complete reaction with FAM and biotin-labeled CS-SNPs coated with streptavidin conjugate, increasing concentrations of Apt-modified AuNPs were added to a fix concentration of CS-SNPs coated with streptavidin. As shown in Fig. 2(b), the FAM and biotin-labeled CS-SNPs coated with streptavidin conjugate had the minimum fluorescence intensity at 10 nM Apt-modified AuNPs concentration (Final concentration), indicating the maximum conjugation of Apt-modified AuNPs to CS-SNPs coated with streptavidin conjugate happened at this concentration. 3.4.3. Optimum incubation time of Apt-modified AuNPs Upon the addition of Apt-modified AuNPs to FAM and biotinlabeled CS-SNPs coated with streptavidin conjugate, the fluorescence intensity was monitored up to 3 h. the fluorescence intensity decreased rapidly as the incubation time increased and reached to minimum in 2 h (Fig. 2(c)), which is the required time for efficient conjugation of Apt-modified AuNPs to CS-SNPs coated with streptavidin conjugate. 3.5. Feasibility of the developed fluorescent aptasensor for cocaine detection Fluorescent measurement was utilized to specify the function of the designed aptasensor. As shown in Fig. 3, the FAM and biotinlabeled CS-SNPs coated with streptavidin conjugate exhibited the maximum fluorescence intensity (red curve), due to hairpin structure of CS and characteristic of SNPs as enhancers of fluorescence intensity. In the absence of cocaine, the fabricated aptasensor remained intact and showed a weak fluorescence intensity at 520 nm (gray curve), which could be attributed to the presence of FAM and biotin-labeled CS in close proximity to the surface of AuNPs. In the presence of cocaine, the fluorescence intensity was significantly enhanced (green curve), confirming the release of CSSNPs coated with streptavidin conjugate from the Apt-modified AuNPs, formation of Apt/target conjugate on the surface of AuNPs and the formation of hairpin structure of FAM and biotin-labeled CS on the surface of SNPs coated with streptavidin, which brings the fluorophore to close proximity to the surface of SNPs.
Fig. 2. Factors involved in the fluorescence intensity of the aptasensor. (a) Fluorescence spectra of FAM and biotin-labeled CS in the presence of various concentrations of SNPs coated with streptavidin (0, 30, 60, 120, 250 and 500 mg/mL, from bottom to top). (b) Fluorescence spectra of FAM and biotin-labeled CS-SNPs coated with streptavidin in the presence of different concentrations of Apt-modified AuNPs (0, 1, 2, 4, 6, 10 and 15 nM, from top to bottom). (c) Fluorescence intensity of FAM and biotin-labeled CS-SNPs coated with streptavidin as a function of Apt-modified AuNPs incubation time.
3.4. Optimization of experimental conditions for the fluorescent aptasensor 3.4.1. Optimum concentration of SNPs coated with streptavidin To obtain the optimum concentration of SNPs coated with streptavidin for complete reaction with FAM and biotin-labeled CS, different amounts of SNPs coated with streptavidin were added to a fix concentration of CS. As shown in Fig. 2(a), the final concentration of 250 mg/mL SNPs coated with streptavidin showed the
Fig. 3. Proof of concept for the designed aptasensor. Fluorescence intensity of FAM and biotin-labeled CS (blue curve), FAM and biotin-labeled CS-SNPs coated with streptavidin conjugate (red curve), the designed aptasensor (gray curve) and aptasensor þcocaine (green curve). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
292
a)
A.S. Emrani et al. / Biosensors and Bioelectronics 79 (2016) 288–293
5
(F -F 0)/F 0
4 3 2 1 0 0 .0 1
0 .1
1
10
100
C o c a in e ( n M )
range (0.5–20 nM) toward cocaine (Fig. 4(b)). The limit of detection was measured to be 209 pM (0.07 ng/mL) based on three times of the standard deviation of the blank/slope (Fig. S2). Reported detection limits of cocaine in different detection methods were as following: 5 mM for label-free DNA hairpin biosensor for colorimetric detection (Nie et al., 2013), 3 ng/mL for HPLC/MS (Johansen and Bhatia, 2007), 300 nM for Label-free electrochemical cocaine aptasensor (Hua et al., 2010), 190 nM for label-free fluorescence aptamer-based sensor (Qiu et al., 2013), 1 ng/mL for reversed-phase HPLC (Tagliaro et al., 1994), 10 pM for microfluidic affinity sensor (Hilton et al., 2011) 105 pM for electrochemical aptasensor based on single-walled carbon nanotubes, 0.48 nM for fluorescent aptasensor based on molecular beacon (Ma et al., 2011), gold electrode and complementary strand of aptamer (Taghdisi et al., 2015) and 0.48 nM for chemiluminescence aptasensor (Li et al., 2011). In comparison with the designed fluorescent aptasensor, most of these analytical approaches are costly, time-consuming and have higher LODs. 3.7. Selectivity of the designed fluorescent aptasensor A workable sensor not only should be sensitive to various concentrations of its target, but also should have acceptable selectivity for its target. The relative fluorescence intensities of the
a)
5
(F -F 0)/F 0
4 3 2 1 0 0 .0 1
0 .1
1
10
100
C o c a in e ( n M )
b)
Fig. 4. (a) Relative fluorescence intensity of FAM and biotin-labeled CS as a function of cocaine concentration. (b) Cocaine standard curve. F0 and F are the fluorescence intensities at 520 nm before and after addition of cocaine, respectively. (c) Relative fluorescence intensity of the fabricated aptasensor in the presence of various substances. F0 and F are the fluorescence intensities at 520 nm before and after addition of each substance, respectively.
3.6. Quantitative analysis of cocaine Fig. 4(a) indicates the relative fluorescence intensity of FAM and biotin-labeled CS at different concentrations of cocaine. The relative fluorescence intensity increased and reached to plateau at concentration of 20 nM cocaine. The assay indicated a well linear
Fig. 5. (a) Relative fluorescence intensity of FAM and biotin-labeled CS upon the addition of various concentrations of cocaine in serum. (b) Cocaine standard curve in serum. F0 and F are the fluorescence intensities at 520 nm before and after addition of cocaine, respectively.
A.S. Emrani et al. / Biosensors and Bioelectronics 79 (2016) 288–293
designed aptasensor toward cocaine and morphine were significantly higher than diazepam, propranolol and chloramphenicol (Fig. 4(c)). These results verified good selectivity of the fabricated aptasensor toward cocaine and morphine, which contain identical groups for recognition by Apt. 3.8. Detection of cocaine in serum The developed fluorescent aptasensor was utilized to measure cocaine in rat serum, as a complex biological fluid with a mixture of proteins and other interfering substances. Different amounts of cocaine were spiked into serum and LOD was measured to be 293 pM (0.098 ng/mL) (Fig. 5 and Fig. S3). The results confirmed the successful application of the designed fluorescent aptasensor for detection of cocaine in serum.
4. Conclusion In conclusion, a fluorescent aptasensor was developed for ultrasensitive and selective detection of cocaine, based on targetinduced release of Apt from CS, hairpin structure of CS and two kinds of nanoparticles, including SNPs coated with streptavidin and AuNPs. The limit of detection (LOD) for cocaine was measured as low as 209 pM. Furthermore, the designed fluorescent aptasensor could well recognize cocaine in serum with LOD of 293 pM.
Conflict of interest There is no conflict of interest about this article.
Acknowledgment Financial support of this study was provided by Mashhad University of Medical Sciences.
Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2015.12.025.
References Asturias-Arribas, L., Alonso-Lomillo, M.A., Domínguez-Renedo, O., Arcos-Martínez, M.J., 2014. Anal. Chim. Acta 834, 30–36. Benson, J., Fung, C.M., Lloyd, J.S., Deganello, D., Smith, N.A., Teng, K.S., 2015.
293
Nanoscale Res. Lett. 10 (1), 1–8. Cai, Q., Chen, L., Luo, F., Qiu, B., Lin, Z., Chen, G., 2011. Anal. Bioanal. Chem. 400 (1), 289–294. Dong, Y., Xu, Y., Yong, W., Chu, X., Wang, D., 2014. Crit. Rev. Food Sci. Nutr. 54 (12), 1548–1561. Du, F., Guo, L., Qin, Q., Zheng, X., Ruan, G., Li, J., Li, G., 2015. TrAC—Trends Anal. Chem. 67, 134–146. Eissa, S., Siaj, M., Zourob, M., 2015. Biosens. Bioelectron. 69, 148–154. Emrani, A.S., Danesh, N.M., Lavaee, P., Ramezani, M., Abnous, K., Taghdisi, S.M., 2016. Food Chem. 190, 115–121. Emrani, A.S., Taghdisi, S.M., Danesh, N.M., Jalalian, S.H., Ramezani, M., Abnous, K., 2015. Anal. Methods 7 (9), 3814–3818. Ge, J., Liu, Z., Zhao, X.S., 2012. Chin. J. Chem. 30 (9), 2023–2028. Hilton, J.P., Nguyen, T.H., Pei, R., Stojanovic, M., Lin, Q., 2011. Sens. Actuators A: Phys. 166 (2), 241–246. Hua, M., Tao, M., Wang, P., Zhang, Y., Wu, Z., Chang, Y., Yang, Y., 2010. Anal. Sci. 26 (12), 1265–1270. Johansen, S.S., Bhatia, H.M., 2007. J. Chromatogr. B: Anal. Technol. Biomed. Life Sci. 852 (1–2), 338–344. Kang, K., Sachan, A., Nilsen-Hamilton, M., Shrotriya, P., 2011. Langmuir: ACS J. Surf. Colloids 27 (23), 14696–14702. Li, X., Kao, F.J., Chuang, C.C., He, S., 2010. Opt. Express 18 (11), 11335–11346. Li, Y., Ji, X., Liu, B., 2011. Anal. BioAnal. Chem. 401 (1), 213–219. Lian, Y., He, F., Wang, H., Tong, F., 2015. Biosens. Bioelectron. 65, 314–319. Ma, C., Wang, W., Yang, Q., Shi, C., Cao, L., 2011. Biosens. Bioelectron. 26, 3309–3312. Mohammad Danesh, N., Ramezani, M., Sarreshtehdar Emrani, A., Abnous, K., Taghdisi, S.M., 2016. Biosens. Bioelectron. 75, 123–128. Mokhtarzadeh, A., Ezzati Nazhad Dolatabadi, J., Abnous, K., de la Guardia, M., Ramezani, M., 2015. Biosens. Bioelectron. 68, 95–106. Nguyen, T.H., Hardwick, S.A., Sun, T., Grattan, K.T.V., 2012. IEEE Sens. J. 12 (1), 255–260. Nie, J., Zhang, D.W., Tie, C., Zhou, Y.L., Zhang, X.X., 2013. Biosens. Bioelectron. 49, 236–242. Pang, Y., Rong, Z., Wang, J., Xiao, R., Wang, S., 2015. Biosens. Bioelectron. 66, 527–532. Qiu, L., Zhou, H., Zhu, W., Jiang, J., Shen, G., Yu, R., 2013. New J. Chem. 37 (12), 3998–4003. Ramezani, M., Danesh, N.M., Lavaee, P., Abnous, K., Taghdisi, S.M., 2016. Sens. Actuators B: Chem. 222, 1–7. Ramezani, M., Mohammad Danesh, N., Lavaee, P., Abnous, K., Mohammad Taghdisi, S., 2015. Biosens. Bioelectron. 70, 181–187. Roncancio, D., Yu, H., Xu, X., Wu, S., Liu, R., Debord, J., Lou, X., Xiao, Y., 2014. Anal. Chem. 86 (22), 11100–11106. Shi, Y., Dai, H., Sun, Y., Hu, J., Ni, P., Li, Z., 2013. Analyst 138 (23), 7152–7156. Storhoff, J.J., Elghanian, R., Mucic, R.C., Mirkin, C.A., Letsinger, R.L., 1998. J. Am. Chem. Soc. 120 (9), 1959–1964. Taghdisi, S.M., Danesh, N.M., Emrani, A.S., Ramezani, M., Abnous, K., 2015. Biosens. Bioelectron. 73, 245–250. Tagliaro, F., Antonioli, C., De Battisti, Z., Ghielmi, S., Marigo, M., 1994. J. Chromatogr. A 674 (1–2), 207–215. Wei, L., Wang, X., Li, C., Li, X., Yin, Y., Li, G., 2015. Biosens. Bioelectron. 71, 348–352. Wren, S.P., Nguyen, T.H., Gascoine, P., Lacey, R., Sun, T., Grattan, K.T.V., 2014. Sens. Actuators B: Chem. 193, 35–41. Wu, S., Zhang, H., Shi, Z., Duan, N., Fang, C., Dai, S., Wang, Z., 2015. Food Control 50, 597–604. Xiang, D., Shigdar, S., Qiao, G., Wang, T., Kouzani, A.Z., Zhou, S.F., Kong, L., Li, Y., Pu, C., Duan, W., 2015. Theranostics 5 (1), 23–42. Yang, C., Wang, Q., Xiang, Y., Yuan, R., Chai, Y., 2014. Sens. Actuators B: Chem. 197, 149–154. Yue, Q., Shen, T., Wang, L., Xu, S., Li, H., Xue, Q., Zhang, Y., Gu, X., Zhang, S., Liu, J., 2014. Biosens. Bioelectron. 56, 231–236. Zhao, B., Wu, P., Zhang, H., Cai, C., 2015. Biosens. Bioelectron. 68, 763–770. Zhou, W., Jimmy Huang, P.J., Ding, J., Liu, J., 2014. Analyst 139 (11), 2627–2640.
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
A novel fluorescent aptasensor based on hairpin structure of complementary strand of aptamer and nanoparticles as a signal amplification approach for ultrasensitive detection of cocaine Ahmad Sarreshtehdar Emrani a,1, Noor Mohammad Danesh b,c,1, Mohammad Ramezani b, Seyed Mohammad Taghdisi d,n, Khalil Abnous e,n a
Cardiovascular Research Center, Ghaem hospital, Mashhad University of Medical Sciences, Mashhad, Iran Nanotechnology Research Center, School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran Research Institute of Sciences and New Technology, Mashhad, Iran d Targeted Drug Delivery Research Center, School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran e Pharmaceutical Research Center, School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran b c
art ic l e i nf o
a b s t r a c t
Article history: Received 3 November 2015 Received in revised form 10 December 2015 Accepted 12 December 2015 Available online 17 December 2015
Cocaine is one of the most commonly misused stimulant which could influence the central nervous system. In this study, a fluorescent aptamer-based sensor (aptasensor) was designed for sensitive and selective detection of cocaine, based on hairpin structure of complementary strand of aptamer (CS), target-induced release of aptamer (Apt) from CS and two kinds of nanoparticles, including silica nanoparticles (SNPs) coated with streptavidin and gold nanoparticles (AuNPs). The designed aptasensor acquires characteristics of AuNPs such as unique optical properties and large surface area, SNPs as amplifiers of fluorescence intensity, higher affinity of Apt toward its target relative to its CS, and finally the hairpin structure of CS that brings the fluorophore (FAM) to close proximity to the surface of SNPs. In the absence of cocaine, FAM is in close proximity to the surface of AuNPs, resulting in a weak fluorescence emission. In the presence of target, FAM comes to close proximity to the surface of SNPs because of the formation of hairpin structure of CS, leading to a very strong fluorescence emission. The fabricated fluorescent aptasensor exhibited a good selectivity toward cocaine with a limit of detection (LOD) as low as 209 pM. Moreover, the designed aptasensor was successfully utilized to detect cocaine in serum with a LOD as low as 293 pM. & 2015 Elsevier B.V. All rights reserved.
Keywords: Fluorescent aptasensor Cocaine Silica nanoparticles Hairpin structure Gold nanoparticles
1. Introduction Cocaine functions as a strong stimulant on the central nervous system. Misuse of cocaine could cause the severe side effects on human, such as anxiety, organ damage, cardiac arrest and spread of human immunodeficiency (Asturias-Arribas et al., 2014; Cai et al., 2011; Roncancio et al., 2014). The addiction to cocaine is a serious universal problem (Wren et al., 2014). Consequently, simple and sensitive methods for detection of cocaine are essential for both law enforcement and clinical diagnosis (Mokhtarzadeh et al., 2015; Shi et al., 2013). Different techniques have been applied for detection of cocaine, including radioimmunoassay, enzyme-linked immunosorbent assay (ELISA), high performance liquid chromatography (HPLC) and n
Corresponding authors. E-mail addresses: [email protected] (S.M. Taghdisi), [email protected] (K. Abnous). 1 These authors contributed equally to the work. http://dx.doi.org/10.1016/j.bios.2015.12.025 0956-5663/& 2015 Elsevier B.V. All rights reserved.
gas chromatography-mass spectrometry (GC-MS). Generally, these analytical approaches are time-consuming, expensive and require trained personnel and sophisticated instruments (Kang et al., 2011; Nguyen et al., 2012; Roncancio et al., 2014; Wren et al., 2014). Aptasensors have been broadly utilized in analytical techniques. Aptamers are artificial single-stranded DNA or RNA nucleic acids, screened by an in vitro selection process termed SELEX (systematic evolution of ligands by exponential enrichment) (Du et al., 2015; Xiang et al., 2015). They bind tightly and selectively to a vast range of heterogeneous targets, ranging from small organic molecules to whole cells (Dong et al., 2014; Zhou et al., 2014). Relative to antibodies, aptamers exhibit significant advantages, including high reproducibility, small size, low cost, high thermal stability, lack of immunogenicity and toxicity and ease of synthesis and modification (Eissa et al., 2015; Lian et al., 2015; Zhao et al., 2015; Zhou et al., 2014). Owing to these features, aptamers are promising recognition ligands for the development of various sensing platforms (Mohammad Danesh et al., 2016; Ramezani
A.S. Emrani et al. / Biosensors and Bioelectronics 79 (2016) 288–293
et al., 2015). Nowadays, gold nanoparticles (AuNPs) are broadly used in the construction of fluorescent, colorimetric and electrochemical aptasensors, due to their unique characteristics, such as chemical stability, ease of synthesis, good biocompatibility and conductivity, extremely high extinction coefficient, large surface area and unique electrical and optical properties (Benson et al., 2015; Ramezani et al., 2016; Wei et al., 2015). Recently, silica nanoparticles (SNPs) have gained noticeable attention for biomedical applications, because of their unique properties, including no toxicity, ease of production, low cost and good stability and biocompatibility. Furthermore, these nanoparticles could enhance fluorescence intensity via the principle of optical interference (Emrani et al., 2015; Li et al., 2010; Yue et al., 2014). Fluorescence has widely been utilized for analytical approaches, due to its high sensitivity and ease of recognition (Pang et al., 2015; Ramezani et al., 2016). In this study, a novel fluorescent aptasensor was developed for detection of cocaine, based on the combination of the hairpin structure of complementary strand of aptamer (CS), SNPs coated with streptavidin and AuNPs (Scheme 1). Using two kinds of nanoparticles with opposite effects on fluorophore (FAM) and the hairpin structure of CS caused a very significant difference in the fluorescence intensity of the designed aptasensor in the presence and absence of target. In this work, a 44 mer ssDNA (Ge et al., 2012), which binds to cocaine with high affinity, was utilized as targeting ligand.
289
(Storhoff et al., 1998). The prepared AuNPs solution was centrifuged at 14,000 g for 20 min at 4 °C. The supernatant was eliminated and ultrapure water was added to the nanoparticles. Concentrations of AuNPs were calculated based on extinction coefficient of 2.7 108 M 1 cm 1 at λ ¼520 nm for 13 nm AuNPs. The size, zeta potential and morphology of the synthesized AuNPs were analyzed through a particle size analyzer (Malvern, UK) and transmission electron microscopy (TEM) (CM120, Philips, Holland). 2.3. Preparation of Apt-modified AuNPs The concentration of AuNPs was measured to be 30 nM. 18 mL apt (40 mM) was added to 1 mL AuNPs (30 nM) and incubated at room temperature for 16 h. The produced Apt-modified AuNPs was stored at 4 °C. 2% agarose gel electrophoresis was used to assess the formation of Apt-modified AuNPs. 2.4. Effect of concentration of SNPs coated with streptavidin on the fluorescence intensity of CS Different concentrations of SNPs coated with streptavidin (0– 500 mg/mL final concentration) were added to 100 nM CS (100 mL final volume). After incubation for 1 h at room temperature, fluorescence intensity spectra, λEx ¼490 nm, were recorded on a Synergy H4 microplate reader (BioTek, USA). 2.5. Optimization of the concentration of Apt-modified AuNPs Increasing amounts of Apt-modified AuNPs (100 mL, 0–30 nM) in 20 mM Tris–HCl (pH 7.4) were added to 100 mL CS-SNPs coated with streptavidin conjugate (250 mg/mL) and incubated for 2 h at room temperature. Then, fluorescence spectra were measured.
2. Materials and methods 2.1. Materials The cocaine aptamer (Apt), 5′- CCATAGGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC -Thiol-3′ and its complementary strand (CS), 5′-FAMATTGAAGGATTTATCCTTGTCTCCCTATGCTTCAAT-Biotin-3′, were purchased from Bioneer (South Korea). Plasma from rat, morphine, diazepam, cocaine, propranolol, chloramphenicol, sodium citrate and Gold (III) chloride hydrate (HAuCl4) were ordered from Sigma-Aldrich (USA). SNPs coated with streptavidin were obtained from Micromod (100 nm, Germany). 2.2. Synthesis of water resuspended gold nanoparticles The classical reduction of HAuCl4 by citrate was used for synthesis of AuNPs, according to the previously published protocol
2.6. Effect of incubation time of Apt-modified AuNPs 00 mL Apt-modified AuNPs (20 nM) was added to 100 mL CSSNPs coated with streptavidin conjugate (250 mg/mL) in 20 mM Tris–HCl (pH 7.4). The mixtures were incubated at room temperature from 0–3 h. Next, fluorescence intensities, λEx ¼490 nm and λEm ¼520 nm, were recorded. 2.7. Detection performance of the developed fluorescent aptasensor The interaction of cocaine and the fabricated aptasensor was assessed by fluorescent measurement. 10 mL cocaine (20 nM) was added to a mixture containing 100 mL CS-SNPs coated with streptavidin conjugate (250 mg/mL) and 100 mL Apt-modified
(a) a b (b)
Complementary strand
AuNPs
Aptamer
SNPs coated with streptavidin
FAM
Target
Biotin
Scheme 1. Schematic illustration of cocaine detection based on fluorescent assay. In the presence of cocaine, the fluorophore (FAM) comes to close proximity to the surface of SNPs because of the formation of hairpin structure of CS, resulting in a very strong fluorescence emission. In the absence of target, Apt-modified AuNPs/CS-SNPs coated with streptavidin complex remains intact, leading to a weak fluorescence emission.
290
A.S. Emrani et al. / Biosensors and Bioelectronics 79 (2016) 288–293
AuNPs (20 nM). After incubation for 40 min at room temperature, fluorescence emission spectra were measured. 2.8. Quantitative analysis of cocaine based on fluorescent measurement Different amounts of cocaine (0–40 nM) were added to the mixtures containing Apt-modified AuNPs (20 nM) and CS-SNPs coated with streptavidin conjugate (250 mg/mL) and incubated for 40 min at room temperature. Finally, fluorescence intensities were recorded. 2.9. Selectivity of the developed aptasensor The specificity was evaluated in the presence of 20 nM diazepam, morphine, propranolol, cocaine and chloramphenicol. 2.10. Detection of cocaine in serum sample To evaluate the function of the designed aptasensor in serum, increasing concentrations of cocaine (0–40 nM) were spiked into rat serum. Proteins of serum were sedimented by adding 125 mL cold acetonitrile to 50 mL serum with gentle mixing. The samples were incubated at 4 °C for 1 h. The mixtures were centrifuged at 9500 g for 10 min at 4 °C. The supernatants were collected and the fluorescence intensities were measured.
3. Results and discussion 3.1. Sensing mechanism of the fluorescent aptasensor The presented fluorescent aptasensor is based on target-induced release of Apt from CS, hairpin structure of CS, SNPs coated with streptavidin as the amplifiers of fluorescence intensity and AuNPs as fluorescence quenchers. SNPs coated with streptavidin bind to FAM and biotin-labeled CS using the strong interaction of streptavidin with biotin with a dissociation constant (Kd) of around 10 14 M. FAM and biotin-labeled CS on the surface of SNPs coated with streptavidin attaches to the Apt-modified AuNPs by binding to Apt. So, fluorescence is quenched because of the close proximity of the AuNPs and fluorophore (FAM), as AuNPs are well-known fluorescence quenchers (Emrani et al., 2016; Shi et al., 2013). The principle of the designed aptasensor has been depicted in Scheme 1. In the absence of cocaine, Apt-modified AuNPs/CS-SNPS coated with streptavidin complex remains intact, leading to a weak fluorescence emission. In the presence of cocaine, FAM and biotin labeled-CS leaves the Apt-modified AuNPs and CS forms a hairpin structure (Fig. S1). It has been approved that aptamer interacts with its corresponding target with a greater binding constant relative to its complementary strand (Wu et al., 2015; Yang et al., 2014). The hairpin structure of CS causes the fluorophore comes to a very close proximity to the surface of SNPs coated with streptavidin, resulting in a significant increase of fluorescent intensity because of well-known SNPs enhancing fluorescence properties.
Fig. 1. (a) TEM image of prepared AuNPs. (b) Agarose gel electrophoresis of Aptmodified AuNPs. Lane 1: DNA ladder, Lane2: Apt-modified AuNPs, Lane 3: Apt (from left to right, respectively).
3.2. AuNPs characterization Particle size and zeta potential of AuNPs were 13.3 nm (polydispersity 0.387) and 35.1 mV, respectively. The TEM image verified a well-dispersed AuNPs with a diameter of about 13 nm (Fig. 1(a)), which was consistent with the result of particle size analyzer.
3.3. Gel retardation assay The production of Apt-modified AuNPs was confirmed by gel retardation assay. As shown in Fig. 1(b), the band of Apt-modified AuNPs was retarded compared to Apt band.
A.S. Emrani et al. / Biosensors and Bioelectronics 79 (2016) 288–293
291
maximum fluorescence intensity, confirming the maximum conjugation of CS with SNPs coated with streptavidin occurred at this concentration. 3.4.2. Optimum concentration of Apt-modified AuNPs To determine the optimum concentration of Apt-modified AuNPs for complete reaction with FAM and biotin-labeled CS-SNPs coated with streptavidin conjugate, increasing concentrations of Apt-modified AuNPs were added to a fix concentration of CS-SNPs coated with streptavidin. As shown in Fig. 2(b), the FAM and biotin-labeled CS-SNPs coated with streptavidin conjugate had the minimum fluorescence intensity at 10 nM Apt-modified AuNPs concentration (Final concentration), indicating the maximum conjugation of Apt-modified AuNPs to CS-SNPs coated with streptavidin conjugate happened at this concentration. 3.4.3. Optimum incubation time of Apt-modified AuNPs Upon the addition of Apt-modified AuNPs to FAM and biotinlabeled CS-SNPs coated with streptavidin conjugate, the fluorescence intensity was monitored up to 3 h. the fluorescence intensity decreased rapidly as the incubation time increased and reached to minimum in 2 h (Fig. 2(c)), which is the required time for efficient conjugation of Apt-modified AuNPs to CS-SNPs coated with streptavidin conjugate. 3.5. Feasibility of the developed fluorescent aptasensor for cocaine detection Fluorescent measurement was utilized to specify the function of the designed aptasensor. As shown in Fig. 3, the FAM and biotinlabeled CS-SNPs coated with streptavidin conjugate exhibited the maximum fluorescence intensity (red curve), due to hairpin structure of CS and characteristic of SNPs as enhancers of fluorescence intensity. In the absence of cocaine, the fabricated aptasensor remained intact and showed a weak fluorescence intensity at 520 nm (gray curve), which could be attributed to the presence of FAM and biotin-labeled CS in close proximity to the surface of AuNPs. In the presence of cocaine, the fluorescence intensity was significantly enhanced (green curve), confirming the release of CSSNPs coated with streptavidin conjugate from the Apt-modified AuNPs, formation of Apt/target conjugate on the surface of AuNPs and the formation of hairpin structure of FAM and biotin-labeled CS on the surface of SNPs coated with streptavidin, which brings the fluorophore to close proximity to the surface of SNPs.
Fig. 2. Factors involved in the fluorescence intensity of the aptasensor. (a) Fluorescence spectra of FAM and biotin-labeled CS in the presence of various concentrations of SNPs coated with streptavidin (0, 30, 60, 120, 250 and 500 mg/mL, from bottom to top). (b) Fluorescence spectra of FAM and biotin-labeled CS-SNPs coated with streptavidin in the presence of different concentrations of Apt-modified AuNPs (0, 1, 2, 4, 6, 10 and 15 nM, from top to bottom). (c) Fluorescence intensity of FAM and biotin-labeled CS-SNPs coated with streptavidin as a function of Apt-modified AuNPs incubation time.
3.4. Optimization of experimental conditions for the fluorescent aptasensor 3.4.1. Optimum concentration of SNPs coated with streptavidin To obtain the optimum concentration of SNPs coated with streptavidin for complete reaction with FAM and biotin-labeled CS, different amounts of SNPs coated with streptavidin were added to a fix concentration of CS. As shown in Fig. 2(a), the final concentration of 250 mg/mL SNPs coated with streptavidin showed the
Fig. 3. Proof of concept for the designed aptasensor. Fluorescence intensity of FAM and biotin-labeled CS (blue curve), FAM and biotin-labeled CS-SNPs coated with streptavidin conjugate (red curve), the designed aptasensor (gray curve) and aptasensor þcocaine (green curve). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
292
a)
A.S. Emrani et al. / Biosensors and Bioelectronics 79 (2016) 288–293
5
(F -F 0)/F 0
4 3 2 1 0 0 .0 1
0 .1
1
10
100
C o c a in e ( n M )
range (0.5–20 nM) toward cocaine (Fig. 4(b)). The limit of detection was measured to be 209 pM (0.07 ng/mL) based on three times of the standard deviation of the blank/slope (Fig. S2). Reported detection limits of cocaine in different detection methods were as following: 5 mM for label-free DNA hairpin biosensor for colorimetric detection (Nie et al., 2013), 3 ng/mL for HPLC/MS (Johansen and Bhatia, 2007), 300 nM for Label-free electrochemical cocaine aptasensor (Hua et al., 2010), 190 nM for label-free fluorescence aptamer-based sensor (Qiu et al., 2013), 1 ng/mL for reversed-phase HPLC (Tagliaro et al., 1994), 10 pM for microfluidic affinity sensor (Hilton et al., 2011) 105 pM for electrochemical aptasensor based on single-walled carbon nanotubes, 0.48 nM for fluorescent aptasensor based on molecular beacon (Ma et al., 2011), gold electrode and complementary strand of aptamer (Taghdisi et al., 2015) and 0.48 nM for chemiluminescence aptasensor (Li et al., 2011). In comparison with the designed fluorescent aptasensor, most of these analytical approaches are costly, time-consuming and have higher LODs. 3.7. Selectivity of the designed fluorescent aptasensor A workable sensor not only should be sensitive to various concentrations of its target, but also should have acceptable selectivity for its target. The relative fluorescence intensities of the
a)
5
(F -F 0)/F 0
4 3 2 1 0 0 .0 1
0 .1
1
10
100
C o c a in e ( n M )
b)
Fig. 4. (a) Relative fluorescence intensity of FAM and biotin-labeled CS as a function of cocaine concentration. (b) Cocaine standard curve. F0 and F are the fluorescence intensities at 520 nm before and after addition of cocaine, respectively. (c) Relative fluorescence intensity of the fabricated aptasensor in the presence of various substances. F0 and F are the fluorescence intensities at 520 nm before and after addition of each substance, respectively.
3.6. Quantitative analysis of cocaine Fig. 4(a) indicates the relative fluorescence intensity of FAM and biotin-labeled CS at different concentrations of cocaine. The relative fluorescence intensity increased and reached to plateau at concentration of 20 nM cocaine. The assay indicated a well linear
Fig. 5. (a) Relative fluorescence intensity of FAM and biotin-labeled CS upon the addition of various concentrations of cocaine in serum. (b) Cocaine standard curve in serum. F0 and F are the fluorescence intensities at 520 nm before and after addition of cocaine, respectively.
A.S. Emrani et al. / Biosensors and Bioelectronics 79 (2016) 288–293
designed aptasensor toward cocaine and morphine were significantly higher than diazepam, propranolol and chloramphenicol (Fig. 4(c)). These results verified good selectivity of the fabricated aptasensor toward cocaine and morphine, which contain identical groups for recognition by Apt. 3.8. Detection of cocaine in serum The developed fluorescent aptasensor was utilized to measure cocaine in rat serum, as a complex biological fluid with a mixture of proteins and other interfering substances. Different amounts of cocaine were spiked into serum and LOD was measured to be 293 pM (0.098 ng/mL) (Fig. 5 and Fig. S3). The results confirmed the successful application of the designed fluorescent aptasensor for detection of cocaine in serum.
4. Conclusion In conclusion, a fluorescent aptasensor was developed for ultrasensitive and selective detection of cocaine, based on targetinduced release of Apt from CS, hairpin structure of CS and two kinds of nanoparticles, including SNPs coated with streptavidin and AuNPs. The limit of detection (LOD) for cocaine was measured as low as 209 pM. Furthermore, the designed fluorescent aptasensor could well recognize cocaine in serum with LOD of 293 pM.
Conflict of interest There is no conflict of interest about this article.
Acknowledgment Financial support of this study was provided by Mashhad University of Medical Sciences.
Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2015.12.025.
References Asturias-Arribas, L., Alonso-Lomillo, M.A., Domínguez-Renedo, O., Arcos-Martínez, M.J., 2014. Anal. Chim. Acta 834, 30–36. Benson, J., Fung, C.M., Lloyd, J.S., Deganello, D., Smith, N.A., Teng, K.S., 2015.
293
Nanoscale Res. Lett. 10 (1), 1–8. Cai, Q., Chen, L., Luo, F., Qiu, B., Lin, Z., Chen, G., 2011. Anal. Bioanal. Chem. 400 (1), 289–294. Dong, Y., Xu, Y., Yong, W., Chu, X., Wang, D., 2014. Crit. Rev. Food Sci. Nutr. 54 (12), 1548–1561. Du, F., Guo, L., Qin, Q., Zheng, X., Ruan, G., Li, J., Li, G., 2015. TrAC—Trends Anal. Chem. 67, 134–146. Eissa, S., Siaj, M., Zourob, M., 2015. Biosens. Bioelectron. 69, 148–154. Emrani, A.S., Danesh, N.M., Lavaee, P., Ramezani, M., Abnous, K., Taghdisi, S.M., 2016. Food Chem. 190, 115–121. Emrani, A.S., Taghdisi, S.M., Danesh, N.M., Jalalian, S.H., Ramezani, M., Abnous, K., 2015. Anal. Methods 7 (9), 3814–3818. Ge, J., Liu, Z., Zhao, X.S., 2012. Chin. J. Chem. 30 (9), 2023–2028. Hilton, J.P., Nguyen, T.H., Pei, R., Stojanovic, M., Lin, Q., 2011. Sens. Actuators A: Phys. 166 (2), 241–246. Hua, M., Tao, M., Wang, P., Zhang, Y., Wu, Z., Chang, Y., Yang, Y., 2010. Anal. Sci. 26 (12), 1265–1270. Johansen, S.S., Bhatia, H.M., 2007. J. Chromatogr. B: Anal. Technol. Biomed. Life Sci. 852 (1–2), 338–344. Kang, K., Sachan, A., Nilsen-Hamilton, M., Shrotriya, P., 2011. Langmuir: ACS J. Surf. Colloids 27 (23), 14696–14702. Li, X., Kao, F.J., Chuang, C.C., He, S., 2010. Opt. Express 18 (11), 11335–11346. Li, Y., Ji, X., Liu, B., 2011. Anal. BioAnal. Chem. 401 (1), 213–219. Lian, Y., He, F., Wang, H., Tong, F., 2015. Biosens. Bioelectron. 65, 314–319. Ma, C., Wang, W., Yang, Q., Shi, C., Cao, L., 2011. Biosens. Bioelectron. 26, 3309–3312. Mohammad Danesh, N., Ramezani, M., Sarreshtehdar Emrani, A., Abnous, K., Taghdisi, S.M., 2016. Biosens. Bioelectron. 75, 123–128. Mokhtarzadeh, A., Ezzati Nazhad Dolatabadi, J., Abnous, K., de la Guardia, M., Ramezani, M., 2015. Biosens. Bioelectron. 68, 95–106. Nguyen, T.H., Hardwick, S.A., Sun, T., Grattan, K.T.V., 2012. IEEE Sens. J. 12 (1), 255–260. Nie, J., Zhang, D.W., Tie, C., Zhou, Y.L., Zhang, X.X., 2013. Biosens. Bioelectron. 49, 236–242. Pang, Y., Rong, Z., Wang, J., Xiao, R., Wang, S., 2015. Biosens. Bioelectron. 66, 527–532. Qiu, L., Zhou, H., Zhu, W., Jiang, J., Shen, G., Yu, R., 2013. New J. Chem. 37 (12), 3998–4003. Ramezani, M., Danesh, N.M., Lavaee, P., Abnous, K., Taghdisi, S.M., 2016. Sens. Actuators B: Chem. 222, 1–7. Ramezani, M., Mohammad Danesh, N., Lavaee, P., Abnous, K., Mohammad Taghdisi, S., 2015. Biosens. Bioelectron. 70, 181–187. Roncancio, D., Yu, H., Xu, X., Wu, S., Liu, R., Debord, J., Lou, X., Xiao, Y., 2014. Anal. Chem. 86 (22), 11100–11106. Shi, Y., Dai, H., Sun, Y., Hu, J., Ni, P., Li, Z., 2013. Analyst 138 (23), 7152–7156. Storhoff, J.J., Elghanian, R., Mucic, R.C., Mirkin, C.A., Letsinger, R.L., 1998. J. Am. Chem. Soc. 120 (9), 1959–1964. Taghdisi, S.M., Danesh, N.M., Emrani, A.S., Ramezani, M., Abnous, K., 2015. Biosens. Bioelectron. 73, 245–250. Tagliaro, F., Antonioli, C., De Battisti, Z., Ghielmi, S., Marigo, M., 1994. J. Chromatogr. A 674 (1–2), 207–215. Wei, L., Wang, X., Li, C., Li, X., Yin, Y., Li, G., 2015. Biosens. Bioelectron. 71, 348–352. Wren, S.P., Nguyen, T.H., Gascoine, P., Lacey, R., Sun, T., Grattan, K.T.V., 2014. Sens. Actuators B: Chem. 193, 35–41. Wu, S., Zhang, H., Shi, Z., Duan, N., Fang, C., Dai, S., Wang, Z., 2015. Food Control 50, 597–604. Xiang, D., Shigdar, S., Qiao, G., Wang, T., Kouzani, A.Z., Zhou, S.F., Kong, L., Li, Y., Pu, C., Duan, W., 2015. Theranostics 5 (1), 23–42. Yang, C., Wang, Q., Xiang, Y., Yuan, R., Chai, Y., 2014. Sens. Actuators B: Chem. 197, 149–154. Yue, Q., Shen, T., Wang, L., Xu, S., Li, H., Xue, Q., Zhang, Y., Gu, X., Zhang, S., Liu, J., 2014. Biosens. Bioelectron. 56, 231–236. Zhao, B., Wu, P., Zhang, H., Cai, C., 2015. Biosens. Bioelectron. 68, 763–770. Zhou, W., Jimmy Huang, P.J., Ding, J., Liu, J., 2014. Analyst 139 (11), 2627–2640.