Bifidobacterium animalis ssp. lactis BB-12 enumeration by quantitative PCR assay in microcapsules with full-fat goat milk and inulin-type fructans

Journal Pre-proofs Bifidobacterium animalis ssp. lactis BB-12 enumeration by quantitative PCR assay in microcapsules with full-fat goat milk and inulin-type fructans Silvani Verruck, Kelly Justin Silva, Helena de Oliveira Santeli, Mirella Christine Scariot, Gustavo Luiz Venturelli, Elane Schwinden Prudencio, Ana Carolina Maisonnave Arisi PII: DOI: Reference:

S0963-9969(20)30156-3 https://doi.org/10.1016/j.foodres.2020.109131 FRIN 109131

To appear in:

Food Research International

Received Date: Revised Date: Accepted Date:

27 November 2019 25 February 2020 26 February 2020

Please cite this article as: Verruck, S., Justin Silva, K., de Oliveira Santeli, H., Christine Scariot, M., Luiz Venturelli, G., Schwinden Prudencio, E., Carolina Maisonnave Arisi, A., Bifidobacterium animalis ssp. lactis BB-12 enumeration by quantitative PCR assay in microcapsules with full-fat goat milk and inulin-type fructans, Food Research International (2020), doi: https://doi.org/10.1016/j.foodres.2020.109131

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier Ltd.

Bifidobacterium animalis ssp. lactis BB-12 enumeration by quantitative PCR assay in microcapsules with full-fat goat milk and inulin-type fructans

Silvani Verruck1, Kelly Justin Silva2, Helena de Oliveira Santeli2, Mirella Christine Scariot2, Gustavo Luiz Venturelli2, Elane Schwinden Prudencio1, Ana Carolina Maisonnave Arisi2*

1Dairy

Technology Laboratory, Food Science and Technology Department, Agrarian

Science Center, Federal University of Santa Catarina, Rod. Admar Gonzaga, 1346, Itacorubi, 88034-001, Florianópolis, SC, Brazil. 2Molecular

Biology Laboratory, Food Science and Technology Department, Agrarian

Science Center, Federal University of Santa Catarina, Rod. Admar Gonzaga, 1346, Itacorubi, 88034-001, Florianópolis, SC, Brazil.

*Corresponding author. Tel.: +55 48 37215382; E-mail: [email protected]

1

Abstract The current study was conducted to develop a quantitative polymerase chain reaction (qPCR) assay for Bifidobacterium animalis ssp. lactis BB-12 quantification in microcapsules matrix with full-fat goat milk and inulin-type fructans. DNA was isolated from milk, feed solutions (before spray drying) and microcapsules (after spray drying) using DNAzol. Two primer pairs targeting Bal-23S or Tuf sequences were evaluated by qPCR. The qPCR efficiency was higher (89.5%) using the Tuf primers than Bal-23S primers (84.8%). Tuf primer pair was able to selectively detect B. animalis ssp. lactis BB12. After, quantification of bifidobacteria in the microcapsules matrix by Tuf qPCR assay was compared to conventional enumeration by plate counting. The analysis of probiotic feed solutions and microcapsules showed higher (P < 0.05) bacterial enumeration determined by Tuf qPCR assay compared to those obtained by plate counting. This qPCR assay was considered a rapid and sensitive alternative for the quantification of B. animalis ssp. lactis BB-12 in probiotic microcapsules compared to plate counting.

Keywords: bifidobacteria, probiotics, prebiotic, qPCR, microencapsulation

1. Introduction

2

With the rapid growth of bifidobacteria utilization in the functional food industry, advanced methods to perform qualitative and quantitative control measurements are increasingly needed (Champagne, Gomes da Cruz, & Daga, 2018; Guimarães et al., 2020). Traditionally, culture-dependent methods such as plate counting are the choice for viability determination of probiotics (Shoeni, 2015). However, these approaches include some disadvantages, such as the relatively long times needed for the colonies growth, i.e., are time-consuming and labor-intensive (Kramer, Obermajer, Matijašić, Rogelj, & Kmetec, 2009). Bifidobacteria are often hard to be enumerated by the traditional procedures because of the lack of suitable media for the selective growth of these bacteria strain from probiotic products (Vinderola & Reinheimer, 1999). Also, Ilha et al. (2016) reported that several species of intimately related bacteria that have similar nutritional and growth requirements are present in the matrices of dairy products, such as yogurt and cheese. Triggered by these shortcomings, independent-culture methods based on direct analyses of the DNA extracted from the food matrix, without the culturing step are developed as an alternative available to culture-dependent methods (Achilleos & Berthier, 2013). Mostly of the culture-independent methods are based on the Polymerase Chain Reaction (PCR) (Matijašić, Obermajer, & Rogelj, 2010). Achilleos and Berthier (2013) emphasized that the extraction method, quality of DNA, the target region (specific primers), and use of positive and negative controls are essential factors to be considerate when using a culture-independent method. Thus, the choice of species-specific primers with conserved protein-coding sequences of the probiotic bacteria is recommended. Solano-Aguilar et al. (2008) suggested a highly conserved and ubiquitous Tuf gene that facilitates the elongation of polypeptides from the ribosome and aminoacyl tRNA during translation. This gene is universally distributed in

3

Bifidobacterium (one Tuf gene per bacterial genome) and can distinguish closely related Bifidobacterium animalis at the subspecies level. In addition, the 23S rRNA gene also offers some advantages, such as universal distribution, conserved function, and invariant and variable regions (Hunt et al., 2006). However, the use of these species-specific primers (Tuf and Bal-23S) for quantification of B. animalis ssp. lactis BB-12 are mostly used in clinical samples and not for quantification of bacterial DNA extracted from dairy products (Solano-Aguilar et al., 2008; Taipale et al., 2011). In addition, the milk and dairy products have a complex composition and structure, as well other bacteria can be present in the matrix. Therefore, independent culture methods based on direct analyses of DNA and RNA have been increasingly used in the quantification of probiotic bacteria in dairy products, such as B. animalis subsp. lactis BB-12 (Desfossés-Foucault et al., 2012; Ganesan et al., 2014; Kramer et al., 2009). Masco, Vanhoutte, Temmerman, Swings, and Huys (2007) and Ganesan et al. (2014) investigated the applicability of qPCR for the quantitative analysis of bifidobacteria in dairy products. These authors indicate that qPCR is a high throughput quantitative analysis of bifidobacteria to be used on a commercial scale of probiotic products. Microencapsulated bifidobacteria are increasingly used in the development of functional dairy products (Champagne, Raymond, Guertin, & Bélanger, 2015; FritzenFreire et al., 2013; Pinto et al., 2012). It is known that microencapsulation provides a particular microenvironment to the cells which stabilize probiotics when applied to dairy foods

(Sathyabama,

Kumar,

Devi,

Vijayabharathi,

&

Priyadharisini,

2014).

Microencapsulation is a promising approach for the protection of bacterial cells, and several studies have investigated the protective role of these techniques (Ashwar, Gani, Gani, Shah, & Masoodi, 2018). Traditionally, probiotics are microencapsulated with bovine milk and by-products. However, non-bovine milk has been used in the

4

manufacture of several probiotic products around the world (Mituniewicz–Małek, Zielińska, & Ziarno, 2019; Ranadheera et al., 2019; Santos et al., 2019; Verruck et al., 2020). The goat milk dominates the market of non-bovine milk products, thus, specific microcapsules must be developed for this kind of product in order to not occur crosscontamination with bovine milk proteins (Ranadheera, Naumovski, & Ajlouni, 2018). In addition, some properties of goat milk, such as appropriate pH, good buffering capacity and high nutrients content could facilitate the long-term survival of probiotics. Verruck, Dantas, and Prudencio (2019) also stated that differences in fatty acids composition, fat globule size, content and conformation of proteins in comparison to cow’s milk represent a better digestibility and nutritional value for goat’s milk. However, in order to improve the performance of probiotic bacteria and mainly their survival in products and throughout the human digestive system, other substances, such as inulin type-fructans, are also used in probiotic microcapsule formulations (Ranadheera, Evans, Adams, & Baines, 2015; Verruck et al., 2017). These prebiotic substances are a source of nutrients selectively used by probiotic bacteria, which means that these bacteria have survival advantages when prebiotics are present (Gibson et al., 2017). However, before the application of a microcapsule in a product, it must be correctly proved that the probiotic bacteria are alive in the microcapsule, in order to exert their benefits. Therefore, due to the lack of suitable isolation media, molecular methods are recommended because of their sensitivity and reliability for the selective detection and enumeration of Bifidobacterium (Masco et al., 2007). In the light of all these observations described above, the goal of this study was to evaluate the efficiency of two different primer pairs (Tuf and Bal-23S genes) for quantification of B. animalis ssp. lactis BB-12 in microcapsules produced with goat’s milk and inulin-type fructans. In addition, the present work also compared a qPCR assay with traditional plate count with the

5

objective to be a more rapid and sensitive alternative for the quantification of B. animalis ssp. lactis BB-12 in probiotic microcapsules.

2. Material and methods

2.1 Feed solutions preparation and parameters for microencapsulation of Bifidobacterium animalis ssp. lactis BB-12 Four different microcapsules were prepared with different quantities of goat’s milk and inulin-type fructans (GM, GMI, GMO, and GMIO). For this, the composition of feed solutions of GM was goat’s milk powder and distilled water (2:8, w/v); GMI was goat’s milk powder, inulin, and distilled water (1:1:8 w/w/v); GMO was goat’s milk powder, oligofructose, and distilled water (1:1:8 w/w/v) and; GMIO was goat’s milk powder, inulin, oligofructose, and distilled water (1:0.5:0.5:8 w/w/w/v). The Bifidobacterium animalis ssp. lactis BB-12 (Nu-trish® BB-12®, Chr. Hansen, Hønsholm, Denmark) suspension used in the feed solutions was prepared following the procedures previously described (Verruck et al., 2017). The feed solutions containing the carrier agents employed for the manufacture of the four different spray-dried B. animalis ssp. lactis BB-12 microcapsules were based on our previous work (Verruck et al., 2017). For the microencapsulation process, a laboratory-scale spray dryer (B-290, Buchi, Flawil, Switzerland) was used operating at constant air inlet temperature of 150 ºC and an outlet temperature of 50 ± 3 ºC, as described previously (Fritzen-Freire et al., 2012). For the B. animalis ssp. lactis BB-12 quantification by qPCR and by plate count method, before and after spray drying process the samples were divided into two groups. The first group represents feed solutions (fs) and the second represents microcapsules

6

(mc) samples. Thus the group of feed solutions were represented by fs after the formulation abbreviation (GMfs, GMIfs, GMOfs, and GMIOfs), i.e., the samples were not submitted to the spray drying process. The group of microcapsules were represented by mc the formulation abbreviation (GMmc, GMImc, GMOmc, and GMIOmc), i.e., samples that were submitted to the spray drying process.

2.2 DNA extraction protocol for Bifidobacterium animalis ssp. lactis BB-12 culture from milk, feed solutions (before spray drying) and microcapsules (after spray drying) To obtain the same total solids concentration observed in the feed solutions, 2 g of each microcapsule formulation was resuspended in 10 mL of distilled water before the B. animalis ssp. lactis BB-12 DNA extraction from the microcapsules (GMmc, GMImc, GMOmc, and GMIOmc). After that, 10 mL of feed solutions (GMfs, GMIfs, GMOfs, and GMIOfs) and previously resuspended microcapsules samples (GMmc, GMImc, GMOmc, and GMIOmc) were submitted to DNA extraction. The DNAzol® method described previously by Ilha et al. (2016) was used to provide the DNA extraction of B. animalis ssp. lactis BB-12 culture in milk, feed solutions and from microcapsules.

2.3 Quantitative PCR assay

2.3.1 Primers pairs test

In order to quantify Bifidobacterium animalis ssp. lactis BB-12 by qPCR, the primer pairs Tuf and Bal-23S were tested (Table 1). Bal-23S primers were designed based on partial bifidobacteria 23S ribosomal DNA sequences and Tuf primers based on

7

elongation factor Tu gene sequence. For species-specific primer pairs, standard curves were performed in three different days

2.3.2 qPCR amplification conditions

Quantitative PCR was performed in ABI PRISM 7500 Detection System (Applied Biosystems, Foster City, CA, USA). Amplification reactions were realized with 12.5 μL of SYBR® Green Master Mix (Applied Biosystems, Foster City, CA, USA), 150 nM of TufR or BalR and 200 nM of TufF or BalF, 2 μL of template DNA (10 ng or 50 ng) and water in a final volume of 25 μL. The reactions were performed in triplicate. The conditions of the thermal cycling were 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 94 °C for 15 s and 60 °C for 1 min. Thus, the fluorescence signal was measured at the end of each 60 °C step. In addition, melting curve analysis was performed automatically by continuous heating from 65 °C to 94 °C. All qPCR runs were done in triplicate and analyzed using automatic software settings.

2.3.3 Primer specificity test For the primer specificity test, strains representing the genera Lactobacillus, Enterococcus, Staphylococcus, Pseudomonas, Bacillus, and Escherichia were tested. Lactobacillus spp. bacterial strains were grown in De Man, Rogosa, and Sharpe (MRS) broth (Merck, Germany) at 30 ± 1 °C for 24 h while the other bacterial strains were grown were grown in nutrient broth (Merck, Germany) at 35 ± 1 °C for 24 h. Optical density (OD) of bacterial cell culture was measured at 600 nm using Hitachi U2910 Spectrophotometer (IL, USA). The DNA extraction of the bacterial cultures was performed as for B. animalis ssp. lactis BB-12 culture in milk, feed solutions and

8

microcapsules DNA extraction and was based on the DNAzol® method described previously (Ilha et al., 2016).

2.4 Construction of standard curve relating Bifidobacterium animalis ssp. lactis BB12 cell numbers to qPCR quantification cycle (Cq) values The genomic DNA isolated from B. animalis ssp. lactis BB-12 culture in milk was used to prepare a standard curve from tenfold serial dilutions with water to a final concentration ranging from 107 to 100 bifidobacteria genomic DNA copies. The number of bacterial DNA copies was calculated by B. animalis ssp. lactis BB-12 (GenBank accession number NC_017214.1) genome length (1.940Mbp). The Cq versus log CFU mL-1 of B. animalis ssp. lactis BB-12 was estimated using genomic DNA extracted from the bacterial culture in milk. Amplification efficiencies were determined using the equation Efficiency = 10(−1/slope)−1. Therefore, B. animalis ssp. lactis BB-12 count by qPCR (log CFU mL−1) in feed solutions (GMfs, GMIfs, GMOfs, and GMIOfs) and microcapsules (GMmc, GMImc, GMOmc, and GMIOmc) were determined as described previously (Ilha et al., 2016).

2.5 Determination of Bifidobacterium animalis ssp. lactis BB-12 concentration before and after spray drying by plate count method To determine B. animalis ssp. lactis BB-12 count, all samples (GMfs, GMIfs, GMOfs, GMIOfs, GMmc, GMImc, GMOmc, and GMIOmc) were ten-fold diluted with peptone water (1 g L-1 ) serially (Oxoid, Hampshire, UK). After, the samples were plated by pour plate method on MRS agar (Merck, Darmstadt, Germany) modified with the addition of 2 g L-1 lithium chloride (Vetec, Rio de Janeiro, Brazil) and 3 g L-1 sodium propionate (Fluka, Neu-Ulm, Germany) (Vinderola & Reinheimer, 1999). The plates

9

were incubated at 37 ± 1 ºC for 72 h in anaerobic jars containing AnaeroGen® (Oxoid, Hampshire, UK). The counts of viable probiotic cells were expressed as log colonyforming units per milliliter (log CFU mL-1).

2.6 Statistical analysis To determine significant differences (P < 0.05) between the qPCR B. animalis ssp. lactis BB-12 count and plate count method, one-way analysis of variance (ANOVA) and Tukey studentized range test was used. All statistical analyses were performed using STATISTICA 13.3 software (Tibco, StatSoft Inc., Tulsa, USA). The data were expressed as a mean ± standard deviation.

3. Results and Discussion

Initially, different target regions were tested for the species-specific detection of Bifidobacterium animalis ssp. lactis BB-12. Thus, standard curves from serial dilution of pure bifidobacteria genomic DNA were constructed (Figure 1), one using Tuf primers (Solano-Aguilar et al., 2008) and other using Bal-23S primers (Taipale et al., 2011). The reaction parameters were calculated from standard curves (Figure 1). The qPCR using Tuf primers showed higher efficiency (89.53%) than qPCR using Bal-23S primers (84.78%). The lower efficiency reported for the Bal-23S primer could result in low precision and consequently poor quantification. Recently, 16S and 23S rRNA gene and the rRNA intergenic spacer region have been used as target genes for some Bifidobacterium spp. However, the high similarities of sequences among closely related Bifidobacterium species could difficult the efficiency of these primers to differentiate species (Sheu et al., 2010). Youn, Seo, and Ji (2007) evaluated 37 Bifidobacterium primer

10

sets, including from 23S rDNA, and found that only part of these primer sets showed the expected specificity. On the other hand, monocopy target genes, including Tuf revealed high divergence for Bifidobacterium species and was chosen as a better alternative of molecular marker (Solano-Aguilar et al., 2008; Ventura, Canchaya, Meylan, Klaenhammer, & Zink, 2003), as occurred in the present study. For Tuf species-specific primer pair, the Figure 2 shows the standard curves obtained in three different days. The parameters obtained in each day are shown in Table 2. The efficiency values found in the present study are in accordance with previous studies (Achilleos & Berthier 2013; Ilha et al., 2016; Solano-Aguilar et al., 2008). Specificity test was conducted using DNA extracted from B. animalis ssp. lactis BB-12 and other bacterial strains to verify if the Tuf primer pair was able to selectively detect B. animalis ssp. lactis BB-12. The specificity of the Tuf primers was tested for strains

representing

the

genera

Lactobacillus,

Enterococcus,

Staphylococcus,

Pseudomonas, Bacillus, and Escherichia (Table 3). It was observed that the Tuf primer par used showed amplifications of Lactobacillus casei INCQS 500006, Lactobacillus paracasei CCT 7501, and Lactobacillus sakei ATTC 5221. This behaviour is considered as unspecific amplification. However, the Cq observed for DNA extracted from these strains (Cq>32.84) can be considered late Cq while the Cq observed for B. animalis ssp. lactis BB-12 was 14.49. Similar results were found by other authors (Solano-Aguilar et al., 2008), and late Cq (Cq = 40) were observed for genera Lactobacillus and Enterococcus when the Tuf primers were tested for B. animalis ssp. lactis BB-12 specific amplification. The Tuf gene was considered an ideal target for designing molecular methods to detect Bifidobacterium species (Sheu et al., 2013). Thus, this gene can be an alternative for the investigation of a Bifidobacterium species commonly used in probiotic

11

products. Also, analysis of amplicon melting curves (Tm) could be used for distinguishing species-specific amplification for each strain (Table 3). Mean Cq values obtained by qPCR using Tuf primers and DNA isolated from feed solutions (GMfs, GMIfs, GMOfs, and GMIOfs) and microcapsules (GMmc, GMImc, GMOmc, and GMIOmc) are shown in Table 4. Cq values are inverse proportional to the amount of target nucleic acid that is in the sample and correlate directly to the number of target copies. The lower the Cq value the greater the amount of the target sequence present in the sample. Most of feed solutions samples presented lower Cq values than microcapsules, i.e., more target sequence is present in these samples. The higher Cq values showed for microcapsules could be related with the thermal stress that bifidobacteria passed during spray drying and to the degradation of target sequences. Behboudi-Jobbehdar, Soukoulis,Yonekura, and Fisk (2013) reported that denaturation of DNA and RNA, dehydration of cytoplasmic membrane or rupture and collapse of the cell membrane due to water loss occurs during spray drying. Liu et al. (2015) at temperatures above the strain's critical temperature, not only cell wall damage occurs, but also denaturation of ribosomes and/or proteins may be responsible for thermal death. In addition, bacteria respond to stress through a variety of protective genes. An example is the control of global stress response by the alternative sigma factor σ38 (rpoS) (Patange et al., 2018). This factor is strongly induced when bacterial cells are exposed to non-ideal temperatures (Weber et al., 2005), and could influence the induction of viable but not culturable (VBNC) state in several bacterial species (Patange et al., 2018). The Cq values obtained from 50 ng of template DNA were used to construct the standard curve of B. animalis ssp. lactis BB-12 Cq versus Log CFU mL-1 (Figure 3). The bifidobacteria plate counts were done in parallel with the serial dilutions of bacterial DNA. Thus, the corresponding CFU values were estimated based on plate counts. For

12

this purpose, 25.9 ng of B. animalis ssp. lactis BB-12 genomic DNA was equivalent to 9.46 log CFU mL-1 in the reaction. This standard curve was used to quantify B. animalis ssp. lactis BB-12 present in feed solutions (GMfs, GMIfs, GMOfs, and GMIOfs) and microcapsules (GMmc, GMImc, GMOmc, and GMIOmc) produced with goat’s milk in association or not with inulin-type fructans. Comparison between the quantification by qPCR and by plate count method of B. animalis ssp. lactis BB-12 in feed solution (GMfs, GMIfs, GMOfs, and GMIOfs) and microcapsules (GMmc, GMImc, GMOmc, and GMIOmc) is presented in Table 5. The analysis of probiotic feed solutions and microcapsules showed significantly higher bacterial concentrations determined by qPCR, compared to those obtained by plate counting (P < 0.05). The results of plate counting reflect the number of culturable bacteria at the time of analysis (Matijasic et al., 2010). However, although it has intact membranes, viable but non-culturable (VBNC) or dormant bacteria are not able to grow on the plates (Bloomfield, Stewart, Dodd, Booth, & Power, 1998; Lahtinen et al., 2006). On the other hand, due to the fact that qPCR analysis is based on the detection of total DNA, i.e., both living and dead bacteria, an overestimation of the number of metabolically active cells could occur (Masco et al., 2007). Thus, the total bacterial enumeration obtained by qPCR enables to determine the culturable, VBNC, dormant, and non-viable cells (Kramer et al., 2009). To make qPCR assay selective only for viable cells, the treatment of bacterial cells before the DNA isolation with propidium or ethidium monoazide could be realized (Scariot, Venturelli, Prudêncio, & Arisi, 2018). The highest count obtained by qPCR for all samples in the present work (Table 5) could be related to VBNC and non-viable cells present in the matrix of feed solutions (GMfs, GMIfs, GMOfs, and GMIOfs) and microcapsules (GMmc, GMImc, GMOmc, and GMIOmc).

13

We observed a interesting result regarding the manufacturing process of the microcapsules by spray drying. It was possible to note a high quantity of bifidobacteria after the spray drying process when prebiotics inulin-type fructans were used to produce the microcapsules (Table 5). However, the microcapsule produced only with goat’s milk powder (GMmc) showed an increase in bifidobacteria count by qPCR. These results can be related to the highest thermal protection provided by the fat present in goat's milk to B. animalis ssp. lactis BB-12, since this microcapsule presents twice fat content in comparison with the microcapsules produced with inulin-type fructans (Verruck et al., 2017). The dehydration envolving in the technological process of spray drying can decrease the culturability of the bifidobacteria. Notably, the manufacturing process usually results in the damage or death of part of the population (Kramer et al., 2009). These differences in bifidobacteria enumeration observed by qPCR cannot be observed by plate count (P > 0.05) due to the culturability limitations of this method. Prasanna and Charalampopoulos (2019) also used the plating count method to enumerate B. animalis ssp. lactis BB-12 before and after the encapsulation process by using sodium alginate, inulin and goat’s milk. These authors also could not observe significative differences in the viable cells count before and after the encapsulation process for five different microcapsules formulations. As reported before, plate counting was lower (P <0.05) than the counting via qPCR, which strongly suggests the existence of viable but non-culturable cells (VBNC). The VBNC refers to a specific phase where the bacteria are not able to produce a colony in the standard culture media, however, the cells are still alive. It is considered a survival mechanism for non-endospore forming bacteria when under unfavorable growth conditions (Liu et al., 2017). Although still a matter of debate, it is assumed that a minimal concentration of probiotic bacteria must be greater than 6 log CFU per mL or g, or 9 log CFU per serving

14

of the product to exert a health-promoting effect (Hill et al., 2014). Consequently, the correct enumeration of bifidobacteria in products on a routine basis is indispensable in the commercial process of production, storage, delivery, and control of a functional product (Matijasic et al., 2010). Frequently the probiotic products in a dried form often do not meet the minimum requirements regarding the number of viable bacteria (Masco et al., 2007). However, this behavior could be related to the state of bacteria, i.e., culturable, VBNC, dormant, or non-viable cells (Matijasic et al., 2010). The applicability of qPCR for the quantitative analysis of bifidobacteria was evaluated using 29 commercial probiotic products (Masco et al., 2007). The assays relied on the use of genusspecific primers (16S rRNA gene and recA gene) and only ten dried dairy products contained the minimal Bifidobacterium concentration of 106 CFU per g of product. Besides that, the lack of suitable media for bifidobacteria count has been observed in several studies (Masco, Huys, De Brandt, Temmerman, & Swings, 2005; Shah, 2000; Van de Casteele et al., 2006; Vinderola & Reinheimer, 1999). Indeed, procedures for the identification, enumeration or confirmation of probiotics have not been standardized to date (Schoeni, 2015). Thus, the use of quantitative molecular methods are in general more sensitive, species selective, economic, and time saver than traditional methods (Matijasic et al., 2010). After the initial investment in the purchase of equipment for the qPCR analysis, the method becomes more economically advantageous than others (Schoeni, 2015). This is because it is possible to run many samples in the same reaction, with a very reduced amount of reagents and supplies compared to conventional plate counting techniques. As a long-term strategy it brings reliability, safety and savings to the laboratory or industry that uses this method. Therefore, independent culture methods have been increasingly used in the quantification of bifidobacteria in dairy products (Kramer et al., 2009). The same approach used in the present study was used for viable cell

15

quantification of Bifidobacterium lactis mixed in fermented milk products (GarcíaCayuela, Tabasco, Peláez, & Requena, 2009). The enumeration of viable bacteria by qPCR was done in 3 h, while enumeration by selective plate counts required 72 h, as also observed in our study. In addition, the direct quantification of bifidobacteria in yogurt samples could be done within four hours (Meng, Pang, Wang, & Wang, 2010). For dairy industries the cell counting via qPCR display many improvements over regular plate counting, such as allowing for the observation of the viable but non-culturable (VBNC) cells of Bifidobacterium BB-12 and the rapid results needed for large-scale production. Finally, the results presented in our study represent an evolution for probiotic quantification in the dairy sector, which can be extrapolated for enumeration of B. animalis ssp. lactis BB-12 in all dairy products.

4. Conclusion The Tuf qPCR assay showed higher efficiency than the Bal-23S qPCR assay and was chosen for the quantification of B. animalis ssp. lactis BB-12 in feed solutions and microcapsules produced with goat’s milk in association or not with inulin-type fructans. The specificity test showed that the Tuf primer pair was able to detect B. animalis ssp. lactis BB-12 selectively. The analysis of probiotic feed solutions and microcapsules showed higher bacterial enumeration determined by qPCR compared to those obtained by plate counting. Also, comparing qPCR and plate count, it was noted that bifidobacteria enumeration was higher after the spray drying process when prebiotics inulin-type fructans were used in the production of the microcapsules. On the other hand, the microcapsule produced only with goat’s milk powder showed an increase in bifidobacteria counts by qPCR. Finally, the method based on qPCR was considered a

16

more rapid and sensitive alternative for the quantification of B. animalis ssp. lactis BB12 count in probiotic microcapsules in comparison with plate counting.

Declaration of competing interest Authors declare that they have no conflicts of interest in this manuscript.

Acknowledgments The authors are thankful to National Council for Scientific and Technological Development (CNPq), Brazil, for financial support, Coordination for the Improvement of Higher Education Personnel (CAPES Finance code 001), Ministry of Education, Brazil, for Ph.D. and post-doctoral fellowships, and Clariant for providing the prebiotics and Chr. Hansen for donating the probiotic culture.

References Achilleos, C., & Berthier, F. (2013). Quantitative PCR for the specific quantification of Lactococcus lactis and Lactobacillus paracasei and its interest for Lactococcus lactis in cheese samples. Food Microbiology, 36(2), 286–295. https://doi.org/10.1016/j.fm.2013.06.024. Ashwar, B. A., Gani, A., Gani, A., Shah, A., & Masoodi, F. A. (2018). Production of RS4 from rice starch and its utilization as an encapsulating agent for targeted delivery of probiotics. Food Chemistry, 239, 287–294. https://doi.org/10.1016/J.FOODCHEM.2017.06.110. Behboudi-Jobbehdar, S., Soukoulis, C., Yonekura, L., & Fisk, I. (2013). Optimization of spray-drying process conditions for the production of maximally viable microencapsulated L. acidophilus NCIMB 701748. Drying Technology, 31(11), 17

1274–1283. https://doi.org/10.1080/07373937.2013.788509. Bloomfield, S. F., Stewart, G. S. A. B., Dodd, C. E. R., Booth, I. R., & Power, E. G. M. (1998). The viable but non-culturable phenomenon explained? Microbiology, 144(1), 1–3. https://doi.org/10.1099/00221287-144-1-1. Champagne, C. P., Gomes da Cruz, A., & Daga, M. (2018). Strategies to improve the functionality of probiotics in supplements and foods. Current Opinion in Food Science, 22, 160–166. https://doi.org/10.1016/J.COFS.2018.04.008. Champagne, C. P., Raymond, Y., Guertin, N., & Bélanger, G. (2015). Effects of storage conditions, microencapsulation and inclusion in chocolate particles on the stability of probiotic bacteria in ice cream. International Dairy Journal, 47, 109–117. https://doi.org/10.1016/j.idairyj.2015.03.003. Desfossés-Foucault, É., Dussault-Lepage, V., Le Boucher, C., Savard, P., LaPointe, G., & Roy, D. (2012). Assessment of probiotic viability during Cheddar cheese manufacture and ripening using propidium monoazide-PCR quantification. Frontiers in Microbiology, 3(OCT), 1–11. https://doi.org/10.3389/fmicb.2012.00350. Fritzen-Freire, C. B., Prudêncio, E. S., Amboni, R. D. M. C., Pinto, S. S., NegrãoMurakami, A. N., & Murakami, F. S. (2012). Microencapsulation of bifidobacteria by spray drying in the presence of prebiotics. Food Research International, 45(1), 306–312. https://doi.org/10.1016/j.foodres.2011.09.020. Fritzen-Freire, C. B., Prudêncio, E. S., Pinto, S. S., Muñoz, I. B., Müller, C. M. O., Vieira, C. R. W., & Amboni, R. D. M. C. (2013). Effect of the application of Bifidobacterium BB-12 microencapsulated by spray drying with prebiotics on the properties of ricotta cream. Food Research International, 52(1).

18

https://doi.org/10.1016/j.foodres.2013.02.049. Ganesan, B., Weimer, B. C., Pinzon, J., Dao Kong, N., Rompato, G., Brothersen, C., & Mcmahon, D. J. (2014). Probiotic bacteria survive in Cheddar cheese and modify populations of other lactic acid bacteria. Journal of Applied Microbiology, 116(6), 1642–1656. https://doi.org/10.1111/jam.12482. García-Cayuela, T., Tabasco, R., Peláez, C., & Requena, T. (2009). Simultaneous detection and enumeration of viable lactic acid bacteria and bifidobacteria in fermented milk by using propidium monoazide and real-time PCR. International Dairy Journal, 19(6–7), 405–409. https://doi.org/10.1016/j.idairyj.2009.02.001. Gibson, G. R., Hutkins, R., Sanders, M. E., Prescott, S. L., Reimer, R. A., Salminen, S. J., … Reid, G. (2017). Expert consensus document: The International Scientific Association for Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of prebiotics. Nature Reviews Gastroenterology and Hepatology, 14(8), 491–502. https://doi.org/10.1038/nrgastro.2017.75. Gomez, D., McGuinness, S., Reddington, K., O'Grady, J., Yanguela, J., Barry, T. (2013). Evaluation of a novel Listeria enrichment broth combined with a real-time PCR diagnostics assay for the specific detection of Listeria monocytogenes in RTE pork products. International Journal of Food Science and Technology, 48, 11031108. https://doi.org/10.1111/ijfs.12053. Guimarães, J. T., Balthazar, C. F., Silva, R., Rocha, R. S., Graça, J. S., Esmerino, E. A., … Cruz, A. G. (2020). Impact of probiotics and prebiotics on food texture. Current Opinion in Food Science, 33, 38–44. https://doi.org/10.1016/j.cofs.2019.12.002. Hill, C., Guarner, F., Reid, G., Gibson, G. R., Merenstein, D. J., Pot, B., … Sanders, M. E. (2014). The International Scientific Association for Probiotics and Prebiotics

19

consensus statement on the scope and appropriate use of the term probiotic. Nature Reviews Gastroenterology & Hepatology, 11(8), 506–514. https://doi.org/10.1038/nrgastro.2014.66. Hunt, D. E., Klepac-Ceraj, V., Acinas, S. G., Gautier, C., Bertilsson, S., & Polz, M. F. (2006). Evaluation of 23S rRNA PCR primers for use in phylogenetic studies of bacterial diversity. Applied and Environmental Microbiology, 72(3), 2221–5. https://doi.org/10.1128/AEM.72.3.2221-2225.2006. Ilha, E. C., Scariot, M. C., Treml, D., Pereira, T. P., Sant′Anna, E. S., Prudêncio, E. S., & Arisi, A. C. M. (2016). Comparison of real-time PCR assay and plate count for Lactobacillus paracasei enumeration in yoghurt. Annals of Microbiology, 66(2), 597–606. https://doi.org/10.1007/s13213-015-1137-7. Kramer, M., Obermajer, N., Matijašić, B. B., Rogelj, I., & Kmetec, V. (2009). Quantification of live and dead probiotic bacteria in lyophilised product by realtime PCR and by flow cytometry. Applied Microbiology and Biotechnology, 84(6), 1137–1147. https://doi.org/10.1007/s00253-009-2068-7. Lahtinen, S. J., Ouwehand, A. C., Reinikainen, J. P., Korpela, J. M., Sandholm, J., & Salminen, S. J. (2006). Intrinsic properties of so-called dormant probiotic bacteria, determined by flow cytometric viability assays. Applied and Environmental Microbiology, 72(7), 5132–5134. https://doi.org/10.1128/AEM.02897-05. Liu, H., Gong, J., Chabot, D., Miller, S. S., Cui, S. W., Ma, J., … Wang, Q. (2015). Protection of heat-sensitive probiotic bacteria during spray-drying bysodium caseinate stabilized fat particles. Food Hydrocolloids, 51, 459–467. https://doi.org/10.1016/j.foodhyd.2015.05.015. Liu, J., Zhou, R., Li, L., Peters, B. M., Li, B., Lin, C.-W., … Shirtliff, M. E. (2017).

20

Viable but non-culturable state and toxin gene expression of enterohemorrhagic Escherichia coli O157 under cryopreservation. Research in Microbiology, 168(3), 188–193. https://doi.org/10.1016/j.resmic.2016.11.002. Masco, L., Huys, G., De Brandt, E., Temmerman, R., & Swings, J. (2005). Culturedependent and culture-independent qualitative analysis of probiotic products claimed to contain bifidobacteria. International Journal of Food Microbiology, 102(2), 221–230. https://doi.org/10.1016/j.ijfoodmicro.2004.11.018. Masco, L., Vanhoutte, T., Temmerman, R., Swings, J., & Huys, G. (2007). Evaluation of real-time PCR targeting the 16S rRNA and recA genes for the enumeration of bifidobacteria in probiotic products. International Journal of Food Microbiology, 113(3), 351–357. https://doi.org/10.1016/j.ijfoodmicro.2006.07.021. Matijašić, B. B., Obermajer, T., & Rogelj, I. (2010). Quantification of Lactobacillus gasseri, Enterococcus faecium and Bifidobacterium infantis in a probiotic OTC drug by real-time PCR. Food Control, 21(4), 419–425. https://doi.org/10.1016/j.foodcont.2009.07.001. Meng, X. C., Pang, R., Wang, C., & Wang, L. Q. (2010). Rapid and direct quantitative detection of viable bifidobacteria in probiotic yogurt by combination of ethidium monoazide and real-time PCR using a molecular beacon approach. The Journal of Dairy Research, 77(4), 498–504. https://doi.org/10.1017/S0022029910000658. Mituniewicz–Małek, A., Zielińska, D., & Ziarno, M. (2019). Probiotic monocultures in fermented goat milk beverages – sensory quality of final product. International Journal of Dairy Technology, 72(2), 240–247. https://doi.org/10.1111/14710307.12576. Nakano, M. (2018). Multiplex PCR for rapid detection of thermophilic Moorella

21

thermoacetica and Geobacillus stearothermophilus from canned foods and beverages. International Journal of Food Science and Technology, 53, 1352-1362. https://doi.org/10.1111/ijfs.13691. Patange, O., Schwall, C., Jones, M., Villava, C., Griffith, D. A., Phillips, A., & Locke, J. C. W. (2018). Escherichia coli can survive stress by noisy growth modulation. Nature Communications, 9(1). https://doi.org/10.1038/s41467-018-07702-z. Pinto, S. S., Fritzen-Freire, C. B., Muñoz, I. B., Barreto, P. L. M., Prudêncio, E. S., & Amboni, R. D. M. C. (2012). Effects of the addition of microencapsulated Bifidobacterium BB-12 on the properties of frozen yogurt. Journal of Food Engineering, 111(4), 563–569. https://doi.org/10.1016/j.jfoodeng.2012.03.016. Pradeep Prasanna, P. H., & Charalampopoulos, D. (2019). Encapsulation in an alginategoats’ milk-inulin matrix improves survival of probiotic Bifidobacterium in simulated gastrointestinal conditions and goats’ milk yoghurt. International Journal of Dairy Technology, 72(1), 132–141. https://doi.org/10.1111/14710307.12568. Ranadheera, C. S., Evans, C. A., Baines, S. K., Balthazar, C. F., Cruz, A. G., Esmerino, E. A., … Vasiljevic, T. (2019). Probiotics in goat milk products: delivery capacity and ability to improve sensory attributes. Comprehensive Reviews in Food Science and Food Safety, 18(4), 867–882. https://doi.org/10.1111/1541-4337.12447. Ranadheera, C. Senaka, Evans, C. A., Adams, M. C., & Baines, S. K. (2015). Microencapsulation of Lactobacillus acidophilus LA-5, Bifidobacterium animalis subsp. lactis BB-12 and Propionibacterium jensenii 702 by spray drying in goat’s milk. Small Ruminant Research, 123(1), 155–159. https://doi.org/10.1016/j.smallrumres.2014.10.012.

22

Ranadheera, Chaminda Senaka, Naumovski, N., & Ajlouni, S. (2018). Non-bovine milk products as emerging probiotic carriers: recent developments and innovations. Current Opinion in Food Science, 22, 109–114. https://doi.org/https://doi.org/10.1016/j.cofs.2018.02.010. Santos, W. M., Nobre, M. S., Cavalcanti, M. T., dos Santos, K. M. O., Salles, H. O., & Alonso Buriti, F. C. (2019). Proteolysis of reconstituted goat whey fermented by Streptococcus thermophilus in co‐culture with commercial probiotic Lactobacillus strains. International Journal of Dairy Technology, 72(4), 559–568. https://doi.org/10.1111/1471-0307.12621. Sathyabama, S., Kumar, M. R., Devi, P. B., Vijayabharathi, R., & Priyadharisini, V. B. (2014). Co-encapsulation of probiotics with prebiotics on alginate matrix and its effect on viability in simulated gastric environment. LWT - Food Science and Technology, 57(1), 419–425. https://doi.org/10.1016/J.LWT.2013.12.024. Scariot, M. C., Venturelli, G. L., Prudêncio, E. S., & Arisi, A. C. M. (2018). Quantification of Lactobacillus paracasei viable cells in probiotic yoghurt by propidium monoazide combined with quantitative PCR. International Journal of Food Microbiology, 264, 1–7. https://doi.org/10.1016/j.ijfoodmicro.2017.10.021. Schoeni, J. L. (2015). 20. Probiotics. In Y. Salfinger & M. Lou Tortorello (Eds.), Compendium of Methods for the Microbiological Examination of Foods (Fifth, pp. 237–276). https://doi.org/doi:10.2105/MBEF.0222.025. Shah, N. P. (2000). Probiotic bacteria: selective enumeration and survival in dairy foods. Journal of Dairy Science, 83(4), 894–907. https://doi.org/10.3168/jds.S0022-0302(00)74953-8. Sheu, S.-J., Chen, H.-C., Lin, C.-K., Lin, W.-H., Chiang, Y.-C., Hwang, W.-Z., & Tsen,

23

H.-Y. (2013). Development and application of tuf gene-based PCR and PCRDGGE methods for the detection of 16 Bifidobacterium species. Journal of Food and Drug Analysis, 21(2), 177–183. https://doi.org/10.1016/J.JFDA.2013.05.008. Sheu, S.-J., Hwang, W.-Z., Chiang, Y.-C., Lin, W.-H., Chen, H.-C., & Tsen, H.-Y. (2010). Use of Tuf gene-based primers for the PCR detection of probiotic Bifidobacterium species and enumeration of bifidobacteria in fermented milk by cultural and quantitative real-time PCR methods. Journal of Food Science, 75(8), M521–M527. https://doi.org/10.1111/j.1750-3841.2010.01816.x. Skerniskyte, J., Armalyte, J., Kvietkauskaite, R., Seputiene, V., Povilonis, J., Suziedeliene, E. (2016). Detection of Salmonella spp., Yersinia enterocolitica, Listeria monocytogenes and Campylobacter spp. by real-time multiplex PCR using amplicon DNA melting analysis and probe-based assay. International Journal of Food Science and Technology, 51, 519-529. https://doi.org/10.1111/ijfs.12990. Solano-Aguilar, G., Dawson, H., Restrepo, M., Andrews, K., Vinyard, B., & Urban, J. F. (2008). Detection of Bifidobacterium animalis subsp. lactis (Bb12) in the intestine after feeding of sows and their piglets. Applied and Environmental Microbiology, 74(20), 6338–6347. https://doi.org/10.1128/AEM.00309-08. Taipale, T., Pienihäkkinen, K., Isolauri, E., Larsen, C., Brockmann, E., Alanen, P., … Söderling, E. (2011). Bifidobacterium animalis subsp. lactis BB-12 in reducing the risk of infections in infancy. The British Journal of Nutrition, 105(3), 409–416. https://doi.org/10.1017/S0007114510003685. Van de Casteele, S., Vanheuverzwijn, T., Ruyssen, T., Van Assche, P., Swings, J., & Huys, G. (2006). Evaluation of culture media for selective enumeration of probiotic strains of lactobacilli and bifidobacteria in combination with yoghurt or

24

cheese starters. International Dairy Journal, 16(12), 1470–1476. https://doi.org/10.1016/J.IDAIRYJ.2005.12.002. Ventura, M., Canchaya, C., Meylan, V., Klaenhammer, T. R., & Zink, R. (2003). Analysis, characterization, and loci of the tuf genes in Lactobacillus and Bifidobacterium species and their direct application for species identification. Applied and Environmental Microbiology, 69(11), 6908–6922. https://doi.org/10.1128/AEM.69.11.6908-6922.2003. Verruck, S., de Carvalho, M. W., de Liz, G. R., Amante, E. R., Vieira, C. R. W., Amboni, R. D. de M. C., & Prudencio, E. S. (2017). Survival of Bifidobacterium BB-12 microencapsulated with full-fat goat’s milk and prebiotics when exposed to simulated gastrointestinal conditions and thermal treatments. Small Ruminant Research, 153(February), 48–56. https://doi.org/10.1016/j.smallrumres.2017.05.008. Verruck, S., Barretta, C., Miotto, M., Canella, M. H. M., de Liz, G. R., Maran, B. M., … Prudencio, E. S. (2020). Evaluation of the interaction between microencapsulated Bifidobacterium BB-12 added in goat’s milk Frozen Yogurt and Escherichia coli in the large intestine. Food Research International, 127, 108690. https://doi.org/10.1016/j.foodres.2019.108690. Verruck, S., Dantas, A., & Prudencio, E. S. (2019). Functionality of the components from goat’s milk, recent advances for functional dairy products development and its implications on human health. Journal of Functional Foods, 52(September 2018), 243–257. https://doi.org/10.1016/j.jff.2018.11.017. Vinderola, C. G., & Reinheimer, J. A. (1999). Culture media for the enumeration of Bifidobacterium bifidum and Lactobacillus acidophilus in the presence of yoghurt

25

bacteria. International Dairy Journal, 9(8), 497–505. https://doi.org/10.1016/S0958-6946(99)00120-X. Weber, H., Polen, T., Heuveling, J., Wendisch, V. F., & Hengge, R. (2005). Genomewide analysis of the general stress response network in Escherichia coli: σSdependent genes, promoters, and sigma factor selectivity. Journal of Bacteriology, 187(5), 1591–1603. https://doi.org/10.1128/JB.187.5.1591-1603.2005. Youn, S. Y., Seo, J. M., & Ji, G. E. (2007). Evaluation of the PCR method for identification of Bifidobacterium species. Letters in Applied Microbiology, 46(1), 7–13. https://doi.org/10.1111/j.1472-765X.2007.02263.x.

26

Figure captions Figure 1. Bifidobacterium animalis ssp. lactis BB-12 assay standard curves performed in triplicate (n = 3). a: qPCR by pair primer Tuf. b: qPCR by pair primer Bal. Figure 2. Bifidobacterium animalis ssp. lactis BB-12 assay standard curves performed in three qPCR runs by primer Tuf on different days, in triplicate (n = 9). Figure 3. Bifidobacterium animalis ssp. lactis BB-12 assay standard curve performed in triplicate (n=3), Cq versus Log CFU ml-1.

27

b)

40

40

30

30

20

20

Cq

Cq

a)

y = -3.6014x + 41.955 R² = 0.9994 E = 89.5%

10

y = -3.7502x + 40.381 R² = 0.9926 E = 84.8%

10 0

0 0

2

4 6 Log DNA copy number

8

0

2

4 6 Log DNA copy number

28

8

29

40

Cq

30

20

10 2

3

4

5

6

7

8

9

10

Log CFU BB-12

30

Table 1. Primers used for Bifidobacterium animalis ssp. lactis BB-12 quantification by qPCR assay. Target gene 23S Tuf

Primer

Sequence (5’- 3’)

Bal-23S F Bal-23S R TufF TufR

CAGGTGGTCTGGTAGAGTATACCG ACGGCGACTTGCGTCTTG GTGTCGAGCGCGGCAA CTCGCACTCATCCATCTGCTT

Amplicon Reference length (bp) Taipale et al., 203 2011 Solano-Aguilar et 117 al., 2008

31

Table 2. Parameters of qPCR standard curves for Bifidobacterium animalis ssp. lactis BB-12 quantification using Tuf primers and B. animalis ssp. lactis BB-12 DNA serial dilution.

Run 1 Run 2 Run 3

Efficiency (%) 89.53 89.46 87.91

slope -3.601 -3.603 -3.650

R2 0.999 0.998 0.999

32

Table 3. Cq and Tm values obtained by qPCR specificity assay using Tuf primers and DNA (10 ng) isolated from Bifidobacterium animalis ssp. lactis BB-12 as positive control or other bacteria as negative control. Template DNA Bifidobacterium BB-12 Lactobacillus casei INCQS 500006 Lactobacillus paracasei ATCC 10746 Lactobacillus delbrueckii ATCC 2214 Lactobacillus brevis ATCC 14869 Lactobacillus plantarum ATCC 8014 Lactobacillus paracasei CCT 7501 Lactobacillus paracasei FNU Lactobacillus sakei ATTC 5221 Enterococcus faecalis ATTC 19433 Staphylococcus aureus ATTC 25923 Pseudomonas aeruginosa ATTC 27853 Bacillus cereus ATTC 14579 Escherichia coli ATTC 25922 Nd = not detected

Cq

Tm

14.49 35.39 Nd Nd Nd Nd 37.03 Nd 32.84 Nd Nd Nd Nd Nd

84.67 82.27 62.36 62.27 62.64 72.23 72.96 62.64 73.98 62.27 62.45 62.73 62.64 62.92

33

Table 4. Mean Cq values obtained by qPCR using Tuf primers and DNA (50 ng) isolated from feed solutions (GMfs, GMIfs, GMOfs, and GMIOfs) and microcapsules (GMmc, GMImc, GMOmc and GMIOmc). Samples GMfs GMIfs GMOfs GMIOfs GMmc GMImc GMOmc GMIOmc Bifidobacterium BB-12 Lactobacillus paracasei ATCC 10746 water SD = standard deviation

Cq 22.48 18.30 18.66 18.39 22.26 21.29 21.49 21.86 19.96 Nd Nd

SD 0.15 0.13 0.08 0.13 0.04 0.22 0.13 0.12 0.04

34

Table 5. Quantification of Bifidobacterium animalis ssp. lactis BB-12 in feed solution (GMfs, GMIfs, GMOfs, and GMIOfs) and microcapsules (GMmc, GMImc, GMOmc, and GMIOmc) by qPCR and by plate count. qPCR* Plate count -1 (Log CFU mL ) (Log CFU mL-1) 9.43 ± 0.04aB 9.22 ± 0.08bA GMfs aA 10.75± 0.04 9.43 ± 0.42bA GMIfs 10.28± 0.02aA 9.67 ± 0.32bA GMOfs 10.77± 0.04aA 9.51 ± 0.47bA GMIOfs aA 9.97± 0.01 8.94 ± 0.69bA GMmc 9.35± 0.06aB 8.73 ± 0.26bA GMImc aB 9.92± 0.04 8.75 ± 0.72bA GMOmc 8.80± 0.04aB 8.19 ± 0.48bA GMIOmc *using 50 ng of template DNA a–b Within a line, means ± standard deviations with different superscript lowercase letters denote significant differences (P < 0.05) among the samples and treatment. A–B Within a column, means ± standard deviations with different superscript uppercase letters denote significant differences (P < 0.05) among the same sample before and after spray drying process. Samples

35

- primers 23S-Bal and Tuf were evaluated for B. animalis ssp. lactis quantification - Tuf gene showed better results and higher efficiency than 23S-Bal - qPCR was able to evaluate viable but non-culturable cells - microcapsules only with goat’s milk powder showed better protection to cells by qPCR - qPCR was more rapid and sensitive alternative for BB-12 quantification

36

GA

37

Florianópolis, February 25, 2020 Credit author statement To: Professor Dr. Chamindha Ranadheera Guest Editor: Food Research International

Dear Editor, The responsibilities of each what each author done in this study is described below:

Silvani Verruck: Design the first idea for the experiment, prepare the samples, monitored the DNA extraction and qPCR data collection. Prepare the manuscript and made the revisions. Kelly Justin Silva: Helped in qPCR data collection, material preparation and in the writing of the manuscript. Helena de Oliveira Santeli: Helped in qPCR data collection and material preparation. Mirella Christine Scariot: Performed the DNA extraction of the samples and help in qPCR data collection Gustavo Luiz Venturelli: Investigated the primer base pairs that could be used in the experiment, designed them and did preliminary tests on qPCR. Elane Schwinden Prudencio: Was responsible of the financial support for the project leading to this publication Ana Carolina Maisonnave Arisi: Was the project leading, and was responsible for the planning, management and execution of the study. Also revised the manuscript before submission. 38

Best regards,

Prof. Dr. Silvani Verruck Federal University of Santa Catarina - Department of Food Science and Technology Rodovia Admar Gonzaga, 1346, Itacorubi 88034-001- Florianópolis - Santa Catarina - Brazil

39