Bacopa monnieri extracts prevent hydrogen peroxide-induced oxidative damage in a cellular model of neuroblastoma IMR32 cells

Chinese Journal of Natural Medicines 2017, 15(11): 08340846

Chinese Journal of Natural Medicines

Bacopa monnieri extracts prevent hydrogen peroxideinduced oxidative damage in a cellular model of neuroblastoma IMR32 cells Gaurav Bhatia1, Vikram Dhuna2, Kshitija Dhuna1, Manpreet Kaur3, Jatinder Singh1* 1

Department of Molecular Biology and Biochemistry, Guru Nanak Dev University, Amritsar-143005, Punjab, India; Department of Biotechnology, DAV College, Amritsar-143006, Punjab, India; 3 Department of Human Genetics, Guru Nanak Dev University, Amritsar-143005, Punjab, India 2

Available online 20 Nov., 2017

[ABSTRACT] Neurodegenerative diseases are the consequences of imbalance between the production of oxidative stress and its nullification by cellular defense mechanisms. Hydrogen peroxide (H2O2), a precursor of deleterious reactive oxygen species, elicits oxidative stress, resulting in severe brain injuries. Bacopa monnieri is well known for its nerve relaxing and memory enhancing properties. The present study was designed to evaluate the protective effects of extracts from Bacopa monnieri against H2O2 induced oxidative stress using a cellular model, neuroblastoma IMR32 cell line. The protective potential of methanolic, ethanolic, and water extracts of B. monnieri (BM-MEx, BM-EEx, and BM-WEx) was evaluated using MTT assay. Although, all the B. monnieri extracts were found to protect cells against H2O2-mediated stress but BM-MEx showed significantly greater protection. UPLC analysis of BM-MEx revealed various polyphenols, including quercetin, catechin, umbelliferone, and caffeic acid predominance. Further, BM-MEx was found to possess considerable greater neuroprotective potential in comparison to the standard polyphenols such as quercetin, catechin, umbelliferone, and caffeic acid. The levels of antioxidant enzymes were significantly elevated after the pretreatment of BM-MEx and quercetin. The expression levels of oxidative stress markers, such as NF200, HSP70, and mortalin, were significantly alleviated after the pretreatment of BM-MEx as shown by immunofluorescence and RT-PCR. In conclusion, the present study demonstrated the protective effects of BM-MEx, suggesting that it could be a candidate for the development of neuropathological therapeutics. [KEY WORDS] Antioxidant enzymes; Bacopa monnieri; H2O2; IMR32 neuroblastoma; NF200; HSP70; Mortalin

[CLC Number] R965

[Document code] A

[Article ID] 2095-6975(2017)11-0834-13

Introduction The ratio of oxidants and antioxidants determines the cellular redox status. Any imbalance between these two defines the oxidative state of the cell, leading to apoptosis or

[Received on] 28-Sep.-2016 [Research funding] The work was supported by grants from the Department of Science and Technology (DST), Ministry of Science and Technology, New Delhi under order No. SR/FT/LS-163 and University with Potential for Excellence (UPE) Scheme, University Grants Commission, New Delhi. [*Corresponding author] Tel: +91-98150-50671, E-mail: [email protected] These authors have no conflict of interest to declare. Published by Elsevier B.V. All rights reserved

necrosis. The brain cells are highly susceptible to oxidative insults, mainly due to reactive oxygen species (ROS) [1]. Oxygen itself is a comparatively unreactive compound but can be metabolized in vivo to form highly reactive free radicals, which include superoxide anions, hydroxyl radicals, and many other reactive species [2]. These free radical species play an important role in the pathophysiology of many neurodegenerative diseases like Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease (HD), ischemia, and aging [1-4]. Cellular defense mechanisms involving endogenous antioxidants and antioxidant enzymes such as superoxide dismutase, glutathione reductase, lipid peroxidase, catalase, glutathione peroxidase, and glutathione, help in detoxification [5-7]. The impairment of these defense mechanisms results in damage to vital biomolecules of the cell (lipid, DNA, and protein) and ultimately pushes the cell towards death [7-8].

– 834 –

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

Today, the conventional medicines, including antibiotics, are ineffective against many serious diseases and therefore herbal renaissance is emerging all over the world. In Ayurvedic medicinal system, Bacopa monnieri Linn. (Scrophulariaceae), commonly known as “Brahmi”, has been used as a well-known nerve relaxant and cognition-enhancer [9-12]. The bioactive components of Brahmi such as alkaloids, brahmine, herpestine, bacosides and bacosaponins are well known for their protective effects. The constituents responsible for Bacopa’s cognitive effects are bacosides A and B [13-16]. Keeping in view of the general protective and cognitive effects of Bacopa in literature, the present study was designed to specifically investigate its possible neuroprotective and antioxidant potential in cellular models of neurodegenerative diseases, by inducing oxidative stress artificially by using hydrogen peroxide (H2O2). H2O2 per se is not a free radical but is very efficient in inducing oxidative stress by generating deleterious reactive oxygen species [7]. A number of polyphenolic compounds have been well characterized to attenuate the oxidative stress mediated damages at cellular level [17-22]. Quercetin, catechin, caffeic acid, and umbelliferone were used as the reference compounds in the current study. IMR32 neuroblastoma cells used as cellular model system in the present study are transformed neural crest derived cells, capable of infinite proliferation in vitro. These cells show common neuronal cell properties like spontaneous or induced elaboration of neuritic processes, synthesis of neurotransmitter biosynthetic enzymes, expression of neurofilaments which make them suitable to be an in vitro model system for studying neurodegenerative diseases [23-26]. The markers used to study the effects of oxidative stress included NF200 (neurofilament), HSP70 (Heat Shock Protein), and mortalin/Grp75 (Glucose regulated protein). The expressions of these markers have been found to be upregulated under oxidative stress-induced neurotoxicity [27-32]. In addition, the levels of antioxidant enzymes, GSH content, and lipid peroxidation (antioxidant machinery) of the cells were also determined.

Materials and Methods Chemicals and reagents 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT), quercetin, catechin, caffeic acid, umbelliferone, hydrogen peroxide, and primary antibodies used for immunofluorescence analysis; mouse monoclonal antibodies against NF200, and HSP70 (Clone BRM-22) were procured from Sigma Aldrich Chemicals Pvt. Ltd., Bangalore, India. Mouse monoclonal antibody against mortalin was procured from Abcam, NuLife Cons & Distr. Pvt. LTD., New Delhi, India. Anti-mouse Alexa Fluor 568 and 488 used as secondary antibodies were obtained from Invitrogen, Genex Life Sciences Pvt. Ltd., New Delhi, India. The PCR reagents including dNTP mix, random hexamer primer, 100bp ladder, reverse transcriptase, and Taq DNA polymerase were from Fermentas Life Sciences, Genex Life Sciences Pvt. Ltd., New Delhi,

India. Primers for synthesis of cDNAs for NF200, HSP70, mortalin, and β-actin were from Bioserve Biotechnologies (India) Pvt. Ltd., Hyderabad, India. All other chemicals and reagents, including FC reagent, EDTA, and sodium hydroxide, and solvents were procured in their purest form available commercially from Qualigens (Trikamlal & Sons, Ahmedabad, India), Himedia laboratories (Mumbai, India), and Sisco Research Laboratories (Mumbai, India). Preparation of plant extracts The whole plant of B. monnieri was used in the present study. The plant was purchased from the local market and identified from the Head, Department of Botanical and Environmental Sciences, Guru Nanak Dev University, Amritsar. It was dried and powdered and then 10 g of plant powder was extracted with 100 mL each of methanol, ethanol and water at 30 ± 5 ºC using orbital shaker. The resultant extracts were named BM-MEx, BM-EEx and BM-WEx, respectively. The extracts were filtered using muslin cloth and centrifuged at 15 000 g for 10 min. The supernatant was air dried and then further diluted with growth medium to obtain final experimental concentrations ranging from 1.5−200 µg·mL−1. Phytochemical screening Three B. monnieri extracts used in the present study were tested for the presence of a range of bioactive constituents like flavonoids, saponins, tannins, amino acids, alkaloids, phytosterols, triterpenoids, and anthroquinones using standard protocols given by Harborne, 1998 [33]. Cell culture and administration of extracts The neuroblastoma cell line IMR32 was procured from the National Center for Cell Sciences, Pune, India. The culture was maintained in DMEM supplemented with 10% heat inactivated fetal bovine serum (Life Technologies (India) Pvt. Ltd., Delhi, India) glutamine (20 mmol·L−1), penicillin (120 µg·mL−1), streptomycin (100 U·mL−1), and gentamycin (100 µg·mL−1) at 37 °C in humid atmosphere with 5% CO2. To elucidate the protective role of extracts of B. monnieri, hydrogen peroxide was used as a stress generator. Three replicates per group were taken for each experiment. To calculate the 50% inhibitory concentration (IC50) of H2O2, the cells were incubated with various concentrations of H2O2 (7.8 to 1 000 µmol.L−1) in a serum-free medium at 50% confluency for 24 h. Similarly, to discover the maximum non-toxic concentration of B. monnieri extracts on the IMR32 cells, incubation at 50% confluency with different concentrations of extracts ranging from 1.5−200 µg·mL−1 for 24 h was done. To assess the neuroprotective effects, the cell culture was pretreated with non-toxic concentrations of BM-MEx, BM-EEx, and BM-WEx at 30% confluency stage for 24 h and then the cells were incubated with IC50-level of H2O2 for additional 24 h. The negative control medium was deprived of H2O2 and extracts. To validate the neuroprotective efficacy of B. monnieri at molecular level, following techniques were used: enzyme assays, immunofluorescence and RT-PCR. Four different groups were included in subsequent experiments: BM-MEx-

– 835 –

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

treated cells, BM-MEx- pretreated + H2O2 treated cells, H2O2 treated cells, and control cells. Cell Viability assay The cell cytotoxicity was determined by using MTT dye (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide). This vital mitochondrial dye was fully permeable to cell membrane and reacts with mitochondrial enzyme, succinate dehydrogenase to form purple colored formazan crystal [34]. After the respective treatment, with different concentrations of extract or H2O2 or both as mentioned in the above section, cells were incubated with 0.5 mg·ml-1 of MTT dye at 37 °C for 4 h. The resultant formazan crystals were dissolved in DMSO and read at 570 nm using ELISA reader (Labsystem, Finland). The cell viability was calculated by the given formula: Percentage viability = [1 − (Abs of control − Abs of test)/Abs of control] × 100% The neuroprotection data showed BM-MEx to confer maximum protection in comparison to BM-EEx and BM-WEx, so only BM-MEx was selected for further experimentations. Phytochemical characterization of BM-MEx Initially BM-MEx was subjected to thin layer chromatography (TLC) using solvent chloroform and methanol (23 : 2). TLC plate was exposed to iodine vapors for the visualization of separated phytochemical bands. Later ultra pressure liquid chromatography (UPLC) was employed for the qualitative and quantitative estimation of standard polyphenolic compounds in BM-MEx. A standard stock solutions of different polyphenols were prepared by dissolving gallic acid, catechin, chlorogenic acid, epicatechin, caffeic acid, umbelliferone, coumaric acid, rutin, ellagic acid, quercetin, and kaempferol in methanol: water (90 : 10). The standard solution analysis was carried out by using Nexera UPLC apparatus (Shimadzu, Japan) at a detection wavelength of 280 nm. Then, BM-MEx at a concentration of 1 mg·mL−1 was estimated for the presence of polyphenolic compounds by comparing the individual peak at related retention time as per the standard polyphenols. The system also gave the information regarding the amount of individual polyphenols presented by comparing the elution peaks with that of standard compounds. Comparative analysis of neuroprotection with standard polyphenols The protective ability of BM-MEx was then compared with the UPLC portrayed predominant polyphenols in BM-MEx. Quercetin, catechin, caffeic acid, and umbelliferone were used as positive controls. All these standard polyphenols were tested at the similar concentration as for different extracts to maintain equality. Before H2O2 exposure, the IMR32 cells were first pretreated with different concentrations (1.5 to 50 µg·mL−1) of these polyphenols. The cell viability was concluded by using MTT method. Estimation of levels of antioxidant enzymes and antioxidants Preparation of whole cell extract The treatments of extract and H2O2 were the same as mentioned in the above section of the neuroprotection assay.

The treated and untreated groups of cells were washed thrice with 0.1 mol·L−1 of PBS and then scrapped with 1 mmol·L−1 of PBS-EDTA. The cells were collected and then centrifuged at 400 g for 10 min. The pellet obtained was homogenized in 10 volumes of chilled homogenizing buffer, pH 7.4 (250 mmol·L−1 of sucrose, 12 mmol·L−1 of Tris-HCl, and 0.1 mmol·L−1 of DTT) by repeated vortexing for 15 min. The homogenate obtained was centrifuged at 12 000 g for 10 min. The supernatant obtained was used for the estimation of levels of antioxidant enzymes and antioxidants. Catalase The rate of breakdown of H2O2 by catalase was determined spectrophotometrically at 240 nm [35]. The reaction mixture measuring 1 mL contained 0.8 mL of 0.2 mol·L−1 of PBS (pH 7.0) containing 12 mmol·L−1 of H2O2 as substrate and 100 μL of cell sample. The final reaction volume makeup was done with DDW. The decrease in absorbance per min was measured against blank (deprived of cell sample). Superoxide dismutase The level of superoxide dismutase (SOD) enzyme was determined by the tetrazolium dye method [36]. The superoxide radicals generated by the autoxidation of hydroxylamine hydrochloride, facilitates the reduction of nitroblue tetrazolium (NBT) dye. The SOD enzyme intervenes in the reduction of NBT dye by dismutating the superoxides into oxygen and hydrogen peroxide. The reduction of NBT leads to the increase in absorbance at 540 nm. The reaction mixture contained 1.3 mL of 50 mmol·L−1 sodium carbonate buffer (pH 10), 500 μL of 96 μmol·L−1 NBT, and 100 μL of 0.6% triton X-100. The reaction was initiated by addition of 100 μL of 20 mmol·L−1 of hydroxylamine hydrochloride (pH 6.0). After 2 min, 50 μL of cell sample was added and the percentage inhibition in the rate of NBT reduction was measured. Reduced glutathione and glutathione peroxidase The total glutathione content (GSH) was measured by the Ellman’s reagent method [37]. To 100 μL of cell sample, 4.4 mL of 10 mmol·L−1 EDTA and 500 μL of tri-chloroacetic acid (50% W/V) was added and the mixture was mixed thoroughly by vortexing and then centrifuged at 3 000 g for 15 min at 4 °C. The supernatant was mixed with 50 μL of 10 mmol·L−1 of 5,5′-dithiobis (2-nitrobenzoic acid) and read spectro- photometrically at 540 nm. The glutathione content was calculated from the standard curve plotted using pure glutathione. Glutathione peroxidase (GPx) activity was calculated indirectly by measuring NADPH oxidation [38]. The reaction mixture (1 mL) contained 50 μL of cell homogenate, 100 nmol·L−1 of GSH, 15 nmol·L−1 of NADPH and 15 nmol·L−1 of H2O2 in 50 mmol·L−1 of phosphate buffer (pH 7.5). The mixture was mixed thoroughly and the shift in absorbance was measured at 340 nm. One unit of glutathione peroxidase activity is defined as 1 μmol of NADPH oxidized per min at pH 7.5 at 25 °C. Lipid peroxidation The levels of lipid peroxidation (LPx) were determined by the thiobarbituric acid method [39]. Lipid peroxides are

– 836 –

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

very unstable and readily undergo decomposition resulting in formation of complex compounds including reactive carbonyl compounds occurs. Polyunsaturated fatty acid peroxides upon decomposition results in the malondialdehyde (MDA) production which forms a 1 : 2 adduct with thiobarbituric acid (TBA) that gives a red product having absorption maxima at 532 nm. To 100 μL of cell homogenate, 100 μL each of 1 mmol·L−1 of FeSO4, 1.5 mmol·L−1 of ascorbic acid, and 150 mmol·L−1 of Tris-HCl buffer (pH 7.1) were added. The makeup of total reaction volume (1 mL) was done by adding DDW and incubated at 37 °C for 15 min. The reaction was terminated by adding 1 mL of trichloroacetic acid (10% W/V), followed by addition of 2 mL of thiobarbituric acid (0.375% W/V). Then the samples were kept in boiling water-bath for 15 min and then centrifuged at 3 000 g for 10 min at 4 ºC. The absorbance of supernatant was measured at 532 nm. Analyses of gene and protein expressions The expression levels of NF200, HSP70 and mortalin at molecular level under oxidative stress conditions were determined using the methods reported in earlier studies [31-32]. Immunofluorescence The cells were grown on 11-mm cover-slips precoated with lysine (Himedia laboratories, Mumbai, India). The treatments of extract and H2O2 were for the same as for neuroprotection assay. The cells (treated and untreated) were rinsed thrice with ice-cold PBS (0.1 mol·L−1) followed by fixation with 4% paraformaldehyde solution for 30 min. These were then permeabilized with 0.32% PBST for 15 min followed by blocking with 5% normal goat serum (NGS) in 0.1% PBST for 2 h at room temperature. The cells were then incubated with mouse anti-NF200 (1 : 500), anti-mortalin (1 : 100) and anti-HSP70 (1 : 500) antibodies prepared in 0.1% PBST, overnight at 4 ºC in humid chamber. Afterwards, the cells were washed with 0.1% PBST thrice to get rid of unbound antibodies. The cells were incubated with anti-mouse secondary antibody Alexa Fluor 488 (anti-NF200) and Alexa Fluor 568 (anti-HSP70 and anti-mortalin) in 0.1% PBST for 2 h at room temperature. The cells were then washed twice with 0.1% PBST and finally with 0.1 mol·L−1 of PBS. The coverslips were then mounted on slides with Fluoromount, an anti-fading mounting medium (Sigma Aldrich Chemicals Pvt. Ltd., Bangalore, India), and observed under a Nikon A1R confocal microscope (Nikon, Japan). The pictures were analyzed by using software ImageJ 1.44p (NIH, USA). Reverse transcription-PCR The respective treatments of extract and H2O2 were the same as above. The different cell groups were scrapped in TRI Reagent (Sigma Aldrich Chemicals Pvt. Ltd., Bangalore, India) by repeated pipetting. The cells were transferred to micro-centrifuge tubes. To ensure complete dissociation of nucleoprotein complexes, the samples were allowed to stand for 5 min at room temperature and then 0.2 mL of chloroform was added. The micro-centrifuge tubes were then tightly capped and shaken vigorously for 15 sec, and allowed to

stand for 15 min at room temperature. The cell samples were then centrifuged at 10 000 g for 15 min. The aqueous phase was transferred to a fresh tube and 0.5 mL of isopropanol was added and the mixture was incubated for 10 min at room temperature. Then the cell samples were centrifuged at 12 000 g for 10 min at 4 °C. The RNA pellet was washed with 75% ethanol, vortexed and centrifuged at 7 500 g for 5 min at 4 °C. The RNA pellet was briefly air-dried and then dissolved in an appropriate volume of Tris-EDTA buffer (10 mmol·L−1 of Tris-HCL, pH 7.5 and 1 mmol·L−1 of EDTA, pH 8) with repeated pipetting. The RNA samples were then incubated at 55–60 °C for 10–15 min. The samples were then read spectrophotometrically at 260 and 280 nm. The 260/280 nm absorbance ratio determines the purity of RNA samples. The total RNA obtained was reverse transcribed according to the manufacturer’s instruction. Briefly, the cDNA was amplified in a 20 μL reaction containing primer pairs (each 1.0 μL): β-actin (forward primer 5′-TCACCCACACTGTGCCCATCTACGA3′, reverse primer 5′-CAGCGGAACCGCTCATTGCCAATGG3′); NF200 (forward primer 5'-AAGTGAACACAGATGCTATGCG-3', reverse primer 5'-CTGTCACTCCTTCCGTCACC-3'); HSP70 (forward primer 5′-GAGTTCAAGCGCAAACACAA3′, reverse primer 5'-CTCAGACTTGTCGCCAA TGA3′); Mortalin (forward primer 5'CAGTCTTCTGGTGGATTAAG3', reverse primer 5′-ATTAGCACCGTCACGTAACA CCTC3′), 10 × reaction buffer (5.0 μL), cDNA (2.0 μL), 25 mmol·L−1 of MgCl2 (3.0 μL), 10 mmol·L−1 of dNTPs (1.0 μL), and Taq polymerase (2.5 U). PCR amplification cycles consisted of denaturation at 94 °C for 1 min, primer annealing at 51, 52 and 45 °C (NF200, HSP70 and mortalin respectively) for 45 sec and extension at 72 °C for 45 sec, for a total of 35 cycles followed by final extension at 72 °C for 10 min. The PCR product was separated by electrophoresis on a 2% agarose gel. Statistical analysis The experimental data were expressed as means ± SEM. from three independent experiments. One-way analysis of variance (ANOVA) was used for multiple variable comparisons. For the evaluation of significance between groups, Bonferroni test was used according to the statistical program Sigma Stat (Jandel Scientific, Chicago, IL, USA).

Results Phytochemical screening The presence or absence of various bioactive components in respective extracts is summarized in Table 1. Apparently, flavonoids, saponins, tannins, alkaloids and triterpenoids were found in all the three extracts. Amino acids, phytosterols and anthroquinones were found to be absent in all the three extracts. Protective effects of B. monnieri extracts against H2O2-induced cytotoxicity In the current study, the cells were pre-treated with various concentrations of B. monnieri extracts before exposure to

– 837 –

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

Table 1 Phytochemical screening of B. monnieri extracts Phytochemicals

BM-MEx

BM-EEx

BM-WEx

Flavonoids

+

+

+

Saponins

+

+

+

Tannins

+

+

+

Amino acids

-

-

-

Alkaloids

+

+

+

Phytosterols

-

-

-

Triterpenoids

+

+

+

Anthroquinones

-

-

-

+: presence; −: absence

H2O2 treatment. The IC50 value of H2O2 was evaluated by cell viability assay (Fig. 1a). A concentration- dependent cell death was observed and the IC50 value was determined by using regression equation y = –18.7 ln (x) + 153.0 (R² = 0.952). The IC50 value calculated for the future experimentation was 246.67 μmol·mL−1, which was further rounded off to 250 μmol·mL−1. Our results indicated that the concentrations below 100 μg·mL−1 for each extract were found to be non-toxic and could be considered to assess their protective ability on our assay system (Fig. 1b). Out of the three extracts tested for the possible protective effect; BM-MEx was found to be highly efficient to confer maximum protection against H2O2-induced oxidative stress. BM-MEx significantly improved the cell viability to 77.85% ± 4.21% (P < 0.05) at 25 μg·mL−1 (Fig. 1c). BM-EEx and BM-WEx also protected cells at 25 and 50 μg·mL−1, respectively, with cell viability of 67.07% ± 4.90% (P < 0.05) and 61.77% ± 3.85% (P < 0.05), respectively (Figs. 1d−e). As the highest protection percentage was achieved with BM-MEx, it was selected for further investigations. Bioactive components of BM-MEx The TLC profile of BM-MEx generated with chloroform: methanol (23 : 2) solvent system, portrayed eleven spots with Rf values of 0.10, 0.17, 0.29, 0.37, 0.46, 0.5, 0.56, 0.65, 0.68, 0.93, and 0.96 (Fig. 2). Afterwards, the UPLC analysis of BM-MEx also revealed the existence of various polyphenolic compounds. The UPLC scan gave information about retention time of different polyphenols in the standard mixture and BM-MEx (Figs. 3a−b). Table 2 summarizes the concentrations of existing polyphenols per mg of the extract. The UPLC analysis revealed quercetin, catechin, umbelliferone, and caffeic acid as major polyphenols in the BM-MEx. Comparison of protective effects of BM-MEx with standard polyphenols UPLC analysis of BM-MEx portrayed quercetin, catechin, umbelliferone and caffeic acid as the predominant compounds. Further, these compounds were tested for their possible protective prospects. The comparison of protective ability of BM-MEx with standard polyphenols portrayed quercetin to significantly improve the cell viability to 71.84% ± 4.04%, followed by catechin with 67.14% ± 4.17%, caffeic acid with

65.26% ± 3.39% and umbelliferone with 62.04% ± 4.32% (P < 0.05) against H2O2-induced cytotoxicity. The BM-MEx was found to deliver utmost protection in contrast of set of selected polyphenols (Fig. 4). Behavior of antioxidant machinery The levels of antioxidants machinery were studied in both BM-MEx- and quercetin-treated cells against H2O2 induced stress. The results showed that pretreatment with BM-MEx and quercetin facilitated the cells to overcome the stress generated by H2O2. The experimental data are shown in Table 3. The activity of catalase was decreased abruptly in H2O2 treated culture as compared to control (P < 0.05). A significant increase in catalase activity was observed in BM-MEx cultures in comparison to control (P < 0.05). The pretreatment with BM-MEx and quercetin helped the cells combat the stress. The activity of catalase was increased significantly in comparison to H2O2 treated cells (P < 0.05). A similar behavior was seen in SOD activity, the expression was seen to be reduced in H2O2 treated cells as compared to control (P < 0.05). Whereas the expression of SOD was found to be elevated significantly in BM-MEx + H2O2, Quercetin + H2O2, and BM-MEx treated cultures in contrast of H2O2 and control cells, respectively (P < 0.05). The levels of GPx and reduced GSH were also studied. The levels of GPx and reduced GSH content were significantly decreased as compared to control after the treatment of H2O2 (P < 0.05). However, the pretreatments with BM-MEx and quercetin showed a significant increase in the levels of both GPx and reduced GSH content in contrast to H2O2 treated cells (P < 0.05). The cells treated only with BM-MEx had also shown a significant increase in the levels of both the GPx and GSH content in comparison to control (P < 0.05). The activity of catalase, SOD, GPx, and GSH was also found to be restored to normal level with the pretreatment of quercetin in H2O2 subjected cultures. A significant increase in lipid peroxidation was seen in H2O2 treated cultures as compared to control (P < 0.05), but the culture with pretreatment of BM-MEx and quercetin revealed a significant decrease in lipid peroxidation (P < 0.05). The decreased lipid peroxidation was seen in both BM-MEx

– 838 –

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

and quercetin treated cultures (P < 0.05), which indicated

their anti-oxidant effects.

Fig. 1 Neuroprotective effects of B. monnieri extracts on IMR32 cell line. (a) Dose-dependent cytotoxic effects of H2O2; (b) Toxicity profile of extracts of B. monnieri; (c) Effects of pretreatment with BM-MEx on H2O2-induced cytotoxicity; (d) Effects of pretreatment with BM-EEx on H2O2-induced stress; (e) Effect of pretreatment with BM-WEx on H2O2-mediated damages. The data represent mean ± SEM from three independent experiments. a', Statistically significant difference between H2O2 treated cultures and control culture; a'', Statistically significant difference between H2O2 cultures and various extracts + H2O2 cultures

– 839 –

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

Table 2 Amount of different polyphenols in BM-MEx

Fig. 2 Analysis of BM-MEx by thin layer chromatography using chloroform−methanol (23 : 2) solvent system

Polyphenols

c/(μg·mg−1)

Gallic acid

0.271

Catechin

2.904

Chlorogenic acid

0.496

Epicatechin

1.810

Caffeic acid

2.166

Umbelliferone

2.858

Coumaric acid

0.175

Rutin

0.012

Ellagic acid

0.261

Quercetin

9.779

Kaempferol

0.025

Fig. 3 Representative chromatograms of UPLC analysis of (a) standard mixture (b) BM-MEx

Changes in NF200 expression in the H2O2 and BM-MEx + H2O2 IMR32 cells NF200 is a well-known cytoskeleton protein found in neurons. The NF200 expressions in the present study were investigated using immunofluorescence and using RT-PCR

(Fig. 5). A significant increase in the expression of NF200 was found in H2O2 treated cells, whereas the pretreatment with BM-MEx revealed the normal expression of NF200. In BM-MEx treated cultures (without H2O2), NF200 expression remained equivalent to that of control, indicating no stress on cells.

– 840 –

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

Fig. 4 Comparative analysis of neuroprotection by BM-MEx with set of polyphenols against H2O2 mediated toxicity. The above figure shows percent cell viability of respective treated groups with respect to control which was considered as 100%. a', Statistically significant difference between H2O2 treated culture and control culture; a'', Statistically significant difference between H2O2 treated cells and BM-MEx + H2O2 cultures and different polyphenols + H2O2 treated cells

Changes in HSP70 expression in the H2O2 and BM-MEx + H2O2 IMR32 cells HSP70 is a major constituent of heat shock protein family. The expression of HSP70 was examined by immuno- fluo-

rescence (Figs. 6a−d). The elevation of expression of HSP70 in H2O2 subjected cell cultures was suppressed by pretreatment with BM-MEx (P < 0.05). The HSP70 expression in the BM-MEx pretreated cells (without H2O2), remained normal as the control cells, indicating no stress. The protection due to BM-MEx was further confirmed at the mRNA level using RT-PCR (Figs. 6e−f). The HSP70 mRNA level was found significantly low in BM-Mex + H2O2 cultures than in H2O2 cultures (P < 0.05). No significant difference in HSP70 expression was observed between control and BM-MEx cultures using immunofluorescence or RT-PCR. Changes in mortalin expression in the H2O2 and BM-MEx + H2O2 IMR32 cells Mortalin is another member of the heat shock protein family but not a heat inducible itself. In the present study, the expression of mortalin was examined by immunofluorescence and RT-PCR. The immunofluorescence study showed that pretreatment with BM-MEx prior to H2O2 suppressed the mortalin expression to the level equivalent to the control cells (P < 0.05). The RT-PCR results also showed the similar trend of protection as shown by the relative intensity of the DNA amplified from the mRNA transcribed in the respective treatment groups. The results showed that over expression of mortalin was alleviated by pretreatment with BM-MEx (Fig. 7).

Table 3 Effects of protective effects of BM-MEx on oxidant scavenging machinery in IMR32 cells Groups

Catalase (U·g−1 tissue)

SOD (U·g−1 tissue)

GSH (mg·g−1 tissue)

GPx (U·g−1 tissue)

LPx (mg·dL–1)

Control

3.36 ± 0.29

17.09 ± 1.29

5.13 ± 0.52

20.62 ± 1.33

18.01 ± 1.24

BM-MEx

3.73 ± 0.43 a

18.74 ± 1.10 a

5.36 ± 0.46 a

23.07 ± 1.54 a

13.34 ± 0.81 a

H2O2

1.96 ± 0.38 b

10.60 ± 0.79 b

2.69 ± 0.43 b

11.92 ± 0.86 b

33.58 ± 1.97 b

c

c

c

c

26.11 ± 1.04 c

BM-Mex + H2O2

2.82 ± 0.41

15.27 ± 1.04

4.02 ± 0.55

18.53 ± 1.24

Quercetin

3.52 ± 0.34

17.94 ± 1.28

5.32 ± 0.74

21.86 ± 1.18

13.12 ± 0.98 a

Quercetin + H2O2

2.65 ± 0.26 c

15.02 ± 1.14 c

4.92 ± 0.54 c

17.21 ± 1.41 c

28.02 ± 1.12 c

The data represent means ± SEM. of protective potential of BM-MEx on oxidant scavenging machinery measured in homogenates obtained from cells of culture dishes (n = 3) derived from three independent cultures. The values having P < 0.05 are considered significant. a, Statistically significant change in BM-MEx or quercetin treated cultures with respect to control cultures; b, statistically significant change in H2O2 treated cultures with respect to the control cultures; c, statistically significant change in BM-MEx + H2O2 or quercetin + H2O2 treated cultures with respect to the H2O2 treated cultures

Discussion Oxidative stress is a well-known factor involved in neuronal cell death. Free radical species play an important role in the deterioration of the CNS [1-4]. Brain cells are highly susceptible to such damage as they do not have regeneration capability. Although the inbuilt defense forces are capable enough to deal with the free radicals, sometimes they are inefficient and cellular damage occurs [7-8]. Keeping above in mind, the boosting of the defense machinery through herbal remedies would be an effective measure to overcome this crisis. It is noteworthy that, in ayurvedic medicinal system, Bacopa monnieri is well established for its cognitive, memory and learning enhancement properties [9-12]. Recent researches

have focused primarily on the protective potential of B. monnieri against many neurodegenerative diseases by using animal models [40-45]. The different phytochemicals of Brahmi responsible for its antioxidant and protective potential are well identified, which plays a significant role in managing the factors responsible for the onset of diseases [15, 42, 46, 47]. There are few reports available on protective effect of Bacopa monnieri on mammalian cells under oxidative stress to study its stress proteins response. Therefore, the current study was designed to elucidate the neuroprotective and antioxidant potential of B. monnieri extracts. The possible mechanism of this protection was explored by measuring the levels of different proteins selected as stress markers and the antioxidant machinery levels.

– 841 –

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

Fig. 5 (a–d) Localization of NF200 in IMR32 cells by immunofluorescence; (e, f) Representative reverse transcription-polymerase chain reaction (RT-PCR) showing β-actin and NF200 expression in IMR32 cells; (g, h) Relative intensity analyses of NF200 in immunofluorescence and RT-PCR. Relative optical density of NF200 in RT-PCR for each group expressed as percentage of β-actin. Relative units of NF200 were calculated for RT-PCR by ImageJ 1.44p. The values having P < 0.05 are considered significant. a', statistically significant difference H2O2 treated cultures and control cultures; a'', statistically significant difference between BM-MEx + H2O2 treated cultures and BM-MEx treated cultures; a''', statistically significant difference between H2O2-treated cultures and BM -MEx + H2O2 treated cultures

H2O2 is a well-known generator of reactive oxygen species (ROS) inflicting cellular injuries, eventually leading to programmed cell death or necrosis [7]. Being deficit of efficient antioxidant system, the cell would be unable to deal with the damages consequent to ROS. In the current study, IMR32 cells were treated with H2O2 (250 μmol·L−1) to induce oxidative stress. The cells were also treated with varied concentrations of B. monnieri extracts to determine the maximum non-toxic concentration, indicating that the concentrations below 100 μg·mL−1 for each extract were found to be non-toxic. Out of the different extracts tested, BM-MEx was found to deliver maximum protection against H2O2-induced stress. Based on preliminary studies BM-MEx was selected to carry out further experimentations. Earlier studies have also supported this protective potential of B .monnieri [40, 48-49]. Besides B. monnieri extracts, aqueous and alcoholic extracts of some other plants like Rosmarinus officinalis and Lonicera japonica have also been known to protect against H2O2 induced oxidative stress [50-51]. Number of polyphenols like quercetin, catechin, kaempferol, and many more are well known to exhibit protective ability against different stress

models [17, 19-21, 52-53]. The UPLC analysis of BM-MEx revealed the presence of various bioactive constituents at different concentrations with quercetin at maximum followed by catechin, umbelliferone, and caffeic acid. Further, the protective ability of BM-MEx was compared with major components detected in UPLC analysis and BM-MEx was found to deliver maximum protection in IMR32 cells. The underlying mechanism for this protective prospect of BM-MEx might be attributed to the synergistic effect of different phytochemicals present in the extract. The natural antioxidant system of the cell is well equipped to combat the deleterious effects of the oxidative stress. Catalase, SOD, GPx and other constituents of the system play an important role to protect the cell from the oxidative damage [5, 7]. In the current study, considerable reductions in the levels of catalase, SOD, GPx and increase in the level of LPx were linked with the H2O2 treatment, signifying damage in the endogenous antioxidant machinery. However, pretreatment of IMR32 cells with BM-MEx and quercetin significantly alleviated the H2O2 effects. These results authenticated the protective attribute of BM-MEx against the oxidative injuries in IMR32 cells.

– 842 –

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

Fig. 6 (a–d) Localization of HSP70 in IMR32 cells by immunofluorescence; (e, f) Representative reverse transcription-polymerase chain reaction (RT-PCR) showing β-actin and HSP70 expression in IMR32 cells; (g, h) Relative intensity analyses of HSP70 in immunofluorescence and RT-PCR. Relative optical density of HSP70 in RT-PCR for each group expressed as percentage of β-actin. Relative units of HSP70 were calculated for RT-PCR by ImageJ 1.44p. The values having P < 0.05 are considered significant. a', statistically significant difference H2O2 treated cultures and control cultures; a'', statistically significant difference between BM-MEx + H2O2 treated cultures and BM-MEx treated cultures; a''', statistically significant difference between H2O2-treated cultures and BM -MEx + H2O2 treated cultures.

To validate the neuroprotective potential of BM-MEx at molecular level, immunofluorescence and RT-PCR were used to observe the expression of three stress indicator proteins, NF200, HSP70, and mortalin. NF200, the intermediate filaments in neurons, is a foremost cytoskeletal constituent of axons and plays an important role in the cytoarchitecture and axonal transport [54]. In the present study, elevated expression of NF200 followed by H2O2 exposure was observed. Such an increment in the level of this neurofilamentous protein is known to occur in response to most brain injuries [31]. Our findings demonstrated that BM-MEx protected the cells against H2O2 induced oxidative damage by down-regulating the NF200 expression at both protein and mRNA levels in IMR32 cells, indicating a possible mechanism of neuroprotective effect of the BM-MEx. Heat shock proteins are also well known to assist the proper functioning of the cell under normal as well as stressed conditions [55]. The levels of HSPs have been observed to be elevated in varied pathological conditions, including cerebral ischemia, neurodegenerative disease, epilepsy, and trauma [32, 56]. The pretreatment of BM-MEx revealed the alleviation in the

expression of HSP70 in IMR32 cells subjected to H2O2 which signified the protective potential of methanolic extract of B. monnieri. Mortalin is a highly conserved protein involved in a variety of functions like stress response and check on cell proliferation. Any variation in the expression level of this protein may end up with severe biological outcomes, including neurodegeneration [57]. The expression of mortalin has been found to be elevated during different oxidative insults [27-28]. The current study also revealed the over expression of mortalin because of H2O2 induced oxidative stress. The significant down-regulation in the expression of mortalin was observed in cells pretreated with BM-MEx, indicating the protective effect of BM-MEx. Present results suggested that expression levels of NF200, HSP70, and mortalin showed changes subsequent to the treatment of BM-MEx and support the existence of neuroprotection. Pretreatment of the cells with extracts significantly elevated the cell viability. These results suggested that BM-MEx may be used as neuroprotective agent against brain disorders and neuropathological conditions arising from oxidative stress injuries.

– 843 –

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

Fig. 7 (a–d) Localization of mortalin in IMR32 cells by immunofluorescence; (e, f) Representative reverse transcription-polymerase chain reaction (RT-PCR) showing β-actin and mortalin expression in IMR32 cells; (g, h) Relative intensity analyses of mortalin in immunofluorescence and RT-PCR. Relative optical density of mortalin in RT-PCR for each group expressed as percentage of β-actin. Relative units of mortalin were calculated for RT-PCR by ImageJ 1.44p. The values having P < 0.05 are considered significant. a', statistically significant difference H2O2 treated cultures and control cultures; a'', statistically significant difference between BM-MEx + H2O2 treated cultures and BM-MEx treated cultures; a''', statistically significant difference between H2O2-treated cultures and BM -MEx + H2O2 treated cultures

Conclusion

[2]

Out of the different extracts tested, BM-MEx exhibited promising protection against H2O2 induced oxidative stress by boosting the endogenous defense machinery, increase in glutathione level and maintaining the membrane integrity. The effects of BM-MEx were comparable to quercetin in regulating the expression of cellular antioxidant machinery and cell viability to normal level in H2O2 treated cells. These findings were further supported by the reduction in the levels of NF200, HSP70 and mortalin with pretreatment of BM-MEx before subjecting to H2O2. The possible protective effect of BM-MEx may be credited to the presence and synergistic effect of different phyto-constituents. Further study is needed to explore other cytoprotective proteins which could be the part of the defense machinery.

References [1]

[3]

[4]

[5]

[6]

[7] [8]

Gandhi S, Abramov AY. Mechanism of oxidative stress in neurodegeneration [J]. Oxid Med Cell Longev, 2012, 2012:

– 844 –

1-11. Kumar H, Lim H-W, More SV, et al. The role of free radicals in the aging brain and Parkinson’s disease: Convergence and parallelism [J]. Int J Mol Sci, 2012, 13(8): 10478-10504. Uttara B, Singh AV, Zamboni P, et al. Oxidative stress and neurodegenerative diseases: A review of upstream and downstream antioxidant therapeutic options [J]. Curr Neuropharmacol, 2009, 7(1): 65-74. Zhao Y, Zhao B. Oxidative stress and the pathogenesis of Alzheimer’s disease [J]. Oxid Med Cell Longev, 2013, 2013: 1-10. Mates J. Effects of antioxidant enzymes in the molecular control of reactive oxygen species toxicology [J]. Toxicology, 2000, 153(1): 83-104. Couto N, Wood J, Barber J. The role of glutathione reductase and related enzymes on cellular redox homeostasis network [J]. Free Radic Biol Med, 2016, 95: 27-42. Sies H. Oxidative stress: A concept in redox biology and medicine [J]. Redox Biol, 2015, 4: 180-183. Wei YH, Lee HC. Oxidative stress, mitochondrial DNA mutation, and impairment of antioxidant enzymes in aging [J]. Exp Biol Med, 2002, 227(9): 671-682.

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

Chatterjee M, Verma P, Palit G. Comparative evaluation of Bacopa monniera and Panax quniquefolium in experimental anxiety and depressive models in mice [J]. Indian J Exp Biol, 2010, 48(3): 306-313. Calabrese C, Gregory WL, Leo M, et al. Effects of a standardized Bacopa monnieri extract on cognitive performance, anxiety, and depression in the elderly: a randomized, double-blind, placebo-controlled trial [J]. J Alt Compl Med, 2008, 14(6): 707-713. Piyabhan P, Wetchateng T. Bacopa monnieri (Brahmi) enhanced cognitive function and prevented cognitive impairment by increasing VGLUT2 immunodensity in prefrontal cortex of sub-chronic phencyclidine rat model of schizophrenia [J]. J Med Assoc Thai, 2015, 98(Suppl 3): S7-15. Rai R, Singh HK, Prasad S. A special extract of Bacopa monnieri (CDRI-08) restores learning and memory by upregulating expression of the NMDA receptor subunit GluN2B in the brain of scopolamine-induced Amnesic mice [J]. Evid Based Compl Alter Med, 2015, 2015: 254303. Aguiar S, Borowski T. Neuropharmacological review of the nootropic herb Bacopa monnieri [J]. Rejuv Res, 2013, 16(4): 313-326. Mathew J, Gangadharan G, Kuruvilla K, et al. Behavioral deficit and decreased GABA receptor functional regulation in the hippocampus of Epileptic rats: Effect of Bacopa monnieri [J]. Neurochem Res, 2011, 36(1): 7-16. Rastogi M, Ojha RP, Prabu P, et al. Prevention of age-associated neurodegeneration and promotion of healthy brain ageing in female Wistar rats by long term use of bacosides [J]. Biogerontology, 2012, 13(2): 183-195. Ramasamy S, Chin SP, Sukumaran SD, et al. In silico and in vitro analysis of bacoside A aglycones and its derivatives as the constituents responsible for the cognitive effects of Bacopa monnieri [J]. PLoS One, 2015, 10(5): e0126565. Arredondo F, Echeverry C, Abin-Carriquiry JA, et al. After cellular internalization, quercetin causes Nrf2 nuclear translocation, increases glutathione levels, and prevents neuronal death against an oxidative insult [J]. Free Radical Biol Med, 2010, 49(5): 738-747. Jazvinšćak Jembrek M, Vuković L, Puhović J, et al. Neuroprotective effect of quercetin against hydrogen peroxide-induced oxidative injury in P19 neurons [J]. J Mol Neurosci, 2012, 47(2): 286-299. Filomeni G, Graziani I, De Zio D, et al. Neuroprotection of kaempferol by autophagy in models of rotenone-mediated acute toxicity: possible implications for Parkinson’s disease [J]. Neurobiol Aging, 2012, 33(4): 767-785. Li S, Pu XP. Neuroprotective effect of kaempferol against a 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced mouse model of Parkinson’s disease [J]. Biol Pharm Bull, 2011, 34(8): 1291-1296. Bobermin LD, Wartchow KM, Flores MP, et al. Ammoniainduced oxidative damage in neurons is prevented by resveratrol and lipoic acid with participation of heme oxygenase 1 [J]. Neurotoxicology, 2015, 49: 28-35. Gu L, Deng WS, Liu Y, et al. Ellagic acid protects lipopolysaccharide/D-galactosamine-induced acute hepatic injury in mice [J]. Int Immunopharmacol, 2014, 22(2): 341-345. Bian X, McAllister-Lucas LM, Shao F, et al. NF-κB activation mediates doxorubicin-induced cell death in N-type neuroblastoma

cells [J]. J Biol Chem, 2001, 276(52): 48921-48929. [24] Dong L, Liu Y, Colberg-Poley AM, et al. Induction of GM1a/GD1b synthase triggers complex ganglioside expression and alters neuroblastoma cell behavior; a new tumor cell model of ganglioside function [J]. Glycoconjugate J, 2011, 28(3-4): 137-147. [25] Kandimalla R, Wani WY, Binukumar B, et al. siRNA against presenilin 1 (PS1) down regulates amyloid b42 production in IMR-32 cells [J]. J Biomed Sci, 2012, 19: 1-9. [26] Redden RA, Doolin EJ. Microgravity assay of neuroblastoma: in vitro aggregation kinetics and organoid morphology correlate with MYCN expression [J]. In Vitro Cell Dev Biol-Animal, 2011, 47(4): 312-317. [27] Guo W, Yang L, Li H, et al. Glucose-regulated protein 75 overexpression attenuates ionizing radiation-mediated injury in PC12 cells by inducing the expression of topoisomerase IIα [J]. Mol Med Rep, 2012, 6(6): 1423-1427. [28] Londono C, Osorio C, Gama V, et al. Mortalin, apoptosis, and neurodegeneration [J]. Biomolecules, 2012, 2(1): 143-164. [29] Leja-Szpak A, Pierzchalski P, Goralska M, et al. Kynuramines induce overexpression of heat shock proteins in pancreatic cancer cells via 5-hydroxytryptamine and MT1/MT2 receptors [J]. J Physiol Pharmacol, 2015, 66(5): 711-718. [30] Liu L, Fu C, Yan M, et al. Resveratrol modulates intestinal morphology and HSP70/90, NF-kappaB and EGF expression in the jejunal mucosa of black-boned chickens on exposure to circular heat stress [J]. Food Funct, 2016, 7(3): 1329-1338. [31] Dhuna K, Dhuna V, Bhatia G, et al. Neuroprotective effect of Convolvulus pluricaulis methanol extract on hydrogen peroxide induced oxidative stress in Human IMR32 neuroblastoma cell line [J]. Brit Biotechnol J, 2012, 2(4): 192-210. [32] Kataria H, Wadhwa R, Kaul SC, et al. Water extract from the leaves of Withania somnifera protect RA differentiated C6 and IMR-32 cells against glutamate-induced excitotoxicity [J]. PLoS One, 2012, 7(5): e37080. [33] Harborne JB. Phytochemical Methods. A Guide to Modern Techniques of Plant Analysis [M]. Springer Science & Business Media, 1998. [34] Hansen MB, Nielsen SE, Berg K. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill [J]. J Immunological Methods, 1989, 119(2): 203-210. [35] Aebi H. Catalase in vitro [J]. Methods Enzymol, 1984, 105: 121-126. [36] Kono Y. Generation of superoxide radical during autoxidation of hydroxylamine and an assay for superoxide dismutase [J]. Arch Biochem Biophys, 1978, 186(1): 189-195. [37] Sedlak J, Lindsay RH. Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman'’s reagent [J]. Anal Biochem, 1968, 25: 192-205. [38] Flohé L, Günzler WA. Assays of glutathione peroxidase [J]. Methods Enzymol, 1984, 105: 114-121. [39] Buege JA, Aust S. Methods in Enzymology [M]. New York: Academic Press, 1978, 52: 302-310. [40] Limpeanchob N, Jaipan S, Rattanakaruna S, et al. Neuroprotective effect of Bacopa monnieri on beta-amyloidinduced cell death in primary cortical culture [J]. J Ethnopharmacol, 2008, 120(1): 112-117. [41] Hosamani R. Neuroprotective efficacy of Bacopa monnieri

– 845 –

Gaurav Bhatia, et al. / Chin J Nat Med, 2017, 15(11): 834846

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

against rotenone induced oxidative stress and neurotoxicity in Drosophila melanogaster [J]. Neurotoxicology, 2009, 30(6): 977-985. Mathew J, Paul J, Nandhu M, et al. Bacopa monnieri and bacoside-A for ameliorating epilepsy associated behavioral deficits [J]. Fitoterapia, 2010, 81(5): 315-322. Simpson T, Pase M, Stough C. Bacopa monnieri as an antioxidant therapy to reduce oxidative stress in the aging brain [J]. Evid Based Compl Alt Med, 2015, 2015: 615384. Rani A, Prasad S. A special extract of Bacopa monnieri (CDRI-08)-restored memory in CoCl2-Hypoxia Mimetic Mice Is Associated with Upregulation of Fmr-1 Gene Expression in Hippocampus [J]. Evid Based Complement Alternat Med, 2015, 2015: 347978. Jansen RL, Brogan B, Whitworth AJ, et al. Effects of five Ayurvedic herbs on locomotor behaviour in a Drosophila melanogaster Parkinson’s disease model [J]. Phytother Res, 2014, 28(12): 1789-1795. Kasture S, Kasture V, Joshua A, et al. Nootropic activity of bacoMind TM, an enriched phytochemical composition from Bacopa monnieri [J]. J Nat Remedies, 2007, 7(1): 166-173. Le XT, Pham HTN, Van Nguyen T, et al. Protective effects of Bacopa monnieri on ischemia-induced cognitive deficits in mice: The possible contribution of bacopaside I and underlying mechanism [J]. J Ethnopharmacol, 2015, 164: 37-45. Paulose C, Chathu F, Khan SR, et al. Neuroprotective role of Bacopa monnieri extract in epilepsy and effect of glucose supplementation during hypoxia: glutamate receptor gene expression [J]. Neurochem Res, 2008, 33(9): 1663-1671. Shinomol GK, Mythri RB, Bharath MS. Bacopa monnieri

[50]

[51]

[52]

[53]

[54]

[55] [56]

[57]

extract offsets rotenone-induced cytotoxicity in dopaminergic cells and oxidative impairments in mice brain [J]. Cell Mol Neurobiol, 2012, 32(3): 455-465. Park SE, Kim S, Sapkota K, et al. Neuroprotective effect of Rosmarinus officinalis extract on human dopaminergic cell line, SH-SY5Y [J]. Cell Mol Neurobiol, 2010, 30(5): 759-767. Kwon SH, Hong SI, Kim JA, et al. The neuroprotective effects of Lonicera japonica Thunb. against hydrogen peroxideinduced apoptosis via phosphorylation of MAPKs and PI3K/Akt in SH-SY5Y cells [J]. Food Chem Toxicol, 2011, 49(4): 1011-1019. Jembrek MJ, Vuković L, Puhović J, et al. Neuroprotective effect of quercetin against hydrogen peroxide-induced oxidative injury in P19 neurons [J]. J Mol Neurosci, 2012, 47(2): 286-299. Vauzour D, Corona G, Spencer JP. Caffeic acid, tyrosol and p-coumaric acid are potent inhibitors of 5-S-cysteinyldopamine induced neurotoxicity [J]. Arch Biochem Biophys, 2010, 501(1): 106-111. Schwartz M, Shneidman P, Bruce J, et al. Axonal dependency of the postnatal upregulation in neurofilament expression [J]. J Neurosci Res, 1990, 27(2): 193-201. Rajdev S, Sharp FR. Stress proteins as molecular markers of neurotoxicity [J]. Toxicol Pathol, 2000, 28(1): 105-112. Yenari MA. Heat shock proteins and neuroprotection. In: Molecular and Cellular Biology of Neuroprotection in the CNS [M]. Springer US, 2003, 513: 281-299. Carette J, Lehnert S, Chow TK. Implication of PBP74/ mortalin/GRP75 in the radio-adaptive response [J]. Int J Radiation Biol, 2002, 78(3): 183-190.

Cite this article as: Gaurav Bhatia, Vikram Dhuna, Kshitija Dhuna, Manpreet Kaur, Jatinder Singh. Bacopa monnieri extracts prevent hydrogen peroxide-induced oxidative damage in a cellular model of neuroblastoma IMR32 cells [J]. Chin J Nat Med, 2017, 15(11): 834-846.

– 846 –