- Email: [email protected]
Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages
Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Contents lists available at ScienceDirect
Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jep
Research Paper
Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages Boyang Hu a, Hai Zhang a, Xianli Meng a, Fei Wang b,n, Ping Wang a,nn a b
Chengdu University of Traditional Chinese Medicine, Chengdu 610075, PR China Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, PR China
art ic l e i nf o
a b s t r a c t
Article history: Received 20 January 2014 Received in revised form 19 March 2014 Accepted 22 March 2014
Ethnopharmacological relevance: Rheum rhabarbarum (rhubarb) has long been used for the treatment of inflammation in China and other Asian countries. However, the mechanism underlying the antiinflammatory activity of this medicinal plant is not fully understood. The present study was designed to investigate the anti-inflammatory effects of anthraquinones, the major constituents in rhubarb, and the molecular mechanism involved in their anti-inflammatory effects. Materials and methods: RAW264.7 cells were stimulated by lipopolysaccharide (LPS) in the presence or absence of the compounds examined. The proliferation of RAW264.7 cells was assayed by the AlamarBlue method. The quantity of nitric oxide (NO) was determined by Griess assay. The expression of proinflammatory cytokines was determined by enzyme-linked immunosorbent assay (ELISA) and quantitative real-time PCR. Inducible nitric oxide synthase (iNOS), inhibitor of nuclear factor κBα (IκBα), extracellular signal-regulated kinase (ERK), p38 mitogen-activated protein kinase (MAPK), c-Jun NH2-terminal kinase (JNK), and Akt/phosphoinositide 3-kinase (PI3K) protein expression levels were determined by Western blotting. Results: Aloe-emodin markedly suppressed the production of NO, interleukin-6 (IL-6), and interleukin1β (IL-1β) in LPS-stimulated RAW264.7 cells with no apparent cytotoxicity. The mRNA expression levels of iNOS, IL-6, and IL-1β genes were also significantly inhibited by aloe-emodin. Western blot analysis showed that aloe-emodin suppressed LPS-induced iNOS protein expression, IκBα degradation, and the phosphorylation of ERK, p38, JNK, and Akt. Conclusions: These results demonstrate that aloe-emodin is the bioactive component of rhubarb that confers an anti-inflammatory effect through a likely mechanism involving a decrease in proinflammatory cytokine production in LPS-induced RAW264.7 macrophages via inhibition of NF-κB, MAPK, and PI3K pathways. & 2014 Elsevier Ireland Ltd. All rights reserved.
Keywords: Anthraquinone Aloe-emodin Rhubarb Inflammation Macrophage Chemical compounds studied in this article: Rhein (PubChem CID: 10168) Emodin (PubChem CID: 3220) Aloe-emodin (PubChem CID: 10207) Physcion (PubChem CID: 10639) Chrysophanol (PubChem CID: 10208)
1. Introduction Inflammation is a local, protective response of the immune system to microbial invasion or injury. Excessive inflammatory responses can be problematic, as in diseases such as rheumatoid arthritis, Alzheimer's disease, septic shock syndrome, and sepsis
Abbreviations: Rhubarb, Rheum rhabarbarum; LPS, lipopolysaccharide; NO, nitric oxide; ELISA, enzyme-linked immunosorbent assay; iNOS, inducible nitric oxide synthase; IκBα, inhibitor of nuclear factor κB α; ERK, extracellular signal-regulated kinase; p38 MAPK, p38 mitogen-activated protein kinase; JNK, c-Jun NH2-terminal kinase; IL-6, interleukin-6; IL-1β, interleukin-1β; PI3K, phosphoinositide 3-kinase n Corresponding author. Tel./fax: þ 86 28 82890651. nn Corresponding author. Tel./fax: þ86 28 87714869. E-mail addresses: [email protected] (F. Wang), [email protected] (P. Wang).
(Tracey, 2002). Lipopolysaccharide (LPS), a component of the cell wall of Gram-negative bacteria, stimulates macrophages to produce pro-inflammatory mediators such as tumor necrosis factor alpha (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), inducible nitric oxide synthase (iNOS), and cyclooxygenase-2, which trigger a cascade responsible for the inflammatory response. Nuclear factor-κB (NF-κB) is a transcription factor with a central role in immune responses, apoptosis, cellular growth, and inflammation. In resting cells, NF-κB is localized to the cytoplasm and binds to an inhibitor protein known as IκB (Viatour et al., 2005; Ghosh and Hayden, 2008). Extracellular stimuli such as viral or bacterial factors, oxidative stress, and pro-inflammatory cytokines such as IL-1 and TNF-α can trigger NF-κB-activated pathways, which in turn causes phosphorylation and subsequent proteasome-mediated degradation of the inhibitor of NF-κB proteins (IκB). Once degraded, IκB no longer binds to NF-κB, and the
http://dx.doi.org/10.1016/j.jep.2014.03.059 0378-8741/& 2014 Elsevier Ireland Ltd. All rights reserved.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
2
free NF-κB translocates into the nucleus where it induces the expression of multiple genes, including those coding for cytokines (such as interleukin-1, -2, and -6), TNF-α, cellular adhesion molecules (intercellular adhesion molecule-1 [ICAM-1], vascular cell adhesion molecule-1 [VCAM-1], and endothelial cell adhesion molecule-1 [ELAM-1]), and other proteins that stimulate an inflammatory response (Kaur et al., 2013). Other signaling pathways may also activate NF-κB, including Akt/phosphoinositide 3-kinase (PI3K) and mitogen-activated protein kinase (MAPK). For instance, Akt can phosphorylate IκB, leading to NF-κB release and activation (Huang and Chen, 2009). The MAPK pathways, which are extracellular signal-regulated kinase (ERK), c-Jun NH2-terminal kinase (JNK), and p38 MAPK pathways in particular (Herlaar and Brown, 1999), also regulate the synthesis of inflammation mediators at the level of transcription and translation through activation of NF-κB and AP-1 transcription factors (Kaminska, 2005). Rhubarb (Rheum rhabarbarum) is a well-known traditional Chinese herbal medicine commonly used to treat constipation, jaundice, gastrointestinal hemorrhage, and ulcers (State Pharmacopoeia Committee, 2010). It is also included as an ingredient in many traditional Chinese medicine formulations for treatment of indications involving inflammation, such as acute appendicitis, acute cholecystitis, and rheumatoid arthritis (Ma et al., 2009). In recent years, rhubarb has also been shown to have anti-bacterial (Wang et al., 2010), antioxidant (Öztürk et al., 2007), anti-cancer (Huang et al., 2007), anti-angiogenesis (He et al., 2009), anti-inflammation (Fang et al., 2007; Cheon et al., 2009; Choi et al., 2013), and other effects. The primary active constituents of rhubarb are thought to be anthraquinone derivatives, including emodin, aloe-emodin, rhein, chrysophanol, physcion, and danthron (Komatsu et al., 2006). In addition, rhubarb also contains several glycosides, catechins, gallic acid, and cinnamic acid, together with small amounts of tannins (Huang et al., 2007). Emodin and rhein exert an anti-inflammatory effect through blocking of MAPK and PI3K pathway signaling (Zheng et al., 2007; Zhu et al., 2011) and inhibition of the activation of NF-κB and iNOS expression (Li et al., 2005). For quality control and clinical use of rhubarb, it will be important to determine whether other rhubarb components exhibit anti-inflammatory activity. Therefore, to elucidate other bioactive constituents of rhubarb, we have investigated the macrophageresponsive anti-inflammatory activity and mechanism of several of the anthraquinones that are major constituents of rhubarb.
2. Materials and methods 2.1. Reagents Rhein, emodin, aloe-emodin, physcion, chrysophanol were purchased from Chengdu Must Bio-Technology Co., Ltd. (Chengdu, China). Dimethyl sulfoxide (DMSO), LPS from Escherichia coli 055: B5, Bay 11-7082 (inhibitor of IκBα), PD98059 (inhibitor of MAPKK), SP600125 (inhibitor of JNK), and SB203580 (inhibitor of p38 MAPK) were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Dulbecco's modified Eagle's medium (DMEM) was from Gibco (Invitrogen, Carlsbad, CA, USA). Fetal bovine serum (FBS) was obtained from Hyclone (Thermo Scientific, Waltham, MA, USA). Alamar-Blue was from Sunbio Medical Biotechnology Co., Ltd. (Shanghai, China). The Griess reagent was purchased from Beyotime Institute of Biotechnology (Haimen, China). Mouse IL-6 enzyme-linked immunosorbent assay (ELISA) kits were purchased from Invitrogen and IL-1β ELISA kits were purchased from R&D Systems, Inc. (Minneapolis, MN, USA). The antibodies for iNOS, phospho-p44/42 MAPK, p44/p42 MAPK, phospho-stress-activated protein kinase (SAPK)/JNK, SAPK/JNK, phospho-Akt, and Akt were purchased from Cell Signaling Technology Inc. (Danvers, MA, USA),
and the antibodies for IκBα, phospho-p38 MAPK, p38 MAPK, and GAPDH were purchased from Epitomics (Burlingame, CA, USA). Horseradish peroxidase (HRP)-conjugated goat anti-rabbit and goat anti-mouse antibodies were from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). 2.2. Cell culture Murine macrophage RAW264.7 cells were obtained from the Center of Cellular Resource, Chinese Academy of Sciences (Shanghai, China). Cells were cultured in DMEM containing 10% FBS and 1% penicillin/streptomycin in a humidified incubator with a 5% CO2 atmosphere at 37 1C. 2.3. Cell proliferation assay Cell proliferation was evaluated by Alamar-Blue assay as described previously (Yang et al., 2011). Briefly, 4 104 RAW264.7 cells were seeded into 96-well plates and incubated at 37 1C in an atmosphere of 5% CO2 overnight. A dilution series of each compound was added to the cells followed by incubation for 24 h. Cell viability was assessed using Alamar-Blue reagent and fluorescence detection on a Thermo Scientific Varioskan Flash Multimode Reader with excitation and emission wavelengths of 544 and 590 nm, respectively. Cellular proliferation inhibition rate was defined as the ratio of the fluorescence intensity in test wells compared to control wells. Reported data are the mean of triplicate analyses. 2.4. Nitric oxide determination Nitric oxide was measured as described previously (Lin et al., 2013). The RAW264.7 cells were plated at 5 105 cells/ml in 24-well plates, incubated overnight, and treated with different concentrations of test compounds for 1 h, followed by treatment with LPS (1 μg/ml) for an additional 24 h. NO measurements were conducted directly in the cell culture medium by using a commercially available kit based on the Griess reaction (Beyotime). Data reported are the mean values from triplicate analyses. 2.5. Cytokine measurement RAW264.7 cells were plated at 5 105 cells/ml in 24-well plates and incubated overnight. The cells were treated with different concentrations of aloe-emodin for 1 h, and then treated with LPS (1 μg/ml) for an additional 24 h. Cell-free supernatants were collected for determination of IL-1β and IL-6 concentrations via ELISA analysis according the manufacturer's protocols. 2.6. Quantitative real-time polymerase chain reaction (qRT-PCR) RAW264.7 cells were plated at 1 106 cells/ml in 6-well plates, incubated overnight, and treated with different concentrations of aloe-emodin for 1 h, followed by treatment with LPS (1 μg/ml) and incubation for an additional 24 h. Total RNA from RAW264.7 cells was extracted using TRIzol Reagent (Invitrogen) according to the manufacturer's instructions. The concentration and purity of RNA were measured by spectrophotometric analysis with a UV-1800 spectrophotometer (Mapada, Shanghai, China). Total RNA (2 μg) was reverse-transcribed to cDNA by using the SuperScripts III First-Strand Synthesis System (Invitrogen) in a total volume of 20 μl. qRT-PCR was performed on a Chromo4 Real-Time PCR System (Bio-Rad, Hercules, CA, USA) with SsoFastTM EvaGreens Supermix (Bio-Rad). The sequences of primers used for qRT-PCR analyses are shown below. Amplification conditions were as follows: 95 1C initial denaturation for 5 min followed by 39 cycles of 95 1C for 15 s and 60 1C for 30 s. Relative expression levels of the
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
ΔΔ
target genes were calculated based on 2 Ct according to the manufacture's specifications by using the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene as a reference housekeeping gene.
3
followed by a Dunnett post hoc test. The differences were considered statistically significant when pr0.05.
3. Results Gene
Primer sequence
iNOS iNOS IL-6 IL-6
Forward: 50 GGATCTTCCCAGGCAACCA 30 Reverse: 50 AATCCACAACTCGCTCCAAGATT 30 Forward: 50 TGGAGTCACAGAAGGAGTGGCTAAG 30 Reverse: 50 TCTGACCACAGTGAGGAATGTCCAC 30 Forward: 50 GCCTTGGGCCTCAAAGGAAAGAATC 30
IL-1β
IL-1β GAPDH GAPDH
Reverse: 50 GGAAGACACAGATTCCATGGTGAAG 30 Forward: 50 AGGTGAAGGTCGGAGTCAACG 30 Reverse: 50 CCTGGAAGATGGTGATGGGAT 30
2.7. Western blotting Following treatment, the cells were rinsed with cold phosphatebuffered saline and lysed in RIPA buffer supplemented with a cocktail of protease and phosphatase inhibitors (Pierce, Rockford, IL, USA). Protein concentrations for each sample were determined using a bicinchoninic acid (BCA) protein assay kit (Pierce). Aliquots of total cell lysates were mixed in loading buffer, boiled for 5 min, and subjected to 10% SDS-PAGE. Proteins were blotted onto nitrocellulose membranes and then blocked with 5% bovine serum albumin in Trisbuffered saline with Tweens 20 (TBST). The membrane was then incubated overnight at 4 1C with specific antibodies (all in 1:1000 dilution). The membranes were subsequently incubated with HRPconjugated secondary antibody (Santa Cruz Biotechnology) for 2 h at room temperature, and bands were visualized using an enhanced chemiluminescence detection system (Amersham Bioscience, Piscataway, NJ, USA). The intensity of each signal was determined by a computer image analysis system (Quantity One, Bio-Rad). 2.8. Statistical analysis Statistical analyses were performed with GraphPad Prism 5.0 software (GraphPad, La Jolla, CA, USA). The results are expressed as the mean7standard deviation of individual values from three independent experiments. Data were compared by one-way ANOVA
3.1. Rhubarb constituent effects on RAW264.7 NO production To assess which rhubarb constituents have anti-inflammatory activity, we screened whether NO production in RAW264.7 murine macrophages is affected by the following five key anthraquinone rhubarb components: emodin, aloe-emodin, rhein, physcion, and chyrsophanol (Fig. 1A). NO is a well-known marker of inflammatory response. To determine concentration ranges for measuring NO suppression, cytotoxic activity was first assessed and was only observed at higher concentrations than were used for NO suppression assays (data not shown). As expected, LPS significantly stimulated NO production, and pretreatment with Bay 11-7082, a known IκB inhibitor, repressed NO production (Fig. 1B). Emodin and aloe-emodin also markedly suppressed NO production, with rhein showing moderate suppression and chrysophanol and physcion having no effect on NO production.
3.2. Effect of aloe-emodin on the expression of pro-inflammatory factors in RAW264.7 cells To precisely determine any cytotoxic effect of aloe-emodin, RAW264.7 cells were incubated with various concentrations of aloe-emodin for 24 h and cell proliferation was examined. The results showed that aloe-emodin did not affect RAW264.7 viability at the concentrations tested (Fig. 2A). All subsequent experiments were conducted at nontoxic aloe-emodin concentrations (5–20 μM). We next determined whether aloe-emodin affects the production of NO and pro-inflammatory cytokines in LPS-stimulated RAW264.7 cells. As shown in Fig. 2B, aloe-emodin significantly inhibited LPS-induced NO production at concentrations of 10–20 μM. It also inhibited LPS-induced NO production in a time-dependent manner (Fig. 2C). Likewise, aloe-emodin significantly suppressed the production of pro-inflammatory cytokines IL-1β and IL-6 at concentrations of 5–20 μM (Fig. 2D and E) to a comparable extent as the known IκB inhibitor Bay 11-7082 does (Lappas et al., 2005). These results indicate that aloe-emodin
Fig. 1. Effect of compounds from rhubarb on NO production in RAW264.7 cells. (A) Chemical structures of anthraquinone constituents of rhubarb. (B) RAW264.7 cells seeded in 24-well plates overnight were pretreated with the compounds respectively at the indicated concentration for 1 h, and then stimulated with LPS (1 μg/ml) for 24 h. Levels of NO were determined by Griess assay in culture medium. nnp o 0.01 and nnnp o0.001 compared to LPS alone treatment.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
4
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Fig. 2. Effect of aloe-emodin on the production of pro-inflammatory factors in RAW264.7 cells. (A) RAW264.7 cells were seeded onto a 96-well plate and treated with aloeemodin at the indicated concentrations for 24 h. Cell proliferation was estimated by Alamar Blue assay and expressed relative to the DMSO control. (B) RAW264.7 cells seeded in 24-well plates overnight were pretreated with aloe-emodin at the indicated concentrations for 1 h, and then stimulated with LPS (1 μg/ml) for 24 h. Levels of NO in the culture medium were assayed using Griess reagent. (C) RAW264.7 cells seeded in 24-well plates overnight were pretreated with aloe-emodin at 10 μM for the indicated time, and then stimulated with LPS (1 μg/ml) for 24 h. Levels of NO in the culture medium were assayed. (D and E) RAW264.7 cells seeded in 24-well plates overnight were pretreated with aloe-emodin at the indicated concentrations for 1 h, and then stimulated with LPS (1 μg/ml) for 24 h. The concentration of IL-1β and IL-6 in the culture medium was measured by ELISA. Assays were conducted three times in triplicate. nnp o 0.01 and nnnp o0.001 compared to LPS alone treatment.
inhibits the production of pro-inflammatory factors in macrophages in a concentration-dependent manner.
3.3. Effect of aloe-emodin on IL-1β and IL-6 mRNA expression To investigate the effect of aloe-emodin pro-inflammatory response at the transcription level, we examined IL-1β and IL-6 mRNA expression in LPS-stimulated RAW264.7 cells. At concentrations of 10–20 μM, aloe-emodin significantly repressed IL-6 mRNA expression, as does BAY11-7082 (Fig. 3A). Similarly, both aloe-emodin and the BAY11-7082 control suppressed expression of IL-1β mRNA (Fig. 3B). These results indicate that aloe-emodin
does inhibit the production of the pro-inflammaotory cytokines at the transcriptional level. 3.4. Effect of aloe-emodin on iNOS in LPS-stimulated RAW264.7 cells To investigate whether the inhibitory effect of aloe-emodin on the production of NO was owing to down-regulation of iNOS expression, we examined iNOS mRNA and protein levels in LPS-stimulated RAW264.7 cells. As a control, the IκB inhibitor BAY11-7082 significantly inhibited iNOS mRNA expression (Fig. 4A), consistent with the finding that iNOS was transcriptionally regulated by the NF-κB pathway (Schmidt et al., 2010). Aloe-emodin also decreased iNOS transcript levels by about 50% at 20 μM compared with that in
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
untreated LPS-stimulated RAW264.7 cells. Consistent with their effects on iNOS transcription, aloe-emodin and BAY11-7082 treatment also decreased iNOS protein expression (Fig. 4B). These results indicate that aloe-emodin inhibits the production of NO in LPS-
5
induced RAW264.7 cells by decreasing the expression of iNOS at the transcription level. 3.5. Effect of aloe-emodin on LPS-induced IκBα degradation The genes repressed by aloe-emodin are normally induced by NF-κB, whose activation depends on IκBα degradation. Therefore, we used Western blot analyses to examine whether aloe-emodin altered IκBα degradation. As shown in Fig. 5, in untreated cells, LPS stimulation decreased the IκBα protein level, which was consistent with the previous finding that LP stimulation triggers IκBα degradation (Aderem and Ulevitch, 2000). Compared with that the inclusion of aloe-emodin at 10 μM and 20 μM significantly reduces the degradation of IκBα induced by LPS, indicating that aloe-emodin does exert an anti-inflammatory effect through inhibition of the LPS-stimulated NF-κB signaling pathway.
Fig. 3. Effect of aloe-emodin on IL-1β and IL-6 mRNA expression in LPS-induced RAW264.7 cells. RAW264.7 cells were pre-treated with different concentrations of aloe-emodin and BAY 11-7082 (10 μM) for 1 h before stimulation with LPS (1 μg/ml) for 24 h. The mRNA levels of IL-1β (A) and IL-6 (B) were measured by qRT-PCR with GAPDH as an internal control. nnnpo 0.001 compared to LPS treatment alone.
Fig. 5. Effect of aloe-emodin on IκBα protein degradation in LPS-induced RAW264.7 cells. Cells were pre-treated with different concentrations of aloe-emodin and BAY 11-7082 (10 μM) for 12 h before the stimulation LPS (1 μg/ml) for 10 min. Cell lysates were immunoblotted with an anti-IκBα antibody. GAPDH staining is shown as a loading control. The quantitative results are depicted. np o 0.05, nnpo 0.01, and nnn p o 0.001 compared to LPS treatment alone.
Fig. 4. Effect of aloe-emodin on iNOS in LPS-stimulated RAW264.7 cells. Cells were pre-treated with different concentrations of aloe-emodin and BAY 11-7082 (10 μM) for 1 h before stimulation with LPS (1 μg/ml) for 24 h. (A) The mRNA level of iNOS was measured by qRT-PCR with GAPDH used as an internal control. (B) Cell lysates were immunoblotted with anti-iNOS antibody. GAPDH staining is shown as a loading control. The quantitative results are depicted. nnpo 0.01 and nnnpo 0.001 compared to LPS treatment alone.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
6
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
3.6. Effect of aloe-emodin on LPS-induced MAPK pathway signaling activation
3.7. Effect of aloe-emodin on LPS-induced PI3K/Akt signaling activation
To determine whether aloe-emodin alters LPS-stimulated activation of MAPK signaling, we examined several key MAPK signaling pathway proteins. As shown in Fig. 6 A, LPS stimulation significantly enhanced phosphorylation of ERK1/2 in RAW264.7 cells, and PD98059, a specific ERK inhibitor, inhibited LPS-induced ERK phosphorylation; this finding was consistent with those reported previously. Similarly, aloe-emodin inhibited phosphorylation of ERK1/2 in a concentration-dependent manner. LPS also significantly enhanced phosphorylation of JNK, and JNK phosphorylation was inhibited by aloe-emodin and by SP600125, a specific JNK inhibitor (Fig. 6B). Finally, LPS stimulation of p38 phosphorylation was inhibited by aloe-emodin at 10 μM and 20 μM and by SB203580, a specific p38 inhibitor (Fig. 6C). These results indicate that aloe-emodin exerts an anti-inflammatory effect, in part, by the inhibition of LPS-stimulated MAPK pathway signaling.
To determine whether aloe-emodin alters LPS-stimulated activation of PI3K signaling, we examined AKT, the key protein in PI3K signaling pathway. As shown in Fig. 7, LPS significantly enhanced phosphorylation of Akt protein in RAW264.7 cells, and Akt phosphorylation was inhibited by aloe-emodin at 5–20 μM and by LY294002, a known P13K inhibitor. This result indicates that aloe-emodin also has an important repressor effect on the LPSstimulated PI3K/Akt pathway signaling.
4. Discussion The anthraquinone derivatives emodin, aloe-emodin, rhein, chrysophanol, and physcion are the main bioactive constituents in rhubarb. In this study, we found that emodin, aloe-emodin, and
Fig. 6. Effect of aloe-emodin on MAPK signaling in LPS-induced RAW264.7 cells. (A) Cells were pre-treated with different concentrations of aloe-emodin and PD98059 (10 μM) for 12 h before stimulation with LPS (1 μg/ml) for 10 min. (B) Cells were pre-treated with different concentrations of aloe-emodin and SP600125 (20 μM) for 4 h before the stimulation with LPS (1 μg/ml) for 15 min. (C) Cells were pre-treated with different concentrations of aloe-emodin and SB203580 (10 μM) for 4 h before stimulation with LPS (1 μg/ml) for 15 min. Cell lysates were immunoblotted with the indicated antibody respectively. The total ERK1/2, JNK, or p38 staining is shown as a loading control respectively. The quantitative results are depicted. nnnp o 0.001 compared to LPS treatment alone.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Fig. 7. Effect of aloe-emodin on PI3K/Akt signaling in LPS-induced RAW264.7 cells. Cells were pre-treated with different concentrations of aloe-emodin and LY294002 (10 μM) for 4 h before stimulation with LPS (1 μg/ml) for 15 min. Cell lysates were immunoblotted with the indicated antibody respectively. The total Akt staining is shown as a loading control. The quantitative results are depicted. nnnp o 0.001 compared to LPS treatment alone.
rhein inhibited NO production with varying potency levels, whereas chrysophanol and physcion have no such effect, indicating that the functional group substitution pattern of anthraquinones is important to their anti-inflammatory potency. Whereas emodin has an R1 methyl group, aloe-emodin and rhein have no substitution at the position. Additionally, emodin has an R2 hydroxyl, aloe-emodin has an R2 hydroxymethyl, and rhein has an R2 carboxylate. Comparing the structural characteristics of the three anthraquinones suggests that acidic substitution with a phenolic or carboxylic group at R1 or R2 position, or polar, hydrophilic substitution such as hydroxymethyl group at R2 position may contribute to the anti-inflammatory potency. Aloe-emodin has been found to have antibacterial, antiviral, hepatoprotective, and anticancer effects (Park et al., 2009); however, its effect on anti-inflammation is seldom reported. In the present study, we found that aloe-emodin potently inhibits the production of LPS-stimulated inflammatory mediators in RAW264.7 macrophages, including NO, IL-1β, and IL-6. This indicates that it is a key contributor to the anti-inflammatory activity of rhubarb. NO is a well-known pro-inflammatory cytokine involved in many inflammatory diseases (Guzik et al., 2003) and is produced in high amounts by the iNOS protein that is induced by microbial products, such as LPS (Korhonen et al., 2005). Our data indicate that aloe-emodin inhibits the transcription and protein expression of iNOS. This result is consistent with that of a previous report that aloe-emodin inhibits the expression of iNOS and cyclooxygenase-2 (Park et al., 2009). Our work also demonstrates that aloe-emodin markedly suppresses the LPS-stimulated transcription and production of IL-1β and IL-6. IL-1β is an early major pro-inflammatory cytokine mediating the inflammatory response at both the local and systemic levels (Dinarello, 2000), and IL-6 plays an important role in a variety of inflammatory conditions, especially in acute-phase responses (Heinrich et al., 1990; Kaplanski et al., 2003). Collectively our data indicate that the anti-inflammatory effect of aloe-emodin is due, at least in part, to its inhibitory effects on the expression of pro-inflammatory mediators. Interestingly, aloe-emodin is also present in Cassiae semen (Cassia obtusifolia), Senna folium (Cassia senna), and other
7
traditional Chinese herbal medicines that are used for laxative and anti-inflammatory effect, suggesting that it may be an important bioactive constituent in these plants. Inflammatory stimuli activate multiple intracellular signaling pathways, including the NF-κB, MAPK, and PI3K pathways to promote the transcription of inflammatory genes through regulation of a set of transcription promoters. NF-κB is a dimeric transcription factor that is complexed with the IκBα repressor and cytoplasmically located in non-stimulated macrophages. Inflammatory stimuli induce phosphorylation of the IκB kinase (IKK) complex to IκBα, which leads to ubiquitination and proteasome-mediated degradation of IκBα (Akira and Takeda, 2004), which frees NF-κB to translocate to the nucleus where it induces the expression of multiple inflammatory genes. In this study, we found that aloe-emodin significantly blocked LPS-induced degradation of IκBα, and thereby repressed NFκB activated pathways involved in the LPS-induced inflammatory response. LPS also activates the ERK, JNK, and p38 MAPK signaling pathways to exert different biological effects (Sweet and Hume, 1996; Guha and Mackman, 2001; Hommes, 2003). We found that aloeemodin significantly reduced ERK1/2, JNK and p38 phosphorylation with different potency. ERK1/2 and p38 MAPK proteins are known to activate the mitogen- and stress-activated kinase (MSK) protein to regulate the NF-κB pathway (Herlaar and Brown, 1999; Nick et al., 1999; Carter, 1999; Saklatvala, 2004). Thus, aloe-emodin may inhibit the LPS-induced NF-κB pathway activation by inhibiting the phosphorylation of ERK1/2 and p38 proteins. Finally, Akt promotes IKKα/ β phosphorylation, which in turn induces IκB kinase phosphorylation and degradation (Madrid et al., 2000; Avni et al., 2012). Similarly, PI3K/Akt can also induce p38 MAPK activation, which in turn initiates NF-κB activation (Kao et al., 2005; Manning and Cantley, 2007). In this study, we found that aloe-emodin significantly inhibited Akt phosphorylation in a dose-dependent manner, indicating that aloeemodin may also suppress the activation of the NF-κB pathway through the inhibition of Akt.
5. Conclusion In summary, our study confirms that aloe-emodin is an important bioactive constituent responsible for the anti-inflammatory activity of rhubarb and that aloe-emodin decreases pro-inflammatory cytokine production in LPS-stimulated macrophages cells through the inhibition of NF-κB, MAPK, and PI3K pathways. Our results not only help to clarify the clinical benefits and side effects of rhubarb, but also emphasize the aloe-emodin's potential value and potential for optimization as a pharmaceutical agent for the prevention and treatment of inflammatory diseases.
Acknowledgments This work was supported by the National Natural Science Foundation of China (Nos. 81073118 and 81274111), and the West Light Foundation of Chinese Academy of Sciences. References Aderem, A., Ulevitch, R.J., 2000. Toll-like receptors in the induction of the innate immune response. Nature 406, 782–787. Akira, S., Takeda, K., 2004. Toll-like receptor signalling. Nat. Rev. Immunol. 4, 499–511. Avni, D., Glucksam, Y., Zor, T., 2012. The phosphatidylinositol 3-kinase (PI3K) inhibitor LY294002 modulates cytokine expression in macrophages via p50 nuclear factor kappa B inhibition, in a PI3K-independent mechanism. Biochem. Pharmacol. 83, 106–114. Carter, A.B., 1999. The p38 mitogen-activated protein kinase is required for NF-κBdependent gene expression. J. Biol. Chem. 274, 30858–30863.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
8
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Cheon, M., Yoon, T., Choi, G., Kim, S., Lee, A., Moon, B., Choo, B., Kim, H., 2009. Comparative study of extracts from rhubarb on inflammatory activity in RAW 264.7 cells. Korean J. Med. Crop Sci. 17, 109–114. Choi, R.J., Ngoc, T.M., Bae, K., Cho, H.J., Kim, D.D., Chun, J., Khan, S., Kim, Y.S., 2013. Anti-inflammatory properties of anthraquinones and their relationship with the regulation of P-glycoprotein function and expression. Eur. J. Pharm. Sci. 48, 272–281. Dinarello, C.A., 2000. Proinflammatory cytokines. CHEST J. 118, 503–508. Fang, X.L., Fang, Q., Luo, J.J., Zheng, X., 2007. Effects of crude rhubarb on intestinal permeability in septic patients. Am. J. Chin. Med. 35, 929–936. Ghosh, S., Hayden, M.S., 2008. New regulators of NF-κB in inflammation. Nat. Rev. Immunol. 8, 837–848. Guha, M., Mackman, N., 2001. LPS induction of gene expression in human monocytes. Cell Signal. 13, 85–94. Guzik, T., Korbut, R., Adamek-Guzik, T., 2003. Nitric oxide and superoxide in inflammation and immune regulation. J. Physiol. Pharmcol. 54, 469–487. He, Z.H., He, M.F., Ma, S.C., But, P.P., 2009. Anti-angiogenic effects of rhubarb and its anthraquinone derivatives. J. Ethnopharmacol. 121, 313–317. Heinrich, P.C., Castell, J.V., Andus, T., 1990. Interleukin-6 and the acute phase response. Biochem. J. 265, 621–636. Herlaar, E., Brown, Z., 1999. p38 MAPK signalling cascades in inflammatory disease. Mol. Med. Today 5, 439–447. Hommes, D.W., 2003. Mitogen activated protein (MAP) kinase signal transduction pathways and novel anti-inflammatory targets. Gut 52, 144–151. Huang, Q., Lu, G., Shen, H.M., Chung, M.C., Ong, C.N., 2007. Anti-cancer properties of anthraquinones from rhubarb. Med. Res. Rev. 27, 609–630. Huang, X.F., Chen, J.Z., 2009. Obesity, the PI3K/Akt signal pathway and colon cancer. Obesity Rev. 10, 610–616. Kaminska, B., 2005. MAPK signalling pathways as molecular targets for antiinflammatory therapy—from molecular mechanisms to therapeutic benefits. Biochim. Biophys. Acta. 1754, 253–262. Kao, S.J., Lei, H.C., Kuo, C.T., Chang, M.S., Chen, B.C., Chang, Y.C., Chiu, W.T., Lin, C.H., 2005. Lipoteichoic acid induces nuclear factor-κB activation and nitric oxide synthase expression via phosphatidylinositol 3-kinase, Akt, and p38 MAPK in RAW 264.7 macrophages. Immunology 115, 366–374. Kaplanski, G., Marin, V., Montero-Julian, F., Mantovani, A., Farnarier, C., 2003. IL-6: a regulator of the transition from neutrophil to monocyte recruitment during inflammation. Trends. Immunol. 24, 25–29. Kaur, S., Oddos, T., Tucker-Samaras, S., Southall, D.M., 2013. Regulation of DNA repair process by the pro-inflammatory NF-κB pathway. In: Chen, Clark (Ed.), New Research Directions in DNA Repair. InTech, Rijeka, Croatia, pp. 213–227. Komatsu, K., Nagayama, Y., Tanaka, K., Ling, Y., Basnet, P., Meselhy, M.R., 2006. Development of a high performance liquid chromatographic method for systematic quantitative analysis of chemical constituents in rhubarb. Chem. Pharm. Bull. 54, 941–947. Korhonen, R., Lahti, A., Kankaanranta, H., Moilanen, E., 2005. Nitric oxide production and signaling in inflammation. Curr. Drug Targets—Inflamm. Allergy 4, 471–479. Lappas, M., Permezel, M., Rice, G.E., 2005. Leptin and adiponectin stimulate the release of proinflammatory cytokines and prostaglandins from human placenta and maternal adipose tissue via nuclear factor-κB, peroxisomal proliferator-
activated receptor-γ and extracellularly regulated kinase 1/2. Endocrinology 146, 3334–3342. Li, H.L., Chen, H.L., Li, H., Zhang, K.L., Chen, X.Y., Wang, X.W., Kong, Q.Y., Liu, J., 2005. Regulatory effects of emodin on NF-κB activation and inflammatory cytokine expression in RAW 264.7 macrophages. Int. J. Mol. Med. 16, 41–47. Lin, Y., Wang, F., Yang, L.J., Chun, Z., Bao, J.K., Zhang, G.L., 2013. Anti-inflammatory phenanthrene derivatives from stems of Dendrobium denneanum. Phytochemistry 95, 242–251. Ma, B.L., Ma, Y.M., Yan, D.M., Zhou, H., Shi, R., Wang, T.M., Yang, Y., Wang, C.H., Zhang, N., 2009. Effective constituents in xiexin decoction for antiinflammation. J. Ethnopharmacol. 125, 151–156. Madrid, L.V., Wang, C.Y., Guttridge, D.C., Schottelius, A.J., Baldwin, A.S., Mayo, M.W., 2000. Akt suppresses apoptosis by stimulating the transactivation potential of the RelA/p65 subunit of NF-κB. Mol. Cell. Biol. 20, 1626–1638. Manning, B.D., Cantley, L.C., 2007. AKT/PKB signaling: navigating downstream. Cell 129, 1261–1274. Nick, J.A., Avdi, N.J., Young, S.K., Lehman, L.A., McDonald, P.P., Frasch, S.C., Billstrom, M.A., Henson, P.M., Johnson, G.L., Worthen, G.S., 1999. Selective activation and functional significance of p38α mitogen-activated protein kinase in lipopolysaccharide-stimulated neutrophils. J. Clin. Invest. 103, 851–858. Öztürk, M., Aydoğmuş-Öztürk, F., Duru, M.E., Topçu, G., 2007. Antioxidant activity of stem and root extracts of Rhubarb (Rheum ribes): an edible medicinal plant. Food Chem. 103, 623–630. Park, M.Y., Kwon, H.J., Sung, M.K., 2009. Evaluation of aloin and aloe-emodin as anti-inflammatory agents in aloe by using murine macrophages. Biosci. Biotechnol. Biochem. 73, 828–832. Saklatvala, J., 2004. The p38 MAP kinase pathway as a therapeutic target in inflammatory disease. Curr. Opin. Pharmacol. 4, 372–377. Schmidt, N., Pautz, A., Art, J., Rauschkolb, P., Jung, M., Erkel, G., Goldring, M.B., Kleinert, H., 2010. Transcriptional and post-transcriptional regulation of iNOS expression in human chondrocytes. Biochem. Pharmacol. 79, 722–732. State Pharmacopoeia Committee, 2010. Pharmacopoeia of the People's Republic of China, First Div., China. Chemical Industry Press, Beijing, pp. 22–23. Sweet, M.J., Hume, D.A., 1996. Endotoxin signal transduction in macrophages. J. Leukoc. Biol. 60, 8–26. Tracey, K.J., 2002. The inflammatory reflex. Nature 420, 853–859. Viatour, P., Merville, M.P., Bours, V., Chariot, A., 2005. Phosphorylation of NF-κB and IκB proteins: implications in cancer and inflammation. Trends Biochem. Sci. 30, 43–52. Wang, J., Zhao, H., Kong, W., Jin, C., Zhao, Y., Qu, Y., Xiao, X., 2010. Microcalorimetric assay on the antimicrobial property of five hydroxyanthraquinone derivatives in rhubarb (Rheum palmatum L.) to Bifidobacterium adolescentis. Phytomedicine 17, 684–689. Yang, L., Chen, Q., Wang, F., Zhang, G., 2011. Antiosteoporotic compounds from seeds of Cuscuta chinensis. J. Ethnopharmacol. 135, 553–560. Zheng, H., Hu, J., Zheng, Z., Huang, L., Chen, Y., Zheng, J., Chen, X., Lv, L., 2007. Emodin induces leukemic HL-60 cells apoptosis probably by inhibiting Akt signal pathway. Acta Pharm. Sin. 42, 1142. Zhu, B., Lin, Y., Zhu, C.F., Zhu, X.L., Huang, C.Z., Lu, Y., Cheng, X.X., Wang, Y.J., 2011. Emodin inhibits extracellular matrix synthesis by suppressing p38 and ERK1/2 pathways in TGF-β1-stimulated NRK-49F cells. Mol. Med. Rep. 4, 505–509.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
Contents lists available at ScienceDirect
Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jep
Research Paper
Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages Boyang Hu a, Hai Zhang a, Xianli Meng a, Fei Wang b,n, Ping Wang a,nn a b
Chengdu University of Traditional Chinese Medicine, Chengdu 610075, PR China Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, PR China
art ic l e i nf o
a b s t r a c t
Article history: Received 20 January 2014 Received in revised form 19 March 2014 Accepted 22 March 2014
Ethnopharmacological relevance: Rheum rhabarbarum (rhubarb) has long been used for the treatment of inflammation in China and other Asian countries. However, the mechanism underlying the antiinflammatory activity of this medicinal plant is not fully understood. The present study was designed to investigate the anti-inflammatory effects of anthraquinones, the major constituents in rhubarb, and the molecular mechanism involved in their anti-inflammatory effects. Materials and methods: RAW264.7 cells were stimulated by lipopolysaccharide (LPS) in the presence or absence of the compounds examined. The proliferation of RAW264.7 cells was assayed by the AlamarBlue method. The quantity of nitric oxide (NO) was determined by Griess assay. The expression of proinflammatory cytokines was determined by enzyme-linked immunosorbent assay (ELISA) and quantitative real-time PCR. Inducible nitric oxide synthase (iNOS), inhibitor of nuclear factor κBα (IκBα), extracellular signal-regulated kinase (ERK), p38 mitogen-activated protein kinase (MAPK), c-Jun NH2-terminal kinase (JNK), and Akt/phosphoinositide 3-kinase (PI3K) protein expression levels were determined by Western blotting. Results: Aloe-emodin markedly suppressed the production of NO, interleukin-6 (IL-6), and interleukin1β (IL-1β) in LPS-stimulated RAW264.7 cells with no apparent cytotoxicity. The mRNA expression levels of iNOS, IL-6, and IL-1β genes were also significantly inhibited by aloe-emodin. Western blot analysis showed that aloe-emodin suppressed LPS-induced iNOS protein expression, IκBα degradation, and the phosphorylation of ERK, p38, JNK, and Akt. Conclusions: These results demonstrate that aloe-emodin is the bioactive component of rhubarb that confers an anti-inflammatory effect through a likely mechanism involving a decrease in proinflammatory cytokine production in LPS-induced RAW264.7 macrophages via inhibition of NF-κB, MAPK, and PI3K pathways. & 2014 Elsevier Ireland Ltd. All rights reserved.
Keywords: Anthraquinone Aloe-emodin Rhubarb Inflammation Macrophage Chemical compounds studied in this article: Rhein (PubChem CID: 10168) Emodin (PubChem CID: 3220) Aloe-emodin (PubChem CID: 10207) Physcion (PubChem CID: 10639) Chrysophanol (PubChem CID: 10208)
1. Introduction Inflammation is a local, protective response of the immune system to microbial invasion or injury. Excessive inflammatory responses can be problematic, as in diseases such as rheumatoid arthritis, Alzheimer's disease, septic shock syndrome, and sepsis
Abbreviations: Rhubarb, Rheum rhabarbarum; LPS, lipopolysaccharide; NO, nitric oxide; ELISA, enzyme-linked immunosorbent assay; iNOS, inducible nitric oxide synthase; IκBα, inhibitor of nuclear factor κB α; ERK, extracellular signal-regulated kinase; p38 MAPK, p38 mitogen-activated protein kinase; JNK, c-Jun NH2-terminal kinase; IL-6, interleukin-6; IL-1β, interleukin-1β; PI3K, phosphoinositide 3-kinase n Corresponding author. Tel./fax: þ 86 28 82890651. nn Corresponding author. Tel./fax: þ86 28 87714869. E-mail addresses: [email protected] (F. Wang), [email protected] (P. Wang).
(Tracey, 2002). Lipopolysaccharide (LPS), a component of the cell wall of Gram-negative bacteria, stimulates macrophages to produce pro-inflammatory mediators such as tumor necrosis factor alpha (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), inducible nitric oxide synthase (iNOS), and cyclooxygenase-2, which trigger a cascade responsible for the inflammatory response. Nuclear factor-κB (NF-κB) is a transcription factor with a central role in immune responses, apoptosis, cellular growth, and inflammation. In resting cells, NF-κB is localized to the cytoplasm and binds to an inhibitor protein known as IκB (Viatour et al., 2005; Ghosh and Hayden, 2008). Extracellular stimuli such as viral or bacterial factors, oxidative stress, and pro-inflammatory cytokines such as IL-1 and TNF-α can trigger NF-κB-activated pathways, which in turn causes phosphorylation and subsequent proteasome-mediated degradation of the inhibitor of NF-κB proteins (IκB). Once degraded, IκB no longer binds to NF-κB, and the
http://dx.doi.org/10.1016/j.jep.2014.03.059 0378-8741/& 2014 Elsevier Ireland Ltd. All rights reserved.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
2
free NF-κB translocates into the nucleus where it induces the expression of multiple genes, including those coding for cytokines (such as interleukin-1, -2, and -6), TNF-α, cellular adhesion molecules (intercellular adhesion molecule-1 [ICAM-1], vascular cell adhesion molecule-1 [VCAM-1], and endothelial cell adhesion molecule-1 [ELAM-1]), and other proteins that stimulate an inflammatory response (Kaur et al., 2013). Other signaling pathways may also activate NF-κB, including Akt/phosphoinositide 3-kinase (PI3K) and mitogen-activated protein kinase (MAPK). For instance, Akt can phosphorylate IκB, leading to NF-κB release and activation (Huang and Chen, 2009). The MAPK pathways, which are extracellular signal-regulated kinase (ERK), c-Jun NH2-terminal kinase (JNK), and p38 MAPK pathways in particular (Herlaar and Brown, 1999), also regulate the synthesis of inflammation mediators at the level of transcription and translation through activation of NF-κB and AP-1 transcription factors (Kaminska, 2005). Rhubarb (Rheum rhabarbarum) is a well-known traditional Chinese herbal medicine commonly used to treat constipation, jaundice, gastrointestinal hemorrhage, and ulcers (State Pharmacopoeia Committee, 2010). It is also included as an ingredient in many traditional Chinese medicine formulations for treatment of indications involving inflammation, such as acute appendicitis, acute cholecystitis, and rheumatoid arthritis (Ma et al., 2009). In recent years, rhubarb has also been shown to have anti-bacterial (Wang et al., 2010), antioxidant (Öztürk et al., 2007), anti-cancer (Huang et al., 2007), anti-angiogenesis (He et al., 2009), anti-inflammation (Fang et al., 2007; Cheon et al., 2009; Choi et al., 2013), and other effects. The primary active constituents of rhubarb are thought to be anthraquinone derivatives, including emodin, aloe-emodin, rhein, chrysophanol, physcion, and danthron (Komatsu et al., 2006). In addition, rhubarb also contains several glycosides, catechins, gallic acid, and cinnamic acid, together with small amounts of tannins (Huang et al., 2007). Emodin and rhein exert an anti-inflammatory effect through blocking of MAPK and PI3K pathway signaling (Zheng et al., 2007; Zhu et al., 2011) and inhibition of the activation of NF-κB and iNOS expression (Li et al., 2005). For quality control and clinical use of rhubarb, it will be important to determine whether other rhubarb components exhibit anti-inflammatory activity. Therefore, to elucidate other bioactive constituents of rhubarb, we have investigated the macrophageresponsive anti-inflammatory activity and mechanism of several of the anthraquinones that are major constituents of rhubarb.
2. Materials and methods 2.1. Reagents Rhein, emodin, aloe-emodin, physcion, chrysophanol were purchased from Chengdu Must Bio-Technology Co., Ltd. (Chengdu, China). Dimethyl sulfoxide (DMSO), LPS from Escherichia coli 055: B5, Bay 11-7082 (inhibitor of IκBα), PD98059 (inhibitor of MAPKK), SP600125 (inhibitor of JNK), and SB203580 (inhibitor of p38 MAPK) were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Dulbecco's modified Eagle's medium (DMEM) was from Gibco (Invitrogen, Carlsbad, CA, USA). Fetal bovine serum (FBS) was obtained from Hyclone (Thermo Scientific, Waltham, MA, USA). Alamar-Blue was from Sunbio Medical Biotechnology Co., Ltd. (Shanghai, China). The Griess reagent was purchased from Beyotime Institute of Biotechnology (Haimen, China). Mouse IL-6 enzyme-linked immunosorbent assay (ELISA) kits were purchased from Invitrogen and IL-1β ELISA kits were purchased from R&D Systems, Inc. (Minneapolis, MN, USA). The antibodies for iNOS, phospho-p44/42 MAPK, p44/p42 MAPK, phospho-stress-activated protein kinase (SAPK)/JNK, SAPK/JNK, phospho-Akt, and Akt were purchased from Cell Signaling Technology Inc. (Danvers, MA, USA),
and the antibodies for IκBα, phospho-p38 MAPK, p38 MAPK, and GAPDH were purchased from Epitomics (Burlingame, CA, USA). Horseradish peroxidase (HRP)-conjugated goat anti-rabbit and goat anti-mouse antibodies were from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). 2.2. Cell culture Murine macrophage RAW264.7 cells were obtained from the Center of Cellular Resource, Chinese Academy of Sciences (Shanghai, China). Cells were cultured in DMEM containing 10% FBS and 1% penicillin/streptomycin in a humidified incubator with a 5% CO2 atmosphere at 37 1C. 2.3. Cell proliferation assay Cell proliferation was evaluated by Alamar-Blue assay as described previously (Yang et al., 2011). Briefly, 4 104 RAW264.7 cells were seeded into 96-well plates and incubated at 37 1C in an atmosphere of 5% CO2 overnight. A dilution series of each compound was added to the cells followed by incubation for 24 h. Cell viability was assessed using Alamar-Blue reagent and fluorescence detection on a Thermo Scientific Varioskan Flash Multimode Reader with excitation and emission wavelengths of 544 and 590 nm, respectively. Cellular proliferation inhibition rate was defined as the ratio of the fluorescence intensity in test wells compared to control wells. Reported data are the mean of triplicate analyses. 2.4. Nitric oxide determination Nitric oxide was measured as described previously (Lin et al., 2013). The RAW264.7 cells were plated at 5 105 cells/ml in 24-well plates, incubated overnight, and treated with different concentrations of test compounds for 1 h, followed by treatment with LPS (1 μg/ml) for an additional 24 h. NO measurements were conducted directly in the cell culture medium by using a commercially available kit based on the Griess reaction (Beyotime). Data reported are the mean values from triplicate analyses. 2.5. Cytokine measurement RAW264.7 cells were plated at 5 105 cells/ml in 24-well plates and incubated overnight. The cells were treated with different concentrations of aloe-emodin for 1 h, and then treated with LPS (1 μg/ml) for an additional 24 h. Cell-free supernatants were collected for determination of IL-1β and IL-6 concentrations via ELISA analysis according the manufacturer's protocols. 2.6. Quantitative real-time polymerase chain reaction (qRT-PCR) RAW264.7 cells were plated at 1 106 cells/ml in 6-well plates, incubated overnight, and treated with different concentrations of aloe-emodin for 1 h, followed by treatment with LPS (1 μg/ml) and incubation for an additional 24 h. Total RNA from RAW264.7 cells was extracted using TRIzol Reagent (Invitrogen) according to the manufacturer's instructions. The concentration and purity of RNA were measured by spectrophotometric analysis with a UV-1800 spectrophotometer (Mapada, Shanghai, China). Total RNA (2 μg) was reverse-transcribed to cDNA by using the SuperScripts III First-Strand Synthesis System (Invitrogen) in a total volume of 20 μl. qRT-PCR was performed on a Chromo4 Real-Time PCR System (Bio-Rad, Hercules, CA, USA) with SsoFastTM EvaGreens Supermix (Bio-Rad). The sequences of primers used for qRT-PCR analyses are shown below. Amplification conditions were as follows: 95 1C initial denaturation for 5 min followed by 39 cycles of 95 1C for 15 s and 60 1C for 30 s. Relative expression levels of the
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
ΔΔ
target genes were calculated based on 2 Ct according to the manufacture's specifications by using the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene as a reference housekeeping gene.
3
followed by a Dunnett post hoc test. The differences were considered statistically significant when pr0.05.
3. Results Gene
Primer sequence
iNOS iNOS IL-6 IL-6
Forward: 50 GGATCTTCCCAGGCAACCA 30 Reverse: 50 AATCCACAACTCGCTCCAAGATT 30 Forward: 50 TGGAGTCACAGAAGGAGTGGCTAAG 30 Reverse: 50 TCTGACCACAGTGAGGAATGTCCAC 30 Forward: 50 GCCTTGGGCCTCAAAGGAAAGAATC 30
IL-1β
IL-1β GAPDH GAPDH
Reverse: 50 GGAAGACACAGATTCCATGGTGAAG 30 Forward: 50 AGGTGAAGGTCGGAGTCAACG 30 Reverse: 50 CCTGGAAGATGGTGATGGGAT 30
2.7. Western blotting Following treatment, the cells were rinsed with cold phosphatebuffered saline and lysed in RIPA buffer supplemented with a cocktail of protease and phosphatase inhibitors (Pierce, Rockford, IL, USA). Protein concentrations for each sample were determined using a bicinchoninic acid (BCA) protein assay kit (Pierce). Aliquots of total cell lysates were mixed in loading buffer, boiled for 5 min, and subjected to 10% SDS-PAGE. Proteins were blotted onto nitrocellulose membranes and then blocked with 5% bovine serum albumin in Trisbuffered saline with Tweens 20 (TBST). The membrane was then incubated overnight at 4 1C with specific antibodies (all in 1:1000 dilution). The membranes were subsequently incubated with HRPconjugated secondary antibody (Santa Cruz Biotechnology) for 2 h at room temperature, and bands were visualized using an enhanced chemiluminescence detection system (Amersham Bioscience, Piscataway, NJ, USA). The intensity of each signal was determined by a computer image analysis system (Quantity One, Bio-Rad). 2.8. Statistical analysis Statistical analyses were performed with GraphPad Prism 5.0 software (GraphPad, La Jolla, CA, USA). The results are expressed as the mean7standard deviation of individual values from three independent experiments. Data were compared by one-way ANOVA
3.1. Rhubarb constituent effects on RAW264.7 NO production To assess which rhubarb constituents have anti-inflammatory activity, we screened whether NO production in RAW264.7 murine macrophages is affected by the following five key anthraquinone rhubarb components: emodin, aloe-emodin, rhein, physcion, and chyrsophanol (Fig. 1A). NO is a well-known marker of inflammatory response. To determine concentration ranges for measuring NO suppression, cytotoxic activity was first assessed and was only observed at higher concentrations than were used for NO suppression assays (data not shown). As expected, LPS significantly stimulated NO production, and pretreatment with Bay 11-7082, a known IκB inhibitor, repressed NO production (Fig. 1B). Emodin and aloe-emodin also markedly suppressed NO production, with rhein showing moderate suppression and chrysophanol and physcion having no effect on NO production.
3.2. Effect of aloe-emodin on the expression of pro-inflammatory factors in RAW264.7 cells To precisely determine any cytotoxic effect of aloe-emodin, RAW264.7 cells were incubated with various concentrations of aloe-emodin for 24 h and cell proliferation was examined. The results showed that aloe-emodin did not affect RAW264.7 viability at the concentrations tested (Fig. 2A). All subsequent experiments were conducted at nontoxic aloe-emodin concentrations (5–20 μM). We next determined whether aloe-emodin affects the production of NO and pro-inflammatory cytokines in LPS-stimulated RAW264.7 cells. As shown in Fig. 2B, aloe-emodin significantly inhibited LPS-induced NO production at concentrations of 10–20 μM. It also inhibited LPS-induced NO production in a time-dependent manner (Fig. 2C). Likewise, aloe-emodin significantly suppressed the production of pro-inflammatory cytokines IL-1β and IL-6 at concentrations of 5–20 μM (Fig. 2D and E) to a comparable extent as the known IκB inhibitor Bay 11-7082 does (Lappas et al., 2005). These results indicate that aloe-emodin
Fig. 1. Effect of compounds from rhubarb on NO production in RAW264.7 cells. (A) Chemical structures of anthraquinone constituents of rhubarb. (B) RAW264.7 cells seeded in 24-well plates overnight were pretreated with the compounds respectively at the indicated concentration for 1 h, and then stimulated with LPS (1 μg/ml) for 24 h. Levels of NO were determined by Griess assay in culture medium. nnp o 0.01 and nnnp o0.001 compared to LPS alone treatment.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
4
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Fig. 2. Effect of aloe-emodin on the production of pro-inflammatory factors in RAW264.7 cells. (A) RAW264.7 cells were seeded onto a 96-well plate and treated with aloeemodin at the indicated concentrations for 24 h. Cell proliferation was estimated by Alamar Blue assay and expressed relative to the DMSO control. (B) RAW264.7 cells seeded in 24-well plates overnight were pretreated with aloe-emodin at the indicated concentrations for 1 h, and then stimulated with LPS (1 μg/ml) for 24 h. Levels of NO in the culture medium were assayed using Griess reagent. (C) RAW264.7 cells seeded in 24-well plates overnight were pretreated with aloe-emodin at 10 μM for the indicated time, and then stimulated with LPS (1 μg/ml) for 24 h. Levels of NO in the culture medium were assayed. (D and E) RAW264.7 cells seeded in 24-well plates overnight were pretreated with aloe-emodin at the indicated concentrations for 1 h, and then stimulated with LPS (1 μg/ml) for 24 h. The concentration of IL-1β and IL-6 in the culture medium was measured by ELISA. Assays were conducted three times in triplicate. nnp o 0.01 and nnnp o0.001 compared to LPS alone treatment.
inhibits the production of pro-inflammatory factors in macrophages in a concentration-dependent manner.
3.3. Effect of aloe-emodin on IL-1β and IL-6 mRNA expression To investigate the effect of aloe-emodin pro-inflammatory response at the transcription level, we examined IL-1β and IL-6 mRNA expression in LPS-stimulated RAW264.7 cells. At concentrations of 10–20 μM, aloe-emodin significantly repressed IL-6 mRNA expression, as does BAY11-7082 (Fig. 3A). Similarly, both aloe-emodin and the BAY11-7082 control suppressed expression of IL-1β mRNA (Fig. 3B). These results indicate that aloe-emodin
does inhibit the production of the pro-inflammaotory cytokines at the transcriptional level. 3.4. Effect of aloe-emodin on iNOS in LPS-stimulated RAW264.7 cells To investigate whether the inhibitory effect of aloe-emodin on the production of NO was owing to down-regulation of iNOS expression, we examined iNOS mRNA and protein levels in LPS-stimulated RAW264.7 cells. As a control, the IκB inhibitor BAY11-7082 significantly inhibited iNOS mRNA expression (Fig. 4A), consistent with the finding that iNOS was transcriptionally regulated by the NF-κB pathway (Schmidt et al., 2010). Aloe-emodin also decreased iNOS transcript levels by about 50% at 20 μM compared with that in
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
untreated LPS-stimulated RAW264.7 cells. Consistent with their effects on iNOS transcription, aloe-emodin and BAY11-7082 treatment also decreased iNOS protein expression (Fig. 4B). These results indicate that aloe-emodin inhibits the production of NO in LPS-
5
induced RAW264.7 cells by decreasing the expression of iNOS at the transcription level. 3.5. Effect of aloe-emodin on LPS-induced IκBα degradation The genes repressed by aloe-emodin are normally induced by NF-κB, whose activation depends on IκBα degradation. Therefore, we used Western blot analyses to examine whether aloe-emodin altered IκBα degradation. As shown in Fig. 5, in untreated cells, LPS stimulation decreased the IκBα protein level, which was consistent with the previous finding that LP stimulation triggers IκBα degradation (Aderem and Ulevitch, 2000). Compared with that the inclusion of aloe-emodin at 10 μM and 20 μM significantly reduces the degradation of IκBα induced by LPS, indicating that aloe-emodin does exert an anti-inflammatory effect through inhibition of the LPS-stimulated NF-κB signaling pathway.
Fig. 3. Effect of aloe-emodin on IL-1β and IL-6 mRNA expression in LPS-induced RAW264.7 cells. RAW264.7 cells were pre-treated with different concentrations of aloe-emodin and BAY 11-7082 (10 μM) for 1 h before stimulation with LPS (1 μg/ml) for 24 h. The mRNA levels of IL-1β (A) and IL-6 (B) were measured by qRT-PCR with GAPDH as an internal control. nnnpo 0.001 compared to LPS treatment alone.
Fig. 5. Effect of aloe-emodin on IκBα protein degradation in LPS-induced RAW264.7 cells. Cells were pre-treated with different concentrations of aloe-emodin and BAY 11-7082 (10 μM) for 12 h before the stimulation LPS (1 μg/ml) for 10 min. Cell lysates were immunoblotted with an anti-IκBα antibody. GAPDH staining is shown as a loading control. The quantitative results are depicted. np o 0.05, nnpo 0.01, and nnn p o 0.001 compared to LPS treatment alone.
Fig. 4. Effect of aloe-emodin on iNOS in LPS-stimulated RAW264.7 cells. Cells were pre-treated with different concentrations of aloe-emodin and BAY 11-7082 (10 μM) for 1 h before stimulation with LPS (1 μg/ml) for 24 h. (A) The mRNA level of iNOS was measured by qRT-PCR with GAPDH used as an internal control. (B) Cell lysates were immunoblotted with anti-iNOS antibody. GAPDH staining is shown as a loading control. The quantitative results are depicted. nnpo 0.01 and nnnpo 0.001 compared to LPS treatment alone.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
6
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
3.6. Effect of aloe-emodin on LPS-induced MAPK pathway signaling activation
3.7. Effect of aloe-emodin on LPS-induced PI3K/Akt signaling activation
To determine whether aloe-emodin alters LPS-stimulated activation of MAPK signaling, we examined several key MAPK signaling pathway proteins. As shown in Fig. 6 A, LPS stimulation significantly enhanced phosphorylation of ERK1/2 in RAW264.7 cells, and PD98059, a specific ERK inhibitor, inhibited LPS-induced ERK phosphorylation; this finding was consistent with those reported previously. Similarly, aloe-emodin inhibited phosphorylation of ERK1/2 in a concentration-dependent manner. LPS also significantly enhanced phosphorylation of JNK, and JNK phosphorylation was inhibited by aloe-emodin and by SP600125, a specific JNK inhibitor (Fig. 6B). Finally, LPS stimulation of p38 phosphorylation was inhibited by aloe-emodin at 10 μM and 20 μM and by SB203580, a specific p38 inhibitor (Fig. 6C). These results indicate that aloe-emodin exerts an anti-inflammatory effect, in part, by the inhibition of LPS-stimulated MAPK pathway signaling.
To determine whether aloe-emodin alters LPS-stimulated activation of PI3K signaling, we examined AKT, the key protein in PI3K signaling pathway. As shown in Fig. 7, LPS significantly enhanced phosphorylation of Akt protein in RAW264.7 cells, and Akt phosphorylation was inhibited by aloe-emodin at 5–20 μM and by LY294002, a known P13K inhibitor. This result indicates that aloe-emodin also has an important repressor effect on the LPSstimulated PI3K/Akt pathway signaling.
4. Discussion The anthraquinone derivatives emodin, aloe-emodin, rhein, chrysophanol, and physcion are the main bioactive constituents in rhubarb. In this study, we found that emodin, aloe-emodin, and
Fig. 6. Effect of aloe-emodin on MAPK signaling in LPS-induced RAW264.7 cells. (A) Cells were pre-treated with different concentrations of aloe-emodin and PD98059 (10 μM) for 12 h before stimulation with LPS (1 μg/ml) for 10 min. (B) Cells were pre-treated with different concentrations of aloe-emodin and SP600125 (20 μM) for 4 h before the stimulation with LPS (1 μg/ml) for 15 min. (C) Cells were pre-treated with different concentrations of aloe-emodin and SB203580 (10 μM) for 4 h before stimulation with LPS (1 μg/ml) for 15 min. Cell lysates were immunoblotted with the indicated antibody respectively. The total ERK1/2, JNK, or p38 staining is shown as a loading control respectively. The quantitative results are depicted. nnnp o 0.001 compared to LPS treatment alone.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Fig. 7. Effect of aloe-emodin on PI3K/Akt signaling in LPS-induced RAW264.7 cells. Cells were pre-treated with different concentrations of aloe-emodin and LY294002 (10 μM) for 4 h before stimulation with LPS (1 μg/ml) for 15 min. Cell lysates were immunoblotted with the indicated antibody respectively. The total Akt staining is shown as a loading control. The quantitative results are depicted. nnnp o 0.001 compared to LPS treatment alone.
rhein inhibited NO production with varying potency levels, whereas chrysophanol and physcion have no such effect, indicating that the functional group substitution pattern of anthraquinones is important to their anti-inflammatory potency. Whereas emodin has an R1 methyl group, aloe-emodin and rhein have no substitution at the position. Additionally, emodin has an R2 hydroxyl, aloe-emodin has an R2 hydroxymethyl, and rhein has an R2 carboxylate. Comparing the structural characteristics of the three anthraquinones suggests that acidic substitution with a phenolic or carboxylic group at R1 or R2 position, or polar, hydrophilic substitution such as hydroxymethyl group at R2 position may contribute to the anti-inflammatory potency. Aloe-emodin has been found to have antibacterial, antiviral, hepatoprotective, and anticancer effects (Park et al., 2009); however, its effect on anti-inflammation is seldom reported. In the present study, we found that aloe-emodin potently inhibits the production of LPS-stimulated inflammatory mediators in RAW264.7 macrophages, including NO, IL-1β, and IL-6. This indicates that it is a key contributor to the anti-inflammatory activity of rhubarb. NO is a well-known pro-inflammatory cytokine involved in many inflammatory diseases (Guzik et al., 2003) and is produced in high amounts by the iNOS protein that is induced by microbial products, such as LPS (Korhonen et al., 2005). Our data indicate that aloe-emodin inhibits the transcription and protein expression of iNOS. This result is consistent with that of a previous report that aloe-emodin inhibits the expression of iNOS and cyclooxygenase-2 (Park et al., 2009). Our work also demonstrates that aloe-emodin markedly suppresses the LPS-stimulated transcription and production of IL-1β and IL-6. IL-1β is an early major pro-inflammatory cytokine mediating the inflammatory response at both the local and systemic levels (Dinarello, 2000), and IL-6 plays an important role in a variety of inflammatory conditions, especially in acute-phase responses (Heinrich et al., 1990; Kaplanski et al., 2003). Collectively our data indicate that the anti-inflammatory effect of aloe-emodin is due, at least in part, to its inhibitory effects on the expression of pro-inflammatory mediators. Interestingly, aloe-emodin is also present in Cassiae semen (Cassia obtusifolia), Senna folium (Cassia senna), and other
7
traditional Chinese herbal medicines that are used for laxative and anti-inflammatory effect, suggesting that it may be an important bioactive constituent in these plants. Inflammatory stimuli activate multiple intracellular signaling pathways, including the NF-κB, MAPK, and PI3K pathways to promote the transcription of inflammatory genes through regulation of a set of transcription promoters. NF-κB is a dimeric transcription factor that is complexed with the IκBα repressor and cytoplasmically located in non-stimulated macrophages. Inflammatory stimuli induce phosphorylation of the IκB kinase (IKK) complex to IκBα, which leads to ubiquitination and proteasome-mediated degradation of IκBα (Akira and Takeda, 2004), which frees NF-κB to translocate to the nucleus where it induces the expression of multiple inflammatory genes. In this study, we found that aloe-emodin significantly blocked LPS-induced degradation of IκBα, and thereby repressed NFκB activated pathways involved in the LPS-induced inflammatory response. LPS also activates the ERK, JNK, and p38 MAPK signaling pathways to exert different biological effects (Sweet and Hume, 1996; Guha and Mackman, 2001; Hommes, 2003). We found that aloeemodin significantly reduced ERK1/2, JNK and p38 phosphorylation with different potency. ERK1/2 and p38 MAPK proteins are known to activate the mitogen- and stress-activated kinase (MSK) protein to regulate the NF-κB pathway (Herlaar and Brown, 1999; Nick et al., 1999; Carter, 1999; Saklatvala, 2004). Thus, aloe-emodin may inhibit the LPS-induced NF-κB pathway activation by inhibiting the phosphorylation of ERK1/2 and p38 proteins. Finally, Akt promotes IKKα/ β phosphorylation, which in turn induces IκB kinase phosphorylation and degradation (Madrid et al., 2000; Avni et al., 2012). Similarly, PI3K/Akt can also induce p38 MAPK activation, which in turn initiates NF-κB activation (Kao et al., 2005; Manning and Cantley, 2007). In this study, we found that aloe-emodin significantly inhibited Akt phosphorylation in a dose-dependent manner, indicating that aloeemodin may also suppress the activation of the NF-κB pathway through the inhibition of Akt.
5. Conclusion In summary, our study confirms that aloe-emodin is an important bioactive constituent responsible for the anti-inflammatory activity of rhubarb and that aloe-emodin decreases pro-inflammatory cytokine production in LPS-stimulated macrophages cells through the inhibition of NF-κB, MAPK, and PI3K pathways. Our results not only help to clarify the clinical benefits and side effects of rhubarb, but also emphasize the aloe-emodin's potential value and potential for optimization as a pharmaceutical agent for the prevention and treatment of inflammatory diseases.
Acknowledgments This work was supported by the National Natural Science Foundation of China (Nos. 81073118 and 81274111), and the West Light Foundation of Chinese Academy of Sciences. References Aderem, A., Ulevitch, R.J., 2000. Toll-like receptors in the induction of the innate immune response. Nature 406, 782–787. Akira, S., Takeda, K., 2004. Toll-like receptor signalling. Nat. Rev. Immunol. 4, 499–511. Avni, D., Glucksam, Y., Zor, T., 2012. The phosphatidylinositol 3-kinase (PI3K) inhibitor LY294002 modulates cytokine expression in macrophages via p50 nuclear factor kappa B inhibition, in a PI3K-independent mechanism. Biochem. Pharmacol. 83, 106–114. Carter, A.B., 1999. The p38 mitogen-activated protein kinase is required for NF-κBdependent gene expression. J. Biol. Chem. 274, 30858–30863.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i
8
B. Hu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Cheon, M., Yoon, T., Choi, G., Kim, S., Lee, A., Moon, B., Choo, B., Kim, H., 2009. Comparative study of extracts from rhubarb on inflammatory activity in RAW 264.7 cells. Korean J. Med. Crop Sci. 17, 109–114. Choi, R.J., Ngoc, T.M., Bae, K., Cho, H.J., Kim, D.D., Chun, J., Khan, S., Kim, Y.S., 2013. Anti-inflammatory properties of anthraquinones and their relationship with the regulation of P-glycoprotein function and expression. Eur. J. Pharm. Sci. 48, 272–281. Dinarello, C.A., 2000. Proinflammatory cytokines. CHEST J. 118, 503–508. Fang, X.L., Fang, Q., Luo, J.J., Zheng, X., 2007. Effects of crude rhubarb on intestinal permeability in septic patients. Am. J. Chin. Med. 35, 929–936. Ghosh, S., Hayden, M.S., 2008. New regulators of NF-κB in inflammation. Nat. Rev. Immunol. 8, 837–848. Guha, M., Mackman, N., 2001. LPS induction of gene expression in human monocytes. Cell Signal. 13, 85–94. Guzik, T., Korbut, R., Adamek-Guzik, T., 2003. Nitric oxide and superoxide in inflammation and immune regulation. J. Physiol. Pharmcol. 54, 469–487. He, Z.H., He, M.F., Ma, S.C., But, P.P., 2009. Anti-angiogenic effects of rhubarb and its anthraquinone derivatives. J. Ethnopharmacol. 121, 313–317. Heinrich, P.C., Castell, J.V., Andus, T., 1990. Interleukin-6 and the acute phase response. Biochem. J. 265, 621–636. Herlaar, E., Brown, Z., 1999. p38 MAPK signalling cascades in inflammatory disease. Mol. Med. Today 5, 439–447. Hommes, D.W., 2003. Mitogen activated protein (MAP) kinase signal transduction pathways and novel anti-inflammatory targets. Gut 52, 144–151. Huang, Q., Lu, G., Shen, H.M., Chung, M.C., Ong, C.N., 2007. Anti-cancer properties of anthraquinones from rhubarb. Med. Res. Rev. 27, 609–630. Huang, X.F., Chen, J.Z., 2009. Obesity, the PI3K/Akt signal pathway and colon cancer. Obesity Rev. 10, 610–616. Kaminska, B., 2005. MAPK signalling pathways as molecular targets for antiinflammatory therapy—from molecular mechanisms to therapeutic benefits. Biochim. Biophys. Acta. 1754, 253–262. Kao, S.J., Lei, H.C., Kuo, C.T., Chang, M.S., Chen, B.C., Chang, Y.C., Chiu, W.T., Lin, C.H., 2005. Lipoteichoic acid induces nuclear factor-κB activation and nitric oxide synthase expression via phosphatidylinositol 3-kinase, Akt, and p38 MAPK in RAW 264.7 macrophages. Immunology 115, 366–374. Kaplanski, G., Marin, V., Montero-Julian, F., Mantovani, A., Farnarier, C., 2003. IL-6: a regulator of the transition from neutrophil to monocyte recruitment during inflammation. Trends. Immunol. 24, 25–29. Kaur, S., Oddos, T., Tucker-Samaras, S., Southall, D.M., 2013. Regulation of DNA repair process by the pro-inflammatory NF-κB pathway. In: Chen, Clark (Ed.), New Research Directions in DNA Repair. InTech, Rijeka, Croatia, pp. 213–227. Komatsu, K., Nagayama, Y., Tanaka, K., Ling, Y., Basnet, P., Meselhy, M.R., 2006. Development of a high performance liquid chromatographic method for systematic quantitative analysis of chemical constituents in rhubarb. Chem. Pharm. Bull. 54, 941–947. Korhonen, R., Lahti, A., Kankaanranta, H., Moilanen, E., 2005. Nitric oxide production and signaling in inflammation. Curr. Drug Targets—Inflamm. Allergy 4, 471–479. Lappas, M., Permezel, M., Rice, G.E., 2005. Leptin and adiponectin stimulate the release of proinflammatory cytokines and prostaglandins from human placenta and maternal adipose tissue via nuclear factor-κB, peroxisomal proliferator-
activated receptor-γ and extracellularly regulated kinase 1/2. Endocrinology 146, 3334–3342. Li, H.L., Chen, H.L., Li, H., Zhang, K.L., Chen, X.Y., Wang, X.W., Kong, Q.Y., Liu, J., 2005. Regulatory effects of emodin on NF-κB activation and inflammatory cytokine expression in RAW 264.7 macrophages. Int. J. Mol. Med. 16, 41–47. Lin, Y., Wang, F., Yang, L.J., Chun, Z., Bao, J.K., Zhang, G.L., 2013. Anti-inflammatory phenanthrene derivatives from stems of Dendrobium denneanum. Phytochemistry 95, 242–251. Ma, B.L., Ma, Y.M., Yan, D.M., Zhou, H., Shi, R., Wang, T.M., Yang, Y., Wang, C.H., Zhang, N., 2009. Effective constituents in xiexin decoction for antiinflammation. J. Ethnopharmacol. 125, 151–156. Madrid, L.V., Wang, C.Y., Guttridge, D.C., Schottelius, A.J., Baldwin, A.S., Mayo, M.W., 2000. Akt suppresses apoptosis by stimulating the transactivation potential of the RelA/p65 subunit of NF-κB. Mol. Cell. Biol. 20, 1626–1638. Manning, B.D., Cantley, L.C., 2007. AKT/PKB signaling: navigating downstream. Cell 129, 1261–1274. Nick, J.A., Avdi, N.J., Young, S.K., Lehman, L.A., McDonald, P.P., Frasch, S.C., Billstrom, M.A., Henson, P.M., Johnson, G.L., Worthen, G.S., 1999. Selective activation and functional significance of p38α mitogen-activated protein kinase in lipopolysaccharide-stimulated neutrophils. J. Clin. Invest. 103, 851–858. Öztürk, M., Aydoğmuş-Öztürk, F., Duru, M.E., Topçu, G., 2007. Antioxidant activity of stem and root extracts of Rhubarb (Rheum ribes): an edible medicinal plant. Food Chem. 103, 623–630. Park, M.Y., Kwon, H.J., Sung, M.K., 2009. Evaluation of aloin and aloe-emodin as anti-inflammatory agents in aloe by using murine macrophages. Biosci. Biotechnol. Biochem. 73, 828–832. Saklatvala, J., 2004. The p38 MAP kinase pathway as a therapeutic target in inflammatory disease. Curr. Opin. Pharmacol. 4, 372–377. Schmidt, N., Pautz, A., Art, J., Rauschkolb, P., Jung, M., Erkel, G., Goldring, M.B., Kleinert, H., 2010. Transcriptional and post-transcriptional regulation of iNOS expression in human chondrocytes. Biochem. Pharmacol. 79, 722–732. State Pharmacopoeia Committee, 2010. Pharmacopoeia of the People's Republic of China, First Div., China. Chemical Industry Press, Beijing, pp. 22–23. Sweet, M.J., Hume, D.A., 1996. Endotoxin signal transduction in macrophages. J. Leukoc. Biol. 60, 8–26. Tracey, K.J., 2002. The inflammatory reflex. Nature 420, 853–859. Viatour, P., Merville, M.P., Bours, V., Chariot, A., 2005. Phosphorylation of NF-κB and IκB proteins: implications in cancer and inflammation. Trends Biochem. Sci. 30, 43–52. Wang, J., Zhao, H., Kong, W., Jin, C., Zhao, Y., Qu, Y., Xiao, X., 2010. Microcalorimetric assay on the antimicrobial property of five hydroxyanthraquinone derivatives in rhubarb (Rheum palmatum L.) to Bifidobacterium adolescentis. Phytomedicine 17, 684–689. Yang, L., Chen, Q., Wang, F., Zhang, G., 2011. Antiosteoporotic compounds from seeds of Cuscuta chinensis. J. Ethnopharmacol. 135, 553–560. Zheng, H., Hu, J., Zheng, Z., Huang, L., Chen, Y., Zheng, J., Chen, X., Lv, L., 2007. Emodin induces leukemic HL-60 cells apoptosis probably by inhibiting Akt signal pathway. Acta Pharm. Sin. 42, 1142. Zhu, B., Lin, Y., Zhu, C.F., Zhu, X.L., Huang, C.Z., Lu, Y., Cheng, X.X., Wang, Y.J., 2011. Emodin inhibits extracellular matrix synthesis by suppressing p38 and ERK1/2 pathways in TGF-β1-stimulated NRK-49F cells. Mol. Med. Rep. 4, 505–509.
Please cite this article as: Hu, B., et al., Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.03.059i