- Email: [email protected]
Anti-hyperuricemic and anti-inflammatory actions of vaticaffinol isolated from Dipterocarpus alatus in hyperuricemic mice
Chinese Journal of Natural Medicines 2017, 15(5): 03300340
Chinese Journal of Natural Medicines
Anti-hyperuricemic and anti-inflammatory actions of vaticaffinol isolated from Dipterocarpus alatus in hyperuricemic mice CHEN Yu-Sheng, CHEN Chao-Jun, YAN Wei, GE Hui-Ming*, KONG Ling-Dong* Institute of Functional Biomolecules, State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing 210023, China Available online 20 May, 2017
[ABSTRACT] The present study was designed to examine the anti-hyperuricemic and anti-inflammatory effects and possible mechanisms of vaticaffinol, a resveratrol tetramer isolated from ethanol extracts of Dipterocarpus alatus, in oxonate-induced hyperuricemic mice. At 1 h after 250 mg·kg-1 potassium oxonate was given, vaticaffinol at 20, 40, and 60 mg·kg-1 was intragastrically administered to hyperuricemic mice once daily for seven consecutive days. Vaticaffinol significantly decreased serum uric acid levels and improved kidney function in hyperuricemic mice. It inhibited hepatic activity of xanthine dehydrogenase (XDH) and xanthine oxidase (XOD), regulated renal mRNA and protein levels of urate transporter 1 (URAT1), glucose transporter 9 (GLUT9), organic anion transporter 1 (OAT1), organic cation transporter 1 (OCT1), OCT2, organic cation/carnitine transporter 1 (OCTN1), and OCTN2 in hyperuricemic mice. Moreover, vaticaffinol markedly down-regulated renal protein levels of NOD-like receptor 3 (NLRP3), apoptosis-associated speck-like (ASC), and Caspase-1, resulting in the reduction of interleukin (IL)-1β, IL-18, IL-6 and tumor necrosis factor-α (TNF-α) levels in this animal model. Additionally, HPLC and LC-MS analyses clearly testified the presence of vaticaffinol in the crude extract. These results suggest that vaticaffinol may be useful for the prevention and treatment of hyperuricemia with kidney inflammation. [KEY WORDS] Dipterocarpus alatus; Vaticaffinol; Anti-hyperuricemic effect; Kidney organic ion transporters; Kidney inflammation
[CLC Number] R965
[Document code] A
[Article ID] 2095-6975(2017)05-0330-11
Introduction Hyperuricemia can cause gouty arthritis, kidney dysfunction, systemic inflammation, cardiovascular disease, and other metabolic disorders [1-2]. Xanthine dehydrogenase (XDH) and xanthine oxidase (XOD) catalyze the oxidation of hypoxanthine to xanthine and then to uric acid with the production of reactive oxygen species (ROS). Inhibition of XDH and XOD activity is able to reduce uric acid and ROS levels. Kidney organic ion transporters are suggested to control kidney excretion of organic anions and cations and associated with kidney function [3]. Urate transporter 1 (URAT1) and glucose transporter 9 (GLUT9) mediate kidney urate re-absorption to
[Received on] 30-Dec.-2016 [Research funding] This work was supported by grants from Program for Changjiang Scholars and Innovative Research Team in University (IRT_14R271020). [*Corresponding author] Tel: 86-25-83594691, E-mail: kongld@ nju.edu.cn or [email protected]. These authors have no conflict of interest to declare. Published by Elsevier B.V. All rights reserved
maintain blood urate homeostasis [3-4]. Renal URAT1 and GLUT9 are highly expressed in patients with uric acid nephrolithiasis [5]. Organic anion transporter 1 (OAT1) is responsible for renal urate secretion [6]. Renal organic cation transporter 1 (OCT1), OCT2, organic cation/carnitine transporter 1 (OCTN1), and OCTN2 contribute to the transport of many cation and/or carnitine compounds. Expression changes of these kidney organic ion transporters impair body organic ion balance and induce kidney solute toxicity [7-8]. On the other hand, uric acid and ROS can drive the activation of NOD-like receptor (NLR) superfamily, pyrin domain containing 3 (NLRP3) inflammasome, which is composed of NLRP3, apoptosis-associated speck-like protein (ASC) and Caspase-1[9]. Caspase-1 activation stimulates the maturation of pro-inflammatory cytokines interleukin (IL)-1β and IL-18, which in turn increase tumor necrosis factor α (TNF-α) production [10]. These inflammatory cytokines induce renal injury, contributing to the progression of chronic kidney disease [11]. Therefore, the NLRP3 inflammasome activation may be associated with kidney inflammation and injury in hyperuricemia. Clinically, XOD inhibitor allopurinol is used to treat hyperuricemia. It regulates renal organic ion transporters in
– 330 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
hyperuricemic animals with kidney dysfunction [8, 12], and reduces the NLRP3 inflammasome activation [13]. However, allopurinol has severe side-effects such as hypersensitivity syndrome [14]. Uricosuric agent benzbromaron is withdrawn because it causes frequently fatal hepatic failure [15]. Thus, there is an urgent need for developing novel anti-hyperuricemic agents with great efficacy and favorable safety profile. Resveratrol (3, 5, 4′-trihydroxystilbene) oligomers from in Dipterocarpaceae plants [16], are evidenced to be anti-oxidation [17], anti-inflammation [18], and immunosuppression[19]. In our previous study, resveratrol and its analogues (such as pterostilbene) were reported to have uricosuric and nephroprotective effects in hyperuricemic mice by regulating renal organic ion transporters [20]. However, resveratrol oligomers with anti-hyperuricemic and anti-inflammatory effects in Dipterocarpaceae plants have not yet been identified. Herein, our curiosity about this topic was expanded to vaticaffinol, a resveratrol tetramer isolated from branches and twigs of Dipterocarpus alatu Roxb. We firstly demonstrated that vaticaffinol showed anti-hyperuricemic and anti-inflammatory effects in hyperuricemic mice by inhibiting liver XDH and XOD activity, regulating renal organic ion transporters and suppressing renal NLRP3 inflammasome activation. These findings indicated that vaticaffinol might be useful in the prevention and treatment of hyperuricemia with kidney inflammation.
Materials and Methods Plant Materials The branches and twigs of D. alatus were collected from the campus of Kasetsart University in Thailand, in April 2010, and were authenticated by Prof. Srunya Vajrodaya, Kasetsart University, Thailand. A voucher specimen (IFB11DA01) was deposited in the herbarium of Nanjing University, P. R. China. These plant samples were air-dried at room temperature to constant weight. Chemicals and Reagents Potassium oxonate, allopurinol, xanthine, nicotinamide adenine dinucleotide (NAD+), as well as hematoxylin and eosin (H&E) reagent were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Assay kits of creatinine and blood urine nitrogen (BUN) were obtained from Jiancheng Biotech (Nanjing, China). ELISA assay kits of IL-1β, IL-6, IL-18 and TNF-α were purchased from IBL (Minneapolis, MN, USA). TRIzol reagent and Moloney murine leukemia virus (MMLV) reverse transcriptase were obtained from Invitrogen (Carlsbad, CA, USA). All primers used in the present study were designed and synthesized by Generay Biotech (Shanghai, China). Taq DNA polymerase and polymerase chain reaction (PCR) buffer mixture were obtained from Genescript Company Limited (Nanjing, China). Primary antibodies against mURAT1, mGLUT9, mOAT1, mOCT1, and mOCT2 were provided by Cellchip Biotech (Beijing, China), of mOCTN1
from Alpha Diagnostic International Inc. (San Antonio, TX, USA). Antibodies against mOCTN2, mNLRP3, mASC, and mCaspase-1 were from Abcam Inc. (Cambridge, MA, USA). Mouse glyceraldehyde-3-phosphate dehydrogenase (mGAPDH) monoclonal antibody was obtained from Kangcheng Biotech (Shanghai, China). α-Tubulin antibody was supplied by Santa Cruz Biotechnology (Santa Cruz, CA, USA). HRP-conjugated goat anti-rabbit IgG was obtained from KPL (Gaithersburg, MD, USA). Other reagents and solvents were of analytical grade and purchased from local firms. Extraction, isolation, and purification of vaticaffinol The air-dried plant materials of D. alatus (1000 g) were extracted thrice with 85% ethanol at room temperature for 24 h each. Evaporation of the solvents under the reduced pressure afforded the crude ethanol extract (76.8 g), which was chromatographed over silica gel column (200-300 mesh, Qingdao Marine Chemical Company, China) eluted with pure chloroform initially, followed by a chloroform: methanol mixture (100 : 5; 100 : 10; 100 : 20; 100 : 50; 100 : 100; 0 : 100, each 2 L) to produce 13 fractions (A to M). Amount them, Fraction L exhibited anti-hyperuricemic activity in animal model of hyperuricemia. Therefore, this fraction was further separated by gel filtration over Sephadex LH-20 (Pharmacia Biotech, Sweden) with MeOH to give fractions L1-L45, according to thin layer chromatography (TLC, Qingdao Marine Chemical Company, China), and Fractions L30-L45 were merged and subjected to semi-preparative HPLC using a PU-2080 pump (Hitachi, Japan) equipped with a L-7400 multi-wavelength detector (Hitachi, Japan) and a 2.5 μm Allsphere-ODS column (250 mm × 4.6 mm; Alltech, USA). The mobile phase was 100% MeOH (solvent A) and ultrapure water (solvent B). The elution conditions were as follows: 30% A to 70% B at a flow rate of 2 mL·min-1. Thus, 1.30 g of Compound 1 was obtained and had a molecular formula of C56H42O12 determined by the LC-MS assay (m/z 907.2752, [M + H]+). The LC-MS analysis was accomplished on an Agilent 6210 TOF LC-MS spectrometer equipped with an Agilent ZORBAX SB-C18 column (5 μm, 150 mm × 2.1 mm). The electrospray ionization interface was operated in positive mode with the source temperature at 350 °C, and curtain gas was flowed at 10 L·min-1 (spray voltage at 4500 V). The compound structure was identified as 2, 2a, 7, 7a, 12, 12a, 17, 17a-octahydro-2, 7, 12, 17-tetrakis (4- hydroxyphenyl)-, (2R, 2aR, 7S, 7aR, 12S, 12aR, 17S, 17aR)-rel-(-)-, (vaticaffinol, Figs. 1A and 1B) by 1H NMR analysis (Bruker DRX500 NMR spectrometer with tetramethylsilane) and comparison with literature data [21]. The purity was estimated directly from the 1H-NMR spectrum (Fig. 1B) and HPLC analysis (Fig. 2) to be greater than 99%. Vaticaffinol was verified as a genuine resveratrol tetramer since it was detectable by assays of HPLC (Fig. 2) and LC-MS (Fig. 1S) in the fresh D. alatus ethanol extract prior to the separation procedure.
– 331 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
Fig. 1 The structure (A) and 1H-NMR spectrogram (B) of vaticaffinol isolated from the fresh D. alatus ethanol extract (measured in DMSO-d6 at 500 MHz; δ in ppm, J in Hz)
Fig. 2 Representative HPLC chromatogram of vaticaffinol and crude ethanol extract of D. alatus. (Agilent 1100 series system hyphened with quaternary pumps, an automatic injector, UV tunable absorbance detector operated at 210 nm, and a 250 mm × 4.6 mm × 5 μm Eclipse XDB-C18 column was used for the separation. HPLC analysis condition: water/MeOH = 70/30 vol %; Flow rate: 1 mL·min–1, 5 μL injection)
Animals Male Kun-Ming mice (weighing 18–22 g) were purchased from the Animal Centre of Qing-Longshan (Nanjing, China) and housed in a temperature- and humidity-controlled environment with a 12 h/12 h light/dark cycle. Experiments reported in this study were carried out in accordance with the
recommendations in the guidelines of the Ministry of Science and Technology of China (2006) and the related ethnical regulations of Nanjing University [SYXK (SU) 2009-0017] A hundred and fifty mice were divided into ten groups: normal + water; oxonate + water; oxonate + 20, 40, and 60 mg·kg–1 of vaticaffinol; oxonate + 5 mg·kg-1 of allopurinol (as a posi-
– 332 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
tive control); normal + 20, 40, and 60 mg·kg-1 of vaticaffinol; normal + 5 mg·kg–1 of allopurinol. Hyperuricemic mice were orally administered by 250 mg·kg-1 oxonate once daily at 8: 00 a.m. for seven consecutive days. Vaticaffinol and allopurinol were orally initiated at 9: 00 a.m. on the day after oxonate was given. All the tested samples were dispersed in distilled water. Standard diet, but not water, was withdrawn from the animals 1 h prior to the administration. Urine collection All the mice were transferred into metabolic cages to collect 24-h urine samples after the administration on the 6th day. They had free access to standard chow and tap water. Urine volume of each of the mice was recorded. Urine samples were centrifuged at 2 000 × g for 10 min at 4 °C. The supernatants were deposited at –20 °C until analysis. Blood and tissue sample collection Animals were killed by decapitation at 1 h after the final treatment on the 7th day, whole blood samples were collected and centrifuged at 10 000 × g for 5 min to obtain the serum, and stored at –20 °C until assays for serum uric acid (SUA) and creatinine (SCr), BUN, IL-1β, IL-6, IL-18 and TNF-α levels. Simultaneously, mouse liver tissues were excised on an ice plate, frozen in liquid nitrogen immediately and stored at –80 °C until XDH and XOD activity analysis. Kidney cortex tissues were dissected quickly and carefully on an ice plate, and parts of them were immediately fixed for H&E
staining analysis, while the remainder was immediately frozen in liquid nitrogen and then stored at –80 °C until RT-PCR and Western blot analyses, respectively. Analyses of uric acid, creatinine, BUN, and proinflammatory cytokine levels SUA and UUA levels were determined by the phosphotungstic acid method as our previously reported [22-23]. SCr, UCr and BUN, serum IL-1β, IL-6, IL-18, and TNF-α levels were measured using standard diagnostic kits, respectively. FEUA was calculated using the formula: FEUA= (UUA × SCr) / (SUA × UCr) × 100, expressed as percentage. XDH and XOD activity analysis Hepatic activity of XDH and XOD was assayed by monitoring uric acid formation using a spectrophotometric method described in our previous report [24]. H&E staining and pathology analysis Mouse kidney tissues were removed and immediately fixed for H&E staining analysis according the method described in our previous report [25]. Semi-Quantitative RT-PCR Gene expression analysis for animal kidney cortex was performed by semi-quantitative RT-PCR method [25]. The sequences of gene-specific PCR primers, the length of production and the appropriate annealing temperature are summarized in Table 1. The reversed transcription products were then subjected to PCR and analyzed as previously described [22, 25].
Table 1 Gene-specific PCR primer sequences, the length of amplificated product, numbers of thermal cycle and the appropriate annealing temperature used in the experiments Description
Genebank
Sense primer (5’→3’)
Antisense primer (5’→3’)
Product size (bp)
Numbers of thermal cycle
Tm (°C)
mGLUT9
NP 001012363
GAGATGCTCATTGTGGGACG
GTGCTACTTCGTCCTCGGT
316
30
56
mURAT1
NM 009203
GCTACCAGAATCGGCACGCT
CACCGGGAAGTCCACAATCC
342
30
58
mOAT1
NM 008766
ACGGGAAACAAGAAGAGGG
AAGAGAGGTATGGAGGGGTAG
580
29
56
mOCT1
NM 009202
ACATCCATGTTGCTCTTTCG
TTGCTCCATTATCCTTACCG
315
29
56
mOCT2
NM 013667
ACAGGTTTGGGCGGAAGT
CACCAGAAATAGAGCAGGAAG
331
29
56
mOCTN1
NM 019687
TGTTCTTCGTAGGCGTTCT
TGGAATAAACCACCACAGG
392
30
53.3
mOCTN2
NM 011396
TCTACGAAGCCTCAGTTGC
ATTCCTTTGACCCTTAGCAT
623
30
53.3
mGAPDH
NM 008084
TGAGGCCGGTGCTGAGTATGT
CAGTCTTCTGGGTGGCAGTGAT
299
35
58
mURAT1, mouse urate transporter 1; mGLUT9, mouse glucose transporter 9; mOAT1, mouse organic anion transporter 1; mOCT1, mouse organic cation transporter 1; mOCT2, mouse organic cation transporter 2; mOCTN1, mouse organic cation/carnitine transporter 1; mOCTN2, mouse organic cation/carnitine transporter 2; mGAPDH, mouse glyceraldehyde-3-phosphate dehydrogenase
Western blot analysis mURAT1, mOCTN1 and mOCTN2 of renal cortical brush-border membrane vesicles, and mGLUT9, mOAT1, mOCT1, mOCT2, mNLRP3, mASC, mCaspase-1 and mGAPDH of renal cortex tissues were analyzed by Western blot as described before [22-23, 25]. Statistical analysis Values were expressed as means ± SD. Statistical analysis was performed using the Statistical Analysis System (Graph Pad Prism 5; Graph Pad Software, Inc., San Diego, CA, USA). Statistical differences between groups were determined
using one-way analysis of variance (ANOVA) followed by a post hoc test (Fisher’s Least Significant Difference test) as appropriate. P < 0.05 was considered statistically significant.
Results Effects of vaticaffinol on serum uric acid levels and kidney function in hyperuricemic mice As shown in Table 2, oxonate significantly increased serum levels of uric acid, creatinine and BUN, decreased urine levels of uric acid, and creatinine in mice compared with control group. Vaticaffinol at 20, 40, and 60 mg·kg–1 effectively
– 333 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
decreased serum levels of uric acid, creatinine and BUN in hyperuricemic mice. Vaticaffinol at 40 mg·kg-1 remarkably increased urine levels of uric acid and creatinine in hyperuricemic mice. In addition, allopurinol at 5 mg·kg–1 also re-
stored the alteration of serum uric acid, creatinine and BUN, as well as urine uric acid and creatinine in this animal model (Table 2). Of note, vaticaffinol had no effects of these biochemical indexes in the normal mice.
Table 2 Effects of vaticaffinol on serum uric acid levels and kidney function in oxonate-induced hyperuricemic mice Group
Serum (mg·dL–1)
Dose (mg·kg–1)
Uric acid
Urine (mg·dL–1)
Creatinine
BUN
Uric acid
Creatinine
FEUA (%)
Normal Vehicle
-
2.84 ± 0.23
0.67 ± 0.05
15.36 ± 2.33
85.02 ± 3.55
110.71 ± 6.43
18.49 ± 1.01
Allopurinol
5
2.71 ± 0.28
0.71 ± 0.06
15.3 9± 2.93
83.46 ± 2.48
115.23 ± 12.86
18.23 ± 2.42
20
2.77 ± 0.42
0.68 ± 0.06
14.30 ± 4.28
82.52 ± 2.48
111.08 ± 7.92
17.47 ± 0.92
40
2.74 ± 0.18
0.69 ± 0.06
15.13 ± 2.73
78.15 ± 4.72
104.30 ± 3.92
18.57 ± 1.09
60
2.68 ± 0.33
0.73 ± 0.08
16.33 ± 2.34
84.40 ± 6.76
117.49 ± 2.85
18.82 ± 0.72
Vaticaffinol
Hyperuricemia Vehicle
-
4.10 ± 0.38+++
0.93 ± 0.10+++
19.93 ± 1.78++
60.04 ± 1.62++
89.97 ± 6.43+
15.77 ± 0.89++
Allopurinol
5
2.95 ± 1.00*
0.69 ± 0.08***
15.62 ± 1.99**
81.90 ± 0.54**
129.94 ± 5.58**
17.23 ± 0.69**
Vaticaffinol
**
20
3.21 ± 0.45
40
2.73 ± 0.47***
60
***
2.76 ± 0.31 ++
The values are mean ± SD (n = 10). P < 0.01 and
+++
0.76 ± 0.07
**
17.31 ± 2.47
0.70 ± 0.08*** 0.66 ± 0.12
*
64.10 ± 2.71
16.39 ± 1.48**
**
14.22 ± 2.04 *
***
93.74 ± 1.73
91.27 ± 1.43*** 70.97 ± 5.49 **
P < 0.001 vs normal + vehicle group. P < 0.05, P < 0.01 and
***
16.68 ± 1.22
119.00 ± 4.08**
20.44 ± 2.00**
94.12 ± 5.88
18.13 ± 1.63**
P < 0.001 vs hyperuricemia + vehicle group.
60 mg·kg-1 of vaticaffinol notably inhibited hepatic XDH and XOD activity in hyperuricemic mice, by 28.62, 51.72, and 44.46% for XDH, and 24.56, 54.61 and 45.17% for XOD, respectively (Table 3). Allopurinol at 5 mg·kg-1 suppressed liver XDH and XOD activity by 54.17 and 56.08%, respectively (Table 3).
Effects of vaticaffinol on liver XDH and XOD activity in hyperuricemic mice To determine whether vaticaffinol had effect on uric acid production in hyperuricemic mice, liver activity of XDH and XOD were determined. Compared with model group, 20, 40, and
Table 3 Effects of vaticaffinol on hepatic XOD and XDH activity in the normal and hyperuricemic mice. Group
Dose (mg·kg–1)
XDH
XOD
Inhibition (%)
(nmole uric acid·mg–1 protein)
XDH
XOD
49.49
45.61
Normal Vehicle Allopurinol Vaticaffinol
-
9.92 ± 1.18
10.03 ± 1.37
5.01 ± 0.53
+++
20
7.85 ± 0.76
++
40
5.47 ± 0.90+++
5
5.46 ± 0.99+++
20.84
16.88
5.78 ± 0.56+++
44.83
42.35
+++
21.73
30.10
4.80 ± 0.63***
5.12 ± 0.87***
56.08
54.17
***
***
60
7.76 ± 0.91
Vehicle
-
10.92 ± 1.00
Allopurinol
5
8.34 ± 0.67
+
++
7.01 ± 0.92
Hyperuricemia
Vaticaffinol
11.16 ± 0.65
20
7.80 ± 1.26
28.62
24.56
40
5.27 ± 0.72***
5.07 ± 0.64***
51.72
54.61
60
***
***
44.46
45.17
6.07 ± 0.88
8.42 ± 0.98 6.12 ± 0.92
The values are mean ± SD (n = 10). + P < 0.05, ++ P < 0.01 and +++ P < 0.001 vs normal + vehicle group; *** P < 0.001 vs hyperuricemia + vehicle group
In the normal mice, vaticaffinol and allopurinol also significantly inhibited liver XDH and XOD activity by 20.84, 44.83 and 21.73% for XDH, and 16.88, 42.35 and 30.10% for XOD, respectively (Table 3). Allopurinol at 5 mg·kg-1 reduced liver XDH and XOD activity in mice by 49.49 and 45.61%, respectively (Table 3).
Effects of vaticaffinol on renal mURAT1 mRNA and protein levels in hyperuricemic mice Compared with the normal group, renal mURAT1 mRNA and protein levels were significantly increased in hyperuricemic mice (Figs. 3 A and B). Vaticaffinol at 20, 40, and 60 mg·kg–1 remarkably down-regulated renal
– 334 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
mURAT1 mRNA and protein levels in hyperuricemic mice. Allopurinol at 5 mg·kg–1 also restored the change of mU-
RAT1 mRNA and protein levels in hyperuricemic mice (Figs. 3A and 3B).
Fig. 3 Effects of vaticaffinol on renal mRNA and protein levels of mURAT1 (A and B) and mGLUT9 (C and D) in the normal and oxonate-induced hyperuricemic mice. The values are mean ± SD (n = 4). ++P < 0.01 vs normal + vehicle group. * P < 0.05, ** P < 0.01, *** P < 0.001 vs hyperuricemia + vehicle group Effects of vaticaffinol on renal mGLUT9 mRNA and protein levels in hyperuricemic mice Oxonate remarkably increased renal mGLUT9 mRNA and protein levels in mice (Figs. 3 C and D). Vaticaffinol at 20, 40, and 60 mg·kg–1 dramatically down-regulated renal mRNA and protein levels of mGLUT9 in hyperuricemic mice. Allopurinol at 5 mg·kg–1 also restored the up-regulation of renal mGLUT9 mRNA and protein levels in this animal model (Figs. 3 C and D). Effects of vaticaffinol on renal mOAT1 mRNA and protein levels in hyperuricemic mice In the present study, hyperuricemic mice observably
produced a reduction of renal mOAT1 mRNA and protein levels (Figs. 4 A and B). Vaticaffinol at 20, 40, and 60 mg·kg–1 dramatically up-regulated renal levels of mOAT1 mRNA and protein in hyperuricemic mice (Figs. 4A and B). 5 mg·kg–1 of allopurinol also remarkably increased renal mOAT1 mRNA and protein levels in hyperuricemic mice (Figs. 4 A and B). Effects of vaticaffinol on renal mOCT1 and mOCT2 mRNA and protein levels in hyperuricemic mice Compared with the normal control, oxonate markedly reduced renal mRNA and protein levels of mOCT1 (Figs. 5A and B), and mOCT2 (Figs. 5 C and D) in mice. Vaticaffinol at 20, 40, and
– 335 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
60 mg·kg–1 effectively up-regulated renal mOCT1 and mOCT2 mRNA and protein levels (Figs. 5 A–D) in hyperuricemic mice.
Allopurinol also significantly increased renal levels of mOCT1 and mOCT2 mRNA and protein in hyperuricemic mice (Figs. 5 A-D).
Fig. 4 Effects of vaticaffinol on renal mRNA and protein levels of mOAT1 (A and B) in the normal and oxonate-induced hyperuricemic mice. The values are mean ± SD (n = 4). ++ P < 0.01, +++ P < 0.01 vs normal + vehicle group；** P < 0.01, *** P < 0.001 vs hyperuricemia + vehicle group
– 336 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
Fig. 5 Effects of vaticaffinol on renal mRNA and protein levels of mOCT1 (A and B), mOCT2 (C and D), mOCTN1 (E and F) and mOCTN2 (G and H) in the normal and oxonate-induced hyperuricemic mice. The values are mean ± SD (n = 4). + P < 0.05, ++ P < 0.01, +++ P < 0.001 vs normal + vehicle group; * P < 0.05, ** P < 0.01, *** P < 0.001 vs hyperuricemia + vehicle group Effects of vaticaffinol on renal mOCTN1 and mOCTN2 mRNA and protein levels in hyperuricemic mice Compared with the normal control, oxonate remarkably renal mRNA and protein levels of mOCTN1 (Figs. 5 E and F) and mOCTN2 (Figs. 5 G and H) in mice. Vaticaffinol at 20, 40, and 60 mg·kg–1 obviously up-regulated renal mRNA and protein levels of mOCTN1 (Figs. 5E and F) and mOCTN2 (Figs. 5 G and H) in hyperuricemic mice. Allopurinol also significantly increased renal mOCTN1 and mOCTN2 mRNA and protein levels in hyperuricemic mice (Figs. 5 E–H). Effects of vaticaffinol on renal NLRP3 inflammasome activation and serum proinflammatory cytokine levels in hyperuricemic mice Oxonate remarkably increased renal protein levels of mNLRP3 (Fig. 6A), mASC (Fig. 6B), and mCaspase-1 (Fig. 6C) in mice. Vaticaffinol at 40 and 60 mg·kg–1 succeeded in
restoring oxonate-induced over-expression of renal NLRP3 inflammasome components. Allopurinol at 5 mg·kg–1 significantly decreased renal protein levels of mNLRP3, mASC, and mCaspase-1 in hyperuricemic mice (Figs. 6A–C). Consistently, histological analyses confirmed that vaticaffinol at 40 and 60 mg·kg–1, as well as 5 mg·kg–1 allopurinol restored oxonate-induced tubulointerstitial pathology of renal proximal tubular epithelial cell degeneration, cytoplasmic relaxation, and slight inflammatory infiltrate in mice, respectively (Fig. 6D). Furthermore, serum IL-1β, IL-6, IL-18 and TNF-α levels (P < 0.001) were increased simultaneously in hyperuricemic mice (Table 4), which were restored by vaticaffinol at 40 and 60 mg·kg–1. Vaticaffinol at 20 mg·kg–1 only reduced serum TNF-α levels in this animal model (Table 4). Allopurinol at 5 mg·kg–1 significantly decreased serum levels of these inflammatory cytokines in hyperuricemic mice (Table 4).
– 337 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
Fig. 6 Effects of vaticaffinol on renal protein levels of mNLRP3 (A), mASC (B) and mCaspase-1 (C) and renal morphological changes (D) in the normal and oxonate-induced hyperuricemic mice. The values are means ± SD (n = 6), ++ P < 0.01, +++ P < 0.01 vs normal + vehicle group; *P < 0.05, **P < 0.01, ***P < 0.001 vs hyperuricemia + vehicle group. Vaticaffinol at 40 and 60 mg·kg–1 and 5 mg·kg–1 allopurinol improved oxonate-induced tubulointerstitial pathology of renal proximal tubular epithelial cell degeneration, cytoplasmic relaxation and slight inflammatory infiltrate in mice, respectively. The scale bar represents 50 μm Table 4 Effects of vaticaffinol on serum IL-1β, IL-6, IL-18 and TNF-α levels in oxonate-induced hyperuricemic mice Dose (mg·kg–1)
IL-1β (ng·L–1)
IL-6 (ng·L–1)
Vehicle
-
3.98 ± 0.76
10.11 ± 0.49
9.90 ± 0.40
11.29 ± 2.04
Allopurinol
5
4.26 ± 0.85
9.91 ± 0.41
10.99 ± 2.27
11.52 ± 3.10
20
4.12 ± 0.44
10.98 ± 0.68
11.09 ± 1.06
11.55 ± 2.43
40
4.21 ± 0.66
10.27 ± 0.74
11.70 ± 0.83
12.32 ± 2.67
60
4.25 ± 1.30
10.02 ± 0.48
11.99 ± 0.68
10.55 ± 2.10
Group
IL-18 (ng·L–1)
TNF-α (ng·L–1)
Normal
Vaticaffinol
Hyperuricemia Vehicle
-
6.85 ± 0.86+++
14.05 ± 1.55+++
21.70 ± 1.25+++
21.96 ± 4.12+++
Allopurinol
5
4.48 ± 0.54***
10.99 ± 0.45***
9.44 ± 0.46***
11.33 ± 3.82***
20
6.91 ± 1.25
16.27 ± 2.96
40
4.64 ± 2.16*
Vaticaffinol
60
3.84 ± 1.21
14.23 ± 1.43
***
10.29 ± 0.63
16.00 ± 5.07*
21.47 ± 1.13
***
11.04 ± 1.08***
12.13 ± 3.18***
***
11.41 ± 2.61***
9.89 ± 0.81
The values are mean ± SD (n = 6). +++ P < 0.001 vs normal + vehicle group; *P < 0.05 and ***P < 0.001 vs hyperuricemia + vehicle group.
Discussion Dipterocarpaceous plants contain various resveratrol oli-
gomers, and some of them reduce ROS production and have anti-oxidant activity [26]. XDH and XOD catalyze the oxidation of hypoxanthine to xanthine and then to uric acid. In the
– 338 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
present study, vaticaffinol was found to inhibit hepatic XDH and XOD activity in hyperuricemic mice, which may partly contribute to its reduction of serum uric acid levels. FEUA is an important parameter of kidney urate handling. In the present study, vaticaffinol remarkably increased FEUA in hyperuricemic mice. Of note, vaticaffinol at 40 mg·kg–1 seemed to be more potent than allopurinol at 5 mg·kg–1, but they had similar inhibitory action on hepatic XDH and XOD activity in hyperuricemic mice. These observations indicated that vaticaffinol might enhance kidney urate excretion to reduce serum urate levels in hyperuricemia. URAT1 and GLUT9 control renal urate re-absorption to mediate renal urate handling for the regulation of blood urate homeostasis. They are considered as the promising therapeutic targets for hyperuricemia and gout [3-4]. OAT1 mediates urate secretion and is associated with the progression of chronic kidney disease [27]. In the present study, vaticaffinol was found to down-regulate the mURAT1 and mGLUT9 mRNA and protein levels, and up-regulate the mOAT1 mRNA and protein levels in the kidney of hyperuricemic mice. The reason for vaticaffinol’s reduction of serum urate levels may be probably the involvement in the regulation of these renal urate transport-related transporters, resulting in the enhancement of kidney urate excretion in hyperuricemic mice. Kidney URAT1, GLUT9 and OAT1 may point toward molecular targets for vaticaffinol as a novel anti-hyperuricemic agent. Hyperuricemia is associated with kidney dysfunction. OCT1, OCT2, OCTN1 and OCTN2 play the predominant roles in modifying kidney transport of cation and carnitine [7-8]. Abnormal expression of renal mOCT1, mOCT2, mOCTN1 and mOCTN2 is observed in hyperuricemia with kidney dysfunction [12, 25]. Allopurinol improves renal function in hyperuricemia by up-regulating renal expression of mOCT1, mOCT2, mOCTN1 and mOCTN2 in hyperuricemic mice and chronic kidney disease patients [22, 28]. In the present study, vaticaffinol and allopurinol were able to up-regulate renal mOCT1, mOCT2, mOCTN1 and mOCTN2 mRNA and protein levels in hyperuricemic mice, which were consistent with the restoration of kidney dysfunction. The NLRP3 inflammasome is one of the innate immune cell sensors. Recently, uric acid and ROS are reported to activate the NLRP3 inflammasome and produce IL-1β [29]. This inflammasome activation promotes kidney inflammation, contributing to chronic kidney disease [11]. In the present study, renal NLRP3 inflammasome activation was activated in hyperuricemic mice, as evidenced by up-regulating the mNLRP3, mASC and mCaspase-1 protein levels. Consistently, systemic inflammation and renal injury were further confirmed in this animal model. Vaticaffinol and allopurinol obviously suppressed renal NLRP3 inflammasome activation, and subsequently reduced systemic inflammation and renal injury in hyperuricemic mice. These results indicated that vaticaffinol with the reduction of serum urate levels may tar-
get the NLRP3 inflammasome to alleviate inflammatory response and injury in hyperuricemia, showing its improvement of kidney function. Hyperuricemia in organ transplantation, cancer and HIV/AIDS is an increasing and challenging clinical problem. Additionally, hyperuricemia is a common side-effect of immunosuppressive drugs such as mizoribine that interfere with purine metabolism [30]. More importantly, vaticaffinol is found to have the immunosuppressive activity by affecting multiple targets against activated T cells. Thus, vaticaffinol may be used to treat hyperuricemia with the immune system disorder. Further studies are required to understand the precise mechanisms of vaticaffinol-mediated these effects. In conclusion, vaticaffinol, a resveratrol tetramer, was isolated and identified from the branches and twigs of D. alatus. This resveratrol tetramer was found to possess anti-hyperuricemic and anti-inflammatory activity in hyperuricemic mice. The inhibition of liver XDH and XOD activity, regulation of renal mURAT1, mGLUT9, mOAT1, mOCT1, mOCT2, mOCTN1, and mOCTN2, as well as suppression of renal NLRP3 inflammasome activation might be involved in the novel mechanisms of its actions in hyperuricemia. These results suggest that vaticaffinol may be potential for the prevention and treatment of hyperuricemia with kidney inflammation. Further clinical studies are needed to evaluate its efficacy.
References [1]
Puddu P, Puddu GM, Cravero E, et al. Relationships among hyperuricemia, endothelial dysfunction and cardiovascular disease: molecular mechanisms and clinical implications [J]. J Cardiol, 2012, 59(3): 235-242. [2] Martin AC, Brown MA. Could uric acid have a pathogenic role in pre-eclampsia? [J]. Nat Rev Nephrol, 2012, 6(12): 744-748. [3] Kanai Y. Molecular mechanisms of urate transport in renal tubules: localization and function of urate transporters [J]. Nihon Rinsho, 2008, 66(4): 659-666. [4] Preitner F, Bonny O, Laverrière A, et al. Glut9 is a major regulator of urate homeostasis and its genetic inactivation induces hyperuricosuria and urate nephropathy [J]. Proc Natl Acad Sci USA, 2009, 106(36): 15501-15506. [5] Fu W, Li Q, Yao J, et al. Protein expression of urate transporters in renal tissue of patients with uric acid nephrolithiasis [J]. Cell Biochem Biophys, 2014, 70(1): 449-454. [6] Eraly SA, Vallon V, Rieg T, et al. Multiple organic anion transporters contribute to net renal excretion of uric acid [J]. Physiol Genomics, 2008, 33(2): 180-192. [7] Johnston RA, Rawling T, Chan T, et al. Selective inhibition of human solute carrier transporters by multikinase inhibitors [J]. Drug Metab Dispos, 2014, 42(11): 1851-1857. [8] Diaz-Torné C, Perez-Herrero N, Perez-Ruiz F. New medications in development for the treatment of hyperuricemia of gout [J]. Curr Opin Rheumatol, 2015, 27(2): 164-169. [9] Schroder K, Zhou R, Tschopp J. The NLRP3 inflammasome: a sensor for metabolic danger? [J]. Science, 2010, 327(5963): 296-300. [10] Zhou R, Yazdi A, Menu P, et al. A role for mitochondria in NLRP3 inflammasome activation [J]. Nature, 2010, 469(7329):
– 339 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
221-225. [11] Vilaysane A, Chun J, Seamone ME, et al. The NLRP3 inflammasome promotes renal inflammation and contributes to CKD [J]. J Am Soc Nephrol, 2010, 21(10): 1732-1744. [12] Wang R, Ma CH, Zhou F, et al. Siwu decoction attenuates oxonate-induced hyperuricemia and kidney inflammation in mice [J]. Chin J Nat Med, 2016, 14(7): 499-507. [13] Griffith JW, Sun T, McIntosh MT, et al. Pure Hemozoin is inflammatory in vivo and activates the NALP3 inflammasome via release of uric acid [J]. J Immunol, 2009, 183(8): 5208-5220. [14] Stamp L, Taylor W, Jones P, et al. Starting dose is a risk factor for allopurinol hypersensitivity syndrome: a proposed safe starting dose of allopurinol [J]. Arthritis Rheum, 2012, 64(8): 2529-2536. [15] Lee MH, Graham GG, Williams KM, et al. A benefit-risk assessment of benzbromarone in the treatment of gout. Was its withdrawal from the market in the best interest of patients? [J]. Drug Saf, 2008, 31(8): 643-665. [16] Shen T, Wang XN, Lou HX. Natural stilbenes: an overview [J]. Nat Prod Rep, 2009, 26(7): 916-935. [17] Ge HM, Yang WH, Zhang J, et al. Antioxidant oligostilbenoids from the stem wood of Hopea hainanensis [J]. J Agric Food Chem, 2009, 57(13): 5756-5761. [18] Bereswill S, Munoz M, Fischer A, et al. Anti-inflammatory effects of resveratrol, curcumin and simvastatin in acute small intestinal inflammation [J]. PLoS One, 2010, 5(12): e15099. [19] Feng LL, Wu XF, Liu HL, et al. Vaticaffinol, a resveratrol tetramer, exerts more preferable immunosuppressive activity than its precursor in vitro and in vivo through multiple aspects against activated T lymphocytes [J]. Toxicol Appl Pharmacol, 2013, 267(2): 167-173. [20] Shi YW, Wang CP, Liu L, et al. Antihyperuricemic and nephroprotective effects of resveratrol and its analogues in hyperuricemic mice [J]. Mol Nutr Food Res, 2012, 56(9): 1433-1444.
[21] Sultanbawa MUS, Surendrakumar S, Mohamed IMW, et al. Novel resveratrol tetramer, vaticaffinol, from Vatica affinis Thw. (Dipterocarpaceae) [J]. JCS Chem Comm, 1981, 23: 1204-1206. [22] Li JM, Zhang X Wang X, et al. Protective effects of cortex fraxini coumarines against oxonate-induced hyperuricemia and renal dysfunction in mice [J]. Eur J Pharmacol, 2011, 666 (1-3): 196-204. [23] Ding XQ, Pan Y, Wang X, et al. Wuling san ameliorates urate under-excretion and renal dysfunction in hyperuricemic mice [J]. Chin J Nat Med, 2013, 11(3): 214-221. [24] Wang X, Wang CP, Hu QH, et al. The dual actions of Sanmiao wan as a hypouricemic agent: down-regulation of hepatic XOD and renal mURAT1 in hyperuricemic mice [J]. J Ethnopharmacol, 2010, 128(1): 107-115. [25] Hu QH, Zhang X, Wang X, et al. Quercetin regulates organic ion transporter and uromodulin expression and improves renal function in hyperuricemic mice [J]. Eur J Nutr, 2012, 51(5): 593-606. [26] Chen X, Qiao H, Liu T, et al. Inhibition of herpes simplex virus infection by oligomeric stilbenoids through ROS generation [J]. Antiviral Res, 2012, 95(1): 30-36. [27] Mandal AK, Mercado A, Foster A, et al. Uricosuric targets of tranilast [J]. Pharmacol Res Perspect, 2017, 5(2): e00291. [28] Yelken B, Caliskan Y, Gorgulu N, et al. Reduction of uric acid levels with allopurinol treatment improves endothelial function in patients with chronic kidney disease [J]. Clin Nephrol, 2012, 77(4): 275-282. [29] Braga TT, Forni MF, Correa-Costa M, et al. Soluble uric acid activiates the NLRP3 inflammasome [J]. Sci Rep, 2017, 13(7): 39884. [30] Ding X, Zhu X, Zhang Y, et al. Influence of serum uric acid levels in response to the conversion from mycophenolate mofetil to mizoribine in kidney transplant recipients [J]. Transplant Proc, 2013, 45(1): 190-193.
Cite this article as: CHEN Yu-Sheng, CHEN Chao-Jun, YAN Wei, GE Hui-Ming, KONG Ling-Dong. Anti-hyperuricemic and anti-inflammatory actions of vaticaffinol isolated from Dipterocarpus alatus in hyperuricemic mice [J]. Chin J Nat Med, 2017, 15(5): 330-340
– 340 –
Chinese Journal of Natural Medicines
Anti-hyperuricemic and anti-inflammatory actions of vaticaffinol isolated from Dipterocarpus alatus in hyperuricemic mice CHEN Yu-Sheng, CHEN Chao-Jun, YAN Wei, GE Hui-Ming*, KONG Ling-Dong* Institute of Functional Biomolecules, State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing 210023, China Available online 20 May, 2017
[ABSTRACT] The present study was designed to examine the anti-hyperuricemic and anti-inflammatory effects and possible mechanisms of vaticaffinol, a resveratrol tetramer isolated from ethanol extracts of Dipterocarpus alatus, in oxonate-induced hyperuricemic mice. At 1 h after 250 mg·kg-1 potassium oxonate was given, vaticaffinol at 20, 40, and 60 mg·kg-1 was intragastrically administered to hyperuricemic mice once daily for seven consecutive days. Vaticaffinol significantly decreased serum uric acid levels and improved kidney function in hyperuricemic mice. It inhibited hepatic activity of xanthine dehydrogenase (XDH) and xanthine oxidase (XOD), regulated renal mRNA and protein levels of urate transporter 1 (URAT1), glucose transporter 9 (GLUT9), organic anion transporter 1 (OAT1), organic cation transporter 1 (OCT1), OCT2, organic cation/carnitine transporter 1 (OCTN1), and OCTN2 in hyperuricemic mice. Moreover, vaticaffinol markedly down-regulated renal protein levels of NOD-like receptor 3 (NLRP3), apoptosis-associated speck-like (ASC), and Caspase-1, resulting in the reduction of interleukin (IL)-1β, IL-18, IL-6 and tumor necrosis factor-α (TNF-α) levels in this animal model. Additionally, HPLC and LC-MS analyses clearly testified the presence of vaticaffinol in the crude extract. These results suggest that vaticaffinol may be useful for the prevention and treatment of hyperuricemia with kidney inflammation. [KEY WORDS] Dipterocarpus alatus; Vaticaffinol; Anti-hyperuricemic effect; Kidney organic ion transporters; Kidney inflammation
[CLC Number] R965
[Document code] A
[Article ID] 2095-6975(2017)05-0330-11
Introduction Hyperuricemia can cause gouty arthritis, kidney dysfunction, systemic inflammation, cardiovascular disease, and other metabolic disorders [1-2]. Xanthine dehydrogenase (XDH) and xanthine oxidase (XOD) catalyze the oxidation of hypoxanthine to xanthine and then to uric acid with the production of reactive oxygen species (ROS). Inhibition of XDH and XOD activity is able to reduce uric acid and ROS levels. Kidney organic ion transporters are suggested to control kidney excretion of organic anions and cations and associated with kidney function [3]. Urate transporter 1 (URAT1) and glucose transporter 9 (GLUT9) mediate kidney urate re-absorption to
[Received on] 30-Dec.-2016 [Research funding] This work was supported by grants from Program for Changjiang Scholars and Innovative Research Team in University (IRT_14R271020). [*Corresponding author] Tel: 86-25-83594691, E-mail: kongld@ nju.edu.cn or [email protected]. These authors have no conflict of interest to declare. Published by Elsevier B.V. All rights reserved
maintain blood urate homeostasis [3-4]. Renal URAT1 and GLUT9 are highly expressed in patients with uric acid nephrolithiasis [5]. Organic anion transporter 1 (OAT1) is responsible for renal urate secretion [6]. Renal organic cation transporter 1 (OCT1), OCT2, organic cation/carnitine transporter 1 (OCTN1), and OCTN2 contribute to the transport of many cation and/or carnitine compounds. Expression changes of these kidney organic ion transporters impair body organic ion balance and induce kidney solute toxicity [7-8]. On the other hand, uric acid and ROS can drive the activation of NOD-like receptor (NLR) superfamily, pyrin domain containing 3 (NLRP3) inflammasome, which is composed of NLRP3, apoptosis-associated speck-like protein (ASC) and Caspase-1[9]. Caspase-1 activation stimulates the maturation of pro-inflammatory cytokines interleukin (IL)-1β and IL-18, which in turn increase tumor necrosis factor α (TNF-α) production [10]. These inflammatory cytokines induce renal injury, contributing to the progression of chronic kidney disease [11]. Therefore, the NLRP3 inflammasome activation may be associated with kidney inflammation and injury in hyperuricemia. Clinically, XOD inhibitor allopurinol is used to treat hyperuricemia. It regulates renal organic ion transporters in
– 330 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
hyperuricemic animals with kidney dysfunction [8, 12], and reduces the NLRP3 inflammasome activation [13]. However, allopurinol has severe side-effects such as hypersensitivity syndrome [14]. Uricosuric agent benzbromaron is withdrawn because it causes frequently fatal hepatic failure [15]. Thus, there is an urgent need for developing novel anti-hyperuricemic agents with great efficacy and favorable safety profile. Resveratrol (3, 5, 4′-trihydroxystilbene) oligomers from in Dipterocarpaceae plants [16], are evidenced to be anti-oxidation [17], anti-inflammation [18], and immunosuppression[19]. In our previous study, resveratrol and its analogues (such as pterostilbene) were reported to have uricosuric and nephroprotective effects in hyperuricemic mice by regulating renal organic ion transporters [20]. However, resveratrol oligomers with anti-hyperuricemic and anti-inflammatory effects in Dipterocarpaceae plants have not yet been identified. Herein, our curiosity about this topic was expanded to vaticaffinol, a resveratrol tetramer isolated from branches and twigs of Dipterocarpus alatu Roxb. We firstly demonstrated that vaticaffinol showed anti-hyperuricemic and anti-inflammatory effects in hyperuricemic mice by inhibiting liver XDH and XOD activity, regulating renal organic ion transporters and suppressing renal NLRP3 inflammasome activation. These findings indicated that vaticaffinol might be useful in the prevention and treatment of hyperuricemia with kidney inflammation.
Materials and Methods Plant Materials The branches and twigs of D. alatus were collected from the campus of Kasetsart University in Thailand, in April 2010, and were authenticated by Prof. Srunya Vajrodaya, Kasetsart University, Thailand. A voucher specimen (IFB11DA01) was deposited in the herbarium of Nanjing University, P. R. China. These plant samples were air-dried at room temperature to constant weight. Chemicals and Reagents Potassium oxonate, allopurinol, xanthine, nicotinamide adenine dinucleotide (NAD+), as well as hematoxylin and eosin (H&E) reagent were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Assay kits of creatinine and blood urine nitrogen (BUN) were obtained from Jiancheng Biotech (Nanjing, China). ELISA assay kits of IL-1β, IL-6, IL-18 and TNF-α were purchased from IBL (Minneapolis, MN, USA). TRIzol reagent and Moloney murine leukemia virus (MMLV) reverse transcriptase were obtained from Invitrogen (Carlsbad, CA, USA). All primers used in the present study were designed and synthesized by Generay Biotech (Shanghai, China). Taq DNA polymerase and polymerase chain reaction (PCR) buffer mixture were obtained from Genescript Company Limited (Nanjing, China). Primary antibodies against mURAT1, mGLUT9, mOAT1, mOCT1, and mOCT2 were provided by Cellchip Biotech (Beijing, China), of mOCTN1
from Alpha Diagnostic International Inc. (San Antonio, TX, USA). Antibodies against mOCTN2, mNLRP3, mASC, and mCaspase-1 were from Abcam Inc. (Cambridge, MA, USA). Mouse glyceraldehyde-3-phosphate dehydrogenase (mGAPDH) monoclonal antibody was obtained from Kangcheng Biotech (Shanghai, China). α-Tubulin antibody was supplied by Santa Cruz Biotechnology (Santa Cruz, CA, USA). HRP-conjugated goat anti-rabbit IgG was obtained from KPL (Gaithersburg, MD, USA). Other reagents and solvents were of analytical grade and purchased from local firms. Extraction, isolation, and purification of vaticaffinol The air-dried plant materials of D. alatus (1000 g) were extracted thrice with 85% ethanol at room temperature for 24 h each. Evaporation of the solvents under the reduced pressure afforded the crude ethanol extract (76.8 g), which was chromatographed over silica gel column (200-300 mesh, Qingdao Marine Chemical Company, China) eluted with pure chloroform initially, followed by a chloroform: methanol mixture (100 : 5; 100 : 10; 100 : 20; 100 : 50; 100 : 100; 0 : 100, each 2 L) to produce 13 fractions (A to M). Amount them, Fraction L exhibited anti-hyperuricemic activity in animal model of hyperuricemia. Therefore, this fraction was further separated by gel filtration over Sephadex LH-20 (Pharmacia Biotech, Sweden) with MeOH to give fractions L1-L45, according to thin layer chromatography (TLC, Qingdao Marine Chemical Company, China), and Fractions L30-L45 were merged and subjected to semi-preparative HPLC using a PU-2080 pump (Hitachi, Japan) equipped with a L-7400 multi-wavelength detector (Hitachi, Japan) and a 2.5 μm Allsphere-ODS column (250 mm × 4.6 mm; Alltech, USA). The mobile phase was 100% MeOH (solvent A) and ultrapure water (solvent B). The elution conditions were as follows: 30% A to 70% B at a flow rate of 2 mL·min-1. Thus, 1.30 g of Compound 1 was obtained and had a molecular formula of C56H42O12 determined by the LC-MS assay (m/z 907.2752, [M + H]+). The LC-MS analysis was accomplished on an Agilent 6210 TOF LC-MS spectrometer equipped with an Agilent ZORBAX SB-C18 column (5 μm, 150 mm × 2.1 mm). The electrospray ionization interface was operated in positive mode with the source temperature at 350 °C, and curtain gas was flowed at 10 L·min-1 (spray voltage at 4500 V). The compound structure was identified as 2, 2a, 7, 7a, 12, 12a, 17, 17a-octahydro-2, 7, 12, 17-tetrakis (4- hydroxyphenyl)-, (2R, 2aR, 7S, 7aR, 12S, 12aR, 17S, 17aR)-rel-(-)-, (vaticaffinol, Figs. 1A and 1B) by 1H NMR analysis (Bruker DRX500 NMR spectrometer with tetramethylsilane) and comparison with literature data [21]. The purity was estimated directly from the 1H-NMR spectrum (Fig. 1B) and HPLC analysis (Fig. 2) to be greater than 99%. Vaticaffinol was verified as a genuine resveratrol tetramer since it was detectable by assays of HPLC (Fig. 2) and LC-MS (Fig. 1S) in the fresh D. alatus ethanol extract prior to the separation procedure.
– 331 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
Fig. 1 The structure (A) and 1H-NMR spectrogram (B) of vaticaffinol isolated from the fresh D. alatus ethanol extract (measured in DMSO-d6 at 500 MHz; δ in ppm, J in Hz)
Fig. 2 Representative HPLC chromatogram of vaticaffinol and crude ethanol extract of D. alatus. (Agilent 1100 series system hyphened with quaternary pumps, an automatic injector, UV tunable absorbance detector operated at 210 nm, and a 250 mm × 4.6 mm × 5 μm Eclipse XDB-C18 column was used for the separation. HPLC analysis condition: water/MeOH = 70/30 vol %; Flow rate: 1 mL·min–1, 5 μL injection)
Animals Male Kun-Ming mice (weighing 18–22 g) were purchased from the Animal Centre of Qing-Longshan (Nanjing, China) and housed in a temperature- and humidity-controlled environment with a 12 h/12 h light/dark cycle. Experiments reported in this study were carried out in accordance with the
recommendations in the guidelines of the Ministry of Science and Technology of China (2006) and the related ethnical regulations of Nanjing University [SYXK (SU) 2009-0017] A hundred and fifty mice were divided into ten groups: normal + water; oxonate + water; oxonate + 20, 40, and 60 mg·kg–1 of vaticaffinol; oxonate + 5 mg·kg-1 of allopurinol (as a posi-
– 332 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
tive control); normal + 20, 40, and 60 mg·kg-1 of vaticaffinol; normal + 5 mg·kg–1 of allopurinol. Hyperuricemic mice were orally administered by 250 mg·kg-1 oxonate once daily at 8: 00 a.m. for seven consecutive days. Vaticaffinol and allopurinol were orally initiated at 9: 00 a.m. on the day after oxonate was given. All the tested samples were dispersed in distilled water. Standard diet, but not water, was withdrawn from the animals 1 h prior to the administration. Urine collection All the mice were transferred into metabolic cages to collect 24-h urine samples after the administration on the 6th day. They had free access to standard chow and tap water. Urine volume of each of the mice was recorded. Urine samples were centrifuged at 2 000 × g for 10 min at 4 °C. The supernatants were deposited at –20 °C until analysis. Blood and tissue sample collection Animals were killed by decapitation at 1 h after the final treatment on the 7th day, whole blood samples were collected and centrifuged at 10 000 × g for 5 min to obtain the serum, and stored at –20 °C until assays for serum uric acid (SUA) and creatinine (SCr), BUN, IL-1β, IL-6, IL-18 and TNF-α levels. Simultaneously, mouse liver tissues were excised on an ice plate, frozen in liquid nitrogen immediately and stored at –80 °C until XDH and XOD activity analysis. Kidney cortex tissues were dissected quickly and carefully on an ice plate, and parts of them were immediately fixed for H&E
staining analysis, while the remainder was immediately frozen in liquid nitrogen and then stored at –80 °C until RT-PCR and Western blot analyses, respectively. Analyses of uric acid, creatinine, BUN, and proinflammatory cytokine levels SUA and UUA levels were determined by the phosphotungstic acid method as our previously reported [22-23]. SCr, UCr and BUN, serum IL-1β, IL-6, IL-18, and TNF-α levels were measured using standard diagnostic kits, respectively. FEUA was calculated using the formula: FEUA= (UUA × SCr) / (SUA × UCr) × 100, expressed as percentage. XDH and XOD activity analysis Hepatic activity of XDH and XOD was assayed by monitoring uric acid formation using a spectrophotometric method described in our previous report [24]. H&E staining and pathology analysis Mouse kidney tissues were removed and immediately fixed for H&E staining analysis according the method described in our previous report [25]. Semi-Quantitative RT-PCR Gene expression analysis for animal kidney cortex was performed by semi-quantitative RT-PCR method [25]. The sequences of gene-specific PCR primers, the length of production and the appropriate annealing temperature are summarized in Table 1. The reversed transcription products were then subjected to PCR and analyzed as previously described [22, 25].
Table 1 Gene-specific PCR primer sequences, the length of amplificated product, numbers of thermal cycle and the appropriate annealing temperature used in the experiments Description
Genebank
Sense primer (5’→3’)
Antisense primer (5’→3’)
Product size (bp)
Numbers of thermal cycle
Tm (°C)
mGLUT9
NP 001012363
GAGATGCTCATTGTGGGACG
GTGCTACTTCGTCCTCGGT
316
30
56
mURAT1
NM 009203
GCTACCAGAATCGGCACGCT
CACCGGGAAGTCCACAATCC
342
30
58
mOAT1
NM 008766
ACGGGAAACAAGAAGAGGG
AAGAGAGGTATGGAGGGGTAG
580
29
56
mOCT1
NM 009202
ACATCCATGTTGCTCTTTCG
TTGCTCCATTATCCTTACCG
315
29
56
mOCT2
NM 013667
ACAGGTTTGGGCGGAAGT
CACCAGAAATAGAGCAGGAAG
331
29
56
mOCTN1
NM 019687
TGTTCTTCGTAGGCGTTCT
TGGAATAAACCACCACAGG
392
30
53.3
mOCTN2
NM 011396
TCTACGAAGCCTCAGTTGC
ATTCCTTTGACCCTTAGCAT
623
30
53.3
mGAPDH
NM 008084
TGAGGCCGGTGCTGAGTATGT
CAGTCTTCTGGGTGGCAGTGAT
299
35
58
mURAT1, mouse urate transporter 1; mGLUT9, mouse glucose transporter 9; mOAT1, mouse organic anion transporter 1; mOCT1, mouse organic cation transporter 1; mOCT2, mouse organic cation transporter 2; mOCTN1, mouse organic cation/carnitine transporter 1; mOCTN2, mouse organic cation/carnitine transporter 2; mGAPDH, mouse glyceraldehyde-3-phosphate dehydrogenase
Western blot analysis mURAT1, mOCTN1 and mOCTN2 of renal cortical brush-border membrane vesicles, and mGLUT9, mOAT1, mOCT1, mOCT2, mNLRP3, mASC, mCaspase-1 and mGAPDH of renal cortex tissues were analyzed by Western blot as described before [22-23, 25]. Statistical analysis Values were expressed as means ± SD. Statistical analysis was performed using the Statistical Analysis System (Graph Pad Prism 5; Graph Pad Software, Inc., San Diego, CA, USA). Statistical differences between groups were determined
using one-way analysis of variance (ANOVA) followed by a post hoc test (Fisher’s Least Significant Difference test) as appropriate. P < 0.05 was considered statistically significant.
Results Effects of vaticaffinol on serum uric acid levels and kidney function in hyperuricemic mice As shown in Table 2, oxonate significantly increased serum levels of uric acid, creatinine and BUN, decreased urine levels of uric acid, and creatinine in mice compared with control group. Vaticaffinol at 20, 40, and 60 mg·kg–1 effectively
– 333 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
decreased serum levels of uric acid, creatinine and BUN in hyperuricemic mice. Vaticaffinol at 40 mg·kg-1 remarkably increased urine levels of uric acid and creatinine in hyperuricemic mice. In addition, allopurinol at 5 mg·kg–1 also re-
stored the alteration of serum uric acid, creatinine and BUN, as well as urine uric acid and creatinine in this animal model (Table 2). Of note, vaticaffinol had no effects of these biochemical indexes in the normal mice.
Table 2 Effects of vaticaffinol on serum uric acid levels and kidney function in oxonate-induced hyperuricemic mice Group
Serum (mg·dL–1)
Dose (mg·kg–1)
Uric acid
Urine (mg·dL–1)
Creatinine
BUN
Uric acid
Creatinine
FEUA (%)
Normal Vehicle
-
2.84 ± 0.23
0.67 ± 0.05
15.36 ± 2.33
85.02 ± 3.55
110.71 ± 6.43
18.49 ± 1.01
Allopurinol
5
2.71 ± 0.28
0.71 ± 0.06
15.3 9± 2.93
83.46 ± 2.48
115.23 ± 12.86
18.23 ± 2.42
20
2.77 ± 0.42
0.68 ± 0.06
14.30 ± 4.28
82.52 ± 2.48
111.08 ± 7.92
17.47 ± 0.92
40
2.74 ± 0.18
0.69 ± 0.06
15.13 ± 2.73
78.15 ± 4.72
104.30 ± 3.92
18.57 ± 1.09
60
2.68 ± 0.33
0.73 ± 0.08
16.33 ± 2.34
84.40 ± 6.76
117.49 ± 2.85
18.82 ± 0.72
Vaticaffinol
Hyperuricemia Vehicle
-
4.10 ± 0.38+++
0.93 ± 0.10+++
19.93 ± 1.78++
60.04 ± 1.62++
89.97 ± 6.43+
15.77 ± 0.89++
Allopurinol
5
2.95 ± 1.00*
0.69 ± 0.08***
15.62 ± 1.99**
81.90 ± 0.54**
129.94 ± 5.58**
17.23 ± 0.69**
Vaticaffinol
**
20
3.21 ± 0.45
40
2.73 ± 0.47***
60
***
2.76 ± 0.31 ++
The values are mean ± SD (n = 10). P < 0.01 and
+++
0.76 ± 0.07
**
17.31 ± 2.47
0.70 ± 0.08*** 0.66 ± 0.12
*
64.10 ± 2.71
16.39 ± 1.48**
**
14.22 ± 2.04 *
***
93.74 ± 1.73
91.27 ± 1.43*** 70.97 ± 5.49 **
P < 0.001 vs normal + vehicle group. P < 0.05, P < 0.01 and
***
16.68 ± 1.22
119.00 ± 4.08**
20.44 ± 2.00**
94.12 ± 5.88
18.13 ± 1.63**
P < 0.001 vs hyperuricemia + vehicle group.
60 mg·kg-1 of vaticaffinol notably inhibited hepatic XDH and XOD activity in hyperuricemic mice, by 28.62, 51.72, and 44.46% for XDH, and 24.56, 54.61 and 45.17% for XOD, respectively (Table 3). Allopurinol at 5 mg·kg-1 suppressed liver XDH and XOD activity by 54.17 and 56.08%, respectively (Table 3).
Effects of vaticaffinol on liver XDH and XOD activity in hyperuricemic mice To determine whether vaticaffinol had effect on uric acid production in hyperuricemic mice, liver activity of XDH and XOD were determined. Compared with model group, 20, 40, and
Table 3 Effects of vaticaffinol on hepatic XOD and XDH activity in the normal and hyperuricemic mice. Group
Dose (mg·kg–1)
XDH
XOD
Inhibition (%)
(nmole uric acid·mg–1 protein)
XDH
XOD
49.49
45.61
Normal Vehicle Allopurinol Vaticaffinol
-
9.92 ± 1.18
10.03 ± 1.37
5.01 ± 0.53
+++
20
7.85 ± 0.76
++
40
5.47 ± 0.90+++
5
5.46 ± 0.99+++
20.84
16.88
5.78 ± 0.56+++
44.83
42.35
+++
21.73
30.10
4.80 ± 0.63***
5.12 ± 0.87***
56.08
54.17
***
***
60
7.76 ± 0.91
Vehicle
-
10.92 ± 1.00
Allopurinol
5
8.34 ± 0.67
+
++
7.01 ± 0.92
Hyperuricemia
Vaticaffinol
11.16 ± 0.65
20
7.80 ± 1.26
28.62
24.56
40
5.27 ± 0.72***
5.07 ± 0.64***
51.72
54.61
60
***
***
44.46
45.17
6.07 ± 0.88
8.42 ± 0.98 6.12 ± 0.92
The values are mean ± SD (n = 10). + P < 0.05, ++ P < 0.01 and +++ P < 0.001 vs normal + vehicle group; *** P < 0.001 vs hyperuricemia + vehicle group
In the normal mice, vaticaffinol and allopurinol also significantly inhibited liver XDH and XOD activity by 20.84, 44.83 and 21.73% for XDH, and 16.88, 42.35 and 30.10% for XOD, respectively (Table 3). Allopurinol at 5 mg·kg-1 reduced liver XDH and XOD activity in mice by 49.49 and 45.61%, respectively (Table 3).
Effects of vaticaffinol on renal mURAT1 mRNA and protein levels in hyperuricemic mice Compared with the normal group, renal mURAT1 mRNA and protein levels were significantly increased in hyperuricemic mice (Figs. 3 A and B). Vaticaffinol at 20, 40, and 60 mg·kg–1 remarkably down-regulated renal
– 334 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
mURAT1 mRNA and protein levels in hyperuricemic mice. Allopurinol at 5 mg·kg–1 also restored the change of mU-
RAT1 mRNA and protein levels in hyperuricemic mice (Figs. 3A and 3B).
Fig. 3 Effects of vaticaffinol on renal mRNA and protein levels of mURAT1 (A and B) and mGLUT9 (C and D) in the normal and oxonate-induced hyperuricemic mice. The values are mean ± SD (n = 4). ++P < 0.01 vs normal + vehicle group. * P < 0.05, ** P < 0.01, *** P < 0.001 vs hyperuricemia + vehicle group Effects of vaticaffinol on renal mGLUT9 mRNA and protein levels in hyperuricemic mice Oxonate remarkably increased renal mGLUT9 mRNA and protein levels in mice (Figs. 3 C and D). Vaticaffinol at 20, 40, and 60 mg·kg–1 dramatically down-regulated renal mRNA and protein levels of mGLUT9 in hyperuricemic mice. Allopurinol at 5 mg·kg–1 also restored the up-regulation of renal mGLUT9 mRNA and protein levels in this animal model (Figs. 3 C and D). Effects of vaticaffinol on renal mOAT1 mRNA and protein levels in hyperuricemic mice In the present study, hyperuricemic mice observably
produced a reduction of renal mOAT1 mRNA and protein levels (Figs. 4 A and B). Vaticaffinol at 20, 40, and 60 mg·kg–1 dramatically up-regulated renal levels of mOAT1 mRNA and protein in hyperuricemic mice (Figs. 4A and B). 5 mg·kg–1 of allopurinol also remarkably increased renal mOAT1 mRNA and protein levels in hyperuricemic mice (Figs. 4 A and B). Effects of vaticaffinol on renal mOCT1 and mOCT2 mRNA and protein levels in hyperuricemic mice Compared with the normal control, oxonate markedly reduced renal mRNA and protein levels of mOCT1 (Figs. 5A and B), and mOCT2 (Figs. 5 C and D) in mice. Vaticaffinol at 20, 40, and
– 335 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
60 mg·kg–1 effectively up-regulated renal mOCT1 and mOCT2 mRNA and protein levels (Figs. 5 A–D) in hyperuricemic mice.
Allopurinol also significantly increased renal levels of mOCT1 and mOCT2 mRNA and protein in hyperuricemic mice (Figs. 5 A-D).
Fig. 4 Effects of vaticaffinol on renal mRNA and protein levels of mOAT1 (A and B) in the normal and oxonate-induced hyperuricemic mice. The values are mean ± SD (n = 4). ++ P < 0.01, +++ P < 0.01 vs normal + vehicle group；** P < 0.01, *** P < 0.001 vs hyperuricemia + vehicle group
– 336 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
Fig. 5 Effects of vaticaffinol on renal mRNA and protein levels of mOCT1 (A and B), mOCT2 (C and D), mOCTN1 (E and F) and mOCTN2 (G and H) in the normal and oxonate-induced hyperuricemic mice. The values are mean ± SD (n = 4). + P < 0.05, ++ P < 0.01, +++ P < 0.001 vs normal + vehicle group; * P < 0.05, ** P < 0.01, *** P < 0.001 vs hyperuricemia + vehicle group Effects of vaticaffinol on renal mOCTN1 and mOCTN2 mRNA and protein levels in hyperuricemic mice Compared with the normal control, oxonate remarkably renal mRNA and protein levels of mOCTN1 (Figs. 5 E and F) and mOCTN2 (Figs. 5 G and H) in mice. Vaticaffinol at 20, 40, and 60 mg·kg–1 obviously up-regulated renal mRNA and protein levels of mOCTN1 (Figs. 5E and F) and mOCTN2 (Figs. 5 G and H) in hyperuricemic mice. Allopurinol also significantly increased renal mOCTN1 and mOCTN2 mRNA and protein levels in hyperuricemic mice (Figs. 5 E–H). Effects of vaticaffinol on renal NLRP3 inflammasome activation and serum proinflammatory cytokine levels in hyperuricemic mice Oxonate remarkably increased renal protein levels of mNLRP3 (Fig. 6A), mASC (Fig. 6B), and mCaspase-1 (Fig. 6C) in mice. Vaticaffinol at 40 and 60 mg·kg–1 succeeded in
restoring oxonate-induced over-expression of renal NLRP3 inflammasome components. Allopurinol at 5 mg·kg–1 significantly decreased renal protein levels of mNLRP3, mASC, and mCaspase-1 in hyperuricemic mice (Figs. 6A–C). Consistently, histological analyses confirmed that vaticaffinol at 40 and 60 mg·kg–1, as well as 5 mg·kg–1 allopurinol restored oxonate-induced tubulointerstitial pathology of renal proximal tubular epithelial cell degeneration, cytoplasmic relaxation, and slight inflammatory infiltrate in mice, respectively (Fig. 6D). Furthermore, serum IL-1β, IL-6, IL-18 and TNF-α levels (P < 0.001) were increased simultaneously in hyperuricemic mice (Table 4), which were restored by vaticaffinol at 40 and 60 mg·kg–1. Vaticaffinol at 20 mg·kg–1 only reduced serum TNF-α levels in this animal model (Table 4). Allopurinol at 5 mg·kg–1 significantly decreased serum levels of these inflammatory cytokines in hyperuricemic mice (Table 4).
– 337 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
Fig. 6 Effects of vaticaffinol on renal protein levels of mNLRP3 (A), mASC (B) and mCaspase-1 (C) and renal morphological changes (D) in the normal and oxonate-induced hyperuricemic mice. The values are means ± SD (n = 6), ++ P < 0.01, +++ P < 0.01 vs normal + vehicle group; *P < 0.05, **P < 0.01, ***P < 0.001 vs hyperuricemia + vehicle group. Vaticaffinol at 40 and 60 mg·kg–1 and 5 mg·kg–1 allopurinol improved oxonate-induced tubulointerstitial pathology of renal proximal tubular epithelial cell degeneration, cytoplasmic relaxation and slight inflammatory infiltrate in mice, respectively. The scale bar represents 50 μm Table 4 Effects of vaticaffinol on serum IL-1β, IL-6, IL-18 and TNF-α levels in oxonate-induced hyperuricemic mice Dose (mg·kg–1)
IL-1β (ng·L–1)
IL-6 (ng·L–1)
Vehicle
-
3.98 ± 0.76
10.11 ± 0.49
9.90 ± 0.40
11.29 ± 2.04
Allopurinol
5
4.26 ± 0.85
9.91 ± 0.41
10.99 ± 2.27
11.52 ± 3.10
20
4.12 ± 0.44
10.98 ± 0.68
11.09 ± 1.06
11.55 ± 2.43
40
4.21 ± 0.66
10.27 ± 0.74
11.70 ± 0.83
12.32 ± 2.67
60
4.25 ± 1.30
10.02 ± 0.48
11.99 ± 0.68
10.55 ± 2.10
Group
IL-18 (ng·L–1)
TNF-α (ng·L–1)
Normal
Vaticaffinol
Hyperuricemia Vehicle
-
6.85 ± 0.86+++
14.05 ± 1.55+++
21.70 ± 1.25+++
21.96 ± 4.12+++
Allopurinol
5
4.48 ± 0.54***
10.99 ± 0.45***
9.44 ± 0.46***
11.33 ± 3.82***
20
6.91 ± 1.25
16.27 ± 2.96
40
4.64 ± 2.16*
Vaticaffinol
60
3.84 ± 1.21
14.23 ± 1.43
***
10.29 ± 0.63
16.00 ± 5.07*
21.47 ± 1.13
***
11.04 ± 1.08***
12.13 ± 3.18***
***
11.41 ± 2.61***
9.89 ± 0.81
The values are mean ± SD (n = 6). +++ P < 0.001 vs normal + vehicle group; *P < 0.05 and ***P < 0.001 vs hyperuricemia + vehicle group.
Discussion Dipterocarpaceous plants contain various resveratrol oli-
gomers, and some of them reduce ROS production and have anti-oxidant activity [26]. XDH and XOD catalyze the oxidation of hypoxanthine to xanthine and then to uric acid. In the
– 338 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
present study, vaticaffinol was found to inhibit hepatic XDH and XOD activity in hyperuricemic mice, which may partly contribute to its reduction of serum uric acid levels. FEUA is an important parameter of kidney urate handling. In the present study, vaticaffinol remarkably increased FEUA in hyperuricemic mice. Of note, vaticaffinol at 40 mg·kg–1 seemed to be more potent than allopurinol at 5 mg·kg–1, but they had similar inhibitory action on hepatic XDH and XOD activity in hyperuricemic mice. These observations indicated that vaticaffinol might enhance kidney urate excretion to reduce serum urate levels in hyperuricemia. URAT1 and GLUT9 control renal urate re-absorption to mediate renal urate handling for the regulation of blood urate homeostasis. They are considered as the promising therapeutic targets for hyperuricemia and gout [3-4]. OAT1 mediates urate secretion and is associated with the progression of chronic kidney disease [27]. In the present study, vaticaffinol was found to down-regulate the mURAT1 and mGLUT9 mRNA and protein levels, and up-regulate the mOAT1 mRNA and protein levels in the kidney of hyperuricemic mice. The reason for vaticaffinol’s reduction of serum urate levels may be probably the involvement in the regulation of these renal urate transport-related transporters, resulting in the enhancement of kidney urate excretion in hyperuricemic mice. Kidney URAT1, GLUT9 and OAT1 may point toward molecular targets for vaticaffinol as a novel anti-hyperuricemic agent. Hyperuricemia is associated with kidney dysfunction. OCT1, OCT2, OCTN1 and OCTN2 play the predominant roles in modifying kidney transport of cation and carnitine [7-8]. Abnormal expression of renal mOCT1, mOCT2, mOCTN1 and mOCTN2 is observed in hyperuricemia with kidney dysfunction [12, 25]. Allopurinol improves renal function in hyperuricemia by up-regulating renal expression of mOCT1, mOCT2, mOCTN1 and mOCTN2 in hyperuricemic mice and chronic kidney disease patients [22, 28]. In the present study, vaticaffinol and allopurinol were able to up-regulate renal mOCT1, mOCT2, mOCTN1 and mOCTN2 mRNA and protein levels in hyperuricemic mice, which were consistent with the restoration of kidney dysfunction. The NLRP3 inflammasome is one of the innate immune cell sensors. Recently, uric acid and ROS are reported to activate the NLRP3 inflammasome and produce IL-1β [29]. This inflammasome activation promotes kidney inflammation, contributing to chronic kidney disease [11]. In the present study, renal NLRP3 inflammasome activation was activated in hyperuricemic mice, as evidenced by up-regulating the mNLRP3, mASC and mCaspase-1 protein levels. Consistently, systemic inflammation and renal injury were further confirmed in this animal model. Vaticaffinol and allopurinol obviously suppressed renal NLRP3 inflammasome activation, and subsequently reduced systemic inflammation and renal injury in hyperuricemic mice. These results indicated that vaticaffinol with the reduction of serum urate levels may tar-
get the NLRP3 inflammasome to alleviate inflammatory response and injury in hyperuricemia, showing its improvement of kidney function. Hyperuricemia in organ transplantation, cancer and HIV/AIDS is an increasing and challenging clinical problem. Additionally, hyperuricemia is a common side-effect of immunosuppressive drugs such as mizoribine that interfere with purine metabolism [30]. More importantly, vaticaffinol is found to have the immunosuppressive activity by affecting multiple targets against activated T cells. Thus, vaticaffinol may be used to treat hyperuricemia with the immune system disorder. Further studies are required to understand the precise mechanisms of vaticaffinol-mediated these effects. In conclusion, vaticaffinol, a resveratrol tetramer, was isolated and identified from the branches and twigs of D. alatus. This resveratrol tetramer was found to possess anti-hyperuricemic and anti-inflammatory activity in hyperuricemic mice. The inhibition of liver XDH and XOD activity, regulation of renal mURAT1, mGLUT9, mOAT1, mOCT1, mOCT2, mOCTN1, and mOCTN2, as well as suppression of renal NLRP3 inflammasome activation might be involved in the novel mechanisms of its actions in hyperuricemia. These results suggest that vaticaffinol may be potential for the prevention and treatment of hyperuricemia with kidney inflammation. Further clinical studies are needed to evaluate its efficacy.
References [1]
Puddu P, Puddu GM, Cravero E, et al. Relationships among hyperuricemia, endothelial dysfunction and cardiovascular disease: molecular mechanisms and clinical implications [J]. J Cardiol, 2012, 59(3): 235-242. [2] Martin AC, Brown MA. Could uric acid have a pathogenic role in pre-eclampsia? [J]. Nat Rev Nephrol, 2012, 6(12): 744-748. [3] Kanai Y. Molecular mechanisms of urate transport in renal tubules: localization and function of urate transporters [J]. Nihon Rinsho, 2008, 66(4): 659-666. [4] Preitner F, Bonny O, Laverrière A, et al. Glut9 is a major regulator of urate homeostasis and its genetic inactivation induces hyperuricosuria and urate nephropathy [J]. Proc Natl Acad Sci USA, 2009, 106(36): 15501-15506. [5] Fu W, Li Q, Yao J, et al. Protein expression of urate transporters in renal tissue of patients with uric acid nephrolithiasis [J]. Cell Biochem Biophys, 2014, 70(1): 449-454. [6] Eraly SA, Vallon V, Rieg T, et al. Multiple organic anion transporters contribute to net renal excretion of uric acid [J]. Physiol Genomics, 2008, 33(2): 180-192. [7] Johnston RA, Rawling T, Chan T, et al. Selective inhibition of human solute carrier transporters by multikinase inhibitors [J]. Drug Metab Dispos, 2014, 42(11): 1851-1857. [8] Diaz-Torné C, Perez-Herrero N, Perez-Ruiz F. New medications in development for the treatment of hyperuricemia of gout [J]. Curr Opin Rheumatol, 2015, 27(2): 164-169. [9] Schroder K, Zhou R, Tschopp J. The NLRP3 inflammasome: a sensor for metabolic danger? [J]. Science, 2010, 327(5963): 296-300. [10] Zhou R, Yazdi A, Menu P, et al. A role for mitochondria in NLRP3 inflammasome activation [J]. Nature, 2010, 469(7329):
– 339 –
CHEN Yu-Sheng, et al. / Chin J Nat Med, 2017, 15(5): 330340
221-225. [11] Vilaysane A, Chun J, Seamone ME, et al. The NLRP3 inflammasome promotes renal inflammation and contributes to CKD [J]. J Am Soc Nephrol, 2010, 21(10): 1732-1744. [12] Wang R, Ma CH, Zhou F, et al. Siwu decoction attenuates oxonate-induced hyperuricemia and kidney inflammation in mice [J]. Chin J Nat Med, 2016, 14(7): 499-507. [13] Griffith JW, Sun T, McIntosh MT, et al. Pure Hemozoin is inflammatory in vivo and activates the NALP3 inflammasome via release of uric acid [J]. J Immunol, 2009, 183(8): 5208-5220. [14] Stamp L, Taylor W, Jones P, et al. Starting dose is a risk factor for allopurinol hypersensitivity syndrome: a proposed safe starting dose of allopurinol [J]. Arthritis Rheum, 2012, 64(8): 2529-2536. [15] Lee MH, Graham GG, Williams KM, et al. A benefit-risk assessment of benzbromarone in the treatment of gout. Was its withdrawal from the market in the best interest of patients? [J]. Drug Saf, 2008, 31(8): 643-665. [16] Shen T, Wang XN, Lou HX. Natural stilbenes: an overview [J]. Nat Prod Rep, 2009, 26(7): 916-935. [17] Ge HM, Yang WH, Zhang J, et al. Antioxidant oligostilbenoids from the stem wood of Hopea hainanensis [J]. J Agric Food Chem, 2009, 57(13): 5756-5761. [18] Bereswill S, Munoz M, Fischer A, et al. Anti-inflammatory effects of resveratrol, curcumin and simvastatin in acute small intestinal inflammation [J]. PLoS One, 2010, 5(12): e15099. [19] Feng LL, Wu XF, Liu HL, et al. Vaticaffinol, a resveratrol tetramer, exerts more preferable immunosuppressive activity than its precursor in vitro and in vivo through multiple aspects against activated T lymphocytes [J]. Toxicol Appl Pharmacol, 2013, 267(2): 167-173. [20] Shi YW, Wang CP, Liu L, et al. Antihyperuricemic and nephroprotective effects of resveratrol and its analogues in hyperuricemic mice [J]. Mol Nutr Food Res, 2012, 56(9): 1433-1444.
[21] Sultanbawa MUS, Surendrakumar S, Mohamed IMW, et al. Novel resveratrol tetramer, vaticaffinol, from Vatica affinis Thw. (Dipterocarpaceae) [J]. JCS Chem Comm, 1981, 23: 1204-1206. [22] Li JM, Zhang X Wang X, et al. Protective effects of cortex fraxini coumarines against oxonate-induced hyperuricemia and renal dysfunction in mice [J]. Eur J Pharmacol, 2011, 666 (1-3): 196-204. [23] Ding XQ, Pan Y, Wang X, et al. Wuling san ameliorates urate under-excretion and renal dysfunction in hyperuricemic mice [J]. Chin J Nat Med, 2013, 11(3): 214-221. [24] Wang X, Wang CP, Hu QH, et al. The dual actions of Sanmiao wan as a hypouricemic agent: down-regulation of hepatic XOD and renal mURAT1 in hyperuricemic mice [J]. J Ethnopharmacol, 2010, 128(1): 107-115. [25] Hu QH, Zhang X, Wang X, et al. Quercetin regulates organic ion transporter and uromodulin expression and improves renal function in hyperuricemic mice [J]. Eur J Nutr, 2012, 51(5): 593-606. [26] Chen X, Qiao H, Liu T, et al. Inhibition of herpes simplex virus infection by oligomeric stilbenoids through ROS generation [J]. Antiviral Res, 2012, 95(1): 30-36. [27] Mandal AK, Mercado A, Foster A, et al. Uricosuric targets of tranilast [J]. Pharmacol Res Perspect, 2017, 5(2): e00291. [28] Yelken B, Caliskan Y, Gorgulu N, et al. Reduction of uric acid levels with allopurinol treatment improves endothelial function in patients with chronic kidney disease [J]. Clin Nephrol, 2012, 77(4): 275-282. [29] Braga TT, Forni MF, Correa-Costa M, et al. Soluble uric acid activiates the NLRP3 inflammasome [J]. Sci Rep, 2017, 13(7): 39884. [30] Ding X, Zhu X, Zhang Y, et al. Influence of serum uric acid levels in response to the conversion from mycophenolate mofetil to mizoribine in kidney transplant recipients [J]. Transplant Proc, 2013, 45(1): 190-193.
Cite this article as: CHEN Yu-Sheng, CHEN Chao-Jun, YAN Wei, GE Hui-Ming, KONG Ling-Dong. Anti-hyperuricemic and anti-inflammatory actions of vaticaffinol isolated from Dipterocarpus alatus in hyperuricemic mice [J]. Chin J Nat Med, 2017, 15(5): 330-340
– 340 –