- Email: [email protected]
An efficient laboratory made apparatus for DNA amplification
Journal of Biochemical and Biophysical Methods, 18 (1989) 227-236 Elsevier
227
BBM 00734
An efficient laboratory made apparatus for DNA amplification Olivier Bertrand 1, Marie-H616ne Delfau z, Michel Garbarz Christiane Picat 1, Isabelle Devaux 1, Didier D h e r m y 1, Pierre Boivin 1 and Bernard G r a n d c h a m p 2
1
J I N S E R M U.160, H9pital Beaujon, 92118 Clichy Cedex, France and 2 Laboratoire de Gdndtique Moldculaire, Facultd de Mddecine Xavier Bichat, 75018 Paris, France
(Received I November 1988) (Accepted 24 January 1989)
Summa~ D N A amplification by the polymerase chain reaction (PCR) is a method capable of producing a selective and very high enrichment of a specific D N A sequence. Hence it seems to be useful in various fields from basic research to clinical applications. In order to automatize P C R we assembled for a very low cost a mechanical system designed to carry a test tube holder successively in three thermal baths set at the required temperatures for the reaction. Two examples of the use of this machine are given: (i) amplification of D N A of a particular subtype of acute intermittent porphyria; (ii) the detection of the chimeric c - a b l / b c r message found in chronic myelogenous leukemia cells. Key words: D N A amplification; Taq polymerase; Polymerase chain reaction
Introduction In vitro DNA amplification by the polymerase chain reaction (PCR) is a method capable of producing a selective enrichment of a specific DNA sequence by a factor of 1 0 6 [1]. PCR amplification involves (1) a pair of oligonucleotide primers that flank the DNA segment to be amplified; (2) repeated cycles of heat denaturation of the DNA, annealing of the oligonucleotides to their complementary sequences, and extension of the primer with DNA polymerase. Each successive cycle doubles the amount of DNA synthesized in the previous cycles. The use of a thermostable DNA polymerase isolated from Thermus aquaticus (Taq polymerase) avoids the need to Correspondence address: O. Bertrand, I N S E R M U160, Hbpital Beaujon, 92118 Clichy Cedex, France. 0165-022X/89/$03.50 © 1989 Elsevier Science Publishers B.V. (Biomedical Division)
228
add fresh emzyrne at each cycle, thus simplifying the phoce we [2]. In order to CR we chose to bu echatical system designed to carry a test tube holder successively in t baths set at the required temperatures for the reaction. Provision was t the time of residence in each bath as well as the total number of cycks were easily set. ‘We have used this me sets of experiments for which DNA amplification had previously been aboratory by the standard method requiring the manual operation: (i) cation of DNA from patients with a particular subtype of acute intermittent porphyria (AIP), an autosomaP inherited disease. This subtype corresponds to a mutation previously i n the porphobilinogen deaminase gene as a single base substitution (GTcanonical 5’-splice donor si?e of intron B [3]; (ii) the amplification of the chimetic c-abl/bcr message found in chronic myelogenous Leukemia (GML) cells [4].
This part is made essentially of two para%lel horizontal circular plates (Figs. 1 and 2). The upper plate is fked to the sh (vertically) a pneumatic cylinder
)
@.
Muowtch
, activated by the screws fixed to the upper plate
@.
plate
Mcrosatches,, activated by piston shait coming in upper position (the third one IS hidden by the upper plate)
Pig. 1. Schematic representation of the PCR apparatus.
229
Fig. 2. Photography of the apparatus with the three thermal baths. which is bolted at the tip of the piston shaft (test tube holder, dimensions: 14 × 6 cm, was cut in an aluminium plate, P C R is performed in polypropylene micro tubes which fit tightly into the holes pierced into the test tube holder. A test tube holder can accommodate together several tens of tubes). On the lower plate which is bolted to the b o d y of the electrical motor and does not rotate are secured four microswitches. One of these (A on Fig. 1) is depressed by screws fixed in the upper plate, its function is essentially to stop the upper plate rotation every 120 °. The other three (B) fixed to the rim of the lower plate have the function of allowing the electrical motor to start when and only when the test tube holder is in the upper position (pilot valve being de-energized, the cylinder is vented to atmosphere, the return is obtained by a spring, factory set inside the cylinder body). Electrical control of the machine
The machine is under the control of a very simple programmer made of six cheap electromechanical timers and an event counter. Fig. 3 is a diagrammatic representation of the programmer allowing one to understand how it works. Simplified description of the programmer: timers numbered 1 to 3 (referred to thereafter as main timers) are used to set the residence times in the heating baths. The other timers will be referred to as auxiliary timers.
230
w]
<
-1
I
Micro switches B
Insert Fig. 3. Diagrammatic representation of the programmer of the PCR apparatus. Triangles numbered 0 to 5 are the timers. Terminals A and B (see insert) are shorted together as long as the timer has not counted down the preset time. Terminals A and D are shorted together only during count down of the preset time. Terntinals A and E are shorted together after the preset time has elapsed. For timers 0 to 4, start of count down of the preset time is obtained by feeding current to A and reset by its interruption. Count down of the preset time by timer 5 is started by applying an electric pulse to terminal F, timer 5 is automatically reset at the end of count down of the preset time. Connections shown for switches A and B are those obtained when the test tube holder is in the lower position (A depressed, B not depressed). Relays are shown not activated.
A s the c o u n t d o w n of preset t i m e for each o f the m a i n timers begins, timers 4 an d 5 are a d e q u a t e l y ac ti v a te d (see below) so as to allow the u p p e r p l at e to r o t a t e 120 o a nd the test tube h o l d e r m o v e d as necessary up and down. T i m e r 1 is act i v at ed as soon as the start switch is rocked. T i m e r s 2 a n d 3 are activated at the en d of the c o u n t d o w n of timers 1 a n d 2, respectively. W h e n the c o u n t i n g of t i m er 3 has ended, t i me r 0 is act i v at ed to reset the m a i n timers, to i n c r e m e n t the c o u n t e r b y one a n d to start a n ew cycle so long as the preset n u m b e r of cycles is n o t reached.
Detailed description of the function of the auxiliary timers W h i l e t i m er 4 counts d o w n its preset time, no cu r r en t is fed to the pilot valve of the cyfinder (relay A is excited) h e n c e test t u b e h o l d e r is in u p p e r position, b u t w h e n time has elapsed current is again fed to the valve p r o v i d e d switch A is again depressed ( i m p l y i n g that u p p e r plate has come to the right position, after a 120 o rotation). T i m e r 4 is reset at the end of the c o u n t of each o n e of the three m a i n timers an d allowed to c o u n t d o w n its preset time again while one of the m a i n timers begins to c o u n t d o w n its o w n preset time. Preset time of t i m er 4 m u s t be longer than time necessary for the test tube h o l d e r to travel to the u p p e r p o s i t i o n allowing c u r r e n t to be fed to timer 5 t h r o u g h activated relay A an d switches B (see below), b u t preset time m u s t be shorter t h a n time n e e d e d for the u p p e r p l at e to r o t a t e 120 °. T i m e r 5 is started w h e n the test tube h o l d e r reaches the u p p e r p o s i t i o n a n d depresses o n e of the three B switches ( p r o v id e d relay A is excited, see before).
231
Re~aB
;
Motor
(~
~)
SwitchA ~ ~ - SwitchesB
Fig. 4. Wiring of the programmer. Circles are terminals of the various components of the programmer (figures are those chosen by the manufacturers to identify them).
D u r i n g t h e c o u n t d o w n o f t i m e r 5 c u r r e n t is f e d t o t h e m o t o r a l l o w i n g t h e u p p e r p l a t e t o b e g i n t o r o t a t e . A s s o o n as t h e s w i t c h A is n o m o r e d e p r e s s e d , c u r r e n t will b e f e d t o t h e m o t o r e v e n if t h e c o u n t d o w n o f t i m e r 5 h a s c o m e t o a n e n d . I n f a c t c u r r e n t will b e f e d t o t h e m o t o r a s l o n g as s w i t c h A will n o t b e d e p r e s s e d a g a i n (i.e.
TABLE 1 LIST OF PARTS WHICH WERE USED TO BUILD THE DESCRIBED MACHINE Two circular PVC plates (thickness 4 mm), diameter 35 cm (upper plate), 25 cm (lower plate). Note that diameters of the plates depend on dimensions of the heating baths. Three laboratory heating baths. Six timers: 220 V AC, Top 2000 model reference number (ref. no.) 882250 (three with max. counting time of 12 h, three with max. counting time of 12 rain) obtained from Crouzet, Valence, France. One event counter CP48 D1 model ref. no. 42 99 765 101 from Crouzet. 2 double-pole, double-throw relays. Three microswitches (B on Figs. 1, 3 and 4) (e.g. Matsushita ref. no. 42 AH71523). One microswitch (A on Figs. 1, 3 and 4) (e.g. Crouzet 505 model). One pilot valve (e.g. 226 series, ref. no. 226 00 003 from Jouvenel et Cordier, Rueil Malmaison, France). One pneumatic cylinder with spring return (e.g. FESTO ref. no. EG-12-00 obtained from FESTO KG Esslingen, F.R.G.). One 220 V AC synchronous motor (e.g. 7.2 W power, 4 rev/min model, ref. no. 82541.0 obtained from Crouzet). Rotary seal was assembled from two quick connect Swagelock fittings (ref. no. -QC4-S-200 and -QC4-B-200) obtained from Crawford Fitting company, Solon, Ohio, U.S.A. One 220 V AC buzzer. Plugs, electric wires, tubings as well as common connectors for the pneumatic part of the machine.
232 a f t e r a 120 o r o t a t i o n of t h e u p p e r plate). T i m e p r e s e t for t i m e r 5 m u s t b e s h o r t e r t h a n t i m e n e c e s s a r y f o r t h e p l a t e to r o t a t e 120 °, t i m e r 5 is w i r e d in s u c h a w a y t h a t it is a u t o m a t i c a l l y reset at the e n d of its c o u n t . T i m e r 0 is s t a r t e d at t h e e n d of the c o u n t d o w n of p r e s e t t i m e of t i m e r 3. A t t h e e n d o f t h e c o u n t d o w n o f its p r e s e t t i m e ( w h i c h is set at 1 s) all m a i n t i m e r s a r e reset, e x c i t a t i o n o f r e l a y B effects a n i n c r e m e n t o f o n e in the e v e n t c o u n t e r . W h e n t h e p r e s e t n u m b e r o f cycles has b e e n c o m p l e t e d b y t h e c o u n t e r , t h e i n t e r n a l c o n t a c t X will o p e n h e n c e the m a c h i n e will stop~ t h e test t u b e h o l d e r will s t a y in u p p e r p o s i t i o n a b o v e t h e t h i r d h e a t i n g b a t h , a n d t h e c l o s u r e of i n t e r n a l c o n t a c t Y will m a k e a b u z z e r ring. C o m p l e t e w i r i n g of t h e p r o g r a m m e r is s h o w n o n Fig. 4. T h e t i m e r s u s e d h a d s c r e w t e r m i n a l s , b u t if o n e s h o u l d d e c i d e to b u i l d several i d e n t i c a l p r o g r a m m e r s it c o u l d b e a d v a n t a g e o u s to s w i t c h to t i m e r s o f the ' p l u g in' type, w h e r e b y all c o n n e c t i o n s c o M d b e m a d e o n a single p r i n t e d c i r c u i t b o a r d . A l s o yet c h e a p e r c o m p o n e n t s c o u l d b e used, for i n s t a n c e t i m e r s 0 a n d 4 c o u l d b e r e p l a c e d b y s i m p l e t i m e d relays. B u t w e w a n t to e m p h a s i z e t h a t c o n c e p t i o n a n d r e a l i s a t i o n of t h e d e s c r i b e d m a c h i n e d i d n o t n e e d a n y skills in e l e c t r o n i c s b u t o n l y c a r e a n d c o m m o n sense. T a b l e 1 gives a list o f t h e p a r t s w h i c h w e r e u s e d to b u i l d t h e m a c h i n e .
ResuRts and Discussion
Amplification of AIP DNA D N A a m p l i f i c a t i o n was c a r r i e d o u t a c c o r d i n g to Salld et al. [2]. T h e 2 p r i m e r s u s e d w e r e b o t h 2 0 - m e r : (i) G T C T G G T A A C G G C A A T G C G G ; (ii) A T C G C T G CACGGCTCGTCCA. T h e y w e r e d e s i g n e d to a n n e a l to t a r g e t s e q u e n c e s , 88 b a s e s a p a r t in g e n o m i c D N A , a l l o w i n g the a m p l i f i c a t i o n o f a s e g m e n t c o n t a i n i n g the site o f m u t a t i o n (Fig. 5a). A s s h o w n in Fig. 5b a 88 b p D N A f r a g m e n t w a s a m p l i f i e d :
Fig. 5. (a) Sequence of the amplified AlP DNA. The target sequences for the two oligonucleotide primers are underlined. The asterisk indicates the position of the base change. Vertical arrow indicates exon intron boundary. (b) Electrophoretic analysis of the amplified AIP DNA. The DNA obtained from patient's white blood cells was amplified as described [2] in the presence of 2 units of Taq polymerase (Cetus). The samples were denatured at 91°C for 1 min, cooled to 50°C over i rain, then heated to 65 o C for 1 min. The reaction was performed by 30 repetitions in the automatic machine. 10/~1 samples were electrophoresed in a 2% agarose gel and picture taken under UV illumination: A, 123 bp ladder marker; B, C, 88 bp amplified fragment. (c) Detection of carriers of the AIP mutation by hybridization of ampl~.fied sequences from family members with oligonucleotides. The amplified sequence from each individual was hybridized in duplicate with a probe 5' CAGCACTCACCGCCGTTGC-3' corresponding to the normal sequence and with a probe 5'GCAACGGCGATGAGTGCTG 3' matching the mutated sequence. For hybridization analysis 10 btl of amplified sample was processed as described [3]. Zeta probe nylon filters were prehybridized in 5 × SSEP, 5 × Denhardt's solution and 0.5% dextran sulfate for 1 h at 55 o C then hybridized at the same temperature for 2-4 h with 106 cpm/ml of radiolabelled oIigonucleotide. The probe was labelled at the 5'-end with 3aP-ATP to a specific activity of 1 × 109 cpm/~g. Blots were washed at room temperature in 2 × SSEP for 30 min, t1~en in 5 × SSEP, 0.1% SDS at 68 ° C for 4 min and autoradiographed at - 70 ° C with one Dupont Cronex liglaming plus intensifying screen. Individuals 3, 4, 5 are patients or obligate carriers; 1, 2 are ur~related controls.
233
this fragment hybridized to the radiolabelled oligonucleofide. One of the oligonucleofides matched the normal sequence and the other the mutated one. As expected, the amplified fragment from the patient hybridized to both probes in agreement with the fact that he is heterozygous for the mutation. All the other affected family members and obligate carriers that we tested also produced a similar pattern of hybridization. In contrast, amplified DNA from normal controls only hybridized with the oligonucleotide of the normal sequence (Fig. 5c),
234
Amplification of the c-abl/bcr cDNA from abl/bcr mRNA As shown on Fig. 6b a 171 bp DNA K562
fragment
was amplified
as expected
since in
c e l l s , b c r e x o n 3 is f u s e d t o c - a b l e x o n 2 ( s e e F i g . 4 a a n d [4]). T h i s f r a g m e n t
Fig. 6. (a) D N A sequence of the amplified c D N A from c-abl/bcr. The targe~ sequences for the two o~gonucleotides are underlined; the junction of bcr exon 2 and 3 is indicated by / . The junction c - a b l / b c r is indicated by :. (b) Electrophoresis analysis of the amplified c D N A from c-abl/bcr. R N A was prepared from K562 cells as described t4]. 1 ~g of R N A was then reverse transcribed using M M L V and 100 pmol of a 20-mer oligonucleotide C T G A G G C T C A A A G T C A G A T G as a primer corresponding to c-abl exon-2 in 20/~1 of the reaction mixture recommended by Gibco BRL (Focus voL 9. no. 1). Then 100 pmol of a second o~gonucleotide TCGTGTGTGAAACTCCAGAGAC hybridizing to bcr exon-2 c D N A were added and the P C R was performed in the presence of 2 units of Taq polymerase as described m the legend of Fig. 5. After amplification 10 ~1 samples were electrophoresed in a 2% agarose gel and photographed under U V lamp. (A) 171 bp amplification product after 30 cycles of PCR: (B) 171 bp amplification product after 20 cycles of PCR; (C) 123 bp ladder marker. (c) Amplified c D N A from c - a b l / b c r after hybridization of the probe. After amplification, the D N A was transferred onto nylon filters and hybridization was performed as described in the legend of Fig. 5c. The oligonucleotide probe used in the hybridization was A G C C C T T C A G C G G C C A G T A . a sequence which is just 5' to the c-abl exon-2 primer (see a). Lanes: A, amplified c-abl/bcr c D N A starting from 10 ~g of total R N A from K562 cells; B, negative control using amplified products from 1/~g of total R N A isolated from normal cells: C. amplified c - a b l / b c r c D N A starting from 0.1 ~g of total R N A from K562 cells idiluted in 1 ~g of normal R N A ~.
235 hybridized with the radiolabelled p r o b e a n d it was possible to detect the chimeric c - a b l / b c r message t h r o u g h its a m p l i f i c a t i o n p r o d u c t starting from 0.1 /~g of total R N A from K562 cells, although n o signal was detected from n o r m a l R N A a l o n e (Fig. 6c). I n contrast with the other a u t o m a t i c m a c h i n e s previously described [51 or c o m m e r c i a l l y available, the system that we present moves the tubes from o n e w a t e r b a t h to a n o t h e r to change the t e m p e r a t u r e required to carry out each of the different steps of D N A amplification. I n this m a n n e r , the time required to reach the a p p r o p r i a t e t e m p e r a t u r e is m u c h shorter (in the range of 30 s) t h a n using a single t h e r m o b l o c k the t e m p e r a t u r e of which is c h a n g e d periodically. Therefore the total time required for c o m p l e t i n g a n a m p l i f i c a t i o n is usually 2 - 3 h instead of 5 - 6 h u s i n g other commercially available a u t o m a t e d systems. W h i l e this p a p e r was i n the writing process a paper was p u b l i s h e d [6] describing a n a u t o m a t i c P C R m a c h i n e using the same a p p r o a c h (i.e. the carrying of a test tube holder i n three h e a t i n g baths) with the same benefit (i.e. a short cycling time) based o n a modified H i s t o k i n e t t e (a tissue e m b e d d i n g i n s t r u m e n t )
Simplified description of the method and its application A mechanical system abte to carry a test tube holder successively through three thermal baths was assembled. It was used for automation of the polymerase chain reaction for DNA amplification. Very satisfactory results were obtained although price of the set-up was low.
References 1 Saikl, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Amheim, N.A. (1985) Enzymatic amplification of/~-globin genomic sequences and restriction site anatysis for diagnosis of sickle cell anemia. Science 230, 1350-1354. 2 Saild, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., MuUis, K.B. and Erlich, H.A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-491. 3 Grandchamp, B., Picat, C., Mignotte, V., Wilson, J.P.H., Te Velde, K., Sandknyl, L., Romeo, P.H., Goossens, M. and Nordman, Y. Tissue-specificsplicing mutation in acute intermittent porphyria. Proc. Natl. Acad. Sci. USA, in press. 4 Delfau, M.H., Garbarz, M., Chaveroche, I. and Grandchamp, B. (1988) Detection du messager chim~rique abl-bcr duns la leuc~mie my~loide chronique. M6decine/Sciences 4, 402-403. 5 Rollo, F., Amici, A. and Salvi, R. (1988) A simple and low cost DNA amplifier. Nucleic Acids Res. 16, 3105-3106. 6 Foulkes, N.S., Pandolfi de Rinaldis, P.P., Macdormell, J., Cross, N.C.P. and Luzzatto, L. (1988) Polymerase chain reaction automated at low cost. Nucleic Acids Res. 16, 5687-5688.
227
BBM 00734
An efficient laboratory made apparatus for DNA amplification Olivier Bertrand 1, Marie-H616ne Delfau z, Michel Garbarz Christiane Picat 1, Isabelle Devaux 1, Didier D h e r m y 1, Pierre Boivin 1 and Bernard G r a n d c h a m p 2
1
J I N S E R M U.160, H9pital Beaujon, 92118 Clichy Cedex, France and 2 Laboratoire de Gdndtique Moldculaire, Facultd de Mddecine Xavier Bichat, 75018 Paris, France
(Received I November 1988) (Accepted 24 January 1989)
Summa~ D N A amplification by the polymerase chain reaction (PCR) is a method capable of producing a selective and very high enrichment of a specific D N A sequence. Hence it seems to be useful in various fields from basic research to clinical applications. In order to automatize P C R we assembled for a very low cost a mechanical system designed to carry a test tube holder successively in three thermal baths set at the required temperatures for the reaction. Two examples of the use of this machine are given: (i) amplification of D N A of a particular subtype of acute intermittent porphyria; (ii) the detection of the chimeric c - a b l / b c r message found in chronic myelogenous leukemia cells. Key words: D N A amplification; Taq polymerase; Polymerase chain reaction
Introduction In vitro DNA amplification by the polymerase chain reaction (PCR) is a method capable of producing a selective enrichment of a specific DNA sequence by a factor of 1 0 6 [1]. PCR amplification involves (1) a pair of oligonucleotide primers that flank the DNA segment to be amplified; (2) repeated cycles of heat denaturation of the DNA, annealing of the oligonucleotides to their complementary sequences, and extension of the primer with DNA polymerase. Each successive cycle doubles the amount of DNA synthesized in the previous cycles. The use of a thermostable DNA polymerase isolated from Thermus aquaticus (Taq polymerase) avoids the need to Correspondence address: O. Bertrand, I N S E R M U160, Hbpital Beaujon, 92118 Clichy Cedex, France. 0165-022X/89/$03.50 © 1989 Elsevier Science Publishers B.V. (Biomedical Division)
228
add fresh emzyrne at each cycle, thus simplifying the phoce we [2]. In order to CR we chose to bu echatical system designed to carry a test tube holder successively in t baths set at the required temperatures for the reaction. Provision was t the time of residence in each bath as well as the total number of cycks were easily set. ‘We have used this me sets of experiments for which DNA amplification had previously been aboratory by the standard method requiring the manual operation: (i) cation of DNA from patients with a particular subtype of acute intermittent porphyria (AIP), an autosomaP inherited disease. This subtype corresponds to a mutation previously i n the porphobilinogen deaminase gene as a single base substitution (GTcanonical 5’-splice donor si?e of intron B [3]; (ii) the amplification of the chimetic c-abl/bcr message found in chronic myelogenous Leukemia (GML) cells [4].
This part is made essentially of two para%lel horizontal circular plates (Figs. 1 and 2). The upper plate is fked to the sh (vertically) a pneumatic cylinder
)
@.
Muowtch
, activated by the screws fixed to the upper plate
@.
plate
Mcrosatches,, activated by piston shait coming in upper position (the third one IS hidden by the upper plate)
Pig. 1. Schematic representation of the PCR apparatus.
229
Fig. 2. Photography of the apparatus with the three thermal baths. which is bolted at the tip of the piston shaft (test tube holder, dimensions: 14 × 6 cm, was cut in an aluminium plate, P C R is performed in polypropylene micro tubes which fit tightly into the holes pierced into the test tube holder. A test tube holder can accommodate together several tens of tubes). On the lower plate which is bolted to the b o d y of the electrical motor and does not rotate are secured four microswitches. One of these (A on Fig. 1) is depressed by screws fixed in the upper plate, its function is essentially to stop the upper plate rotation every 120 °. The other three (B) fixed to the rim of the lower plate have the function of allowing the electrical motor to start when and only when the test tube holder is in the upper position (pilot valve being de-energized, the cylinder is vented to atmosphere, the return is obtained by a spring, factory set inside the cylinder body). Electrical control of the machine
The machine is under the control of a very simple programmer made of six cheap electromechanical timers and an event counter. Fig. 3 is a diagrammatic representation of the programmer allowing one to understand how it works. Simplified description of the programmer: timers numbered 1 to 3 (referred to thereafter as main timers) are used to set the residence times in the heating baths. The other timers will be referred to as auxiliary timers.
230
w]
<
-1
I
Micro switches B
Insert Fig. 3. Diagrammatic representation of the programmer of the PCR apparatus. Triangles numbered 0 to 5 are the timers. Terminals A and B (see insert) are shorted together as long as the timer has not counted down the preset time. Terminals A and D are shorted together only during count down of the preset time. Terntinals A and E are shorted together after the preset time has elapsed. For timers 0 to 4, start of count down of the preset time is obtained by feeding current to A and reset by its interruption. Count down of the preset time by timer 5 is started by applying an electric pulse to terminal F, timer 5 is automatically reset at the end of count down of the preset time. Connections shown for switches A and B are those obtained when the test tube holder is in the lower position (A depressed, B not depressed). Relays are shown not activated.
A s the c o u n t d o w n of preset t i m e for each o f the m a i n timers begins, timers 4 an d 5 are a d e q u a t e l y ac ti v a te d (see below) so as to allow the u p p e r p l at e to r o t a t e 120 o a nd the test tube h o l d e r m o v e d as necessary up and down. T i m e r 1 is act i v at ed as soon as the start switch is rocked. T i m e r s 2 a n d 3 are activated at the en d of the c o u n t d o w n of timers 1 a n d 2, respectively. W h e n the c o u n t i n g of t i m er 3 has ended, t i me r 0 is act i v at ed to reset the m a i n timers, to i n c r e m e n t the c o u n t e r b y one a n d to start a n ew cycle so long as the preset n u m b e r of cycles is n o t reached.
Detailed description of the function of the auxiliary timers W h i l e t i m er 4 counts d o w n its preset time, no cu r r en t is fed to the pilot valve of the cyfinder (relay A is excited) h e n c e test t u b e h o l d e r is in u p p e r position, b u t w h e n time has elapsed current is again fed to the valve p r o v i d e d switch A is again depressed ( i m p l y i n g that u p p e r plate has come to the right position, after a 120 o rotation). T i m e r 4 is reset at the end of the c o u n t of each o n e of the three m a i n timers an d allowed to c o u n t d o w n its preset time again while one of the m a i n timers begins to c o u n t d o w n its o w n preset time. Preset time of t i m er 4 m u s t be longer than time necessary for the test tube h o l d e r to travel to the u p p e r p o s i t i o n allowing c u r r e n t to be fed to timer 5 t h r o u g h activated relay A an d switches B (see below), b u t preset time m u s t be shorter t h a n time n e e d e d for the u p p e r p l at e to r o t a t e 120 °. T i m e r 5 is started w h e n the test tube h o l d e r reaches the u p p e r p o s i t i o n a n d depresses o n e of the three B switches ( p r o v id e d relay A is excited, see before).
231
Re~aB
;
Motor
(~
~)
SwitchA ~ ~ - SwitchesB
Fig. 4. Wiring of the programmer. Circles are terminals of the various components of the programmer (figures are those chosen by the manufacturers to identify them).
D u r i n g t h e c o u n t d o w n o f t i m e r 5 c u r r e n t is f e d t o t h e m o t o r a l l o w i n g t h e u p p e r p l a t e t o b e g i n t o r o t a t e . A s s o o n as t h e s w i t c h A is n o m o r e d e p r e s s e d , c u r r e n t will b e f e d t o t h e m o t o r e v e n if t h e c o u n t d o w n o f t i m e r 5 h a s c o m e t o a n e n d . I n f a c t c u r r e n t will b e f e d t o t h e m o t o r a s l o n g as s w i t c h A will n o t b e d e p r e s s e d a g a i n (i.e.
TABLE 1 LIST OF PARTS WHICH WERE USED TO BUILD THE DESCRIBED MACHINE Two circular PVC plates (thickness 4 mm), diameter 35 cm (upper plate), 25 cm (lower plate). Note that diameters of the plates depend on dimensions of the heating baths. Three laboratory heating baths. Six timers: 220 V AC, Top 2000 model reference number (ref. no.) 882250 (three with max. counting time of 12 h, three with max. counting time of 12 rain) obtained from Crouzet, Valence, France. One event counter CP48 D1 model ref. no. 42 99 765 101 from Crouzet. 2 double-pole, double-throw relays. Three microswitches (B on Figs. 1, 3 and 4) (e.g. Matsushita ref. no. 42 AH71523). One microswitch (A on Figs. 1, 3 and 4) (e.g. Crouzet 505 model). One pilot valve (e.g. 226 series, ref. no. 226 00 003 from Jouvenel et Cordier, Rueil Malmaison, France). One pneumatic cylinder with spring return (e.g. FESTO ref. no. EG-12-00 obtained from FESTO KG Esslingen, F.R.G.). One 220 V AC synchronous motor (e.g. 7.2 W power, 4 rev/min model, ref. no. 82541.0 obtained from Crouzet). Rotary seal was assembled from two quick connect Swagelock fittings (ref. no. -QC4-S-200 and -QC4-B-200) obtained from Crawford Fitting company, Solon, Ohio, U.S.A. One 220 V AC buzzer. Plugs, electric wires, tubings as well as common connectors for the pneumatic part of the machine.
232 a f t e r a 120 o r o t a t i o n of t h e u p p e r plate). T i m e p r e s e t for t i m e r 5 m u s t b e s h o r t e r t h a n t i m e n e c e s s a r y f o r t h e p l a t e to r o t a t e 120 °, t i m e r 5 is w i r e d in s u c h a w a y t h a t it is a u t o m a t i c a l l y reset at the e n d of its c o u n t . T i m e r 0 is s t a r t e d at t h e e n d of the c o u n t d o w n of p r e s e t t i m e of t i m e r 3. A t t h e e n d o f t h e c o u n t d o w n o f its p r e s e t t i m e ( w h i c h is set at 1 s) all m a i n t i m e r s a r e reset, e x c i t a t i o n o f r e l a y B effects a n i n c r e m e n t o f o n e in the e v e n t c o u n t e r . W h e n t h e p r e s e t n u m b e r o f cycles has b e e n c o m p l e t e d b y t h e c o u n t e r , t h e i n t e r n a l c o n t a c t X will o p e n h e n c e the m a c h i n e will stop~ t h e test t u b e h o l d e r will s t a y in u p p e r p o s i t i o n a b o v e t h e t h i r d h e a t i n g b a t h , a n d t h e c l o s u r e of i n t e r n a l c o n t a c t Y will m a k e a b u z z e r ring. C o m p l e t e w i r i n g of t h e p r o g r a m m e r is s h o w n o n Fig. 4. T h e t i m e r s u s e d h a d s c r e w t e r m i n a l s , b u t if o n e s h o u l d d e c i d e to b u i l d several i d e n t i c a l p r o g r a m m e r s it c o u l d b e a d v a n t a g e o u s to s w i t c h to t i m e r s o f the ' p l u g in' type, w h e r e b y all c o n n e c t i o n s c o M d b e m a d e o n a single p r i n t e d c i r c u i t b o a r d . A l s o yet c h e a p e r c o m p o n e n t s c o u l d b e used, for i n s t a n c e t i m e r s 0 a n d 4 c o u l d b e r e p l a c e d b y s i m p l e t i m e d relays. B u t w e w a n t to e m p h a s i z e t h a t c o n c e p t i o n a n d r e a l i s a t i o n of t h e d e s c r i b e d m a c h i n e d i d n o t n e e d a n y skills in e l e c t r o n i c s b u t o n l y c a r e a n d c o m m o n sense. T a b l e 1 gives a list o f t h e p a r t s w h i c h w e r e u s e d to b u i l d t h e m a c h i n e .
ResuRts and Discussion
Amplification of AIP DNA D N A a m p l i f i c a t i o n was c a r r i e d o u t a c c o r d i n g to Salld et al. [2]. T h e 2 p r i m e r s u s e d w e r e b o t h 2 0 - m e r : (i) G T C T G G T A A C G G C A A T G C G G ; (ii) A T C G C T G CACGGCTCGTCCA. T h e y w e r e d e s i g n e d to a n n e a l to t a r g e t s e q u e n c e s , 88 b a s e s a p a r t in g e n o m i c D N A , a l l o w i n g the a m p l i f i c a t i o n o f a s e g m e n t c o n t a i n i n g the site o f m u t a t i o n (Fig. 5a). A s s h o w n in Fig. 5b a 88 b p D N A f r a g m e n t w a s a m p l i f i e d :
Fig. 5. (a) Sequence of the amplified AlP DNA. The target sequences for the two oligonucleotide primers are underlined. The asterisk indicates the position of the base change. Vertical arrow indicates exon intron boundary. (b) Electrophoretic analysis of the amplified AIP DNA. The DNA obtained from patient's white blood cells was amplified as described [2] in the presence of 2 units of Taq polymerase (Cetus). The samples were denatured at 91°C for 1 min, cooled to 50°C over i rain, then heated to 65 o C for 1 min. The reaction was performed by 30 repetitions in the automatic machine. 10/~1 samples were electrophoresed in a 2% agarose gel and picture taken under UV illumination: A, 123 bp ladder marker; B, C, 88 bp amplified fragment. (c) Detection of carriers of the AIP mutation by hybridization of ampl~.fied sequences from family members with oligonucleotides. The amplified sequence from each individual was hybridized in duplicate with a probe 5' CAGCACTCACCGCCGTTGC-3' corresponding to the normal sequence and with a probe 5'GCAACGGCGATGAGTGCTG 3' matching the mutated sequence. For hybridization analysis 10 btl of amplified sample was processed as described [3]. Zeta probe nylon filters were prehybridized in 5 × SSEP, 5 × Denhardt's solution and 0.5% dextran sulfate for 1 h at 55 o C then hybridized at the same temperature for 2-4 h with 106 cpm/ml of radiolabelled oIigonucleotide. The probe was labelled at the 5'-end with 3aP-ATP to a specific activity of 1 × 109 cpm/~g. Blots were washed at room temperature in 2 × SSEP for 30 min, t1~en in 5 × SSEP, 0.1% SDS at 68 ° C for 4 min and autoradiographed at - 70 ° C with one Dupont Cronex liglaming plus intensifying screen. Individuals 3, 4, 5 are patients or obligate carriers; 1, 2 are ur~related controls.
233
this fragment hybridized to the radiolabelled oligonucleofide. One of the oligonucleofides matched the normal sequence and the other the mutated one. As expected, the amplified fragment from the patient hybridized to both probes in agreement with the fact that he is heterozygous for the mutation. All the other affected family members and obligate carriers that we tested also produced a similar pattern of hybridization. In contrast, amplified DNA from normal controls only hybridized with the oligonucleotide of the normal sequence (Fig. 5c),
234
Amplification of the c-abl/bcr cDNA from abl/bcr mRNA As shown on Fig. 6b a 171 bp DNA K562
fragment
was amplified
as expected
since in
c e l l s , b c r e x o n 3 is f u s e d t o c - a b l e x o n 2 ( s e e F i g . 4 a a n d [4]). T h i s f r a g m e n t
Fig. 6. (a) D N A sequence of the amplified c D N A from c-abl/bcr. The targe~ sequences for the two o~gonucleotides are underlined; the junction of bcr exon 2 and 3 is indicated by / . The junction c - a b l / b c r is indicated by :. (b) Electrophoresis analysis of the amplified c D N A from c-abl/bcr. R N A was prepared from K562 cells as described t4]. 1 ~g of R N A was then reverse transcribed using M M L V and 100 pmol of a 20-mer oligonucleotide C T G A G G C T C A A A G T C A G A T G as a primer corresponding to c-abl exon-2 in 20/~1 of the reaction mixture recommended by Gibco BRL (Focus voL 9. no. 1). Then 100 pmol of a second o~gonucleotide TCGTGTGTGAAACTCCAGAGAC hybridizing to bcr exon-2 c D N A were added and the P C R was performed in the presence of 2 units of Taq polymerase as described m the legend of Fig. 5. After amplification 10 ~1 samples were electrophoresed in a 2% agarose gel and photographed under U V lamp. (A) 171 bp amplification product after 30 cycles of PCR: (B) 171 bp amplification product after 20 cycles of PCR; (C) 123 bp ladder marker. (c) Amplified c D N A from c - a b l / b c r after hybridization of the probe. After amplification, the D N A was transferred onto nylon filters and hybridization was performed as described in the legend of Fig. 5c. The oligonucleotide probe used in the hybridization was A G C C C T T C A G C G G C C A G T A . a sequence which is just 5' to the c-abl exon-2 primer (see a). Lanes: A, amplified c-abl/bcr c D N A starting from 10 ~g of total R N A from K562 cells; B, negative control using amplified products from 1/~g of total R N A isolated from normal cells: C. amplified c - a b l / b c r c D N A starting from 0.1 ~g of total R N A from K562 cells idiluted in 1 ~g of normal R N A ~.
235 hybridized with the radiolabelled p r o b e a n d it was possible to detect the chimeric c - a b l / b c r message t h r o u g h its a m p l i f i c a t i o n p r o d u c t starting from 0.1 /~g of total R N A from K562 cells, although n o signal was detected from n o r m a l R N A a l o n e (Fig. 6c). I n contrast with the other a u t o m a t i c m a c h i n e s previously described [51 or c o m m e r c i a l l y available, the system that we present moves the tubes from o n e w a t e r b a t h to a n o t h e r to change the t e m p e r a t u r e required to carry out each of the different steps of D N A amplification. I n this m a n n e r , the time required to reach the a p p r o p r i a t e t e m p e r a t u r e is m u c h shorter (in the range of 30 s) t h a n using a single t h e r m o b l o c k the t e m p e r a t u r e of which is c h a n g e d periodically. Therefore the total time required for c o m p l e t i n g a n a m p l i f i c a t i o n is usually 2 - 3 h instead of 5 - 6 h u s i n g other commercially available a u t o m a t e d systems. W h i l e this p a p e r was i n the writing process a paper was p u b l i s h e d [6] describing a n a u t o m a t i c P C R m a c h i n e using the same a p p r o a c h (i.e. the carrying of a test tube holder i n three h e a t i n g baths) with the same benefit (i.e. a short cycling time) based o n a modified H i s t o k i n e t t e (a tissue e m b e d d i n g i n s t r u m e n t )
Simplified description of the method and its application A mechanical system abte to carry a test tube holder successively through three thermal baths was assembled. It was used for automation of the polymerase chain reaction for DNA amplification. Very satisfactory results were obtained although price of the set-up was low.
References 1 Saikl, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Amheim, N.A. (1985) Enzymatic amplification of/~-globin genomic sequences and restriction site anatysis for diagnosis of sickle cell anemia. Science 230, 1350-1354. 2 Saild, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., MuUis, K.B. and Erlich, H.A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-491. 3 Grandchamp, B., Picat, C., Mignotte, V., Wilson, J.P.H., Te Velde, K., Sandknyl, L., Romeo, P.H., Goossens, M. and Nordman, Y. Tissue-specificsplicing mutation in acute intermittent porphyria. Proc. Natl. Acad. Sci. USA, in press. 4 Delfau, M.H., Garbarz, M., Chaveroche, I. and Grandchamp, B. (1988) Detection du messager chim~rique abl-bcr duns la leuc~mie my~loide chronique. M6decine/Sciences 4, 402-403. 5 Rollo, F., Amici, A. and Salvi, R. (1988) A simple and low cost DNA amplifier. Nucleic Acids Res. 16, 3105-3106. 6 Foulkes, N.S., Pandolfi de Rinaldis, P.P., Macdormell, J., Cross, N.C.P. and Luzzatto, L. (1988) Polymerase chain reaction automated at low cost. Nucleic Acids Res. 16, 5687-5688.