- Email: [email protected]
Amplification and cloning of a long RNA virus genome using immunocapture-long RT-PCR
Journal of Virological Methods Journal of Virological Methods 66 (1997) 159- 163
Short communication
Amplification
and cloning of a long RNA virus genome using immunocapture-long RT-PCR
Alicia Romero a, Begofia Blanco-Urgoiti
‘To,Fernando
Ponz ‘,*
it Laboratorio de Biologia Molecular y Virologia Vegetal, CIT-INIA, Autopista A6, km 7, 28040 Madrid, Spain b CIMA-Arkaute,
Vitoria, Alava, Spain
Accepted 24 February 1997
Abstract A rapid and easy method was developed in order to amplify long fragments of the genome of potato virus Y (PVY), a virus possesing a IO-kb genomic RNA. The method of immunocapture-RT-PCR was adapted, by using thermostable DNA polymerases with proofreading activity and the proper buffers and cycles, to amplify almost the whole genome of PVY in two fragments (5.6 and 4.3 kb) without purifying virions nor viral RNA. Both fragments were cloned subsequently and their ends sequenced. The method is applicable to the rapid cloning and molecular characterization of the genomes of many other RNA viruses. 0 1997 Elsevier Science B.V. Keywords:
Immunocapture;
Long RT-PCR;
PVY
The construction of cDNA clones of part or the complete genome of RNA viruses is a sound approach to study viral structure, pathogenicity and evolution. In the case of viruses with large RNA genomes, such as potyviruses, it is difficult to obtain and handle cDNA fragments of the whole genome or even long fragments. Usually, long clones are obtained after laborious purifica* Corresponding
author. Tel: + 34 1 3476887; fax: + 34 1
3573 107; email: [email protected] 0166-0934/97/$17.00
0 1997 Elsevier Science
PII SO 166-0934(97)00043-8
B.V. All rights
reserved.
tion of virions and RNA, which, additionally, do not yield large amounts (Turpen, 1989; Nicolas and Lalibertt, 1991). Potato virus Y (PVY) is the type species of the Potyuirus genus in the family Potyviridae (Shukla et al., 1994). PVY has flexuous particles which contain a single-stranded genomic RNA of about 10000 nucleotides with a viral protein convalently linked to the 5’ end and a poly(A) tail at the 3’ end. The synthesis of the cDNA of a virus genome usually requires a large amount of purified RNA
A. Romero et al. /Journal
160
S’$TR-forward
(2 1)
of Virological Methods 66 (1997) 159- 163
Cl-fyard
(5403)
Pl Cl-reverse (5696) 5’-5.6kb
3’ UTRreverse (9425)
,,,_‘=“’ _I___
1.1
3’-4.1 kb
oligo-
dT
1.1..
3’-4.3kb
.I_ 5’-1.65kb
Fig. 1. The position of the primers used to amplify the PVY genome. The position of the first nucleotide of each primer is indicated in parenthesis. PCR fragments obtained with the primers are also schematically drawn below. Dashed lines indicate sequenced regions of each fragment. The diagrams are not to-scale.
(Le Gall et al., 1988), but it is difficult to obtain sufficient viral RNA. The polymerase chain reaction (RT-PCR) allows the use of relative small amounts of RNA, but it does not avoid the need to purifiy a very clean RNA (MacFarlane, 1996). In most cases, Taq DNA polymerase is used as the amplifying enzyme. However, this enzyme is not the most appropriate for amplifying long fragments, because it lacks a proofreading activity, and the misincorporation of nucleotides reduces the yield of long fragments (Dunning et al., 1988). Small amounts of enzymes with proofreading activity, such as Pfu, Vent or Deep Vent DNA polymerases, added to Tuq DNA polymerase, or another amplifying enzyme such as rTrh DNA polymerase have been used to improve the amplification of long DNA fragments without misincorporations (Barnes, 1994; Cheng et al., 1994; Nielson et al., 1994; MacFarlane, 1996). A diagnostic method based on immunocaptureRT-PCR has been described by Nolasco et al. (1993). In this paper, we describe a modification of this method, adapted to amplify long fragments of PVY by using rTth XL DNA polymerase (Perkin Elmer) or TaqPZus Long polymerase mixture (Stratagene). Using this approach, we cloned almost the complete genome of PVY in two fragments (5.6 and 4.3 kb) without first needing to purify virions nor RNA. The method is also applicable to the molecular characterization of the genomes of many other RNA viruses.
The isolates of PVY used were PVY-P21 from pepper (pathotype 0; Soto et al., 1994) and PVYc Gelderse Rode (unpublished, PVY collection of CIMA-Arkaute) from potato, both maintained and propagated in Nicotiana tabacum cv. Xhantii nc. Immunocapture was done as described by Nolasco et al. (1993) using the PVY monoclonal antibody lOE3 from Ingenasa (Perez de San Roman et al., 1987; Sanz et al., 1990). RNA was reverse transcribed in a microtiter plate (Nunc-immuno U96, Nunc), using Superscript Reverse Transcriptase (Gibco BRL) in 50 mM Tris (pH 8.3) 75 mM potasium acetate and 3 mM magnesium acetate in a final reaction volume of 20 ,ul. PCR was performed in MicroAmp reaction tubes (Perkin Elmer Cetus) without mineral oil, using a Perkin Elmer Cetus Gene-Amp PCR System 9600. The reaction contained 10 ~1 RT reaction mixture, 15.2 ~1 of 3.3 x rTth XL buffer (Perkin Elmer), 1.1 mM magnesium acetate, 0.4 mM each dNTP, 0.2 PM each primer and 2 units rTth XL DNA polymerase (Perkin Elmer) in a final volume of 50 ~1. When TaqPlus Long polymerase mixture (Stratagene) was used, the mixture contained the same components, except the buffer, which was the high-salt buffer supplied by manufacturers (5 ~1 of 10 x ). Primers for three genomic fragments were designed: 4.1 and 4.3 kb from the 3’ end and 5.6 kb from the 5’ end of the PVY genome, rendering amplification products overlapping by 293 nucleotides (Fig. 1). To amplify the 3’-4.3-kb fragment, oligo-dT,, (Amer-
A. Romero
rt al. /Journal
qf Virological
sham) anchored with two degenerated nucleotides and (J-forward primer (5’ CACTCTTA1‘). GAGCTAGATATGC) were used (Fig. Similarly, to amplify the 3’-4.1-kb fragment, 3’ UTR-reverse primer (5’ TAAAAGTAGTACAGGAAAAGCCA; Blanco-Urgoiti et al., 1996) and CI-forward primer were used. To design the CIforward primer, the cytoplasmic inclusion gene of the isolate PVY-P21 was sequenced (Soto et al., unpublished results). The first five cycles consisted of an annealing step of 1 min at 39°C an elongation step of 4 min at 72°C and a denaturation step of 1 min at 94°C followed by 30 similar cycles, but with the denaturation step of 20 s. A final cycle with an elongation step of 10 min ended the run. The amplification product was analyzed by electrophoresis in 0.8% agarose minigels. The results are shown in Fig. 2, lanes 2 (4.1-kb fragment) and 3 (4.3-kb fragment). One fifth of the amplification reaction was loaded onto the gel. to the The results represented in Fig. 2 correspond
5.6 4.3 4.1
r
1.65
Fig. 2. Agarose gel electrophoresis of the PCR amplified products from immunocdptured PVY. Lanes: I, molecular weight markers; 2, 3’UTR-reverse and CI-forward primers; 3. Oligo-dT and CI-forward primers; 4, Cl-reverse and S’UTRforward primers. Molecular sizes of the amplified fragments are indicated on the left in kilobases.
Methods
66 (1997)
159- 163
IhI
amplification with rTth XL DNA polymerase. The same fragments were obtained with TuqPlus Long polymerase mixture (not shown). In the case of the 5’-5.6 kb fragment, a 5’ UTR-forward primer (5’ AACATAAGAAAAACAACGCAAAAACACTCACAAAC) and a CIreverse primer (5’ CCCTTGGTGATGCACAAGTTTCAACTG) were used (Fig. 1). The sequence of the 5’ UTR-forward primer was chosen by comparing the published sequences of 5’ UTR regions of PVY (Tordo et al., 1995) and selecting the most conserved region. CI-reverse primer was derived from the sequence of the terminal regions of the 4. I-kb amplified fragment. The 30 amplification cycles consisted of 1 min at 62°C 8 min at 72°C and 30 s at 92°C. One fifth of the amplification reaction was loaded onto an agarose gel and the result is shown in Fig. 2 (lane 4). In this case, two amplified bands appeared, 5.6 and 1.6 kb. Again, the results with rTth XL DNA polymerase are represented and the same fragments were obtained with TuqPlus Long polymerase mixture (not shown). The amplification mixtures were used for cloning the different fragments covering almost the whole genome of PVY. Ten microliters of amplification reaction were loaded onto a MicroSpin Sephacryl S-200 HR column (Pharmacia Biotech) to eliminate primers, dNTPs and buffer and subsequently treated with T4 polynucleotide kinase (Promega), before ligation with 100 ng of pUC13 digested with SmclI or HincII and treatment with alkaline phosphatase. Escherichiu coli strain DHSc( competent cells were transformed with the ligation reaction. In the case of the amplification of the 5’ region (Fig. 2, lane 4) each fragment (5.6 and 1.6 kb) was purified from the agarose gel by the CTAB method (Langridge et al., 1980). Recombinant clones were analized using the alkaline lysis method and the 5’ and 3’ terminal ends of the amplified fragments were sequenced using a Sequenase kit version 2.0 (Amersham), to confirm their identity. Sequenced regions of each fragment are indicated in Fig. 1. Cloning and sequencing of the 1.6 kb fragment amplified with S’UTR-forward primer :dnd CIreverse primer (Fig. 2, lane 4) revealed that it
162
A. Romero
et al. /Journal
qf‘ Virological
corresponded to positions 21- 1665 in the PVY genome (Robaglia et al., 1989; Fig. 1). The region surrounding position 1665 in the two isolates used in this study has not been sequenced. In comparison with the sequence published by Robaglia et al. (1989), the CI-reverse primer annealed in that position in 11 nt, most of them at the 3’ end of the primer. Taking into account that reverse transcription is performed at 37-42”C, that annealing can be enough to initiate the synthesis. Thus, a simple method is described to amplify long viral genome fragments, without viral RNA purification. As far as we are aware, these are the longest reported fragments amplified by IC-RTPCR. A 5 kb cDNA representing the 3’-half of PVY genome has been published (Hidaka et al., 1992), but this cDNA was made from purified PVY RNA, without using enzymatic amplification techniques. Handling long RNA genomes is difficult, specially during purification, because of nonspecific degradation by RNAses and mechanical breaking of the virions. By virion immunocapture from crude plant extracts, handling of virions and RNA is avoided. Additionally, the absence of contaminating nucleic acid material or RT-PCR inhibitory elements in the purified RNA prior to amplification is very important. Immunocaptured extracts are highly enriched in viral RNAs without inhibiting contaminants. This method can be specially useful in those cases in which even virion purification is laborious and/or difficult, such as potyviruses, closteroviruses, etc. (Brunt et al., 1996). Long RT-PCR can be useful for rapid cloning of viral genomes, prior to sequencing or the construction of a cDNA clone. The use of r Tth DNA Polymerase XL and of the TagPlus Long polymerase mixture, with the proper buffers and cycles, allows the amplification of long fragments with high fidelity due to their proofreading activity (Cheng et al., 1994). Two isolates of PVY have been used, the S-end sequence of their genomes is not known. In order to design a correct primer, IC-RT-PCR may be used to amplify the 5’-end by RACE (rapid amplification of cDNA ends, Frohman et al., 1988). Sequence information derived from the 5’ IC-RT-RACE and 3’ IC-long RT-PCR clones can then be used to design proper
Methods
66 (1997) 159-163
5’ and 3’ primers to amplify full-length cDNA or, as in this paper, two half-full-length fragments that can be combined to create an infectious clone under the proper promoter sequences. Another potential use of this method is genetic characterization of viral strains by restriction fragment length polymorphisms (RFLP), as developed by Blanco-Urgoiti et al. (1996) for the coat protein gene of PVY. We used IC-RT-PCR for rapid amplification of a small (879 nt) fragment of PVY RNA. The RFLP analysis of the fragments allowed the estimation of genetic distances between isolates, so as to define the genetic structure behind the present classification of virus strains. With IC followed by long RT-PCR, a study of longer fragments of the genome or even the whole genome can be also approached. In this way, information about variability in the different parts of PVY genome would be integrated in the estimation of the genetic distances between isolates. The method of IC-RT-PCR has been used in our laboratory for a wide variety of RNA viruses (Nolasco et al., 1993; Rodriguez et al., 1994; Estepa et al., 1995). With the modifications described above, the long version of the method, it can be adapted for the study of any other plant or animal virus with an RNA genome.
Acknowledgements
Useful advice from Drs F. Sgnchez, M. Agiiero (INIA) and A. Bradley (Perkin-Elmer Hispania) are acknowledged. This work was supported by INIA (grant SC94-105). Alicia Romero and Begoiia Blanco-Urgoiti are holders of fellowships from INIA and Basque Government, respectively.
References Barnes, W.M. (1994) PCR amplification of up to 35-kb DNA with high fidelity and high yield from /i bacteriophage templates. Proc. Nat]. Acad. Sci. USA 91, 2216-2220. Blanco-Urgoiti, B., Sinchez, F., Dopazo, J. and Ponz, F. (1996) A strain-type clustering of potato virus Y based on the genetic distance between isolates calculated by RFLP analysis of the amplified coat protein gene. Arch. Viral. 141, 2425-2442.
A. Romero et (11./Journal
oj’ Virological Methods 66 (1997) 159- 163
Brunt, .A.A., Crabtree, K., Dallwitz, M.J., Gibbs, A.J. and Watson, L. (1996) Viruses of Plants. CAB international, Wallingford. Cheng, S.. Fockler, C., Barnes, W.M. and Higuchi, R. (1994) Effective amplification of long targets from cloned inserts and human genomic DNA. Proc. Nat]. Acad. Sci. USA 91, 569555699. Dunning, A.M., Talmud, P. and Humphries, S.E. (1988) Errors in the polymerase chain reaction. Nucleic Acids Res. 16. 10393. Estepa, A., De Bias. C., Ponz, F. and Coil, J.M. (1995) Detection of trout haemorragic septicaemia rhabdovirus by capture with monoclonal antibodies and amplification with PCR. Bull. Eur. Ass. Fish Pathol. 15, 49-53. Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production of full-lenght cDNAs from rare transcripts: amplification using a simple gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998-9002. Hidaka, M., Yoshida, Y.. Masaki, H., Namba, S., Yamashita, S.. Tsuchizaki, T. and Uozumi, T. (1992) Cloning and sequencing of the 3’ half of a potato virus Y (0 strain) genome encoding the 5k protein, protease, polymerase and coat protein. Nucleic Acids Res. 20, 3515. Langridge. J.. Langridge. P. and Bergquist, P.L. (1980) Extrdction of nucleic acids from agarose gels. Anal. Biochem. 103, 2644271. Le Gall, 0.. Candresse, T., Brault, V., Bretout, C., Hibrand, L. and Dunez, J. (1988) Cloning full-length cDNA of grapevine chrome mosaic nepovirus. Gene 73, 67-75. MacFarlane, S.A. (1996) Rapid cloning of uncharacterized tobacco rattle virus isolates using long template (LT) PCR. J. Viral. Meth. 56, 91-98. Nicolas, 0. and Laliberte, J.F. (1991) The use of PCR for clonmg of large cDNA fragments of turnip mosaic potyvirus. J. Virol. Meth. 32, 57-66. Nielson. K.. Scott. B.. Bauer, J.C. and Kretz, K. (1994)
163
TaqPlus DNA polymerase for more robust PCR. Strategies 7, 64-65. Nolasco, G., De Bias, C., Torres. V. and Ponz, F. (1993) A method combining immunocapture and PCR amplification in a microtiter plate for the detection of plant viruses and subviral pathogens. J. Virol. Meth. 45, 201.~ 218. Perez de San Roman, C., Legorburu, J.. Sanz, A., Vela. C. and Cambra, M. (1987) Serotyping of PVY and PVX with monoclonal antibodies. Potato Res. 30, 166. Robaglia, C., Durand-Tardif, M., Trouchet, M., Bozadin, G. and Astier-Manifacier, S. (1989). Nucleotide sequence of potato virus Y (N strain) genomic DNA. J. Gen. Virol. 70, 9355947. Rodriguez, A., Nufiez, J.I., Nolasco, G., Ponz, F., Sobrino, F. and Bias, C. (1994) Direct PCR detection of foot- andmouth disease virus. J. Virol. Meth. 47, 345~ 349. Sam, A., Cambra, M., Perez de San Roman, Miguet. J.G.. Cortes, E., Gorris, M.T. and Vela, C. (1990) Preparation of additional monoclonal antibodies for detection and discrimination of potato virus Y isolates infecting potato. Potato Res. 33, 3655375. Shukla, D.D., Ward, C.W. and Brunt. A.A. ( 1994) The Potyviridae. CAB International, Wallingford. Soto, M.J., Luis Artedga, M.. Fereres. A. and Ponz, F. (1994) Limited degree of serological variability in pepper strains of potato virus Y as revealed by analysis with monoclonal antibodies. Ann. Appl. Biol. 124, 37743. Tordo. V., Chachulska, A.M.. Fakhfakh, H., Le Romancer, M., Robaglia C. and Astier-Manifacier (1995) Sequence polymorphism in the S’NTR and in the PI coding region of potato virus Y genomic RNA. J. Gen. Virol. 76. 939-949. Turpen, T. (1989) Molecular cloning of a potato virus Y genome: nucleotide sequence homology in non-coding regions of potyviruses. J. Gen. Viral. 70. 1951 1960.
Short communication
Amplification
and cloning of a long RNA virus genome using immunocapture-long RT-PCR
Alicia Romero a, Begofia Blanco-Urgoiti
‘To,Fernando
Ponz ‘,*
it Laboratorio de Biologia Molecular y Virologia Vegetal, CIT-INIA, Autopista A6, km 7, 28040 Madrid, Spain b CIMA-Arkaute,
Vitoria, Alava, Spain
Accepted 24 February 1997
Abstract A rapid and easy method was developed in order to amplify long fragments of the genome of potato virus Y (PVY), a virus possesing a IO-kb genomic RNA. The method of immunocapture-RT-PCR was adapted, by using thermostable DNA polymerases with proofreading activity and the proper buffers and cycles, to amplify almost the whole genome of PVY in two fragments (5.6 and 4.3 kb) without purifying virions nor viral RNA. Both fragments were cloned subsequently and their ends sequenced. The method is applicable to the rapid cloning and molecular characterization of the genomes of many other RNA viruses. 0 1997 Elsevier Science B.V. Keywords:
Immunocapture;
Long RT-PCR;
PVY
The construction of cDNA clones of part or the complete genome of RNA viruses is a sound approach to study viral structure, pathogenicity and evolution. In the case of viruses with large RNA genomes, such as potyviruses, it is difficult to obtain and handle cDNA fragments of the whole genome or even long fragments. Usually, long clones are obtained after laborious purifica* Corresponding
author. Tel: + 34 1 3476887; fax: + 34 1
3573 107; email: [email protected] 0166-0934/97/$17.00
0 1997 Elsevier Science
PII SO 166-0934(97)00043-8
B.V. All rights
reserved.
tion of virions and RNA, which, additionally, do not yield large amounts (Turpen, 1989; Nicolas and Lalibertt, 1991). Potato virus Y (PVY) is the type species of the Potyuirus genus in the family Potyviridae (Shukla et al., 1994). PVY has flexuous particles which contain a single-stranded genomic RNA of about 10000 nucleotides with a viral protein convalently linked to the 5’ end and a poly(A) tail at the 3’ end. The synthesis of the cDNA of a virus genome usually requires a large amount of purified RNA
A. Romero et al. /Journal
160
S’$TR-forward
(2 1)
of Virological Methods 66 (1997) 159- 163
Cl-fyard
(5403)
Pl Cl-reverse (5696) 5’-5.6kb
3’ UTRreverse (9425)
,,,_‘=“’ _I___
1.1
3’-4.1 kb
oligo-
dT
1.1..
3’-4.3kb
.I_ 5’-1.65kb
Fig. 1. The position of the primers used to amplify the PVY genome. The position of the first nucleotide of each primer is indicated in parenthesis. PCR fragments obtained with the primers are also schematically drawn below. Dashed lines indicate sequenced regions of each fragment. The diagrams are not to-scale.
(Le Gall et al., 1988), but it is difficult to obtain sufficient viral RNA. The polymerase chain reaction (RT-PCR) allows the use of relative small amounts of RNA, but it does not avoid the need to purifiy a very clean RNA (MacFarlane, 1996). In most cases, Taq DNA polymerase is used as the amplifying enzyme. However, this enzyme is not the most appropriate for amplifying long fragments, because it lacks a proofreading activity, and the misincorporation of nucleotides reduces the yield of long fragments (Dunning et al., 1988). Small amounts of enzymes with proofreading activity, such as Pfu, Vent or Deep Vent DNA polymerases, added to Tuq DNA polymerase, or another amplifying enzyme such as rTrh DNA polymerase have been used to improve the amplification of long DNA fragments without misincorporations (Barnes, 1994; Cheng et al., 1994; Nielson et al., 1994; MacFarlane, 1996). A diagnostic method based on immunocaptureRT-PCR has been described by Nolasco et al. (1993). In this paper, we describe a modification of this method, adapted to amplify long fragments of PVY by using rTth XL DNA polymerase (Perkin Elmer) or TaqPZus Long polymerase mixture (Stratagene). Using this approach, we cloned almost the complete genome of PVY in two fragments (5.6 and 4.3 kb) without first needing to purify virions nor RNA. The method is also applicable to the molecular characterization of the genomes of many other RNA viruses.
The isolates of PVY used were PVY-P21 from pepper (pathotype 0; Soto et al., 1994) and PVYc Gelderse Rode (unpublished, PVY collection of CIMA-Arkaute) from potato, both maintained and propagated in Nicotiana tabacum cv. Xhantii nc. Immunocapture was done as described by Nolasco et al. (1993) using the PVY monoclonal antibody lOE3 from Ingenasa (Perez de San Roman et al., 1987; Sanz et al., 1990). RNA was reverse transcribed in a microtiter plate (Nunc-immuno U96, Nunc), using Superscript Reverse Transcriptase (Gibco BRL) in 50 mM Tris (pH 8.3) 75 mM potasium acetate and 3 mM magnesium acetate in a final reaction volume of 20 ,ul. PCR was performed in MicroAmp reaction tubes (Perkin Elmer Cetus) without mineral oil, using a Perkin Elmer Cetus Gene-Amp PCR System 9600. The reaction contained 10 ~1 RT reaction mixture, 15.2 ~1 of 3.3 x rTth XL buffer (Perkin Elmer), 1.1 mM magnesium acetate, 0.4 mM each dNTP, 0.2 PM each primer and 2 units rTth XL DNA polymerase (Perkin Elmer) in a final volume of 50 ~1. When TaqPlus Long polymerase mixture (Stratagene) was used, the mixture contained the same components, except the buffer, which was the high-salt buffer supplied by manufacturers (5 ~1 of 10 x ). Primers for three genomic fragments were designed: 4.1 and 4.3 kb from the 3’ end and 5.6 kb from the 5’ end of the PVY genome, rendering amplification products overlapping by 293 nucleotides (Fig. 1). To amplify the 3’-4.3-kb fragment, oligo-dT,, (Amer-
A. Romero
rt al. /Journal
qf Virological
sham) anchored with two degenerated nucleotides and (J-forward primer (5’ CACTCTTA1‘). GAGCTAGATATGC) were used (Fig. Similarly, to amplify the 3’-4.1-kb fragment, 3’ UTR-reverse primer (5’ TAAAAGTAGTACAGGAAAAGCCA; Blanco-Urgoiti et al., 1996) and CI-forward primer were used. To design the CIforward primer, the cytoplasmic inclusion gene of the isolate PVY-P21 was sequenced (Soto et al., unpublished results). The first five cycles consisted of an annealing step of 1 min at 39°C an elongation step of 4 min at 72°C and a denaturation step of 1 min at 94°C followed by 30 similar cycles, but with the denaturation step of 20 s. A final cycle with an elongation step of 10 min ended the run. The amplification product was analyzed by electrophoresis in 0.8% agarose minigels. The results are shown in Fig. 2, lanes 2 (4.1-kb fragment) and 3 (4.3-kb fragment). One fifth of the amplification reaction was loaded onto the gel. to the The results represented in Fig. 2 correspond
5.6 4.3 4.1
r
1.65
Fig. 2. Agarose gel electrophoresis of the PCR amplified products from immunocdptured PVY. Lanes: I, molecular weight markers; 2, 3’UTR-reverse and CI-forward primers; 3. Oligo-dT and CI-forward primers; 4, Cl-reverse and S’UTRforward primers. Molecular sizes of the amplified fragments are indicated on the left in kilobases.
Methods
66 (1997)
159- 163
IhI
amplification with rTth XL DNA polymerase. The same fragments were obtained with TuqPlus Long polymerase mixture (not shown). In the case of the 5’-5.6 kb fragment, a 5’ UTR-forward primer (5’ AACATAAGAAAAACAACGCAAAAACACTCACAAAC) and a CIreverse primer (5’ CCCTTGGTGATGCACAAGTTTCAACTG) were used (Fig. 1). The sequence of the 5’ UTR-forward primer was chosen by comparing the published sequences of 5’ UTR regions of PVY (Tordo et al., 1995) and selecting the most conserved region. CI-reverse primer was derived from the sequence of the terminal regions of the 4. I-kb amplified fragment. The 30 amplification cycles consisted of 1 min at 62°C 8 min at 72°C and 30 s at 92°C. One fifth of the amplification reaction was loaded onto an agarose gel and the result is shown in Fig. 2 (lane 4). In this case, two amplified bands appeared, 5.6 and 1.6 kb. Again, the results with rTth XL DNA polymerase are represented and the same fragments were obtained with TuqPlus Long polymerase mixture (not shown). The amplification mixtures were used for cloning the different fragments covering almost the whole genome of PVY. Ten microliters of amplification reaction were loaded onto a MicroSpin Sephacryl S-200 HR column (Pharmacia Biotech) to eliminate primers, dNTPs and buffer and subsequently treated with T4 polynucleotide kinase (Promega), before ligation with 100 ng of pUC13 digested with SmclI or HincII and treatment with alkaline phosphatase. Escherichiu coli strain DHSc( competent cells were transformed with the ligation reaction. In the case of the amplification of the 5’ region (Fig. 2, lane 4) each fragment (5.6 and 1.6 kb) was purified from the agarose gel by the CTAB method (Langridge et al., 1980). Recombinant clones were analized using the alkaline lysis method and the 5’ and 3’ terminal ends of the amplified fragments were sequenced using a Sequenase kit version 2.0 (Amersham), to confirm their identity. Sequenced regions of each fragment are indicated in Fig. 1. Cloning and sequencing of the 1.6 kb fragment amplified with S’UTR-forward primer :dnd CIreverse primer (Fig. 2, lane 4) revealed that it
162
A. Romero
et al. /Journal
qf‘ Virological
corresponded to positions 21- 1665 in the PVY genome (Robaglia et al., 1989; Fig. 1). The region surrounding position 1665 in the two isolates used in this study has not been sequenced. In comparison with the sequence published by Robaglia et al. (1989), the CI-reverse primer annealed in that position in 11 nt, most of them at the 3’ end of the primer. Taking into account that reverse transcription is performed at 37-42”C, that annealing can be enough to initiate the synthesis. Thus, a simple method is described to amplify long viral genome fragments, without viral RNA purification. As far as we are aware, these are the longest reported fragments amplified by IC-RTPCR. A 5 kb cDNA representing the 3’-half of PVY genome has been published (Hidaka et al., 1992), but this cDNA was made from purified PVY RNA, without using enzymatic amplification techniques. Handling long RNA genomes is difficult, specially during purification, because of nonspecific degradation by RNAses and mechanical breaking of the virions. By virion immunocapture from crude plant extracts, handling of virions and RNA is avoided. Additionally, the absence of contaminating nucleic acid material or RT-PCR inhibitory elements in the purified RNA prior to amplification is very important. Immunocaptured extracts are highly enriched in viral RNAs without inhibiting contaminants. This method can be specially useful in those cases in which even virion purification is laborious and/or difficult, such as potyviruses, closteroviruses, etc. (Brunt et al., 1996). Long RT-PCR can be useful for rapid cloning of viral genomes, prior to sequencing or the construction of a cDNA clone. The use of r Tth DNA Polymerase XL and of the TagPlus Long polymerase mixture, with the proper buffers and cycles, allows the amplification of long fragments with high fidelity due to their proofreading activity (Cheng et al., 1994). Two isolates of PVY have been used, the S-end sequence of their genomes is not known. In order to design a correct primer, IC-RT-PCR may be used to amplify the 5’-end by RACE (rapid amplification of cDNA ends, Frohman et al., 1988). Sequence information derived from the 5’ IC-RT-RACE and 3’ IC-long RT-PCR clones can then be used to design proper
Methods
66 (1997) 159-163
5’ and 3’ primers to amplify full-length cDNA or, as in this paper, two half-full-length fragments that can be combined to create an infectious clone under the proper promoter sequences. Another potential use of this method is genetic characterization of viral strains by restriction fragment length polymorphisms (RFLP), as developed by Blanco-Urgoiti et al. (1996) for the coat protein gene of PVY. We used IC-RT-PCR for rapid amplification of a small (879 nt) fragment of PVY RNA. The RFLP analysis of the fragments allowed the estimation of genetic distances between isolates, so as to define the genetic structure behind the present classification of virus strains. With IC followed by long RT-PCR, a study of longer fragments of the genome or even the whole genome can be also approached. In this way, information about variability in the different parts of PVY genome would be integrated in the estimation of the genetic distances between isolates. The method of IC-RT-PCR has been used in our laboratory for a wide variety of RNA viruses (Nolasco et al., 1993; Rodriguez et al., 1994; Estepa et al., 1995). With the modifications described above, the long version of the method, it can be adapted for the study of any other plant or animal virus with an RNA genome.
Acknowledgements
Useful advice from Drs F. Sgnchez, M. Agiiero (INIA) and A. Bradley (Perkin-Elmer Hispania) are acknowledged. This work was supported by INIA (grant SC94-105). Alicia Romero and Begoiia Blanco-Urgoiti are holders of fellowships from INIA and Basque Government, respectively.
References Barnes, W.M. (1994) PCR amplification of up to 35-kb DNA with high fidelity and high yield from /i bacteriophage templates. Proc. Nat]. Acad. Sci. USA 91, 2216-2220. Blanco-Urgoiti, B., Sinchez, F., Dopazo, J. and Ponz, F. (1996) A strain-type clustering of potato virus Y based on the genetic distance between isolates calculated by RFLP analysis of the amplified coat protein gene. Arch. Viral. 141, 2425-2442.
A. Romero et (11./Journal
oj’ Virological Methods 66 (1997) 159- 163
Brunt, .A.A., Crabtree, K., Dallwitz, M.J., Gibbs, A.J. and Watson, L. (1996) Viruses of Plants. CAB international, Wallingford. Cheng, S.. Fockler, C., Barnes, W.M. and Higuchi, R. (1994) Effective amplification of long targets from cloned inserts and human genomic DNA. Proc. Nat]. Acad. Sci. USA 91, 569555699. Dunning, A.M., Talmud, P. and Humphries, S.E. (1988) Errors in the polymerase chain reaction. Nucleic Acids Res. 16. 10393. Estepa, A., De Bias. C., Ponz, F. and Coil, J.M. (1995) Detection of trout haemorragic septicaemia rhabdovirus by capture with monoclonal antibodies and amplification with PCR. Bull. Eur. Ass. Fish Pathol. 15, 49-53. Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production of full-lenght cDNAs from rare transcripts: amplification using a simple gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998-9002. Hidaka, M., Yoshida, Y.. Masaki, H., Namba, S., Yamashita, S.. Tsuchizaki, T. and Uozumi, T. (1992) Cloning and sequencing of the 3’ half of a potato virus Y (0 strain) genome encoding the 5k protein, protease, polymerase and coat protein. Nucleic Acids Res. 20, 3515. Langridge. J.. Langridge. P. and Bergquist, P.L. (1980) Extrdction of nucleic acids from agarose gels. Anal. Biochem. 103, 2644271. Le Gall, 0.. Candresse, T., Brault, V., Bretout, C., Hibrand, L. and Dunez, J. (1988) Cloning full-length cDNA of grapevine chrome mosaic nepovirus. Gene 73, 67-75. MacFarlane, S.A. (1996) Rapid cloning of uncharacterized tobacco rattle virus isolates using long template (LT) PCR. J. Viral. Meth. 56, 91-98. Nicolas, 0. and Laliberte, J.F. (1991) The use of PCR for clonmg of large cDNA fragments of turnip mosaic potyvirus. J. Virol. Meth. 32, 57-66. Nielson. K.. Scott. B.. Bauer, J.C. and Kretz, K. (1994)
163
TaqPlus DNA polymerase for more robust PCR. Strategies 7, 64-65. Nolasco, G., De Bias, C., Torres. V. and Ponz, F. (1993) A method combining immunocapture and PCR amplification in a microtiter plate for the detection of plant viruses and subviral pathogens. J. Virol. Meth. 45, 201.~ 218. Perez de San Roman, C., Legorburu, J.. Sanz, A., Vela. C. and Cambra, M. (1987) Serotyping of PVY and PVX with monoclonal antibodies. Potato Res. 30, 166. Robaglia, C., Durand-Tardif, M., Trouchet, M., Bozadin, G. and Astier-Manifacier, S. (1989). Nucleotide sequence of potato virus Y (N strain) genomic DNA. J. Gen. Virol. 70, 9355947. Rodriguez, A., Nufiez, J.I., Nolasco, G., Ponz, F., Sobrino, F. and Bias, C. (1994) Direct PCR detection of foot- andmouth disease virus. J. Virol. Meth. 47, 345~ 349. Sam, A., Cambra, M., Perez de San Roman, Miguet. J.G.. Cortes, E., Gorris, M.T. and Vela, C. (1990) Preparation of additional monoclonal antibodies for detection and discrimination of potato virus Y isolates infecting potato. Potato Res. 33, 3655375. Shukla, D.D., Ward, C.W. and Brunt. A.A. ( 1994) The Potyviridae. CAB International, Wallingford. Soto, M.J., Luis Artedga, M.. Fereres. A. and Ponz, F. (1994) Limited degree of serological variability in pepper strains of potato virus Y as revealed by analysis with monoclonal antibodies. Ann. Appl. Biol. 124, 37743. Tordo. V., Chachulska, A.M.. Fakhfakh, H., Le Romancer, M., Robaglia C. and Astier-Manifacier (1995) Sequence polymorphism in the S’NTR and in the PI coding region of potato virus Y genomic RNA. J. Gen. Virol. 76. 939-949. Turpen, T. (1989) Molecular cloning of a potato virus Y genome: nucleotide sequence homology in non-coding regions of potyviruses. J. Gen. Viral. 70. 1951 1960.