Aging decreases retinoic acid and triiodothyronine nuclear expression in rat liver: exogenous retinol and retinoic acid differentially modulate this decreased expression

Mechanisms of Ageing and Development 99 (1997) 123 – 136

Aging decreases retinoic acid and triiodothyronine nuclear expression in rat liver: exogenous retinol and retinoic acid differentially modulate this decreased expression V. Pallet a, V. Azaı¨s-Braesco b, V. Enderlin a, P. Grolier b, C. Noe¨l-Suberville a, H. Garcin a, P. Higueret a,* a

Laboratoire de Nutrition, ISTAB, A6enue des Faculte´s, Uni6ersite´ de Bordeaux I, 33405 Talence, France b Centre de Recherche en Nutrition Humaine, INRA, B.P. 321, 63009 Clermont-Ferrand, France Received 18 February 1997; received in revised form 9 June 1997; accepted 12 June 1997

Abstract The expression of nuclear receptors of retinoic acid (RAR) and triiodothyronine (TR) was analyzed in the liver of rats aged 2.5 (young), 6 (adult) and 24 (aged) months. In aged rats, decreased binding properties, binding capacity (Cmax) and affinity (Ka), of nuclear receptors were observed. This resulted, at least in part, from decreased transcription of receptor genes in that the amount of their mRNA also decreased. Moreover, the activity of malic enzyme (ME) and tissue transglutaminase (tTG), whose genes are TR and RAR responsive, respectively, was reduced in aged rats. These results are in agreement with the decreased binding capacity of these receptors. An inducer-related increase of RAR and TR expression was observed 24 h after a single dose of retinoic acid administration (5 mg/kg), while retinol administration (retinyl palmitate, 13 mg/kg) was without incidence on nuclear receptor expression in aged rats. © 1997 Elsevier Science Ireland Ltd. Keywords: Aging; Nuclear receptor; RAR; TR; mRNA; Retinol; Retinoic acid

* Corresponding author. Fax: + 33 556842776. 0047-6374/97/$17.00 © 1997 Elsevier Science Ireland Ltd. All rights reserved. PII S 0 0 4 7 - 6 3 7 4 ( 9 7 ) 0 0 0 9 8 - 5

124

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

1. Introduction Aging is an unavoidable and universal process characterized by a progressive decline in the functional capacity of several major organ systems (Teramoto et al., 1994). The specific causes of this decline are not well known and two theories about the cellular mechanism of aging are commonly proposed. One considers that cellular death, which is the ultimate term of aging, results from an active process of programmed development, while the other proposes aging as resulting from a passive accumulation of mistakes in macromolecule synthesis. Aging functionally and morphologically alters all tissues and organs. The exact nature of these alterations and their importance in aging are unclear, largely due to species, strain, and gender differences. In the liver, aging induces anatomical (decrease of weight) and histological disorders (decrease in the number of hepatocytes, increase in binucleararity and polyploidization, decrease in the number of mitochondria and possible development of fibrosis (Tauchi et al., 1994)). Among the functional diseases observed in the aged liver there are problems due to modifications of hormonal status (Mooradian and Wong, 1994) resulting mainly from a decrease in the responsiveness to various hormones and from a deficit of genic transcription and translation of certain messengers (Dice and Goff, 1988). Concerning thyroid status, aging induces a decrease in the hormone degradation rate and, secondly, through negative feedback loops, a decrease in the secretory rate so that the serum level of triiodothyronine (T3) is slightly reduced or unaltered. Thus, it appears, in studies performed on human beings and experimental animals, that the serum T3 level is either reduced (Frolkis and Valueva, 1978) or unchanged by age (Olsen et al., 1978). Moreover, the sensitivity of target cells to thyroid hormones is reduced with aging since there is either a decrease of the number or the affinity of receptors (Nayer et al., 1991), or an alteration of the postreceptor responsiveness (Davis, 1979). Most thyroid diseases described in elderly people are related to a hypothyroid status (Finucane and Anderson, 1995). Vitamins can also be involved in the development of problems during aging. Indeed, several physiological and biochemical modifications can alter the vitamin status of elderly people. For instance there are alterations of food intake, plasma vitamin transport, cellular uptake, or metabolism. Such modifications have a drastic effect when the vitamins involved are factors in genic transcription such as vitamin A and D. Modifications of vitamin A status during aging are reported in humans as well as in rodents. High vitamin A concentrations have been detected in the liver of old mice (Sundboom and Olson, 1984), old rats (Pe´riquet, 1986; Hendriks et al., 1988a,b) and elderly people (McLaren and Mawlayi, 1979). Increased serum retinol has been found in humans with aging (Hallfrisch et al., 1994) but not in aged rats (Pe´riquet, 1986). The effects on cell growth and differentiation of retinoic acid (RA), an active metabolite of vitamin A, and T3 are mediated by modulating the expression of specific genes through binding to specific nuclear receptors, retinoic acid receptors (RAR) and triiodothyronine receptors (TR), respectively. Among genes regulated by retinoids, that of tissue transglutaminase (tTG) is particularly well known and

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

125

tTG activity is considered to be a good indicator of retinoid action (Chiocca et al., 1989). Additionally, the malic enzyme (ME) activity is considered to be a good indicator of TR expression and a T3 response element has been described in the gene of ME (Petty et al., 1990). Thus, the aim of this investigation was to study the influence of aging on the expression of RAR and TR in rat liver. This expression was evaluated as binding properties of receptors, quantitation of their mRNA, and assay of tTG and MDH activities. Moreover, since a decrease in receptor expression was observed in old rats, the ability of retinoid administration to restore this expression was examined.

2. Materials and methods

2.1. Experimental design Official French regulations for the care and use of laboratory animals were followed. Weanling male Wistar rats were obtained from IFFA CREDO (L’Arbresle, France). Rats were housed by four in cages in an air conditioned room with a mean temperature of 21°C with a photoperiod which followed the seasonal pattern. Rats were randomly divided into five groups designated as young, adults, aged, aged+RP, aged+ RA. Young rats were studied following 10 weeks of rearing, adult rats following 6 months and aged rats following 24 months. Aged + RP and aged +RA were aged rats treated by intragastric intubation 24 h before sacrifice with 5 mg of retinoic acid (all-trans RA; Sigma No. R 2625)/kg body weight or 13 mg of retinyl palmitate (Sigma No. R 3375)/kg body weight respectively. The semi-synthetic diet (Table 1) was prepared by the ‘Atelier de pre´paration d’aliments experimentaux’ (Institut National de la Recherche Agronomique (INRA), 78350 Jouy en Josas, France) according to the recommendations on the feeding conditions of laboratory animals (rats and mice) (Pottier de Courcy et al., 1989) and contained 8 000 I.U. vitamin A/kg. Diets and water were freely available. Rats were killed by decapitation (between 09:00 and 10:00) and the livers were rapidly excised and washed (twice) in cold saline (9 g NaCl/l) solution. Portions of the livers were immediately used for preparation of nuclei (for binding studies) and cytosol (for enzymatic activities assays) fractions, the remainder being frozen in liquid nitrogen and stored at −80°C for mRNA quantification.

2.2. Hormone binding 2.2.1. Isolation of li6er nuclei All tissue fractionations were carried out at 4°C. Nuclei were prepared according to the method of DeGroot and Torresani (DeGroot and Torresani, 1975). A portion of liver was homogenized in 0.32 SM (0.32 mol/l sucrose plus 1 mmol/l MgCl2), filtered through cheesecloth and centrifuged at 1000× g for 10 min. The crude pellet was washed once and then centrifuged through a layer of sucrose (2.2 mol/l sucrose plus 1 mmol/l MgCl2) at 100 000× g for 60 min. The nuclear pellet

126

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

was gently resuspended in 0.32 SM plus 0.25% (v/v) Triton X-100, centrifuged at 1000 ×g for 10 min and washed once with 0.32 SM.

2.2.2. Triiodothyronine binding The final nuclear pellet derived from 2 g liver was gently resuspended in 2.66 ml TKEM (20 mmol/l Tris – HCl, 0.4 mol/l KCl, 2 mmol/l EDTA and 1 mmol/l MgCl2; pH 7.9, 25°C). After 30 min at 0°C with frequent pipetting of the suspension to disrupt the nuclei, the nuclear residue was pelleted by centrifugation at 100 000× g for 30 min. The supernatant, which contained nuclear proteins, was used for assay of T3 binding (Torresani and DeGroot, 1975). Incubations of nuclear proteins were performed in 0.2 ml TKEM containing 50 mg protein, 0.006 – 0.12 pmol [125I]T3 for 3 h at 20°C. The binding reaction was stopped by the addition of 0.8 ml ice-cold Dowex IX8-400 resin (Sigma, St. Louis, MO) suspension in TKEM (40 mg/ml). After mixing, the resin was sedimented by centrifugation (1000×g, 5 min). Estimation of protein-bound T3 was made by measuring the radioactivity in an aliquot of the supernatant. Non-specific T3 binding was determined by incubation in the presence of a 1000-fold excess of unlabelled T3. All incubations were performed in duplicate. Saturation curves and Scatchard analysis were performed using final concentrations of [125I]T3 in the incubation medium ranging from 0.03 to 0.6 nmol/l. 2.2.3. Retinoid binding Due to the sensitivity of RA to numerous physiochemical factors (particularly to light and oxygen) and its rapid degradation by enzymes contained in tissue extracts, Table 1 Composition of the diet Ingredient

Amount (g/kg)

Cellulose Cornstarch Peanut oil Rapeseed oil Salt mixturea Sucrose Vitamin mixtureb Vitamin-free casein

20.0 443.0 25.0 25.0 40.0 225.0 10.0 220.0

a

The salt mixture consisted of the following (g/kg): calcium phosphate dibasic, 380; calcium carbonate, 180; sodium chloride, 69; potassium monohydrate phosphate, 240; magnesium sulphate, 90; magnesium oxide, 20; manganese sulphate, 5; cupper sulphate, 1; zinc sulphate, 5; iron sulphate, 8.6; potassium iodinate, 0.04; sodium selenite, 0.02; cobalt carbonate, 0.03; potassium and chromium sulphate 0.5; sucrose sqf 1 kg. b The vitamin diet mixture without vitamin A consisted of the following (g/kg): cholecalciferol, 0.00625; all-rac a tocopherol, 5; menadione, 0.1; ascorbic acid, 10; choline, 75; inositol, 5; thiamine HCl, 1; riboflavin, 1; D-calcium panthotenate, 3; pyridoxine HCl, 1; cyanocobalamin, 0.00135; niacin (nicotinic acid), 4.5; p-amino benzoic acid, 5; D-biotin, 0.02; folic acid, 0.2; sucrose sqf 1 kg.

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

127

a synthetic analogue of RA was used as the ligand. The 4-(5,6,7,8-tetrahydro5,5,8,8-tetramethyl-2-anthracenyl) benzoic acid (CD367), was synthesised and tritiated in the Centre International de Recherche Dermatologique (CIRD Galderma, Sophia Antipolis, Valbonne, France). CD367 behaves as a non selective high affinity ligand for the three types of RAR (RARa, RARb, and RARg) (Delescluse et al., 1991). Previous experiments performed in our laboratory have indeed shown that CD367 can be validly used to study binding of RAR in rat liver (AudouinChevallier et al., 1993). To obtain RAR, the nuclei were washed three times with binding buffer (10 mmol/l Hepes, 1.5 mmol/l MgCl2, 10 mmol/l KCl, pH 7.9) and then submitted to a DNAse I (SIGMA No. D 4527) digestion for 30 min at room temperature, followed by a high salt extraction (0.5 mol/l NaCl). The nuclear extract was then obtained by centrifugation at 8000×g for 5 min. The measurement was performed according to Audouin-Chevallier et al. (1993). Aliquots of nuclear extract (96 ml) were mixed with 4 ml of increasing concentrations (0.0125 – 0.125 mmol/l in dimethyl sulfoxide) of CD367 (52.8 Ci/mmol). After 1 h incubation at 4°C, 50 ml of the incubation mixture was submitted to high-performance size-exclusion chromatography separation on a TSK gel G3000SW column (300 mm×7.5 mm, Tosho Haas Stuttgart, Germany), and eluted with 0.3 mol/l KH2PO4, pH 7.8, at a flow rate of 0.5 ml/min. The column was calibrated with a mixture of human albumin (67 kDa), egg albumin (45 kDa), and horse myoglobin (16.8 kDa). Fractions (0.2 ml) were collected and counted in a liquid scintillation counter (Beckman LS 6000 SC scintillation counter) using 4 ml Ready Safe Cocktail (Beckman instrument) as the scintillation liquid. Radioactive counts obtained in the fractions containing the RAR–[3H]CD367 complex were added and expressed as pmol bound ligand/mg of proteins. Non specific binding was determined by incubation in the presence of a 1000-fold excess of unlabelled CD367.

2.2.4. Scatchard analysis Scatchard curves were drawn using a linear regression analysis of the data (SigmaPlot Scientific Graphing System1 2.01, JANDEL Corporation). The slope of the straight line gave the affinity constant (Ka) and the intercept of the slope with the abscissa represented the maximum binding capacity (Cmax) i.e. the maximal concentration of binding sites. 2.3. Quantification of mRNA mRNA was quantified by reverse transcription and amplification by the polymerase chain reaction (RT-PCR). The values of RAR and TR mRNA were obtained by comparison with the level of an internal standard, b-actin, that was simultaneously reverse-transcribed and amplified in the same test tube. Indeed, b-actin is known as being little sensitive to nutritional and hormonal conditions and the b-actin mRNA was previously used as the endogenous standard for semi-quantitative analysis (Ma et al., 1990; Mitsuhashi and Nikodem, 1989). Moreover, according to a competitive RT-PCR method (Siebert and Larrick, 1993)

128

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

Table 2 Sequences of oligonucleotide primers and size of amplified fragments Primers

Sequences

Complementary sites

Size of amplified fragments (bp)

b actina

A1:AGGATGCAGAAGGAGATTACTGCC A2:GTAAAACGCAGCTCAGTAACAGTCC

2814 – 2837 3159 – 3135

222

RARb

R1:TCACTGAGAAGATCCGGAAAGCCCACC R2:TTGGTGGCCAGCTCACTGAATTTGTCCC

538 – 565 680 – 653

143

1247 – 1270 1247 – 1270

118

c

TR

E1:TCCTGATGAAGGTGACGGACCTGC E2:TCAAAGACTTCCAAGAAGAGAGGC

Primers A1 and A2 were chosen in two different exons, the size of the PCR products provided a check that the amplified fragment was not derived from genomic DNA. a From rat cytoplasmic actin gene according to the sequence of Nudel et al. (1983). b From murine RAR cDNA according to the sequence of Zelent et al. (1989). c From rat TR cDNA according to the sequence of Murray et al. (1988).

and using the PCR MIMIC™ Construction Kit (Clontech Laboratories, Pallo Alto, CA) we verified the constancy of the level of b-actin mRNA among the experimental conditions studied. Extraction of RNA was performed according to Chomczynski and Sacchi (1987) modified. Rat liver (400 mg) was homogenized with 4 ml or 10 ml extraction buffer (3:1; 5.3 mol/l guanidium thiocyanate, 0.2 mol/l Tris–HCl pH 7.5, 0.04 mol/l EDTA per solution DTT-N-lauryl sarcosin 2%) respectively, and subsequently total RNA was extracted from this homogenate with an equal volume of phenol–chloroform– isoamyl alcohol (49:49:2). The positions and sequences of the different oligonucleotide primers are summarized in Table 2 . The primers of TR mRNA have been chosen to quantify exclusively the mRNA encoding for proteins which bind T3 (TRa1 and TRb1). Thus, it is possible to compare the mRNA abundance with the binding capacity of receptors. Concerning RAR mRNA the primers have been chosen to quantify exclusively the mRNA encoding for RARb since RARb is the form predominantly expressed in the liver. Primers were purchased from GENSET (Paris, France).

2.3.1. Preparation of cDNA 110 mg Total mRNA, 550 ng of each downstream primer (A2, R2, E2, for b-actin, RAR, and TR respectively) were used for the reverse transcription in the presence of 11 ml of reaction buffer 5 × (250 mmol/l Tris–HCl pH 8.3, 375 mmol/l KCl, 15 mmol/l MgCl, 50 mmol/l DTT), 440 U Moloney murine leukemia virus reverse transcriptase, 88 U RNase inhibitor, 55 U DNase I and 120 mmol/l of each dNTP in a total volume of 55 ml. Synthesized cDNA was then amplified by the polymerase chain reaction (PCR) technique using Taq polymerase (Saiki et al., 1988). 2.3.2. PCR analysis 15 ml cDNA was used for amplification performed in a Perkin Elmer/Cetus

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

129

thermocycler. The reaction mixture (180 ml) contained 1 mg of each primer A1, A2, E1, E2, R1, R2, 10 mM Tris – HCl pH 8.5, 50 mmol/l KCl, 2 mmol/l MgCl2, 10 mg/l gelatin, 0.2 mmol/l of each dNTP, 1.85 MBq deoxycytidine-5%-triphosphate (specific activity\ 111 TBq/mmol, Amersham) and 1.25 U Taq polymerase. The reaction was carried out for a total of 34 cycles. The cycles times were as follows: denaturation, 1 min at 95°C; annealing, 1 min at 60°C; primer extension, 2 min at 72°C. For quantitative analysis of PCR products, 8 ml of PCR reaction were sampled after each (from 10th to 29th) amplification cycle and the coamplified fragments were separated by electrophoresis on a 10% acrylamide gel. The incorporated radioactivity was visualized by autoradiography, the bands were excised from the gel to equal rectangles and quantified by scintillation counting. Fig. 1 shows, as an example, the results of an electrophoresis of PCR products of rat transcripts of b-actin, TR and RAR genes and, also, a semi-logarithmic representation of the relative extent of amplification measured by counting the amount of 32P incorporated.

2.4. Assays 2.4.1. Proteins They were determined according to Bradford (1976) using a Bio-Rad protein assay (Bio-Rad, Munich, Germany).

Fig. 1. Relative quantification of RAR and TR transcripts in rat liver. (A) RT-PCR products resolved on a 10% acrylamide gel electrophoresis and stained with ethidium bromide. Lanes 1 and 2, co-amplification of b-actin, RAR and TR transcripts in rat liver. Lane 3, molecular size markers fX174/hinfI. (B) Semi-logarithmic representation of the relative extent of amplification (Y) measured by counting the amount of [a 32P]dCTP incorporated; R is the PCR efficiency.

130

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

Table 3 The influence of age on the binding properties of TR and on the abundance of their mRNA in rat liver Age (months)

Cmax (fmol/mg protein)a

Affinity Ka (nM−1)a

mRNA (% mRNA of b-actin)b

2.5 6 23 – 24

3039 301 3649 351 1879 132

9.0 91.11 9.7 91.01 3.4 90.52

3.5 9 0.21 3.29 0.21 1.6 9 0.22

Values are mean 9 S.E.M. from 8 rats; b values are mean9S.E.M. from four different pools of two animals; for each parameter the influence of age is significant (Tukey’s test) when the superscript numbers are different.

a

2.4.2. Enzyme assays L-Malate dehydrogenase NADP oxido-reductase (decarboxylating) (EC 1.1.1.40, ME) activity was assayed by the method of Wise and Ball (1964). Transglutaminase activity was measured by detecting the incorporation of [3H]putrescine into N,N%dimethylcasein according to the method of Piacentini et al. (1992). 2.5. Statistical analysis Values are given as means9 S.E.M. The statistical significance of differences between means was calculated by analysis of variance (ANOVA) followed by Tukey’s multiple range post hoc test (K =0.05) using Minitab Statistical Software (USA).

3. Results

3.1. Effects of aging on TR expression While in adult rats the binding characteristics of T3 receptors were not modified relative to those of young rats, in aged rats, the Cmax and Ka decreased 2-fold relative to young and adult rats (Table 3). In aged rats, the abundance of TR mRNA was only 50% of that of young rats (1.6 and 3.5% of b-actin mRNA respectively). The ME activity was lower in adult and aged rats and the lowest value was observed in adult rats (Table 4).

3.2. Effects of aging on RAR expression In adult and aged rats the maximum binding capacity was lower (444 and 353 fmol/mg protein, respectively) relative to young rats (630 fmol/mg protein) while a decreased apparent affinity was observed only in aged rats (0.27 versus 0.92 and 0.70 nM − 1 in young and adult rats, respectively) (Table 5). Aging induced a decreased mRNA content of RAR which is the form of RAR mainly represented in rat liver. The activity of tTG was lower in the liver of aged rats and represented at this age only 50% of the activity assayed in young rats (60 and 111 fmol/min per mg protein respectively) (Table 4).

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

131

Table 4 The influence of age on the activity of tTG and ME in rat liver Age (months)

tTG activity (fmol/min per mg protein)

ME activity nmol/min per mg protein)

2.5 6 23 – 24

1119 71 91962 60 973

33.0 9 1.81 10.0 9 1.22 24.3 9 1.33

tTG is expressed as fmol [3H]putrescine incorporated in N,N%-dimethylcasein/min per mg cytosolic protein; MDH is expressed as nmol NADPH formed/min per mg cytosolic protein. Values are mean 9 S.E.M. from 6 rats; for each parameter the influence of age is significant (Tukey’s test) when the superscript numbers are different.

3.3. Effects of retinyl palmitate or retinoic acid administration on aged rats The results of retinoid administration are reported in Table 6. Retinyl palmitate administration did not modify either the TR and RAR mRNA content in the liver of aged rats, or the maximum binding capacity of receptors, or the enzymatic activities regulated by T3 or RA but induced an increased apparent affinity. On the contrary, retinoic acid administration induced a rapid (24 h) and high increase of all parameters indicating the expression of TR and RAR in the liver of rats.

4. Discussion

4.1. Expression of triiodothyronine nuclear receptors The decreased expression of TR observed in aged rats is in agreement with the results of Kvetny (1985) showing that, in mononuclear leucocytes of aged rats, the binding capacity and the apparent affinity of TR were reduced. However, in hepatocytes, neither Mooradian (1990) nor Nayer et al. (1991) have shown any significant change of the binding properties of these receptors (but these authors observed a significant decrease of Cmax of TR in the brain and cerebellum). Table 5 The influence of age on the binding properties of RAR and on the abundance of their mRNA in rat liver Age (months)

Cmax (fmol/mg protein)a

Affinity Ka (nM−1)a

mRNA (% ARNm of b-actin)b

2.5 6 23 – 24

6309401 4449 382 3539 332

0.92 9 0.071 0.70 9 0.061 0.27 9 0.052

5.0 90.51 4.69 0.31 3.2 90.42

Values are mean 9S.E.M. from 8 rats; b values are mean 9 S.E.M. from 4 different pools of 2 animals; for each parameter the influence of age is significant (Tukey’s test) when the superscript numbers are different. a

132

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

Table 6 Effect of an administration of retinyl palmitate (RP; 13 mg/kg b.w.) or retinoic acid (RA; 5 mg/kg b.w.) in aged rats (23–24 months) on the expression of RAR and TR in the liver

TR Cmax (fmol/mg protein)a TR Ka (nM−1)a TR mRNA (% b-actin mRNA)b Cmax RAR (fmol/mg protein)a RAR Ka (nM−1)a RAR mRNA (% b-actin mRNA)b ME activity (nmol/mn per mg protein)c tTG activity (fmol/mn per mg protein)c

Aged rats

Aged rats+RP

Aged rats+RA

187 9131 3.4 90.51 1.6 90.21 353 9331 0.27 9 0.051 3.2 90.41 24.3 9 1.31 60 9 71

253 9 301 5.4 90.22 1.8 90.21 340 9141 0.91 9 0.072 2.6 90.31 22.0 9 1.01 64 9 51

398 9272 6.8 90.62 3.4 90.52 541 9222 1.21 9 0.132 5.3 90.62 8.8 90.92 95 9 42

tTG is expressed as fmol [3H]putrescine incorporated in N,N%-dimethylcasein/min per mg cytosolic protein; ME is expressed as nmol NADPH formed/mn per mg cytosolic protein. a Values are mean 9 S.E.M. from 8 aged rats (without retinoid treatment) or from 6 rats after retinoid administration; b Values are mean9 S.E.M. from four different pools of two animals; c Values are mean9 S.E.M. from 6 rats; for each parameter the effect of the treatment is significant (Tukey’s test) when the superscript numbers are different.

The decreased Cmax of proteins that we observed can be considered as resulting, at least in part, from a reduced transcription of genes encoding for TR since there was also a decreased abundance of TRb1 mRNA. This isoform is the major expressed form in the rat liver and represents more than 80% of the total mRNA content of TRa1 and TRb1 (Strait et al., 1990). Data concerning the influence of thyroid status on the regulation of transcription of TR genes are few. It has been shown that TR genes have a positive responsiveness to T3 administration (Hamada et al., 1979; Coustaut et al., 1996). To exert an up- or down-regulation on its receptors, a hormone has to be available in the nucleus of hepatocytes. Although it is known that T3 capture by hepatic tissue is lowered in 26 month old rats relative to 6 month old rats (Mooradian, 1990), a decreased hormone rate in the nucleus has not been demonstrated in aged rats. An insufficient nuclear ligand would lead to a decreased TR gene transcription. In aged rats we also observed a decreased apparent affinity of TR. Such a modification of the functionality of TR is frequently regarded as resulting from a change in the phosphorylation – dephosphorylation cycle. Indeed, it is known that TR is phosphorylated (Goldberg et al., 1988) and that T3-binding activity is drastically reduced when a phosphatase is added to the incubation medium (Faure and Dussault, 1988). It has also been demonstrated that the phosphorylation of TR is increased by activation of protein kinase C (PKC) (Goldberg et al., 1988). Thus, a decreased affinity of TR is in agreement with the observations of Rogue et al. (1993) showing that aging leads to a decreased PKC activity (resulting from a decreased responsiveness to stimulation rather than a decrease of the basic activity). The decreased malic enzyme activity observed in aged rats was in agreement with the decreased TR expression.

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

133

4.2. Expression of retinoic acid receptors The present results provide evidence that aging induces a decrease in the amount of RARb mRNA responsible, at least in part, for a reduction in the corresponding nuclear receptors in rat liver. It is known that RA induces a positive regulation of the amount of RAR. Such a regulation has been evidenced firstly in cultured cell lines (de The´ et al., 1989; Zelent et al., 1989), and then in rats submitted to a vitamin A-deficient diet and then administered RA (Audouin-Chevallier et al., 1993; Haq et al., 1991). Thus, it can be hypothesized that aging leads to a lowered bioavailability of RA at the nuclear level. To verify this hypothesis it will be necessary to quantify intranuclear retinoic acid concentrations and, if possible, in the different cell types. Indeed, in the liver, both the parenchymal and the fat-storing cells (Ito cells) play essential roles in retinoid metabolism and more than 70% (82% in 6-month-old and 70% in 36-month-old rats) of liver retinoids are present in the fat-storing cells (Hendriks et al., 1988a). Ito cells contain messenger RNA for RARb at levels significantly higher than those found in other hepatic cell types and a retinoid treatment of cultured Ito cells induces the expression of RARb (Weiner et al., 1992). The effect of aging on the RARb in Ito cells is unknown but an age-induced decrease of their expression could play only a minor role in the results we obtained in liver homogenate since the parenchymal cells account for 92.5% of the protein in the liver (Nagelkerke et al., 1983). Concerning the effect of aging on apparent affinity of RARb, as previously suggested for the affinity of TR, the decreased affinity may be due to a deficiency in RAR phosphorylation since these receptors are also known to be phosphorylated (Gaub et al., 1992; Rochette-Egly et al., 1992). Recently, it has been shown that PKC is able to phosphorylate RAR (Tahayato et al., 1993). Our results indicated that tTG activity decreased with aging. These results are in agreement with the decreased expression of RAR. Indeed, it is known that retinoic acid induces a positive regulation of tTG (Davies et al., 1985; Piacentini et al., 1992). Recently, Nagy et al. (1996) have shown that the tTG gene possess an RA response element (RARE).

4.3. Retinol or retinoic acid administration 24 h After retinol administration in aged rats, neither mRNA contents nor the maximum binding capacity of RAR or TR was modified, while apparent affinity of these receptors was increased. After the same delay, following retinoic acid administration, a significant increase in mRNA contents, and increases in maximum binding capacity and apparent affinity of RAR and TR in the liver of aged rats were observed. The increased apparent affinity of receptors observed after administration of retinol or RA may result from a retinoid action on biochemical mechanisms involved in the functionality of receptors. Among these mechanisms, a phosphorylation process should be taken in account because PKC has been shown to be activated by retinoids in cultured cell lines (Kurie et al., 1993) and in rat liver (Pailler-Rodde et al., 1991).

134

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

In aged rats, retinol administrated by intragastric intubation did not induce transcription of RAR and TR genes while induction of these genes was very significant after RA administration. These results were confirmed by measurement of tTG since this enzymatic activity was not modified by retinol while it was enhanced by RA. It is more difficult to discuss the results concerning malic enzyme activity because, under the present experimental conditions, this activity decreased while TR expression increased. It is necessary to note that several factors, other than TR expression, are implicated in the regulation of malic enzyme gene. In conclusion, we observed that in the liver of aged rats (24 months old), there was an hypoexpression of RAR and TR. Retinol, unlike retinoic acid, did not induce a positive regulation of RAR or TR expression in these animals. This observation can be related to a previous one showing that, in rats made hypothyroidic, there is a reduced expression of RAR which can be corrected by RA or by retinol plus T3 but not by retinol alone (Strait et al., 1990). But in aged rats, the hormonal status cannot necessarily be compared to a status of experimental hypothyroidism. Indeed, there are, in aged rats, specific balances between expression of various nuclear receptors and also between expression of receptors and amounts of available ligands. Thus, further studies are needed to determine, in aged animals, (i) the amounts of available ligands, (ii) the expression of some other nuclear receptors, particularly the expression of RXR. Indeed, it is known that RXR, receptors binding with 9 cis-RA, heterodimerize with RAR and TR and that the major role of RXR is to modulate a number of different hormonal signaling pathways through this formation of heterodimers.

Acknowledgements This study was supported by a ‘Aide Individuelle Programme´e’ of the ‘Institut National de la Recherche Agronomique’ France.

References Audouin-Chevallier, I., Higueret, P., Pallet, V., Higueret, D., Garcin, H., 1993. Dietary vitamin A modulates the properties of retinoic acid and glucocorticoid receptors in rat liver. J. Nutr. 123, 1195–1202. Bradford, M., 1976. A rapid and sensitive method for a quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Ann. Biochem. 72, 248 – 254. Chiocca, E.A., Davies, P.J.A., Stein, J.P., 1989. Regulation of tissue transglutaminase gene expression as a molecular model for retinoid effects on proliferation and differentiation. J. Cell. Biochem. 39, 293–304. Chomczynski, P., Sacchi, N., 1987. Single step method of RNA isolation by acid guanidium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156 – 159. Coustaut, M., Pallet, V., Garcin, H., Higueret, P., 1996. Hypothyroidism impairs the effects of vitamin A on TRs, RARs and GR in rat liver. Br. J. Nutr. 76, 295 – 306. Davis, P.J., 1979. Ageing and endocrine function. Clin. Endocrin. Metab. 8, 603 – 619.

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

135

Davies, P.J.A., Murtaugh, M.P., Moore, W.T. Jr., Johnson, G.S., Lucas, D., 1985. Retinoic acid-induced expression of tissue transglutaminase in human promyelocytic leukemia (HL-60) cells. J. Biol. Chem. 260, 5166–5174. de The´, H., Marchio, A., Tiollais, P., Dejean, A., 1989. Differential expression and ligand regulation of the retinoic acid receptor a and b genes. EMBO J. 8, 429 – 433. DeGroot, L.J., Torresani, J., 1975. Triiodothyronine binding to isolated liver cell nuclei. Endocrinology 96, 357–369. Delescluse, C., Cavey, M.T., Martin, B., et al., 1991. Selective high affinity retinoic acid receptor alpha or beta-gamma ligands. Mol. Pharmacol. 40, 555 – 562. Dice, J.F., Goff, S.A., 1988. Aging and the liver. In: Arias, I.M., Jakoby, W.B., Popper, H., Schachter, D., Shafritz, D.A. (Eds.), The Liver: Biology and Pathobiology. Raven Press, New York, pp. 1245–1258. Faure, R., Dussault, J.H., 1988. Effects of adenosine triphosphate and alkaline phosphatase on solubilized 3,5,3%-triiodothyronine-binding activity. Endocrinology 123, 1245 – 1252. Finucane, P., Anderson, C., 1995. Thyroid disease in older patients. Diagnosis and treatment. Drugs Aging 6, 268–277. Frolkis, V.V., Valueva, G.V., 1978. Metabolism of thyroid hormones during aging. Gerontology 24, 81–94. Gaub, M.P., Rochette-Egly, C., Lutz, Y., et al., 1992. Immunodetection of multiples species of retinoic acid receptor A: evidence for phosphorylation. Exp. Cell Res. 201, 335 – 346. Goldberg, Y., Glineur, C., et al., 1988. Activation of protein kinase C or cAMP-dependent protein kinase increases phosphorylation of the c-erbA-encoded thyroid hormone receptor and of the v-erbA-encoded protein. EMBO J. 7, 2425 – 2433. Hallfrisch, J., Muller, D.C., Singh, V.N., 1994. Vitamin A and E intakes and plasma concentrations of retinol, b-carotene, and a-tocopherol in men and women of the Baltimore Longitudinal Study of Aging. Am. J. Clin. Nutr. 60, 176–182. Hamada, S., Nakamura, H., Nanno, M., Imura, H., 1979. Triiodothyronine-induced increase in rat liver nuclear thyroid hormone receptors associated with increased mitochondrial a-glycerophosphate dehydrogenase activity. Biochem. J. 182, 371 – 375. Haq, R.U., Pfahl, M., Chytil, F., 1991. Retinoic acid affects the expression of nuclear retinoic acid receptors in tissues of retinol-deficient rats. Proc. Natl. Acad. Sci. USA 88, 8272 – 8276. Hendriks, H.F.J., Blaner, W.S., Wennekers, H.M., et al., 1988a. Distributions of retinoids, retinoidbinding proteins and related parameters in different types of liver cells isolated from young and old rats. Eur. J. Biochem. 171, 237–244. Hendriks, H.F.J., Blaner, W.S., Brouwer, A., Goodman, D.S., Knook, D.L., 1988. Age-related changes in retinol status and some parameters of retinoid metabolism. In: Bianchi, L. et al. (Eds.), Aging in Liver and Gastro-Intestinal Tract (Falk Symposium No. 47). MTP Press, Lancaster, UK, pp. 349–357. Kurie, J.M., Younes, A., Miller, W.H. Jr., et al., 1993. Retinoic acid stimulates the protein kinase C pathway before activation of its b-nuclear receptor during human teratocarcinoma differentiation. Biochim. Biophys. Acta 1179, 203–207. Kvetny, J., 1985. Nuclear thyroxine and triiodothyronine binding in mononuclear cells in dependance of age. Horm. Metab. Res. 17, 35–38. Ma, X.J., Salati, L.M., Ash, S.E., et al., 1990. Nutritional regulation and tissue specific expression of the malic enzyme gene in the chicken. J. Biol. Chem. 265, 18435 – 18441. McLaren, D.S., Mawlayi, Z., Downing, A., 1979. Distribution of vitamin A in human liver. Proc. Nutr. Soc. 38, 49A. Mitsuhashi, T., Nikodem, V.M., 1989. Regulation of expression of the alternative mRNAs of the rat alpha thyroid hormone receptor gene. J. Biol. Chem. 264, 8900 – 8904. Mooradian, A.D., 1990. The hepatic transcellular transport of 3,5,3%-triiodothyronine is reduced in aged rats. Biochim. Biophys. Acta 1054, 1– 7. Mooradian, A.D., Wong, N.C.W., 1994. Age-related changes in thyroid hormone action. Eur. J. Endocrinol. 131, 451–461. Murray, M.B., Zyli, N.D., Mac Creary, N.L., Mac Donald, M.J., Towle, H.C., 1988. Isolation and

136

V. Pallet et al. / Mechanisms of Ageing and De6elopment 99 (1997) 123–136

characterization of rat cDNA clones for two distinct thyroid hormone receptors. J. Biol. Chem. 263, 12770–12777. Nagelkerke, J.F., Barto, K.P., Berkel, T.J., 1983. In vivo and in vitro uptake and degradation of acetylated low density lipoprotein by rat liver endothelial, Kupffer, and parenchymal cells. J. Biol. Chem. 258, 12221–12227. Nagy, L., Saydak, M., Shipley, N., et al., 1996. Identification and characterization of a versatile retinoid response element (retinoic acid receptor response element-retinoid X receptor response element) in the mouse tissue transglutaminase gene promoter. J. Biol. Chem. 271, 4355 – 4365. Nayer, P., Rennotte, B., Caucheteux, D., 1991. Thyroid hormone receptors in brain and liver during ageing. Horm. Metab. Res. 23, 12–14. Nudel, U., Zakut, R., Shani, M., Neuman, S., Levy, Z., Yaffe, D., 1983. The nucleotide sequence of the rat cytoplasmic b-actin gene. Nucleic Acids Res. 11, 1759 – 1771. Olsen, T., Laurberg, P., Weeke, J., 1978. Low serum triiodothyronine and high serum reverse triiodothyronine in old age: an effect of disease not age. J. Clin. Endocrinol. Metab. 47, 1111 – 1115. Pailler-Rodde, I., Garcin, H., Higueret, P., 1991. Effect of retinoids on protein kinase C activity and on the binding characteristics of the triiodothyronine nuclear receptor. J. Endocrinol. 128, 245 – 251. Petty, K.J., Desvergne, B., Mitsuhashi, T., Nikodem, V.M., 1990. Identification of a thyroid hormone response element in the malic enzyme gene. J. Biol. Chem. 265, 7395 – 7400. Piacentini, M., Ceru`, M.P., Dini, L., et al., 1992. In vivo and in vitro induction of ‘tissue’ transglutaminase in rat hepatocytes by retinoic acid. Biochim. Biophys. Acta 1135, 171 – 179. Pottier de Courcy, G., Durand, G., Abraham, J., Gueguen, L., 1989. Recommandations sur les conditions d’alimentation des animaux de laboratoire (rats et souris). Sci. Alim. 9, 209 – 217. Pe´riquet, B., 1986. Vitamine A he´patique, re´partitions tissulaire et subcellulaire; incidence du facteur nutritionnel et du mode d’administration. Thesis, University Paul Sabatier, Toulouse, France. Rochette-Egly, C., Gaub, M.P., Lutz, Y., Ali, S., Scheuer, I., Chambon, P., 1992. Retinoic acid receptor-b: immunodetection and phosphorylation on tyrosine residues. Mol. Endocrinol. 6, 2197 – 2209. Rogue, P.J., Ritz, M.F., Malviya, A.N., 1993. Impaired gene transcription and nuclear protein kinase-C activation in the brain and liver of aged rats. FEBS Lett. 334, 351 – 354. Saiki, R.K., Gelfand, D.H., Stoffel, S., et al., 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 236, 487 – 491. Siebert, P.D., Larrick, J.W., 1993. PCR MIMICs: competitive DNA fragments for use as internal standards in quantitative PCR. BioTechniques 14, 244 – 249. Strait, K.A., Schwartz, H.L., Perez-Castillo, A., Oppenheimer, J.H., 1990. Relationship of c-erbA mRNA content to tissue T3 nuclear binding capacity and function in developping rat and adult rat. J. Biol. Chem. 265, 10514–10521. Sundboom, J., Olson, J.A., 1984. Effect of aging on the storage and catabolism of vitamin A in mice. Exp. Gerontol. 19, 257–265. Tahayato, A., Lefebvre, P., Formstecher, P., Dautrevaux, M., 1993. A protein kinase C-dependent activity modulates retinoic acid-induced transcription. Mol. Endocrinol. 7, 1642 – 1653. Tauchi, H., Sato, T., Ito Y, Y., 1994. Morphological aspects of aging liver: half a century of progress in Japan. Arch. Gerontol. Geriatr. 19, 135 – 144. Teramoto, S., Fukuchi, Y., Uejima, Y., Teramoto, K., Oka, T., Orimo, H., 1994. A novel model of senile lung: senescence-accelerated mouse (SAM). Am. J. Respir. Crit. Care Med. 150, 238 – 244. Torresani, J., DeGroot, L.J., 1975. Triiodothyronine binding to liver nuclear solubilized proteins in vitro. Endocrinology 96, 1201–1209. Weiner, F.R., Blaner, W.S., Czaja, M.J., Shah, A., Geerts, A., 1992. Ito cell expression of a nuclear retinoic acid receptor. Hepatology 15, 336 – 342. Wise, E.M., Ball, E.G., 1964. Malic enzyme and lipogenesis. Proc. Natl. Acad. Sci. USA 52, 1255 – 1264. Zelent, A., Krust, A., Petkovich, M., Kastner, P., Chambon, P., 1989. Cloning of murine a and b retinoic acid receptors and a novel receptor g predominantly expressed in skin. Nature 339, 714 – 717.

.