- Email: [email protected]
Approach to the molecular mechanisms of the modulation of growth hormone gene expression by glucocorticoid and thyroid hormones
J. rkwid Biochem. Vol. 27, No. l-3, pp. 149-158, Printed in Great Britain. All rights reserved
1987
0022-473 1/X7 $3.00 + 0.00 Copyright @ 19X7 Pergamon Journals Ltd
Proceedings of the WI International Congress on
Hormonal Steroids (Madrid, Spain, 1986)
APPROACH TO THE MOLECULAR MECHANISMS OF THE MODULATION OF GROWTH HORMONE GENE EXPRESSION BY GLUCOCORTICOID AND THYROID HORMONES G. G. RoussEAu*t, P. H. ELIARD?, J.W. BARLOW?, F. P. LEMAIGREt, D. A. LAFoN’rAINEf’, PH. DE NAmRt, I. V. ECoNOMrDISt, P. FORMSTECHERS, T. IDZIOREK$, M. MATHY-HARTERT§,
M. L. J. Voz§,
A. BELAYEWS and J. A. MARTIAL$
tHormone and Metabolic Research Unit, International Institute of Cellular and Molecular Pathology, and UniversitC de Louvain, 7.5 avenue Hippocrate, B-1200 Brussels, Belgium, SLaboratoire de Biochimie Structurale, Facultt? de MCdicine, 1 Place de Verdun, F-59045 Lille-CCdex, France and PLaboratoire de Genie B-6. University of Likge, B-4000 Sart Tilman, Belgium
Summary-Glucocorticoid and thyroid hormones modulate the expression of the growth hormone gene. To investigate this control mechanism, we have determined whether this gene contains sites that bind the human glucocorticoid and thyroid hormone receptors in t&o. To do so, we have designed a novel assay for studying binding of the purified glucocorticoid receptor to cloned fragments of the human growth hormone (hGH) gene, and have adapted a DNA-competition assay for the thyroid receptor in nuclear cell extracts. Two glucocorticoid receptor binding regions were found in the hGH gene, one of high affinity in a fragment of the gene containing the first intron, and one of low affinity located within a 290 bp-fragment of S-flanking DNA. In contrast, the thyroid receptor bound with high affinity to the S-flanking fragment. Homologous binding regions for the two types of receptor were found in the human placental lactogen (chronic somatomammotropin) gene. DNA binding of the two receptor types appeared to depend on the presence of the hormone, yet antagonist-bound glucocorticoid receptor was still capable of interacting specifically with DNA. There was no evidence for synergism or antagonism of the two receptor types in binding to their respective sites on the hGH gene. The data also make it unlikely that the thyroid receptor negatively controls gene transcription and that the stimulatory effect of thyroid hormone results from a derepression mechanism.
INTRODUCTION
The cloning of genes coding for proteins of the human growth hormone family [l-3] has provided a tool to study the molecular mechanism of gene regulation by glucocorticoid and thyroid hormones. The human growth hormone (hGH)II gene has 92% overall nucleotide sequence homology with the human placental lactogen (chorionic somatomammotropin, hCS) gene [l, 21 and 42% exon sequence homology with the human prolactin (hPRL) gene[3]. Although the PRL gene is much longer (about 10 kb) than the other two (about 2 kb), the three genes all contain five exons of similar size and sequence and are believed to derive from a common ancestor [4,5]. Experiments on cultured rat pituitary cells have shown that glucocorticoids stimulate GH [6] but inhibit PRL [7-91 gene expression. Thy-
*To whom correspondence should be addressed, at UCLICP 7529, 75 avenue Hippocrate, B-1200 Brussels, Belgium. [IAbbreviations: CS, chorionic somatomammotropin; GH, growth hormone; GRE, glucocorticoid response element; hGH, human growth hormone; MMTV, mouse mammary tumor virus; PRL, prolactin; T,, 3,5,3’triiodo-L-thyronine; TRE, thyroid response element.
roid hormone (T3) stimulates GH gene expression and seems to be required for the glucocorticoid hormone effect on that gene; the combined effect of the two hormones is greater than with T, alone [6, 10, 111. T, also reduces PRL mRNA levels in cultured rat pituitary cells [12,13]. Little is known about the hormonal control of CS gene expression. Glucocorticoids act by binding to an intracellular receptor protein and by promoting, through a step called receptor transformation, association of the receptor with defined gene regions called “glucocorticoid response elements” (GRE) that behave as proto-enhancers (reviewed in Ref.[l4]). Thyroid hormone receptors are found in chromatin and are known to bind DNA [ 151. Whether this interaction is specific and the basis for the synergism of T, with glucocorticoids at the gene level is currently undefined. As an approach to these problems, we have searched in the hGH and hCS genes for regions that might bind in vitro the human glucocorticoid and T3 receptors preferentially, and for possible interactions between those receptors. All experiments were performed with cloned gene fragments and with extracts from human lymphoblastoid (IM-9) cells as a source of receptors. 149
G. G. ROUSSEAU ef al
150 MATERIALS
AND METHODS
Preparation of DNA Fragments from the cloned hGH-N and hCS-B genes and from the rat GH (rGH) gene were purified and blunt-ended as described [ 161. Plasmid pBR322 DNA was from blunt-ended, linearized fragments described in individual experiments. LTR45 1 DNA was an EcoRI 1300-bp fragment from a MMTV LTR-tk chimaeric plasmid [17], kindly provided by Dr B. Groner. This fragment contains a GRE within the 451-bp sequence upstream from the viral transcription initiation (cap) site. For assays involving radioactive DNA, fragments were end-labeled with 32P either by the Klenow fragment of DNA polymerase I or by T, polynucleotide kinase [ 181. Glucocorticoid hormone receptors For assays with unpurified receptors, cytosols prepared from IM-9 cells [16] were labeled with 25 nM [3H] dexamethasone at 0°C for at least 2 hand then transformed by raising the temperature to 25°C for 30 min in presence of 0.1 mM phenylmethylsulfonylfluoride. For the DNA-binding assay with purified receptors, purification was carried out by affinity chromatography on a dexamethasoneSepharose gel [ 19,201. Thyroid hormone receptors Since no satisfactory method for receptor purification is available, we use unpurified receptors in nuclear extracts from IM-9 cells. Such extracts were incubated for 4 h at 25°C with ‘*51-labeled T, under conditions where specific T, binding assayed by a hydroxyapatite method corresponds to T3 receptors [21]. Receptor site concentration and affinity were 22.4 fmol/mg protein and 0.14 nM, respectively. DNA- binding assays for the glucocorticoid receptor Two techniques were used: one with unpurified receptors [22] to mimic the situation with Ti receptors, and a new, original, technique with purified receptor. The principle of the latter method is to purify the receptor by steroid affinity chromatography and to incubate matrix-bound receptor with 32P-labeled DNA. Bound DNA can then be determined quantitatively by counting the affinity matrix and qualitatively by DNA agarose gel electrophoresis after elution from the matrix. To do so, 10 vol of cytosol in TEDG buffer (20 mM Tricine, 1 mM EDTA, 2 mM dithiothreitol, 20% glycerol v/v, pH 7.4) were agitated at 4°C with 1 vol of affinity matrix equilibrated in the same buffer. After 16 h, receptor on the matrix was transformed by bringing the mixture to 25°C for 30 min. The matrix was then washed at 0-4°C successively with lOO-vol aliquots of TEDG buffer alone, or containing 300 mM NaCl, or containing 0.1 mg/ml bovine serum albumin. The matrix was then resuspended in 10 vol of the latter washing buffer. Silver staining,
using SDS-PAGE, of the proteins retained on the matrix at this stage showed a major band at about 90 kDa. This band was also seen by autoradiography when electrophoresing an eluate of the affinity matrix obtained with ‘H-labeled dexamethasone mesylate, which is known to bind the receptor covalently. When used for competition experiments, the assay was conducted as follows. Eppendorf tubes (1 .S ml) received successively up to SO ~1 of unlabeled purified competitor DNA fragment (up to 250 ng/tube), SO ~1 of 0.6 M NaCI, 20,000 d.p.m. (about 5 ng) of ‘*P-labeled tracer DNA fragment (e.g. LTR451), 3 ~1 of a bovine serum albumin solution at 10 mg/ml, TEDG buffer up to 250 ~1, and lastly SO ~1 of receptor-containing affinity matrix (i.e. 5 ~1 of packed gel). The tubes were agitated slowly for 60 min at 2~5°C and then the matrix was washed 3 times (Beckman microfuge) with 1 ml of TEDG buffer containing SO mM NaCl. The radioactivity in the pellet was determined by Cerenkov radiation. In experiments with a radioactive mixture of well-characterized fragments of different lengths, the incubations were prepared as above except that 20,000d.p.m. of 32P-labeled DNA mixture were added first and unlabeled DNA was omitted. After the final washing, the matrix pellet was resuspended in 20 ~1 of a 0.1% SDS solution at 37°C spun, and the supernatant processed using agarose gel electrophoresis and autoradiography. The second method involves in uitro transformation of the ‘H-labeled dexamethasone-receptor complex in cytosol followed by incubation of the cytosol with calf thymus DNA-cellulose in the absence or presence of known concentrations of the competing DNA fragment of interest. After washing, the DNA-cellulose bound radioactivity is measured [ 161. Plots of the ratio of the radioactivity from incubations conducted in the absence of competing DNA as a function of the amount of competing DNA added yield a straight line, the slope of which is proportional to the affinity of the receptor for the competing DNA fragment. When investigating possible interactions with the thyroid hormone receptor (Table I), 5 I_LIof packed DNA-cellulose, with or without competing DNA was first incubated for 2 h at room temperature with IO ~1 of T, receptor-containing nuclear extract equilibrated with 0. I nM unlabeled T,. The incubations (0.25 ml) were then brought to 0.3 ml (final KC1 concentration, 66 mM) by addition of cytosol pre-equilibrated for 2 h at 0°C with 25 nM [7H]dexamethasone and activated at 25°C for 30min. After I h at room temperature, incubations were stopped by centrifugation and [3H]dexamethasone bound to DNAcellulose was determined as described [ 161. DNA-binding
assay for the thyroid hormone receptor
This assay [2 I] was based on the competition assay described above with unpurified glucocorticoid receptor. Incubations (0.3 ml) contained the
GH gene binding of steroid and thyroid receptors
e
50
151
f
Q
50
50
Fig. 1. SpecificDNA binding of the purified glucocorticoid receptor. Autoradiography of a 1% DNA agarose gel electrophoresis. Receptor bound to the affinity matrix used for its purification was incubated with a mixture of two populations of DNA fragments end-labeled with the Klenow fragment of DNA polymerase I in the presence of a 32P-dATP. These fragments were obtained by EcoRI digestion of the MMTV LTR451 niasmid. This vielded a 1.3-kb fragment containing the GRE and a 4.2-kb fragment containing a 2.3-kb EcoRI-P&I fragment of pBRy22 and 1.9 kb aufthe structural part of the &pes simplex virus thymidine kinase gene. The incubations were performed in the presence of the NaCl concentrations indicated, following which DNA bound to the affinity matrix was extracted and processed by electrophoresis and autoradiography as described in Materials and Methods. Lanes of the autoradiogram correspond to different experimental conditions as follows: a, input DNA mixture alone prior to incubation; b-g, DNA extracted from the affinity matrix after incubation with (b-f) or without (g) receptor; e and f, same as d, except for the addition of 10 mM NarMoO, (e) or 1 mM pyridoxal phosphate (f) after receptor transformation and prior to incubation with DNA.
et al.
G. G. ROUSSEAU
152 Table
1. Glucocorticoid
and thyroid
hormone
receptor
binding
Glucocorticoid receptor bound to DNA-cellulose (%) Competing DNA pBR322 GH497 GH462
Alone” Y4 85 48
to DNA
alone or in combination
Thyroid receptor DNA-cellulose
+ Thyroid recepto+
Alone’
96 83 48
63 49 54
bound (%)
to
+ Glucocorticoid receptord 62 51 54
as a source of glucocorticoid receptor (a, b) or nuclear extract of thyroid hormone receptor (c,d) was incubated with DNAcellulose. The incubations were performed as such or with the addition of the competing DNA fragments indicated (100 ng DNA/incubation in a, b; 300 ng DNA/incubation in c, d). The origin of the competing DNA fragments was as follows: pBR322, 4200-bp fragment of pBR322-thymidine kinase hybrid; GH497, fragment EcoRI(-4Y6)-BamHI(+2) of the hGH gene; GH462, fragment BamHI(+2)-PuuII(+464) of the hGH gene. The DNA-binding assays for glucocorticoid receptors were conducted as such (a), or the incubation contained, in addition, nuclear extracts bound with unlabeled T3 (b). The DNA-binding assays for thyroid receptors were conducted as such (c), or incubation contained, in addition, unlabelled dexamethasone-bound cytosol (d), Assays were run as described in Materials and Methods and the data expressed as a percentage of the DNA-cellulose binding seen in absence of competing DNA (2212-2223 d.p.m. for [3H]dexamethasone, 4197-4374 d.p.m. for [1251]T3).Data shown are means of duplicate determinations that differed by less than 10%
Cytosol
labeled
with [3H]dexamethasone
labeled with [‘*51]T3 as a source
equivalent of 1.25 ~1 of packed DNA-cellulose, 50 ~1 of nuclear extract (5.4 fmol T, binding sites), 0.1 nM [“‘I]T,, and up to 500 ng of competing DNA fragment. Incubations (final KC1 concentration, 66 mM) were at room temperature with constant end-over-end rotation. After 4 h the tubes were placed on ice and the DNA-cellulose pellet was washed 3 times with ice-cold buffer containing 50mM NaCI, and counted for radioactivity. Nonspecific binding was determined from identical incubations which contained in addition either 0.3 FM unlabeled T, or 3600 ng of salmon sperm DNA. Residual radioactivity bound to DNA-cellulose was the same in both cases. When investigating possible interactions with the glucocorticoid receptor (Table l), the incubations were supplemented, after 2 h at room temperature, with 50 ~1 of IM-9 cytosol. Glucocorticoid receptors in this cytosol had been equilibrated for 2 h at 0°C with 25 nM unlabeled dexamethasone and the glucocorticoid-receptor complexes transformed by heating for 30min at 25°C.
pBR322 DNA. The same pattern of preferential binding was seen with unpurified receptor using the DNA-cellulose competition assay (not shown). The new DNA-binding assay with purified receptor (Fig. 1) was used under conditions of varying LTR451 DNA concentrations to generate Scatchard plots of the binding reaction (Fig. 2). Assuming a simple, monomolecular. site-site interaction that follows the
0.10
h /
0.08
c
0.06
-
B/F 0.04
-
0.02
-
RESULTS AND DISCUSSION
The human glucocorticoid receptor binds to a glucocorticoid response element A good reference of glucocorticoid receptor binding to GRE-containing DNA sequences has been the interaction of the rat receptor with GRE from mouse mammary tumor virus (MMTV) [23]. We first established that this was applicable to the human receptor by comparing its affinity for plasmid DNA and LTR451 DNA, a GRE-containing fragment of MMTV [17]. Figure 1 shows that the IM-9 cell receptor purified by affinity chromatography bound LTR45 1 DNA preferentially as compared to
Fig. 2. DNA concentration-dependence of the binding of the purified glucocorticoid receptor to MMTV LTR451 DNA. This Scatchard plot was obtained by incubating receptor bound to the affinity gel used for receptor purification, with a tracer amount of 32P-labeled MMTV LTR4.51 DNA fragment in the presence of various concentrations of unlabeled LTR 45 1 DNA (see Materials and Methods). NaCl concentration in the incubation was 100 mM. At equilibrium, the affinity gel was washed and 32P radioactivity associated with it was determined. B.: concentration of receptor-bound DNA; F: concentration of free DNA. Although a straight line was drawn through the experimental points, the data do not exclude the possibility of nonlinear (e.g. co-operative) kinetics (dashed line).
GH gene binding of steroid and thyroid receptors law of mass action, the apparent equilibrium constant for this interaction was 0.7 nM.
affinity
The glucocorticoid-receptor complex binds to the promoter region and to the first intron of the GH and CS genes
Using DNA-cellulose competition assay, we therefore searched for human glucocorticoid receptor binding sites on DNA sequences spanning the hGH gene from about 3 kb upstream to about 2 kb downstream from the cap site. LTR45 1 and pBR322 DNA were used as positive and negative controls, respectively. Preferential binding was found with two gene fragments, one (GH 497) just upstream and one (GH462) just downstream from the cap site. Receptor binding to the GH462 fragment was about 3 times stronger than to the GH497 fragment and 2 times stronger than to LTR45 1 DNA [ 161. Subcloning of these fragments allowed localization of the low-affinity DNA sites within 290 bp upstream and of the high-affinity DNA sites within 248 bp downstream from the cap site, a region that encompasses the first exon (68 bp) and 180 bp of the first
l ,
CS467
7 LTR451
/
I
I
I
COMPETING
DNA
I
I
()lg
I
0.2
0.1
0
per
incubation)
Fig. 3. Relative affinity of the purified glucocorticoid receptor for cloned DNA fragments. Receptor bound to the affinity gel was incubated with 3zP-labeled LTR451 DNA fragment as a tracer and with increasing concentrations of either one of the unlabeled DNA fragments indicated. The experiment was then performed as described in Fig. 2. Competition curves were linearized by regression after expressing the ratio of radioactivity bound to the gel in absence (B,) to that bound in presence (B) of competing DNA, as a function of competing DNA concentration. CS467: fragment BamHI(+2)-PvuII(+469) of the hCS acne; LTR451: 1300-bp fragment containing the GRE f;om MMTV-LTR; pBR322:mixture of the three largest fragments (910, 655 and 521-bp long) obtained by AIuI digestion of the pBR322 plasmid.
153
intron [ 161. Two homologous binding regions were also detected in the hCS gene by the same method[16]. These results were confirmed by the novel DNA-binding assay with purified receptor described here, and representative data are shown in Fig. 3. Similar data on the hGH gene but with the rat receptor have been obtained by others [24,25], who used footprinting experiments to map the highaffinity site in the first intron to a position around nucleotide co-ordinate + 100. Role of the hormone for DNA binding of the glucocorticoid receptor
A classical view holds that agonist- but not antagonist-bound glucocorticoid receptors interact specifically with DNA. However, some steroid analogues with antagonist activity are known to promote receptor translocation to the cell nucleus. Thus, glucocorticoid antagonist activity could result from at least two mechanisms. One would be an inability for the steroid to transform the receptor; the other would be an abnormal reaction at or beyond the DNA-binding step [26]. Our data show that the receptor is competent for specific DNA recognition in uitro, even when it is bound to certain antagonists. Indeed, the experiments described in Figs l-3 dealt with receptor bound to a 17@-carboxamide derivative of dexamethasone linked to an agarose matrix[19]. This steroid is known to behave as a glucocorticoid antagonist [27]. Yet, under these conditions, receptor still bound better to LTR451 and to the high affinity, intron-containing fragment CS467 DNA than to pBR322 DNA (Fig. 3). Consistent with these results, we have found, with the DNA-cellulose competition assay, that receptor complexed with the potent antagonist RU486 also bound preferentially to LTR451 DNA and could distinguish fragment GH462 from fragment GH497 with the same efficiency as when it is complexed with dexamethasone (unpublished observations). Such data are compatible with the notion that antagonist activity results from a perturbation in glucocorticoid action at a step beyond the DNA-binding event. Alternatively, the high-affinity antagonists studied here might mimic agonists in inducing the DNAreceptor interaction under our artificial in vitro conditions. Such steroid analogues would, however, exert antagonist activity in vivo by hampering the dissociation of the receptor hetero-oligomer that is postulated to be a prerequisite for glucocorticoid action. The latter interpretation is supported by recent experiments with RU486 and with a dexamethasone 17P-carboxamide analogue [28,29]. Characteristics of the DNA sequences glucocorticoid receptor binding
involved
in
By studying GREs in MMTV DNA and the human metallothionein IIa gene, Karin et al. [30] proposed the 1%mer nucleotide shown below as a
154
G.G. ROUSSEAU
results (Fig. 6) show receptor binding in two overlapping fragments that contain the promoter area of the rGH gene. Binding is lost when the 3’-end of the S-flanking fragment is the KpnI site at -311. These data are therefore consistent with the presence of a TRE between co-ordinates -311 and +8.
consensus sequence for glucocorticoid receptor binding. This sequence contains the hexanucleotide -TGTCCT(underlined) that was originally identified as a minimum requirement for specific glucocorticoid the binding of DNA receptor [23,31]. Consensus
S-
T G G T (0
hGH hCS Synthetic
A C A A T U)
T G T C C T
(C)(A)
eta/.
-3’
(T)
TGGC*. ACAATGTGTCCT TGGC*. ACAAC*GTGTCCT TTTGGG*CACAATGTGTCCTGAGGG
The 15mer consensus is not present as such in the hGH or hCS genes. However, if one allows for the single (hGH) or the two (hCS) mismatches indicated by an asterisk, one finds this consensus in the introncontaining high-affinity fragments of the hGH and hCS genes that bind the receptor in our experiments. The one mismatch found in the hGH high-affinity fragment is also present in a double-stranded 24-mer synthetic oligonucleotide (see above) that has been shown to bind the glucocorticoid receptor in vitro [24]. Interestingly, this synthetic fragment loses its affinity for the receptor when the second base pair (GC) of the hexanucleotide “core” has been changed to a CG base pair [32]. As to the 5’-flanking regions of the hGH and hCS genes which bind the receptor with a lower affinity, they contain a sequence with four mismatches. Less degenerate sequences (two or three mismatches) are found in pBR322, but one of the mismatches always involves the hexanucleotide “core” [16]. Thus, our data appear to make the requirement for a conserved nucleotide motif less stringent, although there seems to be a correlation between receptor affinity and conservation of the consensus sequence.
COMPETITOR
DNA(ng/tubel
Fig. 4. Competition assay of thyroid hormone receptor binding to DNA. Receotor bound to ‘Z51-labeled T, in nuclear extracts was incubated with calf thymus DGAcellulose in absence or presence of the indicated concentrations of competing DNA. Following incubation as described, radioactivity in the DNA-cellulose pellet was determined. GH7.51: fragment SacI(-750)-BamHI(+2) of the hGH gene; pBR322: 4200. bp hybrid of pBR322 and thymidine kinase gene fragment.
The thyroid hormone-receptor complex binds to the promoter of the GH and CS genes The DNA-cellulose competition assay for thyroid hormone receptors was used to screen hGH gene fragments encompassing about 3 kb upstream and 4 kb downstream from the cap site. A clear-cut competition was seen with the Sac1 (-750)BamHI(+2) fragment hGH751 (Fig. 4). A 367-bp EcoRI (-496)-AIuI(-129) subfragment of this 5’flanking region retained the T3 receptor-binding capacity (Fig. 5). From further experiments (not shown) T, receptor binding could be localized between positions -290 and - 129 of the hGH gene and -297 and +2 of the hCS gene[21]. A “thyroid response element” (TRE) i.e. a DNA region that confers thyroid hormone responsiveness to a reporter gene in transfection experiments, has been identified in the rat GH gene between co-ordinates -235 and +l 1 [33]. We therefore applied our assay to rGH gene fragments to determine whether receptor binding sites would be detected in that region as is the case with the human gene. Our preliminary
--xPElR322 I 0
250
I 500
I
I
1
750
1000
1250
[DNAI.II~ / TUBE
Fig. 5. Preferential binding of the thyroid hormone recepto; to S-flanking DNA in the hGH gene. The experiment was oerformed as described in Fig. 4 with either pBR322 or GH367, a lOOO-bp pBR322-GH hybrid containing the region EcoRI(-496)-AluI(-129) of the hGH gene. Data are plotted as described in Fig. 3.
GH gene binding of steroid and thyroid receptors
I
1
I
I
-1760
-1180
-311
8
I
rat Gti
1520
T
s:: hii 4 3? z z2 W L
l-2.0
1
I
-1.5
-1.0
I -0.5
I
I
I
I
0
0.5
1.0
1.5
Lb
Fig. 6. Bar graph of binding of the thyroid hormone receptor along the rat GH gene. Experiments were performed as described in Fig. 5 with the three fragments indicated: EcoRI-XhoI, KpnI (-3 1 I)-Kpnl (1520).and KpnI (-1 180)-KpnI (-311). The ordinate shows the slope of the competition data linearized as in Fig. 5. Results are means f SEM for 3 experiments. If one assumes that region -1760 to -1180does not bind the thyroid hormone receptor, then region -311 to +8 (dashed area) is involved in the high affinity of the EcoRI-XhoI fragment since binding activity is absent from the third fragment tested. The region corresponding to the dashed area might also be responsible for the binding seen with the second fragment tested.
Role of the hormone for DNA binding of the thyroid receptor We investigated whether the T, receptor-DNA interaction described above required the presence of the hormone on the receptor. We found that uncomplexed receptor did bind to DNA-cellulose, albeit with a lower affinity than when complexed with T,. Under these conditions, however, the receptor could no longer distinguish hGH75 1 (5’-flanking) DNA from pBR322 DNA [2 11. Thus, although in the intact cell hormone-free receptor is found in chromatin, our in uitro experiments would suggest that the presence of T1 leads to a tighter and specific interaction of the receptor with DNA. Putative DNA sequence involved in thyroid receptor binding A comparison of the S-flanking sequences of genes known to be under T, control has led to the description of a putative consensus sequence for T, receptor-DNA interactions between co-ordinates -395 and -376 of the hGH gene [34]. On the other hand, one could postulate that a consensus sequence for T, receptor is present in the hGH gene 5’flanking fragment which binds the receptor in our assay system and that this consensus should also occur in the rGH gene TRE. If so, then the consensus homology between the hGH and rGH genes should rather be searched for between co-ordinates -235 (5’-boundary of the rat TRE) and -129 (3’boundary in the human gene binding fragment) (Fig. 7). Such a homology is indeed found over 26 nucleotides downstream from position -139 in the hGH gene [2 I]. This sequence contains one copy (underlined in Fig. 7) of the so-called CC box (decanucleo-
tide), which is a target for promoter-specific transcription factors such as the Spl eukaryotic protein [35]. Whether this sequence is in any way involved in T, receptor binding to the hGH gene promoter remains to be investigated. Approach to the synergistic effect of glucocorticoid and thyroid hormone receptors To our knowledge, our data on T, receptor binding to DNA provide the first demonstration that this receptor can bind preferentially to a defined gene region. Since the experiments with the T, receptor were performed with crude nuclear extracts, we cannot rule out the possibility that T, receptor binding to DNA involves unidentified factor(s) other than the T3 receptor. The glucocortione of these factors coid receptor is not from the nuclear exit is absent since tracts used. In addition, we found that the T, receptor does not bind specifically to the GREcontaining LTR451 DNA fragment. Finally, the glucocorticoid receptor binds with high affinity to a region of the structural part of the hGH and hCS genes that does not bind the T, receptor preferentially. Therefore, the binding sites for glucocorticoid and thyroid receptors on the genes studied are distinct. Still, sites for the glucocorticoid and for the thyroid hormone receptor coexist on the same 5’flanking fragment of the hGH and hCS genes. This is in accordance with the hypothesis [36] that the transcriptional synergism between thyroid and glucocorticoid hormones in controlling GH gene expression depends on the physical interaction of these two types of receptors at their regulatory sites. To test this hypothesis, we studied whether thyroid
G. G. ROUSSEAU
156 -500
L
1
-300
I
hGR bindinga
-100
I;
I
-290
i
I ,
i
-
C.RE=
,
I ,
I I i,
,
%liard b Barlow ‘Robins d Slater eCrev
+11
(rat
T
t-224)
G::G
m-
(139)
TGTGGGAGGAGCTTCTAAATTATCCA(-114)
DNA
al.,
Proc.
et
al .,
Cell
29:
et
al.,
Mol.
Cell.
Biol.
5:
J.
Biol.
Chem.
261:
409-417
500 I 1
I
E2
II]
+251
gene)
L+95)
al.,
I
-
0
et
6 Spindler,
I
n
et
Natl.
GREd
-
homology:
I
I
/: ,,,,,,,,,,,,,,,,,,,,,,I,,,,,,,,,,,l,l,,,,,,,~
C-
sequences:
4:
I
129
-
-235-TREe
hGH/hCS/rGH
I I ,
300
100
I-IEl
I
hTR bindingb
GR consensus
cap
1
et al.
G G C::. C::T
ACAATGTGTCCT G A C A C T C T G T GW
(+llo) A::
(-208)
(1985) Acad.
623-631
Sci.
USA
(in
press)
(1982) 2984-2992
(1985)
5018-5033
(1986)
Fig. 7. Scheme of the interaction of the human glucocorticoid (hGR) and thyroid hormone (hTR) receptors with the human growth hormone gene (GH-N). hCS, human placental lactogen gene; rGH, rat growth hormone gene; cap, transcription initiation site; E, exon; GRE, glucocorticoid response element; TRE, thyroid response element. Asterisks denote mismatches with the canonical consensus sequence. Numbers refer to nucleotide position relative to the caD site. hormone
receptors
receptor
binding
could to
influence
glucocorticoid
GH gene fragments. DNAbinding assays for the glucocorticoid receptor were performed with the 5’-flanking GH497 fragment EcoRI-BamHI under conditions where preferential binding of the glucocorticoid receptor to this fragment could be demonstrated. This interaction was insensitive to the presence of T,-bound thyroid hormone receptors (Table 1). This lack of effect of thyroid hormone receptors on DNA binding of the glucocorticoid receptor also held true when GH497 was replaced by the higher-allinity BamHI(+2)PvuII (+464) fragment GH462 (Table 1). Conversely, we examined whether thyroid hormone receptor binding to DNA was influenced by the presence of glucocorticoid receptors. Thyroid hormone receptors labeled with [12sl]T1 in nuclear extracts were incubated with the same two fragments of the hGH gene. Inclusion of dexamethasonebound glucocorticoid receptor contained in IM-9 cell cytosol was without effect on the interaction of the thyroid hormone receptor with these DNA fragments (Table 1). These data also imply that, under our assay conditions, no cytosolic factor influenced thyroid hormone receptor binding to DNA, and that no factor in the nuclear extract influenced glucocorticoid receptor binding to DNA. Our assay maintains the lOO-fold molar ratio between the glucocorticoid and thyroid hormone receptor site concentration that occurs in the intact cell. Since the actual ratio at the DNA level is unknown, these conditions may preclude in vitro detection of receptor-receptor interactions. Another possibility for our negative preliminary results is that the thyroid and glucocorticoid receptor
binding sites on the 5’-flanking fragment of the hGH gene are too distant from each other (Fig. 7) to allow interaction between the receptors here. In a broader context, one should note that most of the information on the hormonal control of GH gene expression in intact cells derives from studies on the rat gene. To our knowledge, no other data are available on glucocorticoid or thyroid hormone receptors binding to this gene. Therefore, correlations between receptor-DNA interactions in vitro and physiological control remain highly speculative, the more so as increased gene expression in terms of mRNA concentration may also involve post-transcriptional mechanisms. Still, the discovery that the strongest interaction of the human [ 16, this report] and rat [24,25] glucocorticoid receptor with the hGH gene involves a DNA region located within the first intron is intriguing since this interaction, in all the other genes studied, takes place in a region upstream from the cap site. That this unique interaction has physiological relevance is suggested by the report that a fragment (+2 to +lYY) of the hGH gene containing the intron sequences that bind the receptor can confer glucocorticoid control to a reporter gene (thymidine kinase), transcribed from a heterologous promoter (metallothionein) in transfection experiments [25]. This shows that a GRE is present within 200 bp of the structural part of the hGH gene. The occurrence of another GRE in the S’-flanking region of the hGH gene has also been suggested by the same approach [37]. These two sets of data are consistent with our binding experiments. For the rGH gene, data from transfection experiments are also consistent with dual glucocorticoid control depending on DNA sequences both
GH gene binding of steroid and thyroid receptors
upstream [38] and downstream [39] from the cap site. Similar caution applies to the significance of the T, receptor-DNA binding data presented here. The presence of a TRE in the S-flanking region of the hGH gene is consistent with earlier work on the rat gene [33,40]. However, no such data are available on the thyroid control of the hGH gene or on a putative synergism of thyroid and glucocorticoid hormones in controlling this gene. In any case, the demonstration that T, promotes specific DNA binding of its receptor would make it unlikely that unoccupied receptor acts as a transcriptional repressor which dissociates from DNA when complexed with its hormonal ligand. The interpretation of our finding that glucocorticoid and thyroid receptor-binding regions homologous to those in the hGH gene also occur in the hCS gene must await investigation of the hormonal control of this gene.
9.
10,
11. 12.
13.
14. 15.
AcknowledgemenrsWe thank M. Place and I. Dehart for expert assistance and B. Groner for providing the MMTVLTR plasmid. This project was supported in part by Stimulation Action ST2J00751B from the Commission of the European Communities and by grants from the Belgian Fund for Scientific Medical Research and Actions Concertees, and from the University of Lille 11 and INSERM. J. W. B. is a Fellow of the National Health and Medical Research Council (Australia). P. H. E. and M. M. H. were Fellows of the Prime Minister’s Office for Science Policy (PREST), Belgium.
REFERENCES 1. Seeburg P. H.: The human growth hormone gene family: nucleotide sequences show recent divergence and predict a new polypeptide hormone. DNA 1 (1982) 239-249. 2. Selby M. J., Barta A., Baxter J. D., Bell G. I. and Eberhardt N. L.: Analvsis of a maior human chorionic somatomammotropin gene. J. bioi. Chem. 259 (1984) 13131-13138. 3. Cooke N. E., Coit D., Shine J., Baxter J. D. and Martial J. A.: Human prolactin. cDNA structural analysis and evolutionary comparisons. J. biol. Chem. 256 (1981) 4007-4016. 4. Cooke N. E., Coit D., Weiner R. I., Baxter J. D. and Martial J. A.: Structure of cloned DNA complementary to rat prolactin messenger RNA. J. biol. Chem. 255 (1980) 6502-6510. 5. Niall H. D., Hogan M. L., Sauer R., Rosenblum I. Y. and Greenwood F. C.: Sequences of pituitary and placental lactogenic and growth hormones: evolution from a primordial peptide by gene replication. Proc. natn. Acad. Sci. U.S.A. 68 (1971) 866-869. 6. Evens R. M., Birnberg N. C. and Rosenfeld M. G.: Glucocorticoid and thyroid hormones transcriptionally regulate growth hormone gene exnression. Proc. t&n. &ad. gci. U.S.A. 79 (l-982) 7659-7663. Ivarie R. D., Morris J. A. and Martial J. A.: Prolactindeficient variants of GH3 rat pituitary tumor cells: linked expression of prolactin and another horrnonally responsive protein in GH3 cells. Molec. cell. Biol. 2 (1982) 179-189. Camper S. A., Yao Y. A. S. and Rottman F. M.: Hormonal regulation of the bovine prolactin promoter
16.
17.
18.
19.
20.
21.
22.
23
157
in rat pituitary tumor cells. J. biol. Chem. 260 (1985) 12,246-12,251. Wark J. D. and Gurtler V.: Glucocorticoids antagonize induction of prolactin-gene expression by calcitriol in rat pituitary tumor cells. Biochem. J. 233 (1986) 513-518. Spindler S. R., Mellon S. H. and Baxter J. D.: Growth hormone gene transcription is regulated by thyroid and glucocorticoid hormones in cultured rat pituitary tumor cells. J. biol. Chem. 257 (1982) 11,627-l 1,632. Yaffe B. M. and Samuels H. H.: Hormonal regulation of the growth hormone gene. J. biol. Chem. 259 (1984) 6284-6291. Stanley, F. and Samuels, H. H.: n-Butyrate affects thyroid hormone stimulation of prolactin production and mRNA levels in GHl cells. J. biol. Chem. 259 (1984) 9768-9775. Davis J. R. E., Lynam T. C., Franklyn J. A., Docherty K. and Sheppard M. C.: Tri-iodothronine and phenytoin reduce prolactin messenger RNA levels in cultured rat pituitary cells. J. Endocr. 109 (1986) 359364. Rousseau G. G.: Control of gene expression by glucocorticoid hormones. Biochem. _r. 224 (1984) 1-12. MacLeod K. M. and Baxter J. D.: Chromatin receptors for thyroid hormones. Interaction of the solubilized proteins with DNA. J. biol. Chem. 251(1976) 73807387. Eliard P. H., Marchand M. J., Rousseau G. G., Formstecher P., Mathy-Hartert M., Belayew A. and Martial J. A.: Binding of the human glucocorticoid receptor to defined regions in the human growth hormone and nlacental lactoaen eenes. DNA 4 (1985) 409-417. Hynes N., Van-Goykn A. J. J., Kennedy N., Herrlich P., Ponta H. and Groner B.: Subfragments of the large terminal repeat cause glucocorticoid-responsive expression of mouse mammary tumor virus and an adjacent gene. Proc. natn. Acad. Sci. U.S.A. 80 (1983) 3637-3641. Maniatis T., Fritsch E. F. and Sambrook J.: Molecular Cloning. A Laborarory Manual. Cold Spring Harbor Laboratorv, New York (1982). Lustenberger P., Formstecher’P. and Dautrevaux M.: Purification of rat liver glucocorticoid receptor by affinity chromatography: design of a suitable adsorbent. J. steroid B&hem. 14 (1981) 697-703. Idziorek T., Formstecher P., Danze P. M., Sablonniere B., Lustenberger P., Richard C., Dumur V. and Dautrevaux M.: Characterization of the purified molybdate-stabilized glucocorticoid receptor from rat liver. An in vitro transformable complex. Eur. J. B&hem. 153 (1985) 65-74. Barlow J. W., Voz M. L. J., Eliard P. H., Mathy-Hartert M., De Nayer P., Economidis I. V., Belayew A., Martial J. A. and Rousseau G. G.: Thyroid hormone receptors bind to defined regions of the growth hormone and placental lactogen genes. Proc. nam. Acad. Sci. U.S.A. 83 (1986) 9021-9025. Mulvihill E. R., LePennec J. P. and Chambon P.: Chicken oviduct progesterone receptor: location of specific regions of high-affinity binding in cloned DNA fragments- of hormone-responsive genes. Cell 24 (1982) 621-632. Scheidereit C., Geisse S., Westphal H. M. and Beato M.: The glucocorticoid receptor binds to defined nucleotide sequences near the promoter of mouse mammary tumour virus. Nature, Lond. 304 (1983) 749-752.
24 Moore D. D., Marks A. R., Buckley D. I., Kapler G., Payvar F. and Goodman H. M.: The first intron of the human growth hormone gene contains a binding site for glucocorticoid receptor. Proc. nam. Acad. Sci. U.S.A. 82 (1985) 699-702.
1.58
G. G. ROUSSEAUet al.
25. Slater E. P., Rabenau O., Karin M., Baxter J. D. and
26.
27.
28.
29.
30.
31.
32.
Beato M.: Glucocorticoid receptor binding and activation of a heterologous promoter by dexamethasone by the first intron of the human growth hormone gene. Molec. cell. Biol. 5 (1985) 2984-2992. Rousseau G. G.: Structure and regulation of the glucocorticoid hormone receptor. Molec. cell. Endocr. 38 (1984) l-11. Rousseau G. G., Kirchhoff J., Formstecher P. and Lustenberger P.: 17P-Carboxamide steroids are a.new class of glucocorticoid antagonists. Nature, Lond. 279 (1979) 158-160. Sablonniere B., Danze P. M., Formstecher P., Lefebvre P. and Dautrevaux M.: Physical characterization of the activated and non-activated forms of the glucocorticoid-receptor complex bound to the steroid antagonist [‘H]RU486. .I. steroid Biochem. 25 (1986) 605-614. Formstecher P., Lefebvre P. and Dautrevaux M.: RU486 stabilizes the glucocorticoid receptor in a non-transformed high molecular weight form in intact thymus cells under physiological conditions. VII Int. Congr. Hormonal Steroids, Satellite Symp. Antisteroids, Marbella, Spain (1986). _ _ Karin M., Haslinger A., Holtgreve H., Richards R. I., Krauter P., Westphal H. M. and Beato M.: Characterization of DNA sequences through which cadmium and glucocorticoid hormones induce human metallothionein-IIA gene. Nature, Land. 308 (1984) _513519. Renkawitz R., Schlitz G., Von Der Ahe D. and Beato M.: Sequences in the promoter region of the chicken lysozyme gene required for steroid regulation and receptor binding. Cell 37 (1984) 503-510. Marks A. R., Moore D. D., Buckley D. I., Gametchu B.
33.
34.
35. 36.
37.
38.
39.
40.
and Goodman H. M.: Conservation of the DNA binding domain and other properties between porcine and rat glucocorticoid receptors. J. steroid B&hem. 24 (1986) 1097-1103. Crew M. D. and Spindler S. R.: Thyroid hormone regulation of the transfected rat growth hormone promoter. J. biol. Chem. 261 (1986) 5018-5022. Karen P. and Morris B. J.: Stimulation by thyroid hormone of renin mRNA in mouse submandibular gland. Am. J. Physiol. 251 (in press). Dynan W. S. and Tjian R.: Control of eukaryotic messenger RNA synthesis by sequence-specific DNAbinding proteins. Nature, Lond. 316 (1985) 774-778. Nyborg J. K., Nguyen A. P. and Spindler S. R.: Relationships between thyroid and glucocorticoid hormone receptor occupancy, growth hormone gene transcription, and mRNA accumulation. J. biol. Chem. 259 (1984) 12,377-12,381. Robins D., Paek I., Seeburg P. H. and Axe1 R.: Regulated expression of human growth hormone gene in mouse cells. Cell 29 (1982) 623-631. Miller A. D., Ong E. S., kosenield M. G., Verma I. M. and Evans R. M.: Infectious and selectable retrovirus containing an inducible rat growth hormone minigene. Science 225 (1984) 993-998. Birnbaum M. J. and Baxter J. D.: Glucocorticoids regulate the expression of a rat growth hormone gene lacking S-flanking sequences. J. biol. Chem. 261 (1986) 291-297. Casanova J., Copp R. P., Janocko L. and Samuels H. H.: 5’-Flanking DNA of the rat growth hormone gene mediates regulated expression by thyroid hormones. J. biol. Chem. 260 (1985) 11,744-11,748.
1987
0022-473 1/X7 $3.00 + 0.00 Copyright @ 19X7 Pergamon Journals Ltd
Proceedings of the WI International Congress on
Hormonal Steroids (Madrid, Spain, 1986)
APPROACH TO THE MOLECULAR MECHANISMS OF THE MODULATION OF GROWTH HORMONE GENE EXPRESSION BY GLUCOCORTICOID AND THYROID HORMONES G. G. RoussEAu*t, P. H. ELIARD?, J.W. BARLOW?, F. P. LEMAIGREt, D. A. LAFoN’rAINEf’, PH. DE NAmRt, I. V. ECoNOMrDISt, P. FORMSTECHERS, T. IDZIOREK$, M. MATHY-HARTERT§,
M. L. J. Voz§,
A. BELAYEWS and J. A. MARTIAL$
tHormone and Metabolic Research Unit, International Institute of Cellular and Molecular Pathology, and UniversitC de Louvain, 7.5 avenue Hippocrate, B-1200 Brussels, Belgium, SLaboratoire de Biochimie Structurale, Facultt? de MCdicine, 1 Place de Verdun, F-59045 Lille-CCdex, France and PLaboratoire de Genie B-6. University of Likge, B-4000 Sart Tilman, Belgium
Summary-Glucocorticoid and thyroid hormones modulate the expression of the growth hormone gene. To investigate this control mechanism, we have determined whether this gene contains sites that bind the human glucocorticoid and thyroid hormone receptors in t&o. To do so, we have designed a novel assay for studying binding of the purified glucocorticoid receptor to cloned fragments of the human growth hormone (hGH) gene, and have adapted a DNA-competition assay for the thyroid receptor in nuclear cell extracts. Two glucocorticoid receptor binding regions were found in the hGH gene, one of high affinity in a fragment of the gene containing the first intron, and one of low affinity located within a 290 bp-fragment of S-flanking DNA. In contrast, the thyroid receptor bound with high affinity to the S-flanking fragment. Homologous binding regions for the two types of receptor were found in the human placental lactogen (chronic somatomammotropin) gene. DNA binding of the two receptor types appeared to depend on the presence of the hormone, yet antagonist-bound glucocorticoid receptor was still capable of interacting specifically with DNA. There was no evidence for synergism or antagonism of the two receptor types in binding to their respective sites on the hGH gene. The data also make it unlikely that the thyroid receptor negatively controls gene transcription and that the stimulatory effect of thyroid hormone results from a derepression mechanism.
INTRODUCTION
The cloning of genes coding for proteins of the human growth hormone family [l-3] has provided a tool to study the molecular mechanism of gene regulation by glucocorticoid and thyroid hormones. The human growth hormone (hGH)II gene has 92% overall nucleotide sequence homology with the human placental lactogen (chorionic somatomammotropin, hCS) gene [l, 21 and 42% exon sequence homology with the human prolactin (hPRL) gene[3]. Although the PRL gene is much longer (about 10 kb) than the other two (about 2 kb), the three genes all contain five exons of similar size and sequence and are believed to derive from a common ancestor [4,5]. Experiments on cultured rat pituitary cells have shown that glucocorticoids stimulate GH [6] but inhibit PRL [7-91 gene expression. Thy-
*To whom correspondence should be addressed, at UCLICP 7529, 75 avenue Hippocrate, B-1200 Brussels, Belgium. [IAbbreviations: CS, chorionic somatomammotropin; GH, growth hormone; GRE, glucocorticoid response element; hGH, human growth hormone; MMTV, mouse mammary tumor virus; PRL, prolactin; T,, 3,5,3’triiodo-L-thyronine; TRE, thyroid response element.
roid hormone (T3) stimulates GH gene expression and seems to be required for the glucocorticoid hormone effect on that gene; the combined effect of the two hormones is greater than with T, alone [6, 10, 111. T, also reduces PRL mRNA levels in cultured rat pituitary cells [12,13]. Little is known about the hormonal control of CS gene expression. Glucocorticoids act by binding to an intracellular receptor protein and by promoting, through a step called receptor transformation, association of the receptor with defined gene regions called “glucocorticoid response elements” (GRE) that behave as proto-enhancers (reviewed in Ref.[l4]). Thyroid hormone receptors are found in chromatin and are known to bind DNA [ 151. Whether this interaction is specific and the basis for the synergism of T, with glucocorticoids at the gene level is currently undefined. As an approach to these problems, we have searched in the hGH and hCS genes for regions that might bind in vitro the human glucocorticoid and T3 receptors preferentially, and for possible interactions between those receptors. All experiments were performed with cloned gene fragments and with extracts from human lymphoblastoid (IM-9) cells as a source of receptors. 149
G. G. ROUSSEAU ef al
150 MATERIALS
AND METHODS
Preparation of DNA Fragments from the cloned hGH-N and hCS-B genes and from the rat GH (rGH) gene were purified and blunt-ended as described [ 161. Plasmid pBR322 DNA was from blunt-ended, linearized fragments described in individual experiments. LTR45 1 DNA was an EcoRI 1300-bp fragment from a MMTV LTR-tk chimaeric plasmid [17], kindly provided by Dr B. Groner. This fragment contains a GRE within the 451-bp sequence upstream from the viral transcription initiation (cap) site. For assays involving radioactive DNA, fragments were end-labeled with 32P either by the Klenow fragment of DNA polymerase I or by T, polynucleotide kinase [ 181. Glucocorticoid hormone receptors For assays with unpurified receptors, cytosols prepared from IM-9 cells [16] were labeled with 25 nM [3H] dexamethasone at 0°C for at least 2 hand then transformed by raising the temperature to 25°C for 30 min in presence of 0.1 mM phenylmethylsulfonylfluoride. For the DNA-binding assay with purified receptors, purification was carried out by affinity chromatography on a dexamethasoneSepharose gel [ 19,201. Thyroid hormone receptors Since no satisfactory method for receptor purification is available, we use unpurified receptors in nuclear extracts from IM-9 cells. Such extracts were incubated for 4 h at 25°C with ‘*51-labeled T, under conditions where specific T, binding assayed by a hydroxyapatite method corresponds to T3 receptors [21]. Receptor site concentration and affinity were 22.4 fmol/mg protein and 0.14 nM, respectively. DNA- binding assays for the glucocorticoid receptor Two techniques were used: one with unpurified receptors [22] to mimic the situation with Ti receptors, and a new, original, technique with purified receptor. The principle of the latter method is to purify the receptor by steroid affinity chromatography and to incubate matrix-bound receptor with 32P-labeled DNA. Bound DNA can then be determined quantitatively by counting the affinity matrix and qualitatively by DNA agarose gel electrophoresis after elution from the matrix. To do so, 10 vol of cytosol in TEDG buffer (20 mM Tricine, 1 mM EDTA, 2 mM dithiothreitol, 20% glycerol v/v, pH 7.4) were agitated at 4°C with 1 vol of affinity matrix equilibrated in the same buffer. After 16 h, receptor on the matrix was transformed by bringing the mixture to 25°C for 30 min. The matrix was then washed at 0-4°C successively with lOO-vol aliquots of TEDG buffer alone, or containing 300 mM NaCl, or containing 0.1 mg/ml bovine serum albumin. The matrix was then resuspended in 10 vol of the latter washing buffer. Silver staining,
using SDS-PAGE, of the proteins retained on the matrix at this stage showed a major band at about 90 kDa. This band was also seen by autoradiography when electrophoresing an eluate of the affinity matrix obtained with ‘H-labeled dexamethasone mesylate, which is known to bind the receptor covalently. When used for competition experiments, the assay was conducted as follows. Eppendorf tubes (1 .S ml) received successively up to SO ~1 of unlabeled purified competitor DNA fragment (up to 250 ng/tube), SO ~1 of 0.6 M NaCI, 20,000 d.p.m. (about 5 ng) of ‘*P-labeled tracer DNA fragment (e.g. LTR451), 3 ~1 of a bovine serum albumin solution at 10 mg/ml, TEDG buffer up to 250 ~1, and lastly SO ~1 of receptor-containing affinity matrix (i.e. 5 ~1 of packed gel). The tubes were agitated slowly for 60 min at 2~5°C and then the matrix was washed 3 times (Beckman microfuge) with 1 ml of TEDG buffer containing SO mM NaCl. The radioactivity in the pellet was determined by Cerenkov radiation. In experiments with a radioactive mixture of well-characterized fragments of different lengths, the incubations were prepared as above except that 20,000d.p.m. of 32P-labeled DNA mixture were added first and unlabeled DNA was omitted. After the final washing, the matrix pellet was resuspended in 20 ~1 of a 0.1% SDS solution at 37°C spun, and the supernatant processed using agarose gel electrophoresis and autoradiography. The second method involves in uitro transformation of the ‘H-labeled dexamethasone-receptor complex in cytosol followed by incubation of the cytosol with calf thymus DNA-cellulose in the absence or presence of known concentrations of the competing DNA fragment of interest. After washing, the DNA-cellulose bound radioactivity is measured [ 161. Plots of the ratio of the radioactivity from incubations conducted in the absence of competing DNA as a function of the amount of competing DNA added yield a straight line, the slope of which is proportional to the affinity of the receptor for the competing DNA fragment. When investigating possible interactions with the thyroid hormone receptor (Table I), 5 I_LIof packed DNA-cellulose, with or without competing DNA was first incubated for 2 h at room temperature with IO ~1 of T, receptor-containing nuclear extract equilibrated with 0. I nM unlabeled T,. The incubations (0.25 ml) were then brought to 0.3 ml (final KC1 concentration, 66 mM) by addition of cytosol pre-equilibrated for 2 h at 0°C with 25 nM [7H]dexamethasone and activated at 25°C for 30min. After I h at room temperature, incubations were stopped by centrifugation and [3H]dexamethasone bound to DNAcellulose was determined as described [ 161. DNA-binding
assay for the thyroid hormone receptor
This assay [2 I] was based on the competition assay described above with unpurified glucocorticoid receptor. Incubations (0.3 ml) contained the
GH gene binding of steroid and thyroid receptors
e
50
151
f
Q
50
50
Fig. 1. SpecificDNA binding of the purified glucocorticoid receptor. Autoradiography of a 1% DNA agarose gel electrophoresis. Receptor bound to the affinity matrix used for its purification was incubated with a mixture of two populations of DNA fragments end-labeled with the Klenow fragment of DNA polymerase I in the presence of a 32P-dATP. These fragments were obtained by EcoRI digestion of the MMTV LTR451 niasmid. This vielded a 1.3-kb fragment containing the GRE and a 4.2-kb fragment containing a 2.3-kb EcoRI-P&I fragment of pBRy22 and 1.9 kb aufthe structural part of the &pes simplex virus thymidine kinase gene. The incubations were performed in the presence of the NaCl concentrations indicated, following which DNA bound to the affinity matrix was extracted and processed by electrophoresis and autoradiography as described in Materials and Methods. Lanes of the autoradiogram correspond to different experimental conditions as follows: a, input DNA mixture alone prior to incubation; b-g, DNA extracted from the affinity matrix after incubation with (b-f) or without (g) receptor; e and f, same as d, except for the addition of 10 mM NarMoO, (e) or 1 mM pyridoxal phosphate (f) after receptor transformation and prior to incubation with DNA.
et al.
G. G. ROUSSEAU
152 Table
1. Glucocorticoid
and thyroid
hormone
receptor
binding
Glucocorticoid receptor bound to DNA-cellulose (%) Competing DNA pBR322 GH497 GH462
Alone” Y4 85 48
to DNA
alone or in combination
Thyroid receptor DNA-cellulose
+ Thyroid recepto+
Alone’
96 83 48
63 49 54
bound (%)
to
+ Glucocorticoid receptord 62 51 54
as a source of glucocorticoid receptor (a, b) or nuclear extract of thyroid hormone receptor (c,d) was incubated with DNAcellulose. The incubations were performed as such or with the addition of the competing DNA fragments indicated (100 ng DNA/incubation in a, b; 300 ng DNA/incubation in c, d). The origin of the competing DNA fragments was as follows: pBR322, 4200-bp fragment of pBR322-thymidine kinase hybrid; GH497, fragment EcoRI(-4Y6)-BamHI(+2) of the hGH gene; GH462, fragment BamHI(+2)-PuuII(+464) of the hGH gene. The DNA-binding assays for glucocorticoid receptors were conducted as such (a), or the incubation contained, in addition, nuclear extracts bound with unlabeled T3 (b). The DNA-binding assays for thyroid receptors were conducted as such (c), or incubation contained, in addition, unlabelled dexamethasone-bound cytosol (d), Assays were run as described in Materials and Methods and the data expressed as a percentage of the DNA-cellulose binding seen in absence of competing DNA (2212-2223 d.p.m. for [3H]dexamethasone, 4197-4374 d.p.m. for [1251]T3).Data shown are means of duplicate determinations that differed by less than 10%
Cytosol
labeled
with [3H]dexamethasone
labeled with [‘*51]T3 as a source
equivalent of 1.25 ~1 of packed DNA-cellulose, 50 ~1 of nuclear extract (5.4 fmol T, binding sites), 0.1 nM [“‘I]T,, and up to 500 ng of competing DNA fragment. Incubations (final KC1 concentration, 66 mM) were at room temperature with constant end-over-end rotation. After 4 h the tubes were placed on ice and the DNA-cellulose pellet was washed 3 times with ice-cold buffer containing 50mM NaCI, and counted for radioactivity. Nonspecific binding was determined from identical incubations which contained in addition either 0.3 FM unlabeled T, or 3600 ng of salmon sperm DNA. Residual radioactivity bound to DNA-cellulose was the same in both cases. When investigating possible interactions with the glucocorticoid receptor (Table l), the incubations were supplemented, after 2 h at room temperature, with 50 ~1 of IM-9 cytosol. Glucocorticoid receptors in this cytosol had been equilibrated for 2 h at 0°C with 25 nM unlabeled dexamethasone and the glucocorticoid-receptor complexes transformed by heating for 30min at 25°C.
pBR322 DNA. The same pattern of preferential binding was seen with unpurified receptor using the DNA-cellulose competition assay (not shown). The new DNA-binding assay with purified receptor (Fig. 1) was used under conditions of varying LTR451 DNA concentrations to generate Scatchard plots of the binding reaction (Fig. 2). Assuming a simple, monomolecular. site-site interaction that follows the
0.10
h /
0.08
c
0.06
-
B/F 0.04
-
0.02
-
RESULTS AND DISCUSSION
The human glucocorticoid receptor binds to a glucocorticoid response element A good reference of glucocorticoid receptor binding to GRE-containing DNA sequences has been the interaction of the rat receptor with GRE from mouse mammary tumor virus (MMTV) [23]. We first established that this was applicable to the human receptor by comparing its affinity for plasmid DNA and LTR451 DNA, a GRE-containing fragment of MMTV [17]. Figure 1 shows that the IM-9 cell receptor purified by affinity chromatography bound LTR45 1 DNA preferentially as compared to
Fig. 2. DNA concentration-dependence of the binding of the purified glucocorticoid receptor to MMTV LTR451 DNA. This Scatchard plot was obtained by incubating receptor bound to the affinity gel used for receptor purification, with a tracer amount of 32P-labeled MMTV LTR4.51 DNA fragment in the presence of various concentrations of unlabeled LTR 45 1 DNA (see Materials and Methods). NaCl concentration in the incubation was 100 mM. At equilibrium, the affinity gel was washed and 32P radioactivity associated with it was determined. B.: concentration of receptor-bound DNA; F: concentration of free DNA. Although a straight line was drawn through the experimental points, the data do not exclude the possibility of nonlinear (e.g. co-operative) kinetics (dashed line).
GH gene binding of steroid and thyroid receptors law of mass action, the apparent equilibrium constant for this interaction was 0.7 nM.
affinity
The glucocorticoid-receptor complex binds to the promoter region and to the first intron of the GH and CS genes
Using DNA-cellulose competition assay, we therefore searched for human glucocorticoid receptor binding sites on DNA sequences spanning the hGH gene from about 3 kb upstream to about 2 kb downstream from the cap site. LTR45 1 and pBR322 DNA were used as positive and negative controls, respectively. Preferential binding was found with two gene fragments, one (GH 497) just upstream and one (GH462) just downstream from the cap site. Receptor binding to the GH462 fragment was about 3 times stronger than to the GH497 fragment and 2 times stronger than to LTR45 1 DNA [ 161. Subcloning of these fragments allowed localization of the low-affinity DNA sites within 290 bp upstream and of the high-affinity DNA sites within 248 bp downstream from the cap site, a region that encompasses the first exon (68 bp) and 180 bp of the first
l ,
CS467
7 LTR451
/
I
I
I
COMPETING
DNA
I
I
()lg
I
0.2
0.1
0
per
incubation)
Fig. 3. Relative affinity of the purified glucocorticoid receptor for cloned DNA fragments. Receptor bound to the affinity gel was incubated with 3zP-labeled LTR451 DNA fragment as a tracer and with increasing concentrations of either one of the unlabeled DNA fragments indicated. The experiment was then performed as described in Fig. 2. Competition curves were linearized by regression after expressing the ratio of radioactivity bound to the gel in absence (B,) to that bound in presence (B) of competing DNA, as a function of competing DNA concentration. CS467: fragment BamHI(+2)-PvuII(+469) of the hCS acne; LTR451: 1300-bp fragment containing the GRE f;om MMTV-LTR; pBR322:mixture of the three largest fragments (910, 655 and 521-bp long) obtained by AIuI digestion of the pBR322 plasmid.
153
intron [ 161. Two homologous binding regions were also detected in the hCS gene by the same method[16]. These results were confirmed by the novel DNA-binding assay with purified receptor described here, and representative data are shown in Fig. 3. Similar data on the hGH gene but with the rat receptor have been obtained by others [24,25], who used footprinting experiments to map the highaffinity site in the first intron to a position around nucleotide co-ordinate + 100. Role of the hormone for DNA binding of the glucocorticoid receptor
A classical view holds that agonist- but not antagonist-bound glucocorticoid receptors interact specifically with DNA. However, some steroid analogues with antagonist activity are known to promote receptor translocation to the cell nucleus. Thus, glucocorticoid antagonist activity could result from at least two mechanisms. One would be an inability for the steroid to transform the receptor; the other would be an abnormal reaction at or beyond the DNA-binding step [26]. Our data show that the receptor is competent for specific DNA recognition in uitro, even when it is bound to certain antagonists. Indeed, the experiments described in Figs l-3 dealt with receptor bound to a 17@-carboxamide derivative of dexamethasone linked to an agarose matrix[19]. This steroid is known to behave as a glucocorticoid antagonist [27]. Yet, under these conditions, receptor still bound better to LTR451 and to the high affinity, intron-containing fragment CS467 DNA than to pBR322 DNA (Fig. 3). Consistent with these results, we have found, with the DNA-cellulose competition assay, that receptor complexed with the potent antagonist RU486 also bound preferentially to LTR451 DNA and could distinguish fragment GH462 from fragment GH497 with the same efficiency as when it is complexed with dexamethasone (unpublished observations). Such data are compatible with the notion that antagonist activity results from a perturbation in glucocorticoid action at a step beyond the DNA-binding event. Alternatively, the high-affinity antagonists studied here might mimic agonists in inducing the DNAreceptor interaction under our artificial in vitro conditions. Such steroid analogues would, however, exert antagonist activity in vivo by hampering the dissociation of the receptor hetero-oligomer that is postulated to be a prerequisite for glucocorticoid action. The latter interpretation is supported by recent experiments with RU486 and with a dexamethasone 17P-carboxamide analogue [28,29]. Characteristics of the DNA sequences glucocorticoid receptor binding
involved
in
By studying GREs in MMTV DNA and the human metallothionein IIa gene, Karin et al. [30] proposed the 1%mer nucleotide shown below as a
154
G.G. ROUSSEAU
results (Fig. 6) show receptor binding in two overlapping fragments that contain the promoter area of the rGH gene. Binding is lost when the 3’-end of the S-flanking fragment is the KpnI site at -311. These data are therefore consistent with the presence of a TRE between co-ordinates -311 and +8.
consensus sequence for glucocorticoid receptor binding. This sequence contains the hexanucleotide -TGTCCT(underlined) that was originally identified as a minimum requirement for specific glucocorticoid the binding of DNA receptor [23,31]. Consensus
S-
T G G T (0
hGH hCS Synthetic
A C A A T U)
T G T C C T
(C)(A)
eta/.
-3’
(T)
TGGC*. ACAATGTGTCCT TGGC*. ACAAC*GTGTCCT TTTGGG*CACAATGTGTCCTGAGGG
The 15mer consensus is not present as such in the hGH or hCS genes. However, if one allows for the single (hGH) or the two (hCS) mismatches indicated by an asterisk, one finds this consensus in the introncontaining high-affinity fragments of the hGH and hCS genes that bind the receptor in our experiments. The one mismatch found in the hGH high-affinity fragment is also present in a double-stranded 24-mer synthetic oligonucleotide (see above) that has been shown to bind the glucocorticoid receptor in vitro [24]. Interestingly, this synthetic fragment loses its affinity for the receptor when the second base pair (GC) of the hexanucleotide “core” has been changed to a CG base pair [32]. As to the 5’-flanking regions of the hGH and hCS genes which bind the receptor with a lower affinity, they contain a sequence with four mismatches. Less degenerate sequences (two or three mismatches) are found in pBR322, but one of the mismatches always involves the hexanucleotide “core” [16]. Thus, our data appear to make the requirement for a conserved nucleotide motif less stringent, although there seems to be a correlation between receptor affinity and conservation of the consensus sequence.
COMPETITOR
DNA(ng/tubel
Fig. 4. Competition assay of thyroid hormone receptor binding to DNA. Receotor bound to ‘Z51-labeled T, in nuclear extracts was incubated with calf thymus DGAcellulose in absence or presence of the indicated concentrations of competing DNA. Following incubation as described, radioactivity in the DNA-cellulose pellet was determined. GH7.51: fragment SacI(-750)-BamHI(+2) of the hGH gene; pBR322: 4200. bp hybrid of pBR322 and thymidine kinase gene fragment.
The thyroid hormone-receptor complex binds to the promoter of the GH and CS genes The DNA-cellulose competition assay for thyroid hormone receptors was used to screen hGH gene fragments encompassing about 3 kb upstream and 4 kb downstream from the cap site. A clear-cut competition was seen with the Sac1 (-750)BamHI(+2) fragment hGH751 (Fig. 4). A 367-bp EcoRI (-496)-AIuI(-129) subfragment of this 5’flanking region retained the T3 receptor-binding capacity (Fig. 5). From further experiments (not shown) T, receptor binding could be localized between positions -290 and - 129 of the hGH gene and -297 and +2 of the hCS gene[21]. A “thyroid response element” (TRE) i.e. a DNA region that confers thyroid hormone responsiveness to a reporter gene in transfection experiments, has been identified in the rat GH gene between co-ordinates -235 and +l 1 [33]. We therefore applied our assay to rGH gene fragments to determine whether receptor binding sites would be detected in that region as is the case with the human gene. Our preliminary
--xPElR322 I 0
250
I 500
I
I
1
750
1000
1250
[DNAI.II~ / TUBE
Fig. 5. Preferential binding of the thyroid hormone recepto; to S-flanking DNA in the hGH gene. The experiment was oerformed as described in Fig. 4 with either pBR322 or GH367, a lOOO-bp pBR322-GH hybrid containing the region EcoRI(-496)-AluI(-129) of the hGH gene. Data are plotted as described in Fig. 3.
GH gene binding of steroid and thyroid receptors
I
1
I
I
-1760
-1180
-311
8
I
rat Gti
1520
T
s:: hii 4 3? z z2 W L
l-2.0
1
I
-1.5
-1.0
I -0.5
I
I
I
I
0
0.5
1.0
1.5
Lb
Fig. 6. Bar graph of binding of the thyroid hormone receptor along the rat GH gene. Experiments were performed as described in Fig. 5 with the three fragments indicated: EcoRI-XhoI, KpnI (-3 1 I)-Kpnl (1520).and KpnI (-1 180)-KpnI (-311). The ordinate shows the slope of the competition data linearized as in Fig. 5. Results are means f SEM for 3 experiments. If one assumes that region -1760 to -1180does not bind the thyroid hormone receptor, then region -311 to +8 (dashed area) is involved in the high affinity of the EcoRI-XhoI fragment since binding activity is absent from the third fragment tested. The region corresponding to the dashed area might also be responsible for the binding seen with the second fragment tested.
Role of the hormone for DNA binding of the thyroid receptor We investigated whether the T, receptor-DNA interaction described above required the presence of the hormone on the receptor. We found that uncomplexed receptor did bind to DNA-cellulose, albeit with a lower affinity than when complexed with T,. Under these conditions, however, the receptor could no longer distinguish hGH75 1 (5’-flanking) DNA from pBR322 DNA [2 11. Thus, although in the intact cell hormone-free receptor is found in chromatin, our in uitro experiments would suggest that the presence of T1 leads to a tighter and specific interaction of the receptor with DNA. Putative DNA sequence involved in thyroid receptor binding A comparison of the S-flanking sequences of genes known to be under T, control has led to the description of a putative consensus sequence for T, receptor-DNA interactions between co-ordinates -395 and -376 of the hGH gene [34]. On the other hand, one could postulate that a consensus sequence for T, receptor is present in the hGH gene 5’flanking fragment which binds the receptor in our assay system and that this consensus should also occur in the rGH gene TRE. If so, then the consensus homology between the hGH and rGH genes should rather be searched for between co-ordinates -235 (5’-boundary of the rat TRE) and -129 (3’boundary in the human gene binding fragment) (Fig. 7). Such a homology is indeed found over 26 nucleotides downstream from position -139 in the hGH gene [2 I]. This sequence contains one copy (underlined in Fig. 7) of the so-called CC box (decanucleo-
tide), which is a target for promoter-specific transcription factors such as the Spl eukaryotic protein [35]. Whether this sequence is in any way involved in T, receptor binding to the hGH gene promoter remains to be investigated. Approach to the synergistic effect of glucocorticoid and thyroid hormone receptors To our knowledge, our data on T, receptor binding to DNA provide the first demonstration that this receptor can bind preferentially to a defined gene region. Since the experiments with the T, receptor were performed with crude nuclear extracts, we cannot rule out the possibility that T, receptor binding to DNA involves unidentified factor(s) other than the T3 receptor. The glucocortione of these factors coid receptor is not from the nuclear exit is absent since tracts used. In addition, we found that the T, receptor does not bind specifically to the GREcontaining LTR451 DNA fragment. Finally, the glucocorticoid receptor binds with high affinity to a region of the structural part of the hGH and hCS genes that does not bind the T, receptor preferentially. Therefore, the binding sites for glucocorticoid and thyroid receptors on the genes studied are distinct. Still, sites for the glucocorticoid and for the thyroid hormone receptor coexist on the same 5’flanking fragment of the hGH and hCS genes. This is in accordance with the hypothesis [36] that the transcriptional synergism between thyroid and glucocorticoid hormones in controlling GH gene expression depends on the physical interaction of these two types of receptors at their regulatory sites. To test this hypothesis, we studied whether thyroid
G. G. ROUSSEAU
156 -500
L
1
-300
I
hGR bindinga
-100
I;
I
-290
i
I ,
i
-
C.RE=
,
I ,
I I i,
,
%liard b Barlow ‘Robins d Slater eCrev
+11
(rat
T
t-224)
G::G
m-
(139)
TGTGGGAGGAGCTTCTAAATTATCCA(-114)
DNA
al.,
Proc.
et
al .,
Cell
29:
et
al.,
Mol.
Cell.
Biol.
5:
J.
Biol.
Chem.
261:
409-417
500 I 1
I
E2
II]
+251
gene)
L+95)
al.,
I
-
0
et
6 Spindler,
I
n
et
Natl.
GREd
-
homology:
I
I
/: ,,,,,,,,,,,,,,,,,,,,,,I,,,,,,,,,,,l,l,,,,,,,~
C-
sequences:
4:
I
129
-
-235-TREe
hGH/hCS/rGH
I I ,
300
100
I-IEl
I
hTR bindingb
GR consensus
cap
1
et al.
G G C::. C::T
ACAATGTGTCCT G A C A C T C T G T GW
(+llo) A::
(-208)
(1985) Acad.
623-631
Sci.
USA
(in
press)
(1982) 2984-2992
(1985)
5018-5033
(1986)
Fig. 7. Scheme of the interaction of the human glucocorticoid (hGR) and thyroid hormone (hTR) receptors with the human growth hormone gene (GH-N). hCS, human placental lactogen gene; rGH, rat growth hormone gene; cap, transcription initiation site; E, exon; GRE, glucocorticoid response element; TRE, thyroid response element. Asterisks denote mismatches with the canonical consensus sequence. Numbers refer to nucleotide position relative to the caD site. hormone
receptors
receptor
binding
could to
influence
glucocorticoid
GH gene fragments. DNAbinding assays for the glucocorticoid receptor were performed with the 5’-flanking GH497 fragment EcoRI-BamHI under conditions where preferential binding of the glucocorticoid receptor to this fragment could be demonstrated. This interaction was insensitive to the presence of T,-bound thyroid hormone receptors (Table 1). This lack of effect of thyroid hormone receptors on DNA binding of the glucocorticoid receptor also held true when GH497 was replaced by the higher-allinity BamHI(+2)PvuII (+464) fragment GH462 (Table 1). Conversely, we examined whether thyroid hormone receptor binding to DNA was influenced by the presence of glucocorticoid receptors. Thyroid hormone receptors labeled with [12sl]T1 in nuclear extracts were incubated with the same two fragments of the hGH gene. Inclusion of dexamethasonebound glucocorticoid receptor contained in IM-9 cell cytosol was without effect on the interaction of the thyroid hormone receptor with these DNA fragments (Table 1). These data also imply that, under our assay conditions, no cytosolic factor influenced thyroid hormone receptor binding to DNA, and that no factor in the nuclear extract influenced glucocorticoid receptor binding to DNA. Our assay maintains the lOO-fold molar ratio between the glucocorticoid and thyroid hormone receptor site concentration that occurs in the intact cell. Since the actual ratio at the DNA level is unknown, these conditions may preclude in vitro detection of receptor-receptor interactions. Another possibility for our negative preliminary results is that the thyroid and glucocorticoid receptor
binding sites on the 5’-flanking fragment of the hGH gene are too distant from each other (Fig. 7) to allow interaction between the receptors here. In a broader context, one should note that most of the information on the hormonal control of GH gene expression in intact cells derives from studies on the rat gene. To our knowledge, no other data are available on glucocorticoid or thyroid hormone receptors binding to this gene. Therefore, correlations between receptor-DNA interactions in vitro and physiological control remain highly speculative, the more so as increased gene expression in terms of mRNA concentration may also involve post-transcriptional mechanisms. Still, the discovery that the strongest interaction of the human [ 16, this report] and rat [24,25] glucocorticoid receptor with the hGH gene involves a DNA region located within the first intron is intriguing since this interaction, in all the other genes studied, takes place in a region upstream from the cap site. That this unique interaction has physiological relevance is suggested by the report that a fragment (+2 to +lYY) of the hGH gene containing the intron sequences that bind the receptor can confer glucocorticoid control to a reporter gene (thymidine kinase), transcribed from a heterologous promoter (metallothionein) in transfection experiments [25]. This shows that a GRE is present within 200 bp of the structural part of the hGH gene. The occurrence of another GRE in the S’-flanking region of the hGH gene has also been suggested by the same approach [37]. These two sets of data are consistent with our binding experiments. For the rGH gene, data from transfection experiments are also consistent with dual glucocorticoid control depending on DNA sequences both
GH gene binding of steroid and thyroid receptors
upstream [38] and downstream [39] from the cap site. Similar caution applies to the significance of the T, receptor-DNA binding data presented here. The presence of a TRE in the S-flanking region of the hGH gene is consistent with earlier work on the rat gene [33,40]. However, no such data are available on the thyroid control of the hGH gene or on a putative synergism of thyroid and glucocorticoid hormones in controlling this gene. In any case, the demonstration that T, promotes specific DNA binding of its receptor would make it unlikely that unoccupied receptor acts as a transcriptional repressor which dissociates from DNA when complexed with its hormonal ligand. The interpretation of our finding that glucocorticoid and thyroid receptor-binding regions homologous to those in the hGH gene also occur in the hCS gene must await investigation of the hormonal control of this gene.
9.
10,
11. 12.
13.
14. 15.
AcknowledgemenrsWe thank M. Place and I. Dehart for expert assistance and B. Groner for providing the MMTVLTR plasmid. This project was supported in part by Stimulation Action ST2J00751B from the Commission of the European Communities and by grants from the Belgian Fund for Scientific Medical Research and Actions Concertees, and from the University of Lille 11 and INSERM. J. W. B. is a Fellow of the National Health and Medical Research Council (Australia). P. H. E. and M. M. H. were Fellows of the Prime Minister’s Office for Science Policy (PREST), Belgium.
REFERENCES 1. Seeburg P. H.: The human growth hormone gene family: nucleotide sequences show recent divergence and predict a new polypeptide hormone. DNA 1 (1982) 239-249. 2. Selby M. J., Barta A., Baxter J. D., Bell G. I. and Eberhardt N. L.: Analvsis of a maior human chorionic somatomammotropin gene. J. bioi. Chem. 259 (1984) 13131-13138. 3. Cooke N. E., Coit D., Shine J., Baxter J. D. and Martial J. A.: Human prolactin. cDNA structural analysis and evolutionary comparisons. J. biol. Chem. 256 (1981) 4007-4016. 4. Cooke N. E., Coit D., Weiner R. I., Baxter J. D. and Martial J. A.: Structure of cloned DNA complementary to rat prolactin messenger RNA. J. biol. Chem. 255 (1980) 6502-6510. 5. Niall H. D., Hogan M. L., Sauer R., Rosenblum I. Y. and Greenwood F. C.: Sequences of pituitary and placental lactogenic and growth hormones: evolution from a primordial peptide by gene replication. Proc. natn. Acad. Sci. U.S.A. 68 (1971) 866-869. 6. Evens R. M., Birnberg N. C. and Rosenfeld M. G.: Glucocorticoid and thyroid hormones transcriptionally regulate growth hormone gene exnression. Proc. t&n. &ad. gci. U.S.A. 79 (l-982) 7659-7663. Ivarie R. D., Morris J. A. and Martial J. A.: Prolactindeficient variants of GH3 rat pituitary tumor cells: linked expression of prolactin and another horrnonally responsive protein in GH3 cells. Molec. cell. Biol. 2 (1982) 179-189. Camper S. A., Yao Y. A. S. and Rottman F. M.: Hormonal regulation of the bovine prolactin promoter
16.
17.
18.
19.
20.
21.
22.
23
157
in rat pituitary tumor cells. J. biol. Chem. 260 (1985) 12,246-12,251. Wark J. D. and Gurtler V.: Glucocorticoids antagonize induction of prolactin-gene expression by calcitriol in rat pituitary tumor cells. Biochem. J. 233 (1986) 513-518. Spindler S. R., Mellon S. H. and Baxter J. D.: Growth hormone gene transcription is regulated by thyroid and glucocorticoid hormones in cultured rat pituitary tumor cells. J. biol. Chem. 257 (1982) 11,627-l 1,632. Yaffe B. M. and Samuels H. H.: Hormonal regulation of the growth hormone gene. J. biol. Chem. 259 (1984) 6284-6291. Stanley, F. and Samuels, H. H.: n-Butyrate affects thyroid hormone stimulation of prolactin production and mRNA levels in GHl cells. J. biol. Chem. 259 (1984) 9768-9775. Davis J. R. E., Lynam T. C., Franklyn J. A., Docherty K. and Sheppard M. C.: Tri-iodothronine and phenytoin reduce prolactin messenger RNA levels in cultured rat pituitary cells. J. Endocr. 109 (1986) 359364. Rousseau G. G.: Control of gene expression by glucocorticoid hormones. Biochem. _r. 224 (1984) 1-12. MacLeod K. M. and Baxter J. D.: Chromatin receptors for thyroid hormones. Interaction of the solubilized proteins with DNA. J. biol. Chem. 251(1976) 73807387. Eliard P. H., Marchand M. J., Rousseau G. G., Formstecher P., Mathy-Hartert M., Belayew A. and Martial J. A.: Binding of the human glucocorticoid receptor to defined regions in the human growth hormone and nlacental lactoaen eenes. DNA 4 (1985) 409-417. Hynes N., Van-Goykn A. J. J., Kennedy N., Herrlich P., Ponta H. and Groner B.: Subfragments of the large terminal repeat cause glucocorticoid-responsive expression of mouse mammary tumor virus and an adjacent gene. Proc. natn. Acad. Sci. U.S.A. 80 (1983) 3637-3641. Maniatis T., Fritsch E. F. and Sambrook J.: Molecular Cloning. A Laborarory Manual. Cold Spring Harbor Laboratorv, New York (1982). Lustenberger P., Formstecher’P. and Dautrevaux M.: Purification of rat liver glucocorticoid receptor by affinity chromatography: design of a suitable adsorbent. J. steroid B&hem. 14 (1981) 697-703. Idziorek T., Formstecher P., Danze P. M., Sablonniere B., Lustenberger P., Richard C., Dumur V. and Dautrevaux M.: Characterization of the purified molybdate-stabilized glucocorticoid receptor from rat liver. An in vitro transformable complex. Eur. J. B&hem. 153 (1985) 65-74. Barlow J. W., Voz M. L. J., Eliard P. H., Mathy-Hartert M., De Nayer P., Economidis I. V., Belayew A., Martial J. A. and Rousseau G. G.: Thyroid hormone receptors bind to defined regions of the growth hormone and placental lactogen genes. Proc. nam. Acad. Sci. U.S.A. 83 (1986) 9021-9025. Mulvihill E. R., LePennec J. P. and Chambon P.: Chicken oviduct progesterone receptor: location of specific regions of high-affinity binding in cloned DNA fragments- of hormone-responsive genes. Cell 24 (1982) 621-632. Scheidereit C., Geisse S., Westphal H. M. and Beato M.: The glucocorticoid receptor binds to defined nucleotide sequences near the promoter of mouse mammary tumour virus. Nature, Lond. 304 (1983) 749-752.
24 Moore D. D., Marks A. R., Buckley D. I., Kapler G., Payvar F. and Goodman H. M.: The first intron of the human growth hormone gene contains a binding site for glucocorticoid receptor. Proc. nam. Acad. Sci. U.S.A. 82 (1985) 699-702.
1.58
G. G. ROUSSEAUet al.
25. Slater E. P., Rabenau O., Karin M., Baxter J. D. and
26.
27.
28.
29.
30.
31.
32.
Beato M.: Glucocorticoid receptor binding and activation of a heterologous promoter by dexamethasone by the first intron of the human growth hormone gene. Molec. cell. Biol. 5 (1985) 2984-2992. Rousseau G. G.: Structure and regulation of the glucocorticoid hormone receptor. Molec. cell. Endocr. 38 (1984) l-11. Rousseau G. G., Kirchhoff J., Formstecher P. and Lustenberger P.: 17P-Carboxamide steroids are a.new class of glucocorticoid antagonists. Nature, Lond. 279 (1979) 158-160. Sablonniere B., Danze P. M., Formstecher P., Lefebvre P. and Dautrevaux M.: Physical characterization of the activated and non-activated forms of the glucocorticoid-receptor complex bound to the steroid antagonist [‘H]RU486. .I. steroid Biochem. 25 (1986) 605-614. Formstecher P., Lefebvre P. and Dautrevaux M.: RU486 stabilizes the glucocorticoid receptor in a non-transformed high molecular weight form in intact thymus cells under physiological conditions. VII Int. Congr. Hormonal Steroids, Satellite Symp. Antisteroids, Marbella, Spain (1986). _ _ Karin M., Haslinger A., Holtgreve H., Richards R. I., Krauter P., Westphal H. M. and Beato M.: Characterization of DNA sequences through which cadmium and glucocorticoid hormones induce human metallothionein-IIA gene. Nature, Land. 308 (1984) _513519. Renkawitz R., Schlitz G., Von Der Ahe D. and Beato M.: Sequences in the promoter region of the chicken lysozyme gene required for steroid regulation and receptor binding. Cell 37 (1984) 503-510. Marks A. R., Moore D. D., Buckley D. I., Gametchu B.
33.
34.
35. 36.
37.
38.
39.
40.
and Goodman H. M.: Conservation of the DNA binding domain and other properties between porcine and rat glucocorticoid receptors. J. steroid B&hem. 24 (1986) 1097-1103. Crew M. D. and Spindler S. R.: Thyroid hormone regulation of the transfected rat growth hormone promoter. J. biol. Chem. 261 (1986) 5018-5022. Karen P. and Morris B. J.: Stimulation by thyroid hormone of renin mRNA in mouse submandibular gland. Am. J. Physiol. 251 (in press). Dynan W. S. and Tjian R.: Control of eukaryotic messenger RNA synthesis by sequence-specific DNAbinding proteins. Nature, Lond. 316 (1985) 774-778. Nyborg J. K., Nguyen A. P. and Spindler S. R.: Relationships between thyroid and glucocorticoid hormone receptor occupancy, growth hormone gene transcription, and mRNA accumulation. J. biol. Chem. 259 (1984) 12,377-12,381. Robins D., Paek I., Seeburg P. H. and Axe1 R.: Regulated expression of human growth hormone gene in mouse cells. Cell 29 (1982) 623-631. Miller A. D., Ong E. S., kosenield M. G., Verma I. M. and Evans R. M.: Infectious and selectable retrovirus containing an inducible rat growth hormone minigene. Science 225 (1984) 993-998. Birnbaum M. J. and Baxter J. D.: Glucocorticoids regulate the expression of a rat growth hormone gene lacking S-flanking sequences. J. biol. Chem. 261 (1986) 291-297. Casanova J., Copp R. P., Janocko L. and Samuels H. H.: 5’-Flanking DNA of the rat growth hormone gene mediates regulated expression by thyroid hormones. J. biol. Chem. 260 (1985) 11,744-11,748.