A search for virulence genes of Haemophilus parasuis using differential display RT-PCR

Veterinary Microbiology 96 (2003) 189–202

A search for virulence genes of Haemophilus parasuis using differential display RT-PCR C.E. Hill1 , D.S. Metcalf, J.I. MacInnes∗ Department of Pathobiology, Ontario Veterinary College, University of Guelph, Guelph, Ont., Canada N1G 2W1 Received 17 January 2003; received in revised form 16 June 2003; accepted 16 June 2003

Abstract Although Haemophilus parasuis is an important bacterial pathogen of swine, little is known about its pathogenesis or why some strains seem to be more virulent than others. Therefore, we used differential display reverse transcription-polymerase chain reaction (DDRT-PCR) to search for virulence-associated genes in a pathogenic serotype 5 strain, H. parasuis 1185. Gene expression was evaluated following growth in conditions chosen to begin to approximate those found in the upper respiratory tract and those encountered by the organism during acute infection. Seven different differentially expressed gene fragments were identified in cells grown at 40 ◦ C in both the presence and absence of swine serum. Based on the deduced amino acid sequences, the most strongly up-regulated genes were homologs of fadD (a fatty acyl-CoA synthetase), apaH (diadenosine tetraphosphatase), pstI (enzyme I of the phosphoenolpyruvate-protein phosphotransferase system), and cysK (cysteine synthetase). Homologs of Std (Na+ - and Cl− -dependent ion transporter), HSPG (a mammalian basement membrane-specific heparin sulphate core protein precursor) and PntB (pyridine nucleotide transhydrogenase) were also up-regulated, but to a much lower extent. Sequences homologous to all of the differentially expressed genes were detected in the reference strains of all 15 H. parasuis serotypes. This is the first report of a global search for virulence factors of H. parasuis. © 2003 Elsevier B.V. All rights reserved. Keywords: Haemophilus parasuis; Differential display RT-PCR; Virulence; fadD; apaH; pstI; cysK

1. Introduction Haemophilus parasuis, a ubiquitous bacterium in the upper respiratory tract of swine, is the causative agent of Glasser’s disease. With the recent changes in production methods, ∗ Corresponding author. Tel.: +1-519-824-4120x54731; fax: +1-519-767-0809. E-mail addresses: catherine [email protected] (C.E. Hill), [email protected] (D.S. Metcalf), [email protected] (J.I. MacInnes). 1 Present address: Health Canada, Laboratory for Foodborne Zoonoses, Guelph, Ont., Canada N1G 3W4.

0378-1135/$ – see front matter © 2003 Elsevier B.V. All rights reserved. doi:10.1016/S0378-1135(03)00212-8

190

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

diseases caused by H. parasuis have become increasingly significant world-wide (RappGabrielson et al., 1997). Presently, there are no satisfactory vaccines and because the onset of disease is often very sudden, antibiotics may be of little value (Rapp-Gabrielson et al., 1997). To date, more than 15 H. parasuis serotypes have been described, but in some countries up to 25% of isolates are untypable (Kielstein and Rapp-Gabrielson, 1992; Rapp-Gabrielson and Gabrielson, 1992). In addition, there are several lines of evidence to suggest isolates of the same serotype are very heterogeneous. For example, Blackall et al. (1997) using multilocus enzyme electrophoresis identified 34 electrophoretic types among 40 isolates. Some experimental challenge and epidemiological data suggest that serotypes 1, 5 and 12–14 are generally more virulent than others, but there has been no comprehensive studies to correlate serotype and pathogenicity of the organism in conventional swine nor are there any known virulence markers for H. parasuis (Kielstein and Rapp-Gabrielson, 1992; Amano et al., 1994). In Canada and the USA, approximately 40% of the H. parasuis isolates from diseased animals are serotype 4 or 5 (Rapp-Gabrielson, 1999). Several molecular strategies including microarray analysis, in vivo expression technology (IVET), differential display reverse transcription-polymerase chain reaction (DDRT-PCR), and signature-tagged mutagenesis have been used to identify virulence-associated genes in bacteria (Handfield and Levesque, 1999). DDRT-PCR was selected for the current study because, unlike the other techniques, it does not require sequence information or molecular tools which are currently unavailable for H. parasuis. In addition, DDRT-PCR allows several cell populations to be compared simultaneously and is reported to be highly reproducible and very sensitive (Liang and Pardee, 1992). Although DDRT-PCR was originally described for analysis of eukaryotic systems, recent modifications have allowed this technique to be used to study prokaryotes. For example, Gill et al. (1999) used DDRT-PCR to identify nine differentially expressed Escherichia coli genes in response to heat shock and a gene involved in the peptidoglycan biosynthetic pathway was identified in Vibrio cholerae (Chakrabortty et al., 2000) using this technique. In the current study, DDRT-PCR was optimized and used to identify differentially expressed genes of H. parasuis grown under different growth conditions chosen to begin to mimic those found in the host.

2. Materials and methods 2.1. Bacterial strains and culture conditions H. parasuis 1185, a virulent serotype 5 strain obtained from J. Gallant, Gallant Custom Labs, Guelph, Ont., was used in this work. When delivered by the aerosol route, 106 cfu/ml of this strain caused acute Glasser’s disease (unpublished data). For routine culture, H. parasuis strains were grown at 37 ◦ C on brain heart infusion (BHI) agar (Fisher Scientific, Nepean, Ont.) supplemented with 0.02% nicotinomide adenine dinucleotide (NAD) and 5% heat-inactivated horse serum (BHI–NAD–HS) in the presence of 5% CO2 . To begin to reproduce conditions in the upper respiratory tract, H. parasuis 1185 cells were grown overnight at 35 ◦ C in BHI–NAD–HS broth and to mimic conditions during acute disease, cells were grown at 40 ◦ C in BHI–NAD–HS broth in the presence of 50% heat-inactivated

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

191

pig serum. Gene expression following growth at 40 ◦ C in BHI–NAD–HS broth in the absence of serum was also evaluated. Reference strains of the 15 KRG H. parasuis serotypes (Kielstein and Rapp-Gabrielson, 1992) obtained from Ø. Angen at Danish Veterinary Laboratory, Copenhagen, Denmark were used for Southern blot and PCR analyses. 2.2. RNA isolation Total RNA was isolated from 3 ml cultures of H. parasuis 1185 using an RNeasy Spin Mini Kit (Qiagen Ltd., Mississauga, Ont.). The efficiency of RNA isolation was increased by homogenization of cell lysates using a QIAshredder spin column (Qiagen) and DNA contamination was eliminated using an RNase-free DNase set (Qiagen). RNA isolation was done according to the manufacturer’s suggestions except the cell lysis step was extended to 10 min and the DNase reaction was extended to 1 h. RNA was quantified spectrophotometrically (Ultrospec 2000, Amersham Biosciences, Baie d’Urfé, Que.). 2.3. Reverse transcription For cDNA synthesis, 1 ␮g of H. parasuis 1185 total RNA was reverse transcribed using 8 units of Moloney murine leukaemia virus reverse transcriptase (Gibco Ltd., Burlington, Ont.) in a solution containing 1 ␮M of random hexanucleotides (Invitrogen Life Technologies, Burlington, Ont.), 10 ␮l of 5× first strand buffer (250 mM Tris–HCl (pH 8.3), 375 mM KCl, 15 mM MgCl2 ), 8 mM DTT, 1 mM dNTPs, and 2 units of RNase inhibitor (Invitrogen Life Technologies) in a total volume of 50 ␮l. The cDNA reactions were carried out at 40 ◦ C for 1 h, then at 72 ◦ C for 5 min using a T-Gradient thermocycler (Biometra, Goettingen, Germany). 2.4. Differential display PCR The cDNAs were amplified under relatively relaxed conditions. The 20 ␮l total reaction volume contained 6 ␮M MgCl2 , 0.8 ␮l of reverse transcription reaction, 1.5 ␮M of arbitrary 13-mer primers (GenHunter Corp., Nashville, TN), 0.15 mM dNTPs, 2 ␮l of 10× PCR buffer (200 mM Tris–HCl (pH 8.4), 500 mM KCl), and 2.5 units of Taq DNA polymerase (Gibco). The following conditions were used for amplification: 5 min at 94 ◦ C, 40 cycles of 1 min at 94 ◦ C, 2 min at 40.6 ◦ C, and 30 s at 72 ◦ C, and one final elongation of 5 min at 72 ◦ C. More than 20 primer pair combinations were tested for their ability to amplify H. parasuis cDNAs. In order to increase the chance of amplification, primers with a G + C content (%) comparable to that of H. parasuis (∼41–42%) were used (GenHunter RNAimage® Kit 6). The primer pair combinations which generated a reasonable number of bands for analysis are shown in Table 1 and the sequences of the primers are shown in Table 2. 2.5. Sodium dodecyl polyacylamide gel electrophoresis (SDS-PAGE) and silver staining The DD-PCR products were separated by SDS-PAGE using 15% separating/4% stacking gels. The gels were electrophoresed at 195 V for 80 min in 1× buffer (10× buffer: 0.25 M

192

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

Table 1 Amplification by different arbitrary primer combinations used in DD-PCR AP primer pair

No. of bands generated

No. of differentially expressed bands

Band(s) characterized

AP17/AP18 AP17/AP19 AP17/AP20 AP17/AP22 AP17/AP24 AP17/AP41 AP17/AP48 AP18/AP19 AP18/AP21 AP18/AP41 AP19/AP20 AP21/AP22 AP23/AP24 AP41/AP48

30 15 20 20 5 30 15 20 20 10 10 30 5 15

3 1 5 2 1 5 1 5 4 1 2 4 1 4

CHG1a CHG24 rRNA 13b /CHG27 CHG28 CHG2/CHG3c rRNAs 6–9 rRNAs 10–11 rRNA 12 rRNAs 1–4/CHG10 rRNA 5/CHG15/CHG17

a

The eight differentially expressed gene fragments identified in this study are shown in bold. rRNAs 1–3, 5 and 11 have sequence homology to 16S rRNA. rRNAs 4, 6–10, 12 and 13 have sequence homology to 23S rRNA. c CHG2 was a smaller overlapping gene fragment of CHG3; CHG3 was used for subsequent analysis. b

Tris, 0.192 M glycine, and 0.1% SDS). DNA bands were visualized by silver staining using the method of Peng (1995). 2.6. Re-amplification Following silver staining, gels were rinsed 3× 10 min in deionized water before the differentially expressed bands of interest were “scratched” with a 25-gauge needle. The material removed was re-suspended in 20 ␮l of deionized water. After incubation for 5 min at room temperature, the DNA solutions were placed on ice and used directly in re-amplification reactions. Ten microlitres of this suspension was added to a 30 ␮l re-amplification reaction Table 2 Sequences of arbitrary primers used in DD-PCR Primer

Sequence 5 –3

G + C content (%)

AP17 AP18 AP19 AP20 AP21 AP22 AP23 AP24 AP41 AP48

AAGCTTACCAGGT AAGCTTAGAGGCA AAGCTTATCGCTC AAGCTTGTTGTGC AAGCTTTCTCTGG AAGCTTTTGATCC AAGCTTGGCTATG AAGCTTCACTAGC AAGCTTACGGGGT AAGCTTGCGGTGA

46 46 46 46 46 38 46 46 54 54

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

193

using the same amplification conditions and primer pairs that were used for the initial DD-PCR. Half of the re-amplified product was run on a 15% SDS-PAG to check that the single band of interest was re-amplified. At this point, the remaining PCR product was purified using a QIAquick PCR purification kit (Qiagen). Alternatively, the entire re-amplification product was run on a 1.5% agarose (BIO-RAD, Hercules, CA) gel and the re-amplification product was purified from the gel using a QIAquick gel extraction kit (Qiagen). 2.7. Cloning and sequencing Immediately prior to cloning, 3 A overhangs were added by incubation of 10 ␮l of purified PCR product, 1.2 ␮l of 10× buffer (Qiagen), 0.07 mM dNTPs (Amersham Biosciences) and 6.8 units of Taq polymerase. The reactions was incubated at 72 ◦ C for 10 min then placed on ice prior to being ligated into pCR® 4–TOPO® according to manufacturer’s instructions (Invitrogen Life Technologies). The next day, colonies were patched onto another LB-AMP plate and screened for the presence of inserts by rapid disruption of bacterial colonies as described previously (Sambrook et al., 1989). The transformants were analysed for the presence of inserts by PCR using the same primer pairs that were used in the initial DD-PCR. Inserts were sequenced by dye terminator cycle sequencing at the Guelph Molecular Supercentre, University of Guelph, using a universal T7 primer. DNA sequences were analysed using the Basic Local Alignment Search Tool (BlastX) to identify homologs of the genes at GenBank, the National Centre for Biotechnology Information server (http://www.ncbi.nlm.nih.gov). Alignments with the closest homologs identified in GenBank were done using the European Bioinformatics Institute ClustalW program (http://www.ebi.ac.uk/clustalw/). 2.8. Confirmation of differential expression by RT-PCR A second round of DD-PCR was done using specific primers (Sigma-Genosys, Oakville, Ont.) based on the sequence of the differentially expressed gene fragments (Table 3). The PCR conditions in this second PCR were the same except that, depending on the G + C content (%) of the primers, the annealing temperature was more stringent. In order to preserve the differences in starting mRNA template, the number of PCR cycles was reduced to 25 (Mathieu-Daude et al., 1999). The conditions were as follows: a hot-start of 2 min at 94 ◦ C, 25 cycles of 30 s at 94 ◦ C, 30 s at 47.4 ◦ C to 55 ◦ C depending on the gene fragment being amplified (Table 3), 1 min at 72 ◦ C, and a final extension for 5 min at 72 ◦ C. Quantitation of expression of the differentially expressed gene fragments was done with images captured by Gene Snap software using the BioImaging System, Gene Genius and analysed using Gene Tools software (Syngene, Frederick, MD). 2.9. DDRT-PCR reproducibility In order to assess the reproducibility of the technique, triplicate DDRT-PCR reactions were performed using two arbitrary 13-mer primers, AP17 and AP18 (Table 2), as described earlier. Two independent RNA preparations from each of the three conditions tested were examined. Three independent DDRT-PCR experiments done on different days were also

194

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

Table 3 Sequences of specific primers used to confirm differential expression Primer pair

Sequence 5 –3

Product length (bp)

Annealing temperature (◦ C)

CHG1-F CHG1-R

GTGGTACTGCTCGTTAAGTC GCTTAGAGGCAGTATCAGAG

300

47.4

CHG3-F CHG3-R

TCGTAGGAAGCCATTCAG CAGCTTCTATCTTGTTCCTG

450

48

CHG10-F CHG10-R

GCCCCCAAAGCCTTCACATA GATGAACTTTGGCTAACGGG

96

50

CHG15-F CHG15-R

GCGGTGGAGCAAAGTTGGAA GTCCCGTGCGTAAGAAACCA

300

50

CHG17-F CHG17-R

TTCTGTGGAAGAGATCCGTG ACGGGGTCGATACTGAAGAA

215

50

CHG24-F CHG24-R

CTTATCGCTCCATTGAGCGT CTTGCTGAAGCGAAAGTGCC

250

55

CHG27-F CHG27-R

GCTTACCAGGTCCACACAAT ATAACGTTCTGAGGCGGAAG

275

55

compared. An arbitrary scoring system was devised to compare the gels based on the number of bands observed. A score of 100% was given for the replicate with the most bands. If one band was missing from one of the three replicates, a score of −3% was given to that replicate. If, however, the band was present but faint, a score of −1.5% was given. 2.10. Southern blotting Genomic DNA was isolated from H. parasuis 1185 using a GenomicPrep kit (Amersham Biosciences) and digested with PstI. Following digestion, the DNA was electrophoresed on 1% agarose gel and transferred to a positively charged nylon membrane (Roche Applied Science, Laval, Que.). The DNA was cross-linked to the membrane by UV irradiation (FB-UVXL-1000, Fisher Scientific). Southern blot analysis was performed as described in the “DIG System User’s Guide for Filter Hybridization” (Boehringer Mannheim, Laval, Que). The membrane was hybridized overnight with a DIG-labelled probe to CHG3, prepared using the Random Primed DNA labelling kit (Roche Applied Science) according to the manufacturer’s instructions. Hybridization was carried out under moderately stringent conditions in a buffer containing 50% formamide (Fisher Scientific), 5×SSC (20× SSC: 3 M NaCl, 0.3 M Na citrate, pH 7.0), 0.1% l-lauryl-sarcosine, 0.02% SDS, and 1% blocking reagent (Roche Applied Science) at 37 ◦ C. Washes with 2× SSC were carried out at room temperature twice for 5 min and 0.5× SSC washes were carried out at 37 ◦ C twice for 15 min. Alternatively, genomic DNA isolated from the reference strains of H. parasuis serotypes 1–15 was used as template in PCRs to screen for the presence of CHG1, CHG10, CHG15,

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

195

CHG17, CHG24 and CHG27 using the specific primers in Table 2 and using the conditions described in confirmation of differential gene expression. 2.11. Nucleotide sequence accession numbers The GenBank accession numbers for the sequences reported in this paper are AY204903 (CHG1), AY204904 (CHG3), AY204905 (CHG10), AY204906 (CHG15), AY204907 (CHG17), AY204908 (CHG24), and AY204909 (CHG27). 3. Results 3.1. Reproducibility of DDRT-PCR in H. parasuis After using arbitrary primers AP17 and AP18 (Table 2) in DDRT-PCR experiments, a reproducible pattern of approximately 30 bands was observed. The gel shown in Fig. 1 was selected as it had the greatest number of clear differences. In general, there was little difference in the pattern of bands obtained when using independent RNA preparations (Fig. 1, lanes 1–3 versus lanes 5–7) or between different replicates done on the same day (Fig. 1, lanes 2 and 3). Similarly, over 3 days there was little variation of banding pattern with the same RNAs and primers (data not shown). Based on the arbitrary scoring system described earlier, DDRT-PCR was found to be 97.3% reproducible for RNAs tested on a single day and 97.8% reproducible for the same RNA across 3 days.

Fig. 1. Silver-stained SDS-PAG of DDRT-PCR products. Two independent preparations of RNA isolated from H. parasuis grown at 35 ◦ C were amplified using arbitrary primers AP17 and AP18. (Lanes 1–3) DDRT-PCR products from triplicate reactions of RNA #1; (lane 4) 100 bp DNA ladder; (lanes 5–7) DDRT-PCR products from triplicate reactions of RNA #2. The arrows indicate the positions of four major bands missing from the replicate in lane 5.

196

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

3.2. Differentially expressed genes Depending on the primers used, the number of amplification products generated by DDRT-PCR studies of H. parasuis ranged from 0 to approximately 30. There were no bands present in the negative controls, which confirmed the absence of contaminating DNA in the RNA samples used to synthesize the cDNAs. Thirty-nine differentially expressed bands were identified by DDRT-PCR in cells grown at 40 ◦ C. Twenty of these differentially expressed bands were successfully re-amplified, cloned, and sequenced. Twelve re-amplified products shared homology with rRNA sequences, seven recombinants shared homology with genes found in other bacteria, and one had low homology with a mammalian protein (Tables 1 and 4). 3.3. Identification of differentially expressed genes The percent identity and similarity of the closest homologs of the deduced amino acids of the differentially expressed genes are shown in Table 5. The homology between CHG1 and perlecan is low and alignment of the sequences reveals that the conserved and identical amino acids are scattered over a large region. The deduced amino acid sequence of Table 4 Quantitation of expression Gene fragment

Growth conditiona

CHG1 (Hsp homolog)

1 2 3

– 1.3 1.8

CHG3 (Sdt homolog)

1 2 3

– 2 1.7

CHG10 (ApaH homolog)

1 2 3

– 7.7 5.7

CHG15 (FadD homolog)

1 2 3

– 35 13

CHG17 (PstI homolog)

1 2 3

– 22.4 2.8

CHG24 (PntB homolog)

1 2 3

– 1.2 –

CHG27 (CysK homolog)

1 2 3

– 22.7 7.5

Fold increase

a Growth condition: (1) BHI–NAD–HS at 35 ◦ C; (2) BHI–NAD–HS at 40 ◦ C; (3) BHI–NAD–HS + 50% swine serum at 40 ◦ C.

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

197

CHG3 shares high homology with many bacterial sodium- and chloride-dependent ion transporters (Sdt homolog) with the greatest homology between amino acids 1–85 of the CHG3 fragment. The deduced amino acids of the 142 bp CHG10 fragment share homology with diadenosine tetraphosphatase, ApaH, an Ap4A-hydrolase responsible for preventing cell damage during heat shock by reducing diadenosine tetraphosphate (Ap4A) molecules in the cell. The alignment result of CHG10 with its closest homologs demonstrates that the region of homology is located close to the carboxy terminus of the ApaH homologs. The CHG15 fragment shares homology with long chain fatty acid CoA ligase (FadD), an enzyme involved in the uptake and esterification of long chain fatty acids. Alignments between CHG15 and its closest homologs demonstrate the presence of part of the fatty acyl-CoA synthetase signature motif (FACS) that 11 of 25 amino acids are present at the extreme 3 end of the fragment. CHG17 shares homology with a number of PstI homologs. PstI is a member of the phosphoenolpyruvate (PEP)-protein phosphotransferase system (PTS), which is involved in carbohydrate uptake. The deduced amino acid sequence of the CHG24 gene fragment shares very high homology with pyridine nucleotide transhydrogenases (PntB), which are involved in providing NADPH for biosynthesis in the pentose phosphate pathway. Alignment between CHG24 and its closest homologs shows that the homology is located near the amino terminus of the PntB proteins (data not shown). Finally, the CHG27 gene fragment encodes a polypeptide that shares homology with a number of cysteine synthetases (CysK). The region of highest homology is located at the N-terminus of CHG27. 3.4. Confirmation of differential expression by RT-PCR Up-regulation of the gene fragments was confirmed using specific primers in a second round of PCR under more stringent conditions (Table 3). RNA controls were included to demonstrate the lack of DNA contamination. Up-regulation of the different differentially expressed genes was generally greatest at 40 ◦ C in the absence of 50% swine serum (Table 4). The FadD, PstI, and CysK homologs were all induced more than 20-fold at 40 ◦ C whereas the ApaH homolog was only induced about 7-fold. Induction of the Hsp and Std homologs was even lower but greater than 1.5-fold, which is considered to be the cut-off for significance (Boyce et al., 2002). When specific primers were used, the PntB homolog was induced only 1.2-fold. 3.5. Presence of the differentially expressed gene fragments in H. parasuis reference serotypes Sequences with homology to CHG1, CHG3, CHG10, CHG15, CHG17, CHG24, and CHG27 were detected in reference strains of all 15 H. parasuis serotypes by Southern blotting or PCR analysis (data not shown).

4. Discussion and conclusions Although H. parasuis is an important bacterial pathogen of swine world-wide, there are no known virulence markers nor are there any effective vaccines or effective diagnostic

198

Table 5 Homologs of differentially expressed H. parasuis gene fragments Size (bp)

Homolog(s)

Description

Accession no.

Identity (%)

Homologya (%)

CHG1

311

Homo sapiens

Basement membrane-specific heparin sulphate core protein precursor (perlecan)

XP 035465

28

63

CHG3

267b

H. influenzae H. somnus P. multocida

Na+ - and Cl− -dependent ion transporter

U32842 NZ AABG01000004 AE006074

78 79 78

93 97 93

CHG10

142

A. actinomycetemcomitans H. influenzae ApaH P. multocida ApaH

Diadenosine tetraphosphatase

AF043998 U32737 AE006161

61 57 54

83 87 78

CHG15

304

H. influenzae P. multocida FadD V. cholerae

Long-chain fatty acid CoA ligase

U32686 AE006132 AE004318

84 82 72

95 97 91

CHG17

215

E. coli

PEP-protein phosphotransferase system enzyme I

AE005472

70

85

U32844 AE006128

75 79

92 92

H. influenzae P. multocida PstI CHG24

242

H. influenzae PntB P. multocida PntB H. somnus

Pyridine nucleotide transhydrogenase

U20964 AE006113 ZP 00122249

89 88 88

90 91 89

CHG27

291c

H. influenzae CysK P. multocida CysK H. somnus

Cysteine synthetase

U32790 AE006206 NZ AABG01000001

84 79 74

93 89 91

a

Identical plus conserved and semi-conserved amino acids. The entire fragment length was 393 bp but only the 267 bp that shared homology with Na+ - and Cl− -dependent ion transporters was compared. c The entire fragment length was 398 bp but only the 291 bp that shared homology with CysK was compared.

b

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

Gene fragment

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

199

tests. Although some serotypes are thought to be more virulent than others, there is not an absolute correlation between serotype and pathogenicity (Kielstein and Rapp-Gabrielson, 1992). In order to control Glasser’s disease, it is necessary to be able to identify H. parasuis strains with high pathogenic potential. To do this, we hypothesized that virulence factors had to be identified in order to differentiate between strains with little pathogenic potential and those with the ability to cause severe Glasser’s disease. DDRT-PCR was used to study the effects of specific environmental conditions on H. parasuis gene expression. The conditions were selected in the hopes of being able to identify true virulence genes rather than so called virulence lifestyle genes such as adhesions which would be predicted to be in strains of both high and low virulence potential (Wassenaar and Gaastra, 2001). In the current study, a number of 13-mer arbitrary primers were found to amplify cDNA synthesized from H. parasuis RNA. Most, but not all, of these had a G + C content (%) comparable to that of H. parasuis (Table 2). As was seen in other studies (Rivera-Marrero et al., 1998), a number of rRNA sequences were amplified in the current work. It might be possible to limit such unwanted amplification using a bacterial mRNA purification kit (MICROBExpressTM , Ambion, Austin, TX), which has very recently become available. In the current study, seven genes were detected that were differentially expressed following a temperature up-shift of H. parasuis (Tables 4 and 5). All but the CHG1 homolog were expressed at the highest level in the absence of serum. Three of the genes identified in this study were up-regulated only to a small degree. The first of these, CHG1, is a homolog of the basement membrane-specific heparin sulphate protein, perlecan. Although the resemblance to mammalian protein present in joints is intriguing, the level of homology is quite low (Table 4) and is scattered throughout the immunoglobulin-like (IG) domain 10 of the 12 IG domains of perlecan (data not shown). The role of this gene in pathogenesis, if any, requires further study. The CHG3 gene fragment was also up-regulated to a low degree. It encodes a homolog of several Sdt proteins, which are sodium- and chloride-dependent ion transporters common among bacterial pathogens, including Pasteurella multocida, H. influenzae, Actinobacillus actinomycetemcomitans and A. pleuropneumonaie. There are several lines of evidence that suggest that these transporters contribute to virulence and it has been hypothesized that the Na+ motive force may provide an additional source of energy to the proton motive force (Häse et al., 2001). One other possible role for these pumps is the adaptation to an environment high in salt such as is found in blood plasma (Häse et al., 2001). As H. parasuis is always host associated (and Na+ concentrations may even be higher in the upper respiratory tract) the presence of a Na+ pump might be useful for growth in all conditions, particularly in the face of superoxide radicals. A third gene fragment whose expression initially appeared be differentially expressed was found to be only slightly up-regulated when DDRT-PCR was repeated with specific primers (Table 5). This low level of induction is of arguable significance (Boyce et al., 2002). The deduced amino acid gene fragment CHG24 shares high homology with PntB a pyridine nucleotide transhydrogenase which provides NADPH for biosynthesis in the pentose phosphate pathway. In aerobic conditions, E. coli mutants lacking nucleotide transhydrogenase activity have increased sensitivity to oxidative stress and grow more slowly because NADPH is required for cellular biosynthesis (Hickman et al., 2002) but again, a role for this gene in virulence, would have to be established.

200

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

The level of expression of four other genes was markedly increased. CHG10 encodes a protein that shares high homology with Ap4A-hydrolases of several members of the family Pasteurellaceae (Table 4). Ap4A-hydrolases are induced in response to the accumulation of Ap4A during heat shock and it has been hypothesized that ApaH may prevent cell damage by reducing the levels of Ap4A molecules in the cell, which can dysregulate cell functions (Johnston and Farr, 1991). Several studies suggest that Ap4A plays an important role in modulating the heat shock response, not only because Ap4A levels rise when the cell is exposed to heat, but because apaH mutants have increased sensitivity to killing by heat (Fuge and Farr, 1993) although it the mechanism by which Ap4A prevents cell damage is not clear. The CHG15 fragment encodes a protein which shares high homology with the FadD an enzyme involved in lipid synthesis and whose expression may be important at various stages in infection (Table 4). Long chain fatty acyl-CoA ligases play an important role in the uptake of long chain fatty acids (LCFA) and formation of fatty acyl-CoA. All fatty acyl-CoA synthetases have a 25-amino acid consensus FACS signature motif, DGWLHTGDIGXWXPXGXLKIIKRKK (Black et al., 1997) which is essential for catalytic activity and is important in determining fatty acid chain length specificity. CHG15 contains 11 amino acid residues of this motif at the 3 end of the fragment. Of these 11 amino acids, 5 are identical and 2 are highly conserved. Acyl-CoA synthetase gene expression has been demonstrated to be important in virulence in a number of organisms. For example, the fadD homolog of Xanthomonas campestris, rpfB, is part of a cluster of genes that are involved in regulating the synthesis of virulence factors (Soto et al., 2002). Virulence of X. campestris is reduced when a mutation is introduced in rpfB, as it leads to a reduction of extracellular enzyme and polysaccharide production. The loss of acyl-CoA synthetase in S. enterica serovar Typhimurium represses the expression of hilA, which is involved in activating invasion genes. In a study by Utley et al. (1998), they determined that a S. enterica serovar Typhimurium fad mutant was avirulent after inoculation in mice. The deduced amino acid sequence of CHG17 has homology with PstI, enzyme I of the phosphoenolpyruvate-protein phosphotransferase system that transports carbohydrates into the cell and is involved in signal transduction (Table 4). It has been suggested that PTS controls the expression of many virulence factors via catabolite repression (Chung et al., 2000). Listeria monocytogenes virulence genes are regulated by catabolite repression and are repressed by ␤-glucosides (Gravesen et al., 2000). Interestingly, three components of the ␤-glucoside PEP-PTS system were identified by Gravesen et al. (2000) using DDRT-PCR. CHG27 encodes a protein that is highly homologous to the cysteine synthetase, CysK, of different members of the family Pasteurellaceae (Table 3). There have been no previous reports of an up-regulation of cysK in response to heat shock, however, cysK expression has been shown to be regulated by other environmental stimuli such as pH and salt stress (Duche et al., 2002; Stancik et al., 2002). In summary, this is the first report of a global search for virulence factors of H. parasuis. DDRT-PCR was optimized to compare gene expression of cells grown under different in vitro growth conditions and using a relatively small number of primers, seven differentially expressed genes were identified. Further analysis of these differentially expressed gene fragments by the creation of isogenic strains by, e.g. allelic exchange mutagenesis would be needed to demonstrate the role of these genes in H. parasuis virulence, but unfortunately

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

201

there are no systems to do this at this time. Furthermore, Southern blot and/or PCR analyses showed that all of the differentially expressed gene fragments were present in the reference strains of all 15 H. parasuis serotypes so even if it could be demonstrated that these genes were involved in virulence, they would not be suitable markers of H. parasuis strains with high pathogenic potential for diagnostic purposes. Nevertheless, DDRT-PCR appears to have good potential for the identification genes that may be involved in virulence, particularly those unique to isolates with high pathogenic potential. In the long term, the identification of virulence factors will not only help to elucidate the pathogenesis of H. parasuis but it will also be useful for the development of therapeutic agents and/or diagnostic tools.

Acknowledgements These studies were supported by a Natural Sciences and Engineering Research Council of Canada (NSERC) grant.

References Amano, H., Shibata, M., Kajio, N., Morozumi, T., 1994. Pathologic observations of pigs intranasally inoculated with serovars 1, 4, and 5 of Haemophilus parasuis using immunoperoxidase method. J. Vet. Med. Sci. 56, 639–644. Black, P.N., Zhang, Q., Weimar, J.D., DiRusso, C.C., 1997. Mutational analysis of a fatty acyl-coenzyme A synthetase signature motif identifies seven amino acid residues that modulate fatty acid substrate specificity. J. Biol. Chem. 272, 4896–4903. Blackall, P.J., Trott, D.J., Rapp-Gabrielson, V., Hampson, D.J., 1997. Analysis of Haemophilus parasuis by multilocus enzyme electrophoresis. Vet. Microbiol. 56, 125–134. Boyce, J.D., Wilkie, I., Harper, M., Paustian, M.L., Kapur, V., Adler, B., 2002. Genomic scale analysis of Pasteurella multocida gene expression during growth within the natural chicken host. Infect. Immun. 70, 6871–6879. Chakrabortty, A., Das, S., Majumdar, S., Mukhopadhyay, K., Roychoudhury, S., Chaudhuri, K., 2000. Use of RNA arbitrarily primed-PCR fingerprinting to identify Vibrio cholerae genes differentially expressed in the host following infection. Infect. Immun. 68, 3878–3887. Chung, T., Farh, L., Chen, Y., Shiuan, D., 2000. Molecular cloning and characterization of a unique 60 kDa/72 kDa antigen gene encoding enzyme I of the phosphoenolpyruvate: sugar phosphotransferase system (PTS) of Mycoplasma hyopneumoniae. J. Biochem. 128, 261–269. Duche, O., Tremoulet, F., Glaser, P., Labadie, J., 2002. Salt stress proteins induced in Listeria monocytogenes. Appl. Environ. Microbiol. 68, 1491–1498. Fuge, E.K., Farr, S.B., 1993. AppppA-binding protein E89 is the Escherichia coli heat shock protein ClpB. J. Bacteriol. 175, 2321–2326. Gill, R.T., Valdes, J.J., Bentley, W.E., 1999. Reverse transcription-PCR differential display analysis of Escherichia coli global gene regulation in response to heat shock. Appl. Environ. Microbiol. 65, 5386–5393. Gravesen, A., Warthoe, P., Knochel, S., Thirstrup, K., 2000. Restriction fragment differential display of pediocin-resistant Listeria monocytogenes 412 mutants shows consistent overexpression of a putative ␤-glucoside-specific PTS system. Microbiology 146, 1381–1389. Handfield, M., Levesque, R.C., 1999. Strategies for isolation of in vivo expressed genes from bacteria. FEMS Microbiol. Rev. 23, 69–91. Häse, C.C., Fedorova, N.D., Galperin, M.Y., Dibrov, P.A., 2001. Sodium ion cycle in bacterial pathogens: evidence from cross-genome comparisons. Microbiol. Mol. Biol. Rev. 65, 353–370. Hickman, J.W., Barber, R.D., Skaar, E.P., Donohue, T.J., 2002. Link between membrane-bound pyridine nucleotide transhydrogenase and glutathione-dependent processes in Rhodobacter sphaeroides. J. Bacteriol. 184, 200– 209.

202

C.E. Hill et al. / Veterinary Microbiology 96 (2003) 189–202

Johnston, D.B., Farr, S.B., 1991. AppppA binds to several proteins in Escherichia coli, including the heat shock and oxidative stress proteins DnaK, GroEL, E89, C45 and C40. EMBO J. 10, 3897–3904. Kielstein, P., Rapp-Gabrielson, V.J., 1992. Designation of 15 serovars of Haemophilus parasuis on the basis of immunodiffusion using heat-stable antigen extracts. J. Clin. Microbiol. 30, 862–865. Liang, P., Pardee, A.B., 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967–971. Mathieu-Daude, F., Trenkle, T., Welsh, J., Jung, B., Vogt, T., McClelland, M., 1999. Identification of differentially expressed genes using RNA fingerprinting by arbitrarily primed polymerase chain reaction. Methods Enzymol. 303, 309–324. Peng, H., 1995. High-resolution Sscp analysis using polyacrylamide agarose composite. Biotechniques 19, 410– 414. Rapp-Gabrielson, V.J., 1999. Haemophilus parasuis. In: Straw, B.E., D’Allaire, S., Mengeling, W.L., Taylor, D.J. (Eds.), Diseases of Swine, eighth ed. University Iowa State Press, Ames, pp. 475–481. Rapp-Gabrielson, V.J., Gabrielson, D.A., 1992. Prevalence of Haemophilus parasuis serovars among isolates from swine. Am. J. Vet. Res. 53, 659–664. Rapp-Gabrielson, V.J., Kocur, G.J., Clark, J.T., Muir, S.K., 1997. Haemophilus parasuis: immunity in swine after vaccination. Vet. Med. 92, 83–90. Rivera-Marrero, C.A., Burroughs, M.A., Masse, R.A., Vannberg, F.O., Leimbach, D.L., Roman, J., Murtagh Jr., J.J., 1998. Identification of genes differentially expressed in Mycobacterium tuberculosis by differential display PCR. Microb. Pathog. 25, 307–316. Sambrook, J., Fritsch, E.F., Miniatis, T., 1989. Plasmid vectors. In: Molecular Cloning, second ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp. 1–32. Soto, M.J., Fernandez-Pascual, M., Sanjuan, J., Olivares, J., 2002. A fadD mutant of Sinorhizobium meliloti shows multicellular swarming migration and is impaired in nodulation efficiency on alfalfa roots. Mol. Microbiol. 43, 371–382. Stancik, L.M., Stancik, D.M., Schmidt, B., Barnhart, D.M., Yoncheva, Y.N., Slonczewski, J.L., 2002. pH-dependent expression of periplasmic proteins and amino acid catabolism in Escherichia coli. J. Bacteriol. 184, 4246–4258. Utley, M., Franklin, D.P., Krogfelt, K.A., Lauz, D.C., Cohen, P.S., 1998. A Salmonella typhimurium mutant unable to utilize fatty acids and citrate is avirulent and immunogenic in mice. FEMS Microbiol. Lett. 163, 129–134. Wassenaar, T.M., Gaastra, W., 2001. Bacterial virulence: can we draw the line? FEMS Microbiol. Lett. 210, 1–7.