- Email: [email protected]
Biochemical characteristics and gene cloning of a novel thermostable feruloyl esterase from Chaetomium sp.
Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
Contents lists available at ScienceDirect
Journal of Molecular Catalysis B: Enzymatic journal homepage: www.elsevier.com/locate/molcatb
Biochemical characteristics and gene cloning of a novel thermostable feruloyl esterase from Chaetomium sp. Shao-Qing Yang a , Luo Tang a , Qiao-Juan Yan b , Peng Zhou a , Hai-Bo Xu a , Zheng-Qiang Jiang a,∗ , Pan Zhang a a b
Department of Biotechnology, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, China Bioresource Utilization Laboratory, College of Engineering, China Agricultural University, Beijing 100083, China
a r t i c l e
i n f o
Article history: Received 24 December 2012 Received in revised form 20 June 2013 Accepted 21 June 2013 Available online 2 July 2013 Keywords: Feruloyl esterase Chaetomium Characterization Purification Gene sequence
a b s t r a c t A feruloyl esterase from Chaetomium sp. CQ31 was purified and biochemically characterized. The purified feruloyl esterase had a specific activity of 38.6 U/mg. The molecular mass of the enzyme was estimated to be 30.2 kDa by SDS-PAGE, and 29.6 kDa by gel filtration, indicating that the enzyme was a monomer. The optimum pH and temperature of the enzyme were pH 7.5 and 60 ◦ C, respectively. It was stable over a broad pH range of 4.0–10.0, and also exhibited good thermostability. The enzyme displayed strict substrate specificity. The Km and Vmax values for methyl ferulate were 0.98 mol/min/mg and 42.6 U/mg, respectively. Furthermore, the feruloyl esterase gene was cloned and sequenced. Open reading frame (ORF) of the feruloyl esterase gene (879-bp) encodes 274 amino acids. The deduced amino acid sequence of the feruloyl esterase gene exhibited the highest identity (79%) with that of type B feruloyl esterase from Magnaporthe oryzae. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Feruloyl esterases (EC 3.1.1.73), also known as cinnamoyl esterases, are a subclass of carboxylic acid esterases that are capable of catalyzing the hydrolysis of the ester bond between hydroxycinnamic acids and sugars on the polysaccharides in plant cell wall. They have been recognized as common components of many microbial cellulosic enzyme systems. Feruloyl esterases can be classified into four subclasses (viz. type A, B, C and D) based on their substrate specificity for aromatic moieties, functional properties and phylogenetic comparisons of protein sequences [1]. Feruloyl esterases have received a great deal of attention in recent years for their wide potential applications [2]. Ferulic acid
Abbreviations: CAPS, (cyclohexylamino)-1-propanesulphonic acid; CHES, acid; DEPC, diethylenepyrocarbonate; 2-(cyclohexylamino)ethanesulfonic DTNB, 5,5-dithio-bis-2-nitrobenzonic acid; MCA, methyl caffeate; MES, 2-(N-morpholino)ethane sulfonic acid; MFA, methyl ferulate; MOPS, 3-(Nmorpholin)-propane sulfonic acid; MpCA, methyl p-coumarate; MSA, methyl sinapate; NBS, N-bromosuccinimid; ORF, open reading frame; PCR, polymerase chain reaction; PHB, polyhydroxybutyrate; PMSF, phenyl-methylsulfonyl fluoride; pNP, p-nitrophenol; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; WRK, Woodward’s reagent K. ∗ Corresponding author at: PO Box 294, China Agricultural University, No. 17 Qinghua Donglu, Haidian District, Beijing 100083, China. Tel.: +86 10 62737689; fax: +86 10 82388508. E-mail address: [email protected] (Z.-Q. Jiang). 1381-1177/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.molcatb.2013.06.011
released from plant cell wall by the hydrolysis reaction of feruloyl esterases has long been used as food preservative to inhibit microbial cell growth [3]. Feruloyl esterases could be used as animal feed additive to increase the digestibility and the calorific value [4]. The utilization of feruloyl esterases in pulp and paper industry can reduce chlorine consumption and improve brightness of the pulp [5]. In addition, feruloyl esterases also play an important role in the efficient and cost-effective conversion of renewable cellulosic materials to fuel ethanol [2]. These application fields require various types of feruloyl esterases to fit certain pH, temperature, stability or some other profiles. To date, more than 30 feruloyl esterases have been purified and characterized from various microorganisms [6], many of which are from mesophilic fungi, such as Neurospora crassa [7], Fusarium oxysporum [8,9] and Aspergillus oryzae [5]. Among them, different Aspergillus species such as Aspergillus flavipes [10] and Aspergillus nidulans [11] are the most active producers of feruloyl esterases under submerged cultivation in the presence of lignocelluloic carbon sources. Generally, thermophilic fungi are considered to be more attractive enzyme producers since the enzymes from thermophilic fungi have higher temperature and thermostability when compared to the enzymes form mesophilic fungi. Among thermophilic fungi, type B feruloyl esterases have been reported in Sporotrichum thermophile [12] and Myceliophthora thermophila [13]. Chaetomium sp. CQ31 has been reported to secrete a thermostable xylanase when grown in the submerged culture using corncobs as carbon source [14]. In further investigations, we found
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
329
2. Materials and methods
Flow (10 cm × 1.0 cm) column which was equilibrated with 20 mM Tris–HCl buffer (pH 9.0). The bound proteins were eluted with a linear gradient of 0–100 mM NaCl in the equilibration buffer at a flow rate of 1.0 ml/min. Fractions were collected and monitored for feruloyl esterase activity. The purity was checked by SDS-PAGE. All purification steps were carried out at 4 ◦ C unless otherwise stated.
2.1. Materials
2.4. Enzyme assay and protein determination
TRIzol (Invitrogen, Carlsbad, USA) and Oligotex mRNA Midi Kit (Qiagen, Hilden, Germany) were used for total RNA extraction and mRNA purification. SMARTerTM RACE cDNA Amplification was purchased from Clontech (Palo Alto, CA, USA). Restriction endonucleases and T4 DNA ligase were purchased from England Biolabs (Ipswich, MA, USA). DNA polymerase Ex Taq and pMD18-T simple vector system were obtained from TaKaRa (Dalian, China). Escherichia coli JM109 (Bomaide, Beijing, China) was used for propagation of plasmids. Ferulic acid and methyl ferulate were purchased from Alfa Aser Company (USA). Methyl p-coumarate, methyl caffeate and methyl sinapate were purchased from Apin Chemicals Limited (UK). Corncobs were obtained locally and were chopped into small pieces, and ground in a hammer mill. Q-Sepharose Fast Flow gel was obtained from GE Life Sciences (USA). DEAE 52 resin was the product of Whatman Company (USA). All other chemicals used were analytical grade reagents unless otherwise stated.
Feruloyl esterase activity was assayed according to the method of Shin and Chen [15], by analyzing the free ferulic acid released from methyl ferulate. The reaction buffer used was 50 mM pH 7.0 MOPS (3-(N-morpholin)-propane sulfonic acid) buffer. One unit (U) of feruloyl esterase activity was defined as the amount of enzyme that catalyzes the release of 1 mol ferulic acid per minute under the assay conditions. Protein concentrations were determined according to Lowry method [16] using BSA (bovine serum albumin) as the standard.
that the strain also secreted feruloyl esterase in the fermentation medium. Thus, the present study was investigated on purification, characterization and gene sequence of an extracellular feruloyl esterase from Chaetomium sp. CQ31.
2.2. Fungal strain and growth conditions The fungus, Chaetomium sp. CQ31 used in the present study was preserved in China General Microbiological Culture Collection Center (CGMCC, accession No. 3341). It was maintained on potato dextrose-agar (PDA) medium at 4 ◦ C and transferred every 6–7 weeks. The PDA plates were incubated at 37 ◦ C for 5 days and then stored at 4 ◦ C until use. For fungal mycelium production, Chaetomium sp. CQ31 was grown in a medium containing (g/l) 20 wheat bran, 12 tryptone, 0.3 MgSO4 ·7H2 O, 0.3 FeSO4 and 0.3 CaCl2 at 37 ◦ C for 3 days, and then the mycelia were collected by centrifugation (5000 × g, 10 min) and washed twice with sterile water at 4 ◦ C. For feruloyl esterase production, the liquid fermentation medium contains (g/l) 40 corncobs, 12 yeast extract, 0.3 MgSO4 ·7H2 O, 0.3 CaCl2 , 0.3 (NH4 )2 SO4 , 0.3 FeSO4 , 5 Tween 80 and distilled water. The initial pH of the culture medium was adjusted to pH 7.0 and not controlled in the fermentation process. A piece (1 cm2 ) of agar medium covered with 5-day-old mycelia was transferred into 250 ml Erlenmeyer flask containing 50 ml fermentation medium and incubated at 40 ◦ C on a rotary shaker at 200 rpm for 6 days. After the culture growth, broths were centrifuged at 10,000 × g for 10 min and the supernatant was used as crude enzyme for subsequent analysis. All the fermentations were carried out in triplicates.
2.5. SDS-PAGE and molecular mass determination The homogeneity of the purified feruloyl esterase was determined by SDS-PAGE using 12.5% acrylamide gel as described by Laemmli [17]. The protein bands were visualized by staining with Coomassie brilliant blue R-250. Glycoprotein was detected by periodic acid-schiff (PAS) staining of gels after the SDS-PAGE according to the method of Zacharius et al. [18]. Native molecular mass of the purified feruloyl esterase was determined by gel filtration on a Superdex-75 column (40 cm × 1.0 cm) previously equilibrated with 50 mM pH 7.0 Tris–HCl buffer. The protein sample was loaded and eluted at a flow rate of 0.35 ml/min with the same buffer. Molecular weight standards from Sigma used to calibrate the column were phosphorylase b (97.2 kDa), albumin bovine V (68.0 kDa), albumin (45.0 kDa), chymotrypsinogen a (25.7 kDa) and cytochrome c (12.3 kDa). 2.6. Identification of internal peptide sequences The purified feruloyl esterase was digested by trypsin and submitted to the National Center of Biomedical Analysis (China) for amino acid sequencing using high performance liquid chromatography–electrospray tandem mass spectrometry (HPLC–ESI-MS/MS). Mass spectral sequencing was performed using a Q-TOF II mass analyser (Q-TOF2, Micromass Ltd., Manchester, UK). Peptide sequencing was performed using a palladium-coated borosilicate electrospray needle (Protana, Denmark). The mass spectrometer was used in positive ion mode with a source temperature of 80 ◦ C, and a potential of 800 V was applied to the Nanospray probe. MS/MS spectra were transformed using MaxEnt3 software (MassLynx, Micromass), and amino acid sequences were interpreted manually using PepSeq software (BioLynx, Micromass). 2.7. Enzymatic properties of the purified feruloyl esterase
2.3. Purification of a feruloyl esterase from Chaetomium sp. CQ31 The crude enzyme was subjected to 40–50% ammonium sulfate saturation. After stirring at 4 ◦ C for 1 h, the precipitated proteins were collected by centrifugation at 10,000 × g for 10 min and dissolved in 20 mM Tris–HCl buffer (pH 7.5), then dialyzed against the same buffer overnight. The dialyzed protein sample was then applied to a DEAE 52 (10 cm × 1.0 cm) ion exchange column pre-equilibrated with 20 mM Tris–HCl buffer (pH 7.5). The unbound proteins were collected and concentrated by ultrafiltration using a 10-kDa membrane (Stirred Cell Model 8050, Millipore) and then dialyzed against 20 mM Tris–HCl buffer (pH 9.0) overnight. The dialyzed sample was loaded onto a Q-Sepharose Fast
Effect of pH on feruloyl esterase activity was determined in 50 mM different buffers with the pH ranging from 3.0 to 11.0. The buffers used were citrate buffer (pH 3.0–6.5), acetate buffer (pH 4.0–5.5), MES (2-(N-morpholino) ethane sulfonic acid) buffer (pH 5.0–7.0), MOPS buffer (pH 6.5–8.5), CHES (2(cyclohexylamino)ethanesulfonic acid) buffer (pH 8.0–11.0) and CAPS ((cyclohexylamino)-1-propanesulphonic acid) buffer (pH 9.0–11.0), respectively. To determine the pH stability, the enzyme was incubated in the above mentioned buffers at 50 ◦ C for 30 min, and then the residual feruloyl esterase activities were measured. The optimal temperature of feruloyl esterase activity was determined at different temperatures (30–90 ◦ C) in 50 mM MOPS buffer
330
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
(pH 7.5). For the thermostability determination, the purified feruloyl esterase was incubated at different temperatures (30–90 ◦ C) for 30 min, and then the residual activities were measured. The thermal inactivation of the enzyme was studied at 55, 60, 65 and 70 ◦ C by incubating the enzyme for 5 h in 50 mM MOPS buffer (pH 7.5). Aliquots were withdrawn at different time intervals. After cooling on ice for 30 min to 0 ◦ C, the residual activity was measured according to the standard assay method. The results were expressed as the percentage of residual enzyme activities compared to the control without treatment. Each assay was carried out in triplicate and the results presented are the average of three trials. The effects of metal ions and reagents on the feruloyl esterase activity were determined by measuring the residual enzyme activities after the enzyme was incubated in the buffers with 1 mM of different metal ions and agents at 50 ◦ C for 30 min. In order to elucidate whether the inhibition of EDTA on enzyme activity could be alleviated by adding some metal ions, Mn2+ , Mg2+ , and Li+ ions were added in the enzyme solution pre-incubated with 1 mM EDTA, and then the residual enzyme activities were determined.
2.8. Substrate specificity and kinetic parameters Substrate specificity of the purified feruloyl esterase was determined in 50 mM MOPS (pH 7.5) buffer at 50 ◦ C for 10 min. Enzyme activities were measured by the standard assay method by replacing the substrate with 1 mM of methyl p-coumarate, methyl caffeate, and methyl sinapate, respectively. Specific activities are expressed as units per milligram protein. For kinetics determination, the hydrolysis reaction was carried out in 50 mM MOPS buffer (pH 7.5) at 50 ◦ C with the methyl ferulate substrate concentrations ranging from 0.6 to 2.6 mM. The constant kinetic parameters Km and Vmax were estimated by nonlinearregression method using Michaelis–Menten equation.
2.9. Synergistic action of feruloyl esterase with xylanase for the hydrolysis of wheat straw 1 g wheat straw powder (40 meshes) was suspended in 1 ml 100 mM MOPS buffer (pH 7.0), 30 U of purified xylanase from Paecilomyces thermophilia J18 [19] or 50 U of feruloyl esterase or 30 U of xylanase and 50 U of feruloyl esterase were added into the substrate separately, mixed and incubated at 50 ◦ C in water bath for 6 h. Samples were withdrawn at every 1 h, and the released reducing sugars and feruloyl acid were analyzed. The content of reducing sugars was determined by DNS method according to the method of Miller [20] using xylose as the standard, and the content of feruloyl acid was determined by HPLC as mentioned in Section 2.4.
2.10. Estimation of catalytically important amino acids Catalytically important amino acids of feruloyl esterase were identified by measuring the residual activity after the enzyme was modified by various inhibitors. The residual enzyme activities were measured after the enzyme was incubated at 25 ◦ C for different times (0–60 min) in the presence of 5 mM NBS (N-bromosuccinimid, specifically modify tryptophan), WRK (Woodward’s reagent K, specifically modify glutamic acid or asparagic acid), DTNB (5,5-dithio-bis-2-nitrobenzonic acid, specifically modify cysteine), PMSF (phenyl-methylsulfonyl fluoride, specifically modify serine) and DEPC (diethylenepyrocarbonate, specifically modify histidine) in 50 mM MOPS buffer (pH 7.5), respectively.
2.11. Cloning and sequence analysis of the feruloyl esterase gene To clone the feruloyl esterase gene, degenerate primers DP1 (GGCGGCATGATGACCAAYGTNATGGC) and DP2 (CGCCCAGGACGTTGGWCCAYTGYTTNA) were designed based on the conserved sequences (GGMMTNVMA and KQWSNVLGV) of other known fungal feruloyl esterases using the CODEHOP algorithm [21]. Genomic DNA of Chaetomium sp. CQ31 was used as template for polymerase chain reaction (PCR) amplification. The PCR conditions are as follows: a hot start at 94 ◦ C for 5 min, 10 cycles of 94 ◦ C for 30 s, 61–55 ◦ C for 30 s and 72 ◦ C for 2 min, followed by 20 cycles of 94 ◦ C for 30 s, 55 ◦ C for 30 s and 72 ◦ C for 2 min. The PCR product was purified, ligated to pMD18-T vector and sequenced. The full-length cDNA sequence of the feruloyl esterase was obtained by 5 and 3 RACE (rapid amplification of cDNA ends) using a SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA) in accordance with the manufacturer’s instructions. 5 end of the cDNA was amplified using the primers SP1 (AGGCCGTGCGTGATCTGCAT) and adapter primer UPM (Universal Primer A Mix), followed by a nested PCR using nested gene specific primer NSP1 (GGATACGAGTTGCGCACCAG) and adapter primer NUP (Nested Universal Primer A). 3 RACE was performed using the primers SP2 (GGGCCTCCAGAAGACGGAGC) and UPM, followed by a nested PCR using the nested gene specific primer NSP2 (CCTGGCCGACTTCCTGGTGC) and NUP. The obtained PCR product was purified, cloned and sequenced. The feruloyl esterase cDNA sequence from Chaetomium sp. CQ31 has been deposited in the GeneBank with accession number of JN896340. The coding region of feruloyl esterase gene was amplified from the Chaetomium sp. CQ31 genomic DNA using the specific primers EP1 (CATATGGCCTCGCTGCAGCAGGTGA) and EP2 (CTCGAGGTTGATCAGGCCGAAAAACCT). The DNA product was purified and cloned into a pMD18-T vector, and transformed into E. coli JM109 for sequencing. The alignments of DNA and protein sequence were constructed using BLAST at NCBI server (http://blast.ncbi.nlm.nih.gov/ Blast.cgi). Multiple alignment analysis of deduced amino acid sequences were performed by ClustalW2 (http://www.ebi.ac.uk/ Tools/clustalw2/index.html). Structural analysis of deduced protein was carried out on the website of ExPASy Proteomics Server (http://www.expasy.ch/tools/). Signal peptide was analyzed by SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP/). Search analysis of conserved domain was carried out using ScanProsite (http://www.expasy.ch/tools/ScanProsite). N-Glycosylation sites were predicted using NetNGlyc1.0 (http://www.cbs.dtu.dk/ services/NetNGlyc/). 2.12. Structure modeling of the feruloyl esterase from Chaetomium sp. The model of the feruloyl esterase from Chaetomium sp. was built by submitting the amino acid sequence to the Robetta server (http://robetta.bakerlab.org/) [22]. A prolyl endopeptidase from Myxococcus xanthus sharing a sequence identity of 21% with the present enzyme was chosen as the template (PDB code: 2BKL). 3. Results 3.1. Production and purification of feruloyl esterase from Chaetomium sp. CQ31 Production of feruloyl esterase by Chaetomium sp. CQ31 was studied in shake flasks. The maximum extracellular feruloyl esterase activity of 2.1 U/ml was achieved after 6 days of cultivation at 40 ◦ C in the submerged culture containing 4% corncobs as
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
331
Table 1 Purification of a feruloyl esterase from Chaetomium sp. CQ31. Purification step
Total activity (U)a
Total protein (mg)b
Specific activity (U/mg)
Purification factor (-fold)
Recovery (%)
Crude enzyme (NH4 )2 SO4 precipitation DEAE 52 Q-Sepharose Fast Flow
1076.0 833.9 374.4 108.0
3956.4 553.1 37.3 2.8
0.3 1.5 10.0 38.6
1.0 5.0 33.5 128.6
100.0 77.5 34.8 10.0
a b
Activity was measured in 50 mM MOPS buffer (pH 7.0) at 50 ◦ C for 10 min using 1 mM methyl ferulate as substrate by the standard method. The protein concentration was estimated by the Lowry method [16], using BSA (bovine serum albumin) as the standard.
carbon source (data not shown). The extracellular feruloyl esterase was purified to 128.6-fold apparent homogeneity with a recovery yield of 10% (Table 1) from the culture supernatant of Chaetomium sp. CQ31. During the purification process, the specific activity of feruloyl esterase was increased from 0.3 to 38.6 U/mg protein. The purified feruloyl esterase was electrophoretically homogenous as observed on SDS-PAGE with a molecular mass of approximately 30.2 kDa (Fig. 1), while the native molecular mass of feruloyl esterase was found to be about 29.6 kDa by gel filtration, which indicated monomeric nature of the protein. 3.2. Identification of feruloyl esterase by internal peptide sequences The purified feruloyl esterase was hydrolyzed to peptide fragments by trypsin, and three major peptide fragments were obtained. The N-terminal amino acid sequences of the peptides were determined to be RFLQAWCQLTR (Peptide 1), QWSNVLGVQLTR (Peptide 2) and TEQEWGDLVR (Peptide 3), respectively by HPLC–ESI-MS/MS. The sequences of three peptides from the feruloyl esterase were submitted to the NCBI BLAST database and compared with some other known esterases (data not shown). Peptide 2 showed an identity of 75% with the feruloyl esterase precursors from N. crassa OR74A and Neurospora tetrasperma FGSC 2508. Peptide 3 showed relative high identities with some feruloyl esterases and other types of esterases from Nocardiopsis dassonvillei subsp. (90%), Streptomyces hygroscopicus ATCC 53653 (80%), Catenulispora
acidiphila DSM 44928 (80%) and Saccharopolyspora erythraea NRRL 2388 (80%), all of which belonged to polyhydroxybutyrate (PHB) depolymerase family. It is noteworthy that Peptides 1 displayed no significant sequence similarities with other known feruloyl esterases. 3.3. Effect of pH and temperature on the activity and stability of feruloyl esterase The purified feruloyl esterase exhibited an optimum activity at pH 7.5 in 50 mM MOPS buffer (Fig. 2A). The enzyme activity decreased by more than 50% when the pH increased to 9.5 or decreased to 6.0 (Fig. 2A). The feruloyl esterase had an excellent pH stability, since more than 90% of its activity was maintained when the enzyme was treated at 40 ◦ C for 30 min within the pH range of 4.5–10.5 (Fig. 2B). The enzyme showed highest activity at 60 ◦ C (Fig. 3A), and it was stable up to 50 ◦ C for 30 min at which more than 95% of enzyme activities remained (Fig. 3B). The halflives of feruloyl esterase at 50, 55, 60 and 65 ◦ C were 417, 235, 57.8 and 18.5 min (Fig. 3C), respectively. The effects of various cations and compounds at 1 mM on the activity of feruloyl esterase were tested. The feruloyl esterase activity was strongly inhibited by K+ (13.4%), Li+ (22.9%), Na+ (23.2%), SDS (27.6%), Fe3+ (59.7%), Ag+ (65.5%) and Cu2+ (69.7%), whereas it was moderately inhibited by EDTA (83.7%). On the contrary, the enzyme was activated by the addition of Mn2+ (168.4%), Ni2+ (150.3%), Co2+ (148.4%), Sr2+ (135.5%), Hg2+ (123.2%) and Zn2+ (116.3%). No significant effect of enzyme activity in the presence of Mg2+ and Ca2+ were observed. Furthermore, the addition of Mn2+ (102.9%), Mg2+ (102.4) and Li+ (99.9%) in the dialyzed enzyme solution could not obviously alleviate the inhibition of EDTA on the enzyme activity, suggesting the enzyme is not a metal-activated enzyme. The modification of DEPC, PMSF and WRK drastically decreased the enzyme activities of feruloyl esterase from Chaetomium sp. CQ31, after incubated for 5 min, more than 60% of activities were lost, while DTNB and NBS moderately inhibited the enzyme activity by less than 20% after the enzyme was treated for 60 min (data not shown). The results indicated that histidine, serine and glutamic acid (aspartic acid) may be existed in the enzyme active site. 3.4. Substrate specificity and kinetic parameters
Fig. 1. Purification of a feruloyl esterase from Chaetomium sp. CQ31. Lane M, low molecular weight protein standards; lane 1, crude extract; lane 2, fraction of 40–50% ammonium sulfate precipitation; lane 3, fraction of DEAE 52 column; lane 4, fraction of Q-Sepharose Fast Flow column. The molecular weight standards (Pharmacia) used for the calibration of feruloyl esterase molecular mass were phosphorylase b (97.0 kDa), bovine serum albumin (66.0 kDa), ovalbumin (45.0 kDa), carbonic anhydrase (30.0 kDa), trypsin inhibitor (20.1 kDa) and ␣-lactalbumin (14.4 kDa).
The substrate specificity of the feruloyl esterase was determined by measuring its activity with methyl ferulate, methyl p-coumarate, methyl caffeate and methyl sinapate as substrates. The maximum activity of 38.6 U/mg protein was obtained when methyl ferulate was used as substrate, while little (less than 1% of maximum activity) or no activity was detected toward other substrates tested including methyl p-coumarate, methyl caffeate and methyl sinapate, indicating the enzyme has a strict specificity for the methyl ferulate ester linkage. The Michaelis–Menten constant Km and Vmax values toward methyl ferulate were 0.98 mM and 42.6 mol/min/mg, respectively.
332
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
Fig. 2. Effect of pH on the activity (A) and stability (B) of the purified feruloyl esterase from Chaetomium sp. CQ31. The influence of pH on feruloyl esterase activity was determined by measuring the enzyme activity at 50 ◦ C using 50 mM of different buffers with the pH ranging from 3.0 to 11.0. For pH stability, the remained activities were measured at 50 ◦ C in 50 mM MOPS buffer (pH 7.5) after incubating the enzyme at 50 ◦ C for 30 min in various buffers with different pH values (pH 3.0–11.0). Buffers used were citrate (), acetate (䊉), MES (), MOPS (), CHES (), CAPS (). The highest activity obtained in pH 7.5 MOPS (with specificity activity of 43.3 U/mg) was defined as 100%.
3.5. Synergistic action of feruloyl esterase with xylanase for the hydrolysis of wheat straw The synergistic action of the feruloyl esterase and the xylanase for the hydrolysis of wheat straw was studied. Feruloyl esterase did
not exhibit activity on the hydrolysis of wheat straw, while xylanase also could not release ferulic acid from wheat straw powder (Fig. 4). However, after the two enzymes were added together, an obviously synergistic effect was observed, the amounts of released reducing sugars and ferulic acids were improved by 57.8% and
Fig. 3. Optimal temperature (A), thermostability (B) and denature time (C) of the purified feruloyl esterase from Chaetomium sp. CQ31. The optimal temperature was measured at different temperatures (30–90 ◦ C) in 50 mM MOPS buffer (pH 7.5) by standard assay, the highest enzyme activity obtained at 60 ◦ C (with specificity activity of 73.5 U/mg) was defined as 100%. For determination of thermostability, the residual activities of feruloyl esterase were measured after the enzyme was incubated at different temperatures (30–90 ◦ C) for 30 min. For estimation of denaturing half-life, the enzyme was pre-incubated at 50 ◦ C (), 60 ◦ C (), 65 ◦ C () and 70 ◦ C (♦) in 50 mM, pH 7.5 MOPS buffer for 5 h, and the residual activities of aliquots withdrawn at different time intervals were measured.
350
80
300
70 60
250
50
200
40
150
30
100
20
50 0
10
1
2
3
4
5
6
333
acceptor/donor and Asp201 as the residue stabilizing the histidine was found (Fig. 7). Released ferulic acid (μmol)
Released reducing sugars (μmol)
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
0
Time (h) Fig. 4. Synergistic action of the feruloyl esterase (FAE) and the xylanase (Xyn) for the hydrolysis of wheat straw. The reducing sugars released by Xyn (), FAE () and Xyn coupled with FAE () were indicated. The ferulic acid released by Xyn (), FAE (䊉) and Xyn coupled with FAE () were indicated.
18.4%, respectively (Fig. 4) when compared with the hydrolysis efficiency of single enzyme. 3.6. Cloning of a feruloyl esterase gene from Chaetomium sp. CQ31 The full-length cDNA of feruloyl esterase gene (1206-bp) was obtained with an ORF of 879-bp (Fig. 5). BLAST analysis showed that the nucleotide sequence shares 80% identity with that of feruloyl esterase B2 gene from Chrysosporium lucknowense (accession number JF826029.1) indicating the enzyme in the present study might be a type B feruloyl esterase. Genomic sequence comparison showed that there are two introns of 95 bp and 120 bp in the coding region of the gene. ORF of the feruloyl esterase gene codes a 274amino acid, which has a predicted molecular mass of 29,592 Da and a theoretical pI of 6.59. The mature protein contains a signal peptide of 18-amino acids and one possible N-glycosylation site. The nucleotide sequence has been submitted to GenBank database and has been allocated the accession number JN896340. The phylogenetic position of the feruloyl esterase in the present study was demonstrated on a phylogenetic tree, which was constructed based on eight feruloyl esterases with high-sequence identities using ClustalX (Fig. 6). The phylogenetic tree revealed that feruloyl esterase from Chaetomium sp. CQ31, C. lucknowense and Magnaporthe oryzae were located inside the group, which has a high similarity of more than 78%. The deduced amino acid sequence of the feruloyl esterase gene from Chaetomium sp. CQ31 shared significant identity with the feruloyl esterases from M. oryzae 70–15 (79%, EHA55715.1), C. lucknowense (78%, AEP33618.1), N. crassa (73%, CAC05587.1) and M. thermophila ATCC 42464 (75%, AEO57203.1). On the basis of amino acid sequence similarity with other known fungal feruloyl esterases, the feruloyl esterase can be classified into carbohydrate esterase (CE) family 1. 3.7. Structure model of the feruloyl esterase A model of feruloyl esterase from Chaetomium sp. was obtained. It has the canonical architecture of an ␣/ hydrolase fold protein consisting of a central -sheet of eight strands surrounded by helices. The active site of feruloyl esterase was identified by the location of the nucleophile serine Ser118 within the conserved pentapeptide sequence Gly-X-Ser-X-Gly (GFSSG). A classical catalytic triad, consisting of Ser118 as the nucleophile, His257 as the proton
4. Discussion In the present study, we describe the production, purification, characterization and gene cloning of a novel feruloyl esterase from the thermophilic fungus Chaetomium sp. CQ31. This is the first report on feruloyl esterase from Chaetomium species. The strain could utilize corncobs as carbon source to produce feruloyl esterase. Similar results were also observed from some other fungi [9]. Chaetomium sp. CQ31 secreted feruloyl esterase in submerged culture with the activity of 2.1 U/ml, which was higher than most of the reported values [7,15,23], but lower than those of 33 U/ml produced by A. flavipes [10] and 2.4 U/ml by Aspergillus phoenicis IMI 211395 [24]. Purification of a feruloyl esterase from Streptomyces olivochromogenes was first reported in 1991 [6]. So far some feruloyl esterases have been purified and characterized from mesophilic fungi such as Aspergillus niger CFR 1105 [25], A. nidulans [11], F. oxysporum [9], M. thermophila [13] and N. crassa [26]. Feruloyl esterases have a broad range of molecular mass distribution, and most of them range from 11 to 210 kDa [7]. The molecular mass (30.2 kDa) of the feruloyl esterase from Chaetomium sp. CQ31 is similar to those of the feruloyl esterases from F. oxysporum (31 kDa) [9] and Fusarium proliferatum NRRL 26517 (31 kDa [15]), but higher than that of the enzyme (23 kDa) from S. thermophile [27], and lower than that of feruloyl esterases from Aureobasidium pullulans (210 kDa [23]), A. niger CFR 1105 (50 kDa, 55 kDa [25]) and Pleurotus sapidus (55 kDa [28]). The majority of feruloyl esterases reported to date are optimally active at acidic (pH 4.5–6.5) or neutral pH values. The optimum pH 7.5 of feruloyl esterase in this study is higher than that of feruloyl esterases from most other fungi, such as A. oryzae (pH 6.0 [5]), N. crassa (pH 6.0 [26]), P. sapidus (pH 6.0 [26]), S. thermophile (pH 6.0 [12]), A. nidulans (pH 7.0 [11]) and F. oxysporum (pH 7.0 [9]). Similar results have also been reported for the 31 kDa feruloyl esterase from F. proliferatum NRRL 26517, which had a neutral optimum pH in the range of 6.5–7.5 [15]. Besides, the activities of the feruloyl esterase at pH 8.0 and 9.0 were 90% and 70% that of the activity at optimum pH 7.5, respectively, indicating that the enzyme is an alkaline tolerant feruloyl esterase. More than 90% of the enzyme activity was retained after incubated at 40 ◦ C for 30 min in the pH range of 4.5–10.5, suggesting that the enzyme is stable in both acidic and alkaline conditions, and is more stable than some of the other fungal feruloyl esterases from A. oryzae (pH 3.0–9.0 [5]), F. proliferatum NRRL 26517 (pH 5.0–9.0 [15]) and F. oxysporum (pH 7.0–9.0 [9]). The high stability of the feruloyl esterase in acidic and alkaline conditions may be advantageous in many biotechnological applications that require extreme conditions such as animal feed additive (acidic condition) and treatment of alkaline pulp (alkaline condition). Generally, the optimal temperatures for most fungal feruloyl esterases are typically between 30 ◦ C and 60 ◦ C [7]. Compared to other fungal feruloyl esterases, the optimal temperature of the feruloyl esterase (60 ◦ C) from Chaetomium sp. CQ31 in the present study was similar to that of the feruloyl esterases from thermophilic fungus S. thermophile [12] and mesophilic fungus Talaromyces stipitatus [29], but higher than that of feruloyl esterases from F. proliferatum NRRL 26517 (50 ◦ C [15]), N. crassa (55 ◦ C [26]) and F. oxysporum (55 ◦ C [9]). This temperature is only lower than that of three recombinant feruloyl esterases from Penicillium funiculosum (66.3 ◦ C and 70.4 ◦ C [30]) and F. oxysporum (65 ◦ C [8]). The feruloyl esterase from Chaetomium sp. CQ31 also displayed remarkable thermostability with a thermal denaturing half-lives of 235.3 min at 55 ◦ C and 57.8 min at 60 ◦ C, respectively, which is longer than that of the
334
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
Fig. 5. Nucleotide and deduced amino acid sequence of the feruloyl esterase gene from Chaetomium sp. CQ31. Nucleotides not in the cDNA (introns) are shown in lower case letters, and those in the cDNA are shown in upper case letter. The translational initiation codon (ATG) and termination codon (TGA) are boxed in frame, and the termination codon is also marked by asterisk (*). A putative signal peptide is indicated underline. A poly (A + ) tail is double underlined. The nucleotide sequence report here has been submitted to Genbank under accession number JN896340.
feruloyl esterase from the thermophilic fungus S. thermophile (45 min at 55 ◦ C [12]). The time is also longer than that of the recombinant feruloyl esterase from a leachate metagenomic library exhibited (<30 min at 50 ◦ C [31]), but shorter than that of the recombinant enzyme AnFaeA from A. niger exhibiting a half-life of more than 4000 min at 55 ◦ C [32]. The efficient application of enzyme in an industrial process is often hampered by unsatisfactory
92 90 65 99
process performance and enzyme thermal stability [4]. The feruloyl esterase in the present study exhibited high optimal temperature and high thermal stability, the properties of which may possesses the enzyme a lots of advantages in biotechnological applications, since a higher reaction temperature can not only improve the reaction rate, but also reduce the enzyme dosage. Metal ions serve many functions in proteins, the most important of which is the
Chrysosporium lucknowense gb|AEP33618.1 Chaetomium sp. CQ31 gb|JN896340 Magnaporthe oryzae 70-15 gb|EHA55715.1 Neurospora crassa emb|CAC05587.1 Penicillium funiculosum emb|CAC14144.1 Chrysosporium lucknowense gb|ADZ98864.1 Myceliophthora thermophila ATCC 42464 gb|AEO57203.1
99
Volvariella volvacea gb|ABI63599.1
0.2 Fig. 6. Phylogenetic dendrogram based on full-length amino acid sequences of other CE (carbohydrate esterase) family 1 proteins obtained by NCBI BLAST, showing the position of feruloyl esterase from Chaetomium sp. CQ31 related to other bacterial and fungal feruloyl esterase. The dendrogram is shown with microbial sources and GenBank accession numbers. The number for each interior brance is the bootstrap value. The scale for branch length is indicated at the bottom of the phylogenetic dendrogram.
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
Fig. 7. Surface representation of feruloyl esterase, with the catalytic triad (Ser118 as a nucleophile, His257 as the proton acceptor/donor and Asp201 as the residue stabilizing the histidine) shown in stick mode.
modification of protein structures, enhancement of the structural stability of the proteins in the conformation required for biological function, or take part in the catalytic processes of enzymes. For some enzymes, the presence of metal ions is crucial for activity [33]. In the present study, Mn2+ (168.4%), Ni2+ (150.3%), Co2+ (148.4%), Sr2+ (135.5%), Hg2+ (123.2%) and Zn2+ (116.3%) markedly promoted the feruloyl esterase activity. These metal ions may be help to increase enzymatic efficiency and reduce the reaction cost. The feruloyl esterase from Chaetomium sp. CQ31 exhibited strict substrate specificity. It can act on methyl ferulate, while showed no activity on the other tested substrates, which is different from some other fungal type B feruloyl esterases with broad substrate specificity [5,9,11,29]. However, the hydrolytic pattern against methyl ferulate is similar to that observed for type B feruloyl esterase. The property of strict substrate specificity may possess the enzyme potential application in ferulic acid production from abundant agro-industrial waste materials [34], the fine ferulic acid can be further enzymatically converted into vanillin, a major flavor compound [4]. The Km value (0.98 mM) of feruloyl esterase for methyl ferulate is higher than that of the feruloyl esterases from F. proliferatum NRRL 26517 (0.15 mM [15]), A. nidulans (0.25 mM [11]), F. oxysporum (0.60 mM [9]) and S. thermophile (0.71 mM [12]), suggesting it has a relative low substrate affinity. The catalytic efficiency (kcat /Km ) value (0.72 s−1 M−1 ) of the enzyme is lower than that of the other feruloyl esterases [9,12,23,27], but higher than that of the feruloyl esterases from F. proliferatum NRRL 26517 (0.44 s−1 M−1 [15]), A. oryzae (0.23 s−1 M−1 and 0.24 s−1 M−1 [5]) and A. nidulans (0.17 s−1 M−1 [11]), indicating the present enzyme hydrolyzed methyl ferulate faster and more efficiently. Ferulic acids are widely occurred in the plant cell walls, such as wheat straw, oat hull, wheat bran and maize bran. They can be used as raw material for bio-catalytic production of vanillin, vanillic acid and some other valued-added products [35]. Besides, they serve as obstacle in the biodegradation of cellulosic materials for bio-ethanol production [36]. The present feruloyl esterase did not show activity on wheat straw powder, however, after the xylanase was added, the hydrolysis efficiency was enhanced markedly, suggesting the enzyme may possess potential application in ferulic acids production with the xylanase. In addition, the synergistic
335
action improved the degradation efficiency of polysaccharides. These results may enable the enzyme great potential in biomass degradation. Feruloyl esterases have been divided into four sub-classes, types A, B, C and D, on the basis of their primary sequences and substrate specificities [26]. Type A feruloyl esterases have activity against MSA, but not MCA, while type B feruloyl esterases have no activity against MSA, but do have activity against MCA. The present feruloyl esterase exhibited activity on MFA, and was inactive against MCA, MSA and MpCA, the property of which is different from that of both type A and type B feruloyl esterases. However, it exhibited somewhat similar properties of both type A and type B feruloyl esterases (type A feruloyl esterases are inactive against MCA, type B feruloyl esterases are inactive against MSA). Hence, it is difficult to classify the present enzyme to type A or type B feruloyl esterase from the aspect of substrate specificity. The classification of feruloyl esterase based on the functional properties should also be supported by phylogenetic comparisons of protein sequences. Sequence alignment showed that the present enzyme shared relative high similarity with several other putative proteins and type B feruloyl esterases. Besides, the predicted catalytic domain motif sequence (GFSSG) of feruloyl esterase in the present study is not conserved among the feruloyl esterases, but somewhat matches with that of the other known type B feruloyl esterases, such as the enzymes from P. funiculosum (CAC14144, GSSSG) and N. crassa (CAC05587, GTSSG), whereas GHSLG is conserved in type A feruloyl esterases, GCSTG is conserved in type C feruloyl esterases and the motif of type D feruloyl esterases is less conserved than type A, B and C feruloyl esterases [11]. Further, phylogenetic tree built based on the feruloyl esterases sharing high sequence identities revealed that the feruloyl esterase from Chaetomium sp. CQ31 is close to type B feruloyl esterases in evolutionary relationship. So, the enzyme was classified as a type B feruloyl esterase based on both the functional property and evolutionary relationship. The analysis of feruloyl esterase model structure revealed that it is a member of the ␣/ hydrolase family with diverse catalytic functions. Most of other reported esterases belong to the ␣/ hydrolase family enzymes [37]. The structure has a Gly-X-Ser-X-Gly catalytic triad consisting of a Ser118 as the nucleophile, His257 as the proton acceptor/donor and Asp201 as the residue stabilizing the histidine (Fig. 7), which is in accordance with the esterase from Thermotoga maritima [38]. In addition, Serine is a candidate for a component of the catalytic triad featured in all the family members [1]. 5. Conclusions A novel type B feruloyl esterase from Chaetomium sp. CQ31 was purified and characterized. The enzyme was a monomeric protein with molecular weights of 30.2 kDa and 29.6 kDa when determined by SDS-PAGE and gel filtration, respectively. The optimal temperature and pH of the purified enzyme were 60 ◦ C and pH 7.5. The enzyme was thermostable up to 55 ◦ C with a denature half-life of 235 min. The enzyme also showed good pH stability. The feruloyl esterase gene was further cloned and sequenced. The excellent properties of the enzyme may make it attractive in industrial applications. Acknowledgements This work was financially supported by the National High Technology Research and Development Program of China (863 Program, No. 2011AA100905) and the Transformation Fund for Agricultural Science and Technology Achievements (Project No. 2010GB23600652).
336
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
References [1] V.F. Crepin, C.B. Faulds, I.F. Connerton, Biochem. J. 370 (2003) 417–427. [2] C. Thörn, H. Gustafsson, L. Olssona, J. Mol. Catal. B: Enzym. 72 (2011) 57–64. [3] H. Schroeter, R.J. Williams, R. Matin, L. Iversen, C.A. Rice-Evans, Free Radic. Biol. Med. 29 (2000) 1223–1233. [4] U.T. Bornscheuer, FEMS Microbiol. Rev. 26 (2002) 73–81. [5] T. Koseki, A. Hori, S. Seki, T. Murayama, Y. Shiono, Appl. Microbiol. Biotechnol. 83 (2009) 689–696. [6] C.B. Faulds, G. Williamson, J. Gen. Microbiol. 137 (1991) 2339–2345. [7] E. Topakas, C. Vafiadi, P. Christakopoulos, Process Biochem. 42 (2007) 497–509. [8] M. Moukouli, E. Topakas, P. Christakopoulos, Appl. Microbiol. Biotechnol. 79 (2008) 245–254. [9] E. Topakas, H. Stamatis, M. Mastihubova, P. Biely, D. Kekos, B.J. Macris, P. Christakopoulos, Enzyme Microb. Technol. 33 (2003) 729–737. [10] S. Mathew, T.E. Abraham, Enzyme Microb. Technol. 36 (2005) 565–570. [11] H.D. Shin, R.R. Chen, Appl. Microbiol. Biotechnol. 73 (2007) 1323–1330. [12] E. Topakas, H. Stamatis, P. Biely, P. Christakopoulos, Appl. Microbiol. Biotechnol. 63 (2004) 686–690. [13] E. Topakas, M. Moukouli, M. Dimarogona, P. Christakopoulos, Appl. Microbiol. Biotechnol. 94 (2012) 399–411. [14] Z.Q. Jiang, Q.Q. Cong, Q.J. Yan, N. Kumar, X.D. Du, Food Chem. 120 (2010) 457–462. [15] H.D. Shin, R.R. Chen, Enzyme Microb. Technol. 38 (2006) 478–485. [16] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, J. Biol. Chem. 193 (1954) 265–275. [17] U.K. Laemmli, Nature 227 (1970) 680–685. [18] R.M. Zacharius, T.E. Zell, J.H. Morrison, J.J. Woodlock, Anal. Biochem. 30 (1969) 148–152. [19] G.S. Fan, P. Katrolia, H.Y. Jia, S.Q. Yang, Q.J. Yan, Z.Q. Jiang, Biotechnol. Lett. 34 (2012) 2043–2048. [20] G.L. Miller, Anal. Chem. 31 (1959) 426–428.
[21] T.M. Rose, E.R. Schultz, J.G. Henikoff, S. Pietrokovski, C.M. McCallum, S. Henikoff, Nucleic Acids Res. 26 (1998) 1628–1635. [22] D.E. Kim, D. Chivian, D. Baker, Nucleic Acids Res. 32 (2004) 526–531. [23] K. Rumbold, P. Biely, M. Mastihubova, M. Gudalj, G. Gubitz, K.H. Robra, Appl. Environ. Microbiol. 69 (2003) 5622–5626. [24] D.C. Smith, K.M. Bhat, T.M. Wood, World J. Microbiol. Biotechnol. 7 (1991) 475–484. [25] S. Hegde, G. Muralikrishna, World J. Microbiol. Biotechnol. 25 (2009) 1963–1969. [26] V.F. Crepin, C.B. Faulds, I.F. Connerton, Appl. Microbiol. Biotechnol. 63 (2004) 567–570. [27] E. Topakas, C. Vafiadi, H. Stamatis, P. Christakopoulos, Enzyme Microb. Technol. 36 (2005) 729–736. [28] D. Linke, R. Matthes, M. Nimtz, H. Zorn, M. Bunzel, R.G. Berger, Appl. Microbiol. Biotechnol. (2012), http://dx.doi.org/10.1007/s00253-012-4598-7. [29] M.T. Garcia-Conesa, V.F. Crepin, A.J. Goldson, G. Williamson, N.J. Cummings, I.F. Connerton, C.B. Faulds, P.A. Kroon, J. Biotechnol. 108 (2004) 227–241. [30] E.P. Knoshaug, M.J. Selig, J.O. Baker, S.R. Decker, M.E. Himmel, W.S. Adney, Appl. Biochem. Biotechnol. 146 (2008) 79–87. [31] K. Rashamuse, W. Sanyika, T. Ronneburg, D. Brady, Biochem. Mol. Biol. Rep. 45 (2012) 14–19. [32] S.B. Zhang, Z.L. Wu, Bioresour. Technol. 117 (2012) 140–147. [33] J.M. Berg, Cold Spring Harb. Symp. Quant. Biol. 52 (1987) 579–585. [34] P. Debeire, P. Khoune, J.M. Jeltsch, V. Phalip, Bioresour. Technol. 119 (2012) 425–428. [35] I. Benoit, D. Navarro, N. Marnet, N. Rakotomanomana, L. Lesage-Meessen, J.C. Sigoillot, M. Asther, M. Asther, Carbohydr. Res. 341 (2006) 1820–1827. [36] D.W.S. Wong, Appl. Biochem. Biotechnol. 133 (2006) 87–112. [37] R.A. Khudary, R. Venkatachalam, M. Katzer, S. Elleuche, G. Antranikian, Extremophiles 14 (2010) 273–285. [38] M. Levisson, L. Sun, S. Hendriks, P. Swinkels, T. Akveld, J.B. Bultema, A. Barendregt, R.H.H. van den Heuvel, B.W. Dijkstra, J. van der Oost, S.W.M. Kengen, J. Mol. Biol. 385 (2009) 949–962.
Contents lists available at ScienceDirect
Journal of Molecular Catalysis B: Enzymatic journal homepage: www.elsevier.com/locate/molcatb
Biochemical characteristics and gene cloning of a novel thermostable feruloyl esterase from Chaetomium sp. Shao-Qing Yang a , Luo Tang a , Qiao-Juan Yan b , Peng Zhou a , Hai-Bo Xu a , Zheng-Qiang Jiang a,∗ , Pan Zhang a a b
Department of Biotechnology, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, China Bioresource Utilization Laboratory, College of Engineering, China Agricultural University, Beijing 100083, China
a r t i c l e
i n f o
Article history: Received 24 December 2012 Received in revised form 20 June 2013 Accepted 21 June 2013 Available online 2 July 2013 Keywords: Feruloyl esterase Chaetomium Characterization Purification Gene sequence
a b s t r a c t A feruloyl esterase from Chaetomium sp. CQ31 was purified and biochemically characterized. The purified feruloyl esterase had a specific activity of 38.6 U/mg. The molecular mass of the enzyme was estimated to be 30.2 kDa by SDS-PAGE, and 29.6 kDa by gel filtration, indicating that the enzyme was a monomer. The optimum pH and temperature of the enzyme were pH 7.5 and 60 ◦ C, respectively. It was stable over a broad pH range of 4.0–10.0, and also exhibited good thermostability. The enzyme displayed strict substrate specificity. The Km and Vmax values for methyl ferulate were 0.98 mol/min/mg and 42.6 U/mg, respectively. Furthermore, the feruloyl esterase gene was cloned and sequenced. Open reading frame (ORF) of the feruloyl esterase gene (879-bp) encodes 274 amino acids. The deduced amino acid sequence of the feruloyl esterase gene exhibited the highest identity (79%) with that of type B feruloyl esterase from Magnaporthe oryzae. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Feruloyl esterases (EC 3.1.1.73), also known as cinnamoyl esterases, are a subclass of carboxylic acid esterases that are capable of catalyzing the hydrolysis of the ester bond between hydroxycinnamic acids and sugars on the polysaccharides in plant cell wall. They have been recognized as common components of many microbial cellulosic enzyme systems. Feruloyl esterases can be classified into four subclasses (viz. type A, B, C and D) based on their substrate specificity for aromatic moieties, functional properties and phylogenetic comparisons of protein sequences [1]. Feruloyl esterases have received a great deal of attention in recent years for their wide potential applications [2]. Ferulic acid
Abbreviations: CAPS, (cyclohexylamino)-1-propanesulphonic acid; CHES, acid; DEPC, diethylenepyrocarbonate; 2-(cyclohexylamino)ethanesulfonic DTNB, 5,5-dithio-bis-2-nitrobenzonic acid; MCA, methyl caffeate; MES, 2-(N-morpholino)ethane sulfonic acid; MFA, methyl ferulate; MOPS, 3-(Nmorpholin)-propane sulfonic acid; MpCA, methyl p-coumarate; MSA, methyl sinapate; NBS, N-bromosuccinimid; ORF, open reading frame; PCR, polymerase chain reaction; PHB, polyhydroxybutyrate; PMSF, phenyl-methylsulfonyl fluoride; pNP, p-nitrophenol; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; WRK, Woodward’s reagent K. ∗ Corresponding author at: PO Box 294, China Agricultural University, No. 17 Qinghua Donglu, Haidian District, Beijing 100083, China. Tel.: +86 10 62737689; fax: +86 10 82388508. E-mail address: [email protected] (Z.-Q. Jiang). 1381-1177/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.molcatb.2013.06.011
released from plant cell wall by the hydrolysis reaction of feruloyl esterases has long been used as food preservative to inhibit microbial cell growth [3]. Feruloyl esterases could be used as animal feed additive to increase the digestibility and the calorific value [4]. The utilization of feruloyl esterases in pulp and paper industry can reduce chlorine consumption and improve brightness of the pulp [5]. In addition, feruloyl esterases also play an important role in the efficient and cost-effective conversion of renewable cellulosic materials to fuel ethanol [2]. These application fields require various types of feruloyl esterases to fit certain pH, temperature, stability or some other profiles. To date, more than 30 feruloyl esterases have been purified and characterized from various microorganisms [6], many of which are from mesophilic fungi, such as Neurospora crassa [7], Fusarium oxysporum [8,9] and Aspergillus oryzae [5]. Among them, different Aspergillus species such as Aspergillus flavipes [10] and Aspergillus nidulans [11] are the most active producers of feruloyl esterases under submerged cultivation in the presence of lignocelluloic carbon sources. Generally, thermophilic fungi are considered to be more attractive enzyme producers since the enzymes from thermophilic fungi have higher temperature and thermostability when compared to the enzymes form mesophilic fungi. Among thermophilic fungi, type B feruloyl esterases have been reported in Sporotrichum thermophile [12] and Myceliophthora thermophila [13]. Chaetomium sp. CQ31 has been reported to secrete a thermostable xylanase when grown in the submerged culture using corncobs as carbon source [14]. In further investigations, we found
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
329
2. Materials and methods
Flow (10 cm × 1.0 cm) column which was equilibrated with 20 mM Tris–HCl buffer (pH 9.0). The bound proteins were eluted with a linear gradient of 0–100 mM NaCl in the equilibration buffer at a flow rate of 1.0 ml/min. Fractions were collected and monitored for feruloyl esterase activity. The purity was checked by SDS-PAGE. All purification steps were carried out at 4 ◦ C unless otherwise stated.
2.1. Materials
2.4. Enzyme assay and protein determination
TRIzol (Invitrogen, Carlsbad, USA) and Oligotex mRNA Midi Kit (Qiagen, Hilden, Germany) were used for total RNA extraction and mRNA purification. SMARTerTM RACE cDNA Amplification was purchased from Clontech (Palo Alto, CA, USA). Restriction endonucleases and T4 DNA ligase were purchased from England Biolabs (Ipswich, MA, USA). DNA polymerase Ex Taq and pMD18-T simple vector system were obtained from TaKaRa (Dalian, China). Escherichia coli JM109 (Bomaide, Beijing, China) was used for propagation of plasmids. Ferulic acid and methyl ferulate were purchased from Alfa Aser Company (USA). Methyl p-coumarate, methyl caffeate and methyl sinapate were purchased from Apin Chemicals Limited (UK). Corncobs were obtained locally and were chopped into small pieces, and ground in a hammer mill. Q-Sepharose Fast Flow gel was obtained from GE Life Sciences (USA). DEAE 52 resin was the product of Whatman Company (USA). All other chemicals used were analytical grade reagents unless otherwise stated.
Feruloyl esterase activity was assayed according to the method of Shin and Chen [15], by analyzing the free ferulic acid released from methyl ferulate. The reaction buffer used was 50 mM pH 7.0 MOPS (3-(N-morpholin)-propane sulfonic acid) buffer. One unit (U) of feruloyl esterase activity was defined as the amount of enzyme that catalyzes the release of 1 mol ferulic acid per minute under the assay conditions. Protein concentrations were determined according to Lowry method [16] using BSA (bovine serum albumin) as the standard.
that the strain also secreted feruloyl esterase in the fermentation medium. Thus, the present study was investigated on purification, characterization and gene sequence of an extracellular feruloyl esterase from Chaetomium sp. CQ31.
2.2. Fungal strain and growth conditions The fungus, Chaetomium sp. CQ31 used in the present study was preserved in China General Microbiological Culture Collection Center (CGMCC, accession No. 3341). It was maintained on potato dextrose-agar (PDA) medium at 4 ◦ C and transferred every 6–7 weeks. The PDA plates were incubated at 37 ◦ C for 5 days and then stored at 4 ◦ C until use. For fungal mycelium production, Chaetomium sp. CQ31 was grown in a medium containing (g/l) 20 wheat bran, 12 tryptone, 0.3 MgSO4 ·7H2 O, 0.3 FeSO4 and 0.3 CaCl2 at 37 ◦ C for 3 days, and then the mycelia were collected by centrifugation (5000 × g, 10 min) and washed twice with sterile water at 4 ◦ C. For feruloyl esterase production, the liquid fermentation medium contains (g/l) 40 corncobs, 12 yeast extract, 0.3 MgSO4 ·7H2 O, 0.3 CaCl2 , 0.3 (NH4 )2 SO4 , 0.3 FeSO4 , 5 Tween 80 and distilled water. The initial pH of the culture medium was adjusted to pH 7.0 and not controlled in the fermentation process. A piece (1 cm2 ) of agar medium covered with 5-day-old mycelia was transferred into 250 ml Erlenmeyer flask containing 50 ml fermentation medium and incubated at 40 ◦ C on a rotary shaker at 200 rpm for 6 days. After the culture growth, broths were centrifuged at 10,000 × g for 10 min and the supernatant was used as crude enzyme for subsequent analysis. All the fermentations were carried out in triplicates.
2.5. SDS-PAGE and molecular mass determination The homogeneity of the purified feruloyl esterase was determined by SDS-PAGE using 12.5% acrylamide gel as described by Laemmli [17]. The protein bands were visualized by staining with Coomassie brilliant blue R-250. Glycoprotein was detected by periodic acid-schiff (PAS) staining of gels after the SDS-PAGE according to the method of Zacharius et al. [18]. Native molecular mass of the purified feruloyl esterase was determined by gel filtration on a Superdex-75 column (40 cm × 1.0 cm) previously equilibrated with 50 mM pH 7.0 Tris–HCl buffer. The protein sample was loaded and eluted at a flow rate of 0.35 ml/min with the same buffer. Molecular weight standards from Sigma used to calibrate the column were phosphorylase b (97.2 kDa), albumin bovine V (68.0 kDa), albumin (45.0 kDa), chymotrypsinogen a (25.7 kDa) and cytochrome c (12.3 kDa). 2.6. Identification of internal peptide sequences The purified feruloyl esterase was digested by trypsin and submitted to the National Center of Biomedical Analysis (China) for amino acid sequencing using high performance liquid chromatography–electrospray tandem mass spectrometry (HPLC–ESI-MS/MS). Mass spectral sequencing was performed using a Q-TOF II mass analyser (Q-TOF2, Micromass Ltd., Manchester, UK). Peptide sequencing was performed using a palladium-coated borosilicate electrospray needle (Protana, Denmark). The mass spectrometer was used in positive ion mode with a source temperature of 80 ◦ C, and a potential of 800 V was applied to the Nanospray probe. MS/MS spectra were transformed using MaxEnt3 software (MassLynx, Micromass), and amino acid sequences were interpreted manually using PepSeq software (BioLynx, Micromass). 2.7. Enzymatic properties of the purified feruloyl esterase
2.3. Purification of a feruloyl esterase from Chaetomium sp. CQ31 The crude enzyme was subjected to 40–50% ammonium sulfate saturation. After stirring at 4 ◦ C for 1 h, the precipitated proteins were collected by centrifugation at 10,000 × g for 10 min and dissolved in 20 mM Tris–HCl buffer (pH 7.5), then dialyzed against the same buffer overnight. The dialyzed protein sample was then applied to a DEAE 52 (10 cm × 1.0 cm) ion exchange column pre-equilibrated with 20 mM Tris–HCl buffer (pH 7.5). The unbound proteins were collected and concentrated by ultrafiltration using a 10-kDa membrane (Stirred Cell Model 8050, Millipore) and then dialyzed against 20 mM Tris–HCl buffer (pH 9.0) overnight. The dialyzed sample was loaded onto a Q-Sepharose Fast
Effect of pH on feruloyl esterase activity was determined in 50 mM different buffers with the pH ranging from 3.0 to 11.0. The buffers used were citrate buffer (pH 3.0–6.5), acetate buffer (pH 4.0–5.5), MES (2-(N-morpholino) ethane sulfonic acid) buffer (pH 5.0–7.0), MOPS buffer (pH 6.5–8.5), CHES (2(cyclohexylamino)ethanesulfonic acid) buffer (pH 8.0–11.0) and CAPS ((cyclohexylamino)-1-propanesulphonic acid) buffer (pH 9.0–11.0), respectively. To determine the pH stability, the enzyme was incubated in the above mentioned buffers at 50 ◦ C for 30 min, and then the residual feruloyl esterase activities were measured. The optimal temperature of feruloyl esterase activity was determined at different temperatures (30–90 ◦ C) in 50 mM MOPS buffer
330
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
(pH 7.5). For the thermostability determination, the purified feruloyl esterase was incubated at different temperatures (30–90 ◦ C) for 30 min, and then the residual activities were measured. The thermal inactivation of the enzyme was studied at 55, 60, 65 and 70 ◦ C by incubating the enzyme for 5 h in 50 mM MOPS buffer (pH 7.5). Aliquots were withdrawn at different time intervals. After cooling on ice for 30 min to 0 ◦ C, the residual activity was measured according to the standard assay method. The results were expressed as the percentage of residual enzyme activities compared to the control without treatment. Each assay was carried out in triplicate and the results presented are the average of three trials. The effects of metal ions and reagents on the feruloyl esterase activity were determined by measuring the residual enzyme activities after the enzyme was incubated in the buffers with 1 mM of different metal ions and agents at 50 ◦ C for 30 min. In order to elucidate whether the inhibition of EDTA on enzyme activity could be alleviated by adding some metal ions, Mn2+ , Mg2+ , and Li+ ions were added in the enzyme solution pre-incubated with 1 mM EDTA, and then the residual enzyme activities were determined.
2.8. Substrate specificity and kinetic parameters Substrate specificity of the purified feruloyl esterase was determined in 50 mM MOPS (pH 7.5) buffer at 50 ◦ C for 10 min. Enzyme activities were measured by the standard assay method by replacing the substrate with 1 mM of methyl p-coumarate, methyl caffeate, and methyl sinapate, respectively. Specific activities are expressed as units per milligram protein. For kinetics determination, the hydrolysis reaction was carried out in 50 mM MOPS buffer (pH 7.5) at 50 ◦ C with the methyl ferulate substrate concentrations ranging from 0.6 to 2.6 mM. The constant kinetic parameters Km and Vmax were estimated by nonlinearregression method using Michaelis–Menten equation.
2.9. Synergistic action of feruloyl esterase with xylanase for the hydrolysis of wheat straw 1 g wheat straw powder (40 meshes) was suspended in 1 ml 100 mM MOPS buffer (pH 7.0), 30 U of purified xylanase from Paecilomyces thermophilia J18 [19] or 50 U of feruloyl esterase or 30 U of xylanase and 50 U of feruloyl esterase were added into the substrate separately, mixed and incubated at 50 ◦ C in water bath for 6 h. Samples were withdrawn at every 1 h, and the released reducing sugars and feruloyl acid were analyzed. The content of reducing sugars was determined by DNS method according to the method of Miller [20] using xylose as the standard, and the content of feruloyl acid was determined by HPLC as mentioned in Section 2.4.
2.10. Estimation of catalytically important amino acids Catalytically important amino acids of feruloyl esterase were identified by measuring the residual activity after the enzyme was modified by various inhibitors. The residual enzyme activities were measured after the enzyme was incubated at 25 ◦ C for different times (0–60 min) in the presence of 5 mM NBS (N-bromosuccinimid, specifically modify tryptophan), WRK (Woodward’s reagent K, specifically modify glutamic acid or asparagic acid), DTNB (5,5-dithio-bis-2-nitrobenzonic acid, specifically modify cysteine), PMSF (phenyl-methylsulfonyl fluoride, specifically modify serine) and DEPC (diethylenepyrocarbonate, specifically modify histidine) in 50 mM MOPS buffer (pH 7.5), respectively.
2.11. Cloning and sequence analysis of the feruloyl esterase gene To clone the feruloyl esterase gene, degenerate primers DP1 (GGCGGCATGATGACCAAYGTNATGGC) and DP2 (CGCCCAGGACGTTGGWCCAYTGYTTNA) were designed based on the conserved sequences (GGMMTNVMA and KQWSNVLGV) of other known fungal feruloyl esterases using the CODEHOP algorithm [21]. Genomic DNA of Chaetomium sp. CQ31 was used as template for polymerase chain reaction (PCR) amplification. The PCR conditions are as follows: a hot start at 94 ◦ C for 5 min, 10 cycles of 94 ◦ C for 30 s, 61–55 ◦ C for 30 s and 72 ◦ C for 2 min, followed by 20 cycles of 94 ◦ C for 30 s, 55 ◦ C for 30 s and 72 ◦ C for 2 min. The PCR product was purified, ligated to pMD18-T vector and sequenced. The full-length cDNA sequence of the feruloyl esterase was obtained by 5 and 3 RACE (rapid amplification of cDNA ends) using a SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA) in accordance with the manufacturer’s instructions. 5 end of the cDNA was amplified using the primers SP1 (AGGCCGTGCGTGATCTGCAT) and adapter primer UPM (Universal Primer A Mix), followed by a nested PCR using nested gene specific primer NSP1 (GGATACGAGTTGCGCACCAG) and adapter primer NUP (Nested Universal Primer A). 3 RACE was performed using the primers SP2 (GGGCCTCCAGAAGACGGAGC) and UPM, followed by a nested PCR using the nested gene specific primer NSP2 (CCTGGCCGACTTCCTGGTGC) and NUP. The obtained PCR product was purified, cloned and sequenced. The feruloyl esterase cDNA sequence from Chaetomium sp. CQ31 has been deposited in the GeneBank with accession number of JN896340. The coding region of feruloyl esterase gene was amplified from the Chaetomium sp. CQ31 genomic DNA using the specific primers EP1 (CATATGGCCTCGCTGCAGCAGGTGA) and EP2 (CTCGAGGTTGATCAGGCCGAAAAACCT). The DNA product was purified and cloned into a pMD18-T vector, and transformed into E. coli JM109 for sequencing. The alignments of DNA and protein sequence were constructed using BLAST at NCBI server (http://blast.ncbi.nlm.nih.gov/ Blast.cgi). Multiple alignment analysis of deduced amino acid sequences were performed by ClustalW2 (http://www.ebi.ac.uk/ Tools/clustalw2/index.html). Structural analysis of deduced protein was carried out on the website of ExPASy Proteomics Server (http://www.expasy.ch/tools/). Signal peptide was analyzed by SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP/). Search analysis of conserved domain was carried out using ScanProsite (http://www.expasy.ch/tools/ScanProsite). N-Glycosylation sites were predicted using NetNGlyc1.0 (http://www.cbs.dtu.dk/ services/NetNGlyc/). 2.12. Structure modeling of the feruloyl esterase from Chaetomium sp. The model of the feruloyl esterase from Chaetomium sp. was built by submitting the amino acid sequence to the Robetta server (http://robetta.bakerlab.org/) [22]. A prolyl endopeptidase from Myxococcus xanthus sharing a sequence identity of 21% with the present enzyme was chosen as the template (PDB code: 2BKL). 3. Results 3.1. Production and purification of feruloyl esterase from Chaetomium sp. CQ31 Production of feruloyl esterase by Chaetomium sp. CQ31 was studied in shake flasks. The maximum extracellular feruloyl esterase activity of 2.1 U/ml was achieved after 6 days of cultivation at 40 ◦ C in the submerged culture containing 4% corncobs as
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
331
Table 1 Purification of a feruloyl esterase from Chaetomium sp. CQ31. Purification step
Total activity (U)a
Total protein (mg)b
Specific activity (U/mg)
Purification factor (-fold)
Recovery (%)
Crude enzyme (NH4 )2 SO4 precipitation DEAE 52 Q-Sepharose Fast Flow
1076.0 833.9 374.4 108.0
3956.4 553.1 37.3 2.8
0.3 1.5 10.0 38.6
1.0 5.0 33.5 128.6
100.0 77.5 34.8 10.0
a b
Activity was measured in 50 mM MOPS buffer (pH 7.0) at 50 ◦ C for 10 min using 1 mM methyl ferulate as substrate by the standard method. The protein concentration was estimated by the Lowry method [16], using BSA (bovine serum albumin) as the standard.
carbon source (data not shown). The extracellular feruloyl esterase was purified to 128.6-fold apparent homogeneity with a recovery yield of 10% (Table 1) from the culture supernatant of Chaetomium sp. CQ31. During the purification process, the specific activity of feruloyl esterase was increased from 0.3 to 38.6 U/mg protein. The purified feruloyl esterase was electrophoretically homogenous as observed on SDS-PAGE with a molecular mass of approximately 30.2 kDa (Fig. 1), while the native molecular mass of feruloyl esterase was found to be about 29.6 kDa by gel filtration, which indicated monomeric nature of the protein. 3.2. Identification of feruloyl esterase by internal peptide sequences The purified feruloyl esterase was hydrolyzed to peptide fragments by trypsin, and three major peptide fragments were obtained. The N-terminal amino acid sequences of the peptides were determined to be RFLQAWCQLTR (Peptide 1), QWSNVLGVQLTR (Peptide 2) and TEQEWGDLVR (Peptide 3), respectively by HPLC–ESI-MS/MS. The sequences of three peptides from the feruloyl esterase were submitted to the NCBI BLAST database and compared with some other known esterases (data not shown). Peptide 2 showed an identity of 75% with the feruloyl esterase precursors from N. crassa OR74A and Neurospora tetrasperma FGSC 2508. Peptide 3 showed relative high identities with some feruloyl esterases and other types of esterases from Nocardiopsis dassonvillei subsp. (90%), Streptomyces hygroscopicus ATCC 53653 (80%), Catenulispora
acidiphila DSM 44928 (80%) and Saccharopolyspora erythraea NRRL 2388 (80%), all of which belonged to polyhydroxybutyrate (PHB) depolymerase family. It is noteworthy that Peptides 1 displayed no significant sequence similarities with other known feruloyl esterases. 3.3. Effect of pH and temperature on the activity and stability of feruloyl esterase The purified feruloyl esterase exhibited an optimum activity at pH 7.5 in 50 mM MOPS buffer (Fig. 2A). The enzyme activity decreased by more than 50% when the pH increased to 9.5 or decreased to 6.0 (Fig. 2A). The feruloyl esterase had an excellent pH stability, since more than 90% of its activity was maintained when the enzyme was treated at 40 ◦ C for 30 min within the pH range of 4.5–10.5 (Fig. 2B). The enzyme showed highest activity at 60 ◦ C (Fig. 3A), and it was stable up to 50 ◦ C for 30 min at which more than 95% of enzyme activities remained (Fig. 3B). The halflives of feruloyl esterase at 50, 55, 60 and 65 ◦ C were 417, 235, 57.8 and 18.5 min (Fig. 3C), respectively. The effects of various cations and compounds at 1 mM on the activity of feruloyl esterase were tested. The feruloyl esterase activity was strongly inhibited by K+ (13.4%), Li+ (22.9%), Na+ (23.2%), SDS (27.6%), Fe3+ (59.7%), Ag+ (65.5%) and Cu2+ (69.7%), whereas it was moderately inhibited by EDTA (83.7%). On the contrary, the enzyme was activated by the addition of Mn2+ (168.4%), Ni2+ (150.3%), Co2+ (148.4%), Sr2+ (135.5%), Hg2+ (123.2%) and Zn2+ (116.3%). No significant effect of enzyme activity in the presence of Mg2+ and Ca2+ were observed. Furthermore, the addition of Mn2+ (102.9%), Mg2+ (102.4) and Li+ (99.9%) in the dialyzed enzyme solution could not obviously alleviate the inhibition of EDTA on the enzyme activity, suggesting the enzyme is not a metal-activated enzyme. The modification of DEPC, PMSF and WRK drastically decreased the enzyme activities of feruloyl esterase from Chaetomium sp. CQ31, after incubated for 5 min, more than 60% of activities were lost, while DTNB and NBS moderately inhibited the enzyme activity by less than 20% after the enzyme was treated for 60 min (data not shown). The results indicated that histidine, serine and glutamic acid (aspartic acid) may be existed in the enzyme active site. 3.4. Substrate specificity and kinetic parameters
Fig. 1. Purification of a feruloyl esterase from Chaetomium sp. CQ31. Lane M, low molecular weight protein standards; lane 1, crude extract; lane 2, fraction of 40–50% ammonium sulfate precipitation; lane 3, fraction of DEAE 52 column; lane 4, fraction of Q-Sepharose Fast Flow column. The molecular weight standards (Pharmacia) used for the calibration of feruloyl esterase molecular mass were phosphorylase b (97.0 kDa), bovine serum albumin (66.0 kDa), ovalbumin (45.0 kDa), carbonic anhydrase (30.0 kDa), trypsin inhibitor (20.1 kDa) and ␣-lactalbumin (14.4 kDa).
The substrate specificity of the feruloyl esterase was determined by measuring its activity with methyl ferulate, methyl p-coumarate, methyl caffeate and methyl sinapate as substrates. The maximum activity of 38.6 U/mg protein was obtained when methyl ferulate was used as substrate, while little (less than 1% of maximum activity) or no activity was detected toward other substrates tested including methyl p-coumarate, methyl caffeate and methyl sinapate, indicating the enzyme has a strict specificity for the methyl ferulate ester linkage. The Michaelis–Menten constant Km and Vmax values toward methyl ferulate were 0.98 mM and 42.6 mol/min/mg, respectively.
332
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
Fig. 2. Effect of pH on the activity (A) and stability (B) of the purified feruloyl esterase from Chaetomium sp. CQ31. The influence of pH on feruloyl esterase activity was determined by measuring the enzyme activity at 50 ◦ C using 50 mM of different buffers with the pH ranging from 3.0 to 11.0. For pH stability, the remained activities were measured at 50 ◦ C in 50 mM MOPS buffer (pH 7.5) after incubating the enzyme at 50 ◦ C for 30 min in various buffers with different pH values (pH 3.0–11.0). Buffers used were citrate (), acetate (䊉), MES (), MOPS (), CHES (), CAPS (). The highest activity obtained in pH 7.5 MOPS (with specificity activity of 43.3 U/mg) was defined as 100%.
3.5. Synergistic action of feruloyl esterase with xylanase for the hydrolysis of wheat straw The synergistic action of the feruloyl esterase and the xylanase for the hydrolysis of wheat straw was studied. Feruloyl esterase did
not exhibit activity on the hydrolysis of wheat straw, while xylanase also could not release ferulic acid from wheat straw powder (Fig. 4). However, after the two enzymes were added together, an obviously synergistic effect was observed, the amounts of released reducing sugars and ferulic acids were improved by 57.8% and
Fig. 3. Optimal temperature (A), thermostability (B) and denature time (C) of the purified feruloyl esterase from Chaetomium sp. CQ31. The optimal temperature was measured at different temperatures (30–90 ◦ C) in 50 mM MOPS buffer (pH 7.5) by standard assay, the highest enzyme activity obtained at 60 ◦ C (with specificity activity of 73.5 U/mg) was defined as 100%. For determination of thermostability, the residual activities of feruloyl esterase were measured after the enzyme was incubated at different temperatures (30–90 ◦ C) for 30 min. For estimation of denaturing half-life, the enzyme was pre-incubated at 50 ◦ C (), 60 ◦ C (), 65 ◦ C () and 70 ◦ C (♦) in 50 mM, pH 7.5 MOPS buffer for 5 h, and the residual activities of aliquots withdrawn at different time intervals were measured.
350
80
300
70 60
250
50
200
40
150
30
100
20
50 0
10
1
2
3
4
5
6
333
acceptor/donor and Asp201 as the residue stabilizing the histidine was found (Fig. 7). Released ferulic acid (μmol)
Released reducing sugars (μmol)
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
0
Time (h) Fig. 4. Synergistic action of the feruloyl esterase (FAE) and the xylanase (Xyn) for the hydrolysis of wheat straw. The reducing sugars released by Xyn (), FAE () and Xyn coupled with FAE () were indicated. The ferulic acid released by Xyn (), FAE (䊉) and Xyn coupled with FAE () were indicated.
18.4%, respectively (Fig. 4) when compared with the hydrolysis efficiency of single enzyme. 3.6. Cloning of a feruloyl esterase gene from Chaetomium sp. CQ31 The full-length cDNA of feruloyl esterase gene (1206-bp) was obtained with an ORF of 879-bp (Fig. 5). BLAST analysis showed that the nucleotide sequence shares 80% identity with that of feruloyl esterase B2 gene from Chrysosporium lucknowense (accession number JF826029.1) indicating the enzyme in the present study might be a type B feruloyl esterase. Genomic sequence comparison showed that there are two introns of 95 bp and 120 bp in the coding region of the gene. ORF of the feruloyl esterase gene codes a 274amino acid, which has a predicted molecular mass of 29,592 Da and a theoretical pI of 6.59. The mature protein contains a signal peptide of 18-amino acids and one possible N-glycosylation site. The nucleotide sequence has been submitted to GenBank database and has been allocated the accession number JN896340. The phylogenetic position of the feruloyl esterase in the present study was demonstrated on a phylogenetic tree, which was constructed based on eight feruloyl esterases with high-sequence identities using ClustalX (Fig. 6). The phylogenetic tree revealed that feruloyl esterase from Chaetomium sp. CQ31, C. lucknowense and Magnaporthe oryzae were located inside the group, which has a high similarity of more than 78%. The deduced amino acid sequence of the feruloyl esterase gene from Chaetomium sp. CQ31 shared significant identity with the feruloyl esterases from M. oryzae 70–15 (79%, EHA55715.1), C. lucknowense (78%, AEP33618.1), N. crassa (73%, CAC05587.1) and M. thermophila ATCC 42464 (75%, AEO57203.1). On the basis of amino acid sequence similarity with other known fungal feruloyl esterases, the feruloyl esterase can be classified into carbohydrate esterase (CE) family 1. 3.7. Structure model of the feruloyl esterase A model of feruloyl esterase from Chaetomium sp. was obtained. It has the canonical architecture of an ␣/ hydrolase fold protein consisting of a central -sheet of eight strands surrounded by helices. The active site of feruloyl esterase was identified by the location of the nucleophile serine Ser118 within the conserved pentapeptide sequence Gly-X-Ser-X-Gly (GFSSG). A classical catalytic triad, consisting of Ser118 as the nucleophile, His257 as the proton
4. Discussion In the present study, we describe the production, purification, characterization and gene cloning of a novel feruloyl esterase from the thermophilic fungus Chaetomium sp. CQ31. This is the first report on feruloyl esterase from Chaetomium species. The strain could utilize corncobs as carbon source to produce feruloyl esterase. Similar results were also observed from some other fungi [9]. Chaetomium sp. CQ31 secreted feruloyl esterase in submerged culture with the activity of 2.1 U/ml, which was higher than most of the reported values [7,15,23], but lower than those of 33 U/ml produced by A. flavipes [10] and 2.4 U/ml by Aspergillus phoenicis IMI 211395 [24]. Purification of a feruloyl esterase from Streptomyces olivochromogenes was first reported in 1991 [6]. So far some feruloyl esterases have been purified and characterized from mesophilic fungi such as Aspergillus niger CFR 1105 [25], A. nidulans [11], F. oxysporum [9], M. thermophila [13] and N. crassa [26]. Feruloyl esterases have a broad range of molecular mass distribution, and most of them range from 11 to 210 kDa [7]. The molecular mass (30.2 kDa) of the feruloyl esterase from Chaetomium sp. CQ31 is similar to those of the feruloyl esterases from F. oxysporum (31 kDa) [9] and Fusarium proliferatum NRRL 26517 (31 kDa [15]), but higher than that of the enzyme (23 kDa) from S. thermophile [27], and lower than that of feruloyl esterases from Aureobasidium pullulans (210 kDa [23]), A. niger CFR 1105 (50 kDa, 55 kDa [25]) and Pleurotus sapidus (55 kDa [28]). The majority of feruloyl esterases reported to date are optimally active at acidic (pH 4.5–6.5) or neutral pH values. The optimum pH 7.5 of feruloyl esterase in this study is higher than that of feruloyl esterases from most other fungi, such as A. oryzae (pH 6.0 [5]), N. crassa (pH 6.0 [26]), P. sapidus (pH 6.0 [26]), S. thermophile (pH 6.0 [12]), A. nidulans (pH 7.0 [11]) and F. oxysporum (pH 7.0 [9]). Similar results have also been reported for the 31 kDa feruloyl esterase from F. proliferatum NRRL 26517, which had a neutral optimum pH in the range of 6.5–7.5 [15]. Besides, the activities of the feruloyl esterase at pH 8.0 and 9.0 were 90% and 70% that of the activity at optimum pH 7.5, respectively, indicating that the enzyme is an alkaline tolerant feruloyl esterase. More than 90% of the enzyme activity was retained after incubated at 40 ◦ C for 30 min in the pH range of 4.5–10.5, suggesting that the enzyme is stable in both acidic and alkaline conditions, and is more stable than some of the other fungal feruloyl esterases from A. oryzae (pH 3.0–9.0 [5]), F. proliferatum NRRL 26517 (pH 5.0–9.0 [15]) and F. oxysporum (pH 7.0–9.0 [9]). The high stability of the feruloyl esterase in acidic and alkaline conditions may be advantageous in many biotechnological applications that require extreme conditions such as animal feed additive (acidic condition) and treatment of alkaline pulp (alkaline condition). Generally, the optimal temperatures for most fungal feruloyl esterases are typically between 30 ◦ C and 60 ◦ C [7]. Compared to other fungal feruloyl esterases, the optimal temperature of the feruloyl esterase (60 ◦ C) from Chaetomium sp. CQ31 in the present study was similar to that of the feruloyl esterases from thermophilic fungus S. thermophile [12] and mesophilic fungus Talaromyces stipitatus [29], but higher than that of feruloyl esterases from F. proliferatum NRRL 26517 (50 ◦ C [15]), N. crassa (55 ◦ C [26]) and F. oxysporum (55 ◦ C [9]). This temperature is only lower than that of three recombinant feruloyl esterases from Penicillium funiculosum (66.3 ◦ C and 70.4 ◦ C [30]) and F. oxysporum (65 ◦ C [8]). The feruloyl esterase from Chaetomium sp. CQ31 also displayed remarkable thermostability with a thermal denaturing half-lives of 235.3 min at 55 ◦ C and 57.8 min at 60 ◦ C, respectively, which is longer than that of the
334
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
Fig. 5. Nucleotide and deduced amino acid sequence of the feruloyl esterase gene from Chaetomium sp. CQ31. Nucleotides not in the cDNA (introns) are shown in lower case letters, and those in the cDNA are shown in upper case letter. The translational initiation codon (ATG) and termination codon (TGA) are boxed in frame, and the termination codon is also marked by asterisk (*). A putative signal peptide is indicated underline. A poly (A + ) tail is double underlined. The nucleotide sequence report here has been submitted to Genbank under accession number JN896340.
feruloyl esterase from the thermophilic fungus S. thermophile (45 min at 55 ◦ C [12]). The time is also longer than that of the recombinant feruloyl esterase from a leachate metagenomic library exhibited (<30 min at 50 ◦ C [31]), but shorter than that of the recombinant enzyme AnFaeA from A. niger exhibiting a half-life of more than 4000 min at 55 ◦ C [32]. The efficient application of enzyme in an industrial process is often hampered by unsatisfactory
92 90 65 99
process performance and enzyme thermal stability [4]. The feruloyl esterase in the present study exhibited high optimal temperature and high thermal stability, the properties of which may possesses the enzyme a lots of advantages in biotechnological applications, since a higher reaction temperature can not only improve the reaction rate, but also reduce the enzyme dosage. Metal ions serve many functions in proteins, the most important of which is the
Chrysosporium lucknowense gb|AEP33618.1 Chaetomium sp. CQ31 gb|JN896340 Magnaporthe oryzae 70-15 gb|EHA55715.1 Neurospora crassa emb|CAC05587.1 Penicillium funiculosum emb|CAC14144.1 Chrysosporium lucknowense gb|ADZ98864.1 Myceliophthora thermophila ATCC 42464 gb|AEO57203.1
99
Volvariella volvacea gb|ABI63599.1
0.2 Fig. 6. Phylogenetic dendrogram based on full-length amino acid sequences of other CE (carbohydrate esterase) family 1 proteins obtained by NCBI BLAST, showing the position of feruloyl esterase from Chaetomium sp. CQ31 related to other bacterial and fungal feruloyl esterase. The dendrogram is shown with microbial sources and GenBank accession numbers. The number for each interior brance is the bootstrap value. The scale for branch length is indicated at the bottom of the phylogenetic dendrogram.
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
Fig. 7. Surface representation of feruloyl esterase, with the catalytic triad (Ser118 as a nucleophile, His257 as the proton acceptor/donor and Asp201 as the residue stabilizing the histidine) shown in stick mode.
modification of protein structures, enhancement of the structural stability of the proteins in the conformation required for biological function, or take part in the catalytic processes of enzymes. For some enzymes, the presence of metal ions is crucial for activity [33]. In the present study, Mn2+ (168.4%), Ni2+ (150.3%), Co2+ (148.4%), Sr2+ (135.5%), Hg2+ (123.2%) and Zn2+ (116.3%) markedly promoted the feruloyl esterase activity. These metal ions may be help to increase enzymatic efficiency and reduce the reaction cost. The feruloyl esterase from Chaetomium sp. CQ31 exhibited strict substrate specificity. It can act on methyl ferulate, while showed no activity on the other tested substrates, which is different from some other fungal type B feruloyl esterases with broad substrate specificity [5,9,11,29]. However, the hydrolytic pattern against methyl ferulate is similar to that observed for type B feruloyl esterase. The property of strict substrate specificity may possess the enzyme potential application in ferulic acid production from abundant agro-industrial waste materials [34], the fine ferulic acid can be further enzymatically converted into vanillin, a major flavor compound [4]. The Km value (0.98 mM) of feruloyl esterase for methyl ferulate is higher than that of the feruloyl esterases from F. proliferatum NRRL 26517 (0.15 mM [15]), A. nidulans (0.25 mM [11]), F. oxysporum (0.60 mM [9]) and S. thermophile (0.71 mM [12]), suggesting it has a relative low substrate affinity. The catalytic efficiency (kcat /Km ) value (0.72 s−1 M−1 ) of the enzyme is lower than that of the other feruloyl esterases [9,12,23,27], but higher than that of the feruloyl esterases from F. proliferatum NRRL 26517 (0.44 s−1 M−1 [15]), A. oryzae (0.23 s−1 M−1 and 0.24 s−1 M−1 [5]) and A. nidulans (0.17 s−1 M−1 [11]), indicating the present enzyme hydrolyzed methyl ferulate faster and more efficiently. Ferulic acids are widely occurred in the plant cell walls, such as wheat straw, oat hull, wheat bran and maize bran. They can be used as raw material for bio-catalytic production of vanillin, vanillic acid and some other valued-added products [35]. Besides, they serve as obstacle in the biodegradation of cellulosic materials for bio-ethanol production [36]. The present feruloyl esterase did not show activity on wheat straw powder, however, after the xylanase was added, the hydrolysis efficiency was enhanced markedly, suggesting the enzyme may possess potential application in ferulic acids production with the xylanase. In addition, the synergistic
335
action improved the degradation efficiency of polysaccharides. These results may enable the enzyme great potential in biomass degradation. Feruloyl esterases have been divided into four sub-classes, types A, B, C and D, on the basis of their primary sequences and substrate specificities [26]. Type A feruloyl esterases have activity against MSA, but not MCA, while type B feruloyl esterases have no activity against MSA, but do have activity against MCA. The present feruloyl esterase exhibited activity on MFA, and was inactive against MCA, MSA and MpCA, the property of which is different from that of both type A and type B feruloyl esterases. However, it exhibited somewhat similar properties of both type A and type B feruloyl esterases (type A feruloyl esterases are inactive against MCA, type B feruloyl esterases are inactive against MSA). Hence, it is difficult to classify the present enzyme to type A or type B feruloyl esterase from the aspect of substrate specificity. The classification of feruloyl esterase based on the functional properties should also be supported by phylogenetic comparisons of protein sequences. Sequence alignment showed that the present enzyme shared relative high similarity with several other putative proteins and type B feruloyl esterases. Besides, the predicted catalytic domain motif sequence (GFSSG) of feruloyl esterase in the present study is not conserved among the feruloyl esterases, but somewhat matches with that of the other known type B feruloyl esterases, such as the enzymes from P. funiculosum (CAC14144, GSSSG) and N. crassa (CAC05587, GTSSG), whereas GHSLG is conserved in type A feruloyl esterases, GCSTG is conserved in type C feruloyl esterases and the motif of type D feruloyl esterases is less conserved than type A, B and C feruloyl esterases [11]. Further, phylogenetic tree built based on the feruloyl esterases sharing high sequence identities revealed that the feruloyl esterase from Chaetomium sp. CQ31 is close to type B feruloyl esterases in evolutionary relationship. So, the enzyme was classified as a type B feruloyl esterase based on both the functional property and evolutionary relationship. The analysis of feruloyl esterase model structure revealed that it is a member of the ␣/ hydrolase family with diverse catalytic functions. Most of other reported esterases belong to the ␣/ hydrolase family enzymes [37]. The structure has a Gly-X-Ser-X-Gly catalytic triad consisting of a Ser118 as the nucleophile, His257 as the proton acceptor/donor and Asp201 as the residue stabilizing the histidine (Fig. 7), which is in accordance with the esterase from Thermotoga maritima [38]. In addition, Serine is a candidate for a component of the catalytic triad featured in all the family members [1]. 5. Conclusions A novel type B feruloyl esterase from Chaetomium sp. CQ31 was purified and characterized. The enzyme was a monomeric protein with molecular weights of 30.2 kDa and 29.6 kDa when determined by SDS-PAGE and gel filtration, respectively. The optimal temperature and pH of the purified enzyme were 60 ◦ C and pH 7.5. The enzyme was thermostable up to 55 ◦ C with a denature half-life of 235 min. The enzyme also showed good pH stability. The feruloyl esterase gene was further cloned and sequenced. The excellent properties of the enzyme may make it attractive in industrial applications. Acknowledgements This work was financially supported by the National High Technology Research and Development Program of China (863 Program, No. 2011AA100905) and the Transformation Fund for Agricultural Science and Technology Achievements (Project No. 2010GB23600652).
336
S.-Q. Yang et al. / Journal of Molecular Catalysis B: Enzymatic 97 (2013) 328–336
References [1] V.F. Crepin, C.B. Faulds, I.F. Connerton, Biochem. J. 370 (2003) 417–427. [2] C. Thörn, H. Gustafsson, L. Olssona, J. Mol. Catal. B: Enzym. 72 (2011) 57–64. [3] H. Schroeter, R.J. Williams, R. Matin, L. Iversen, C.A. Rice-Evans, Free Radic. Biol. Med. 29 (2000) 1223–1233. [4] U.T. Bornscheuer, FEMS Microbiol. Rev. 26 (2002) 73–81. [5] T. Koseki, A. Hori, S. Seki, T. Murayama, Y. Shiono, Appl. Microbiol. Biotechnol. 83 (2009) 689–696. [6] C.B. Faulds, G. Williamson, J. Gen. Microbiol. 137 (1991) 2339–2345. [7] E. Topakas, C. Vafiadi, P. Christakopoulos, Process Biochem. 42 (2007) 497–509. [8] M. Moukouli, E. Topakas, P. Christakopoulos, Appl. Microbiol. Biotechnol. 79 (2008) 245–254. [9] E. Topakas, H. Stamatis, M. Mastihubova, P. Biely, D. Kekos, B.J. Macris, P. Christakopoulos, Enzyme Microb. Technol. 33 (2003) 729–737. [10] S. Mathew, T.E. Abraham, Enzyme Microb. Technol. 36 (2005) 565–570. [11] H.D. Shin, R.R. Chen, Appl. Microbiol. Biotechnol. 73 (2007) 1323–1330. [12] E. Topakas, H. Stamatis, P. Biely, P. Christakopoulos, Appl. Microbiol. Biotechnol. 63 (2004) 686–690. [13] E. Topakas, M. Moukouli, M. Dimarogona, P. Christakopoulos, Appl. Microbiol. Biotechnol. 94 (2012) 399–411. [14] Z.Q. Jiang, Q.Q. Cong, Q.J. Yan, N. Kumar, X.D. Du, Food Chem. 120 (2010) 457–462. [15] H.D. Shin, R.R. Chen, Enzyme Microb. Technol. 38 (2006) 478–485. [16] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, J. Biol. Chem. 193 (1954) 265–275. [17] U.K. Laemmli, Nature 227 (1970) 680–685. [18] R.M. Zacharius, T.E. Zell, J.H. Morrison, J.J. Woodlock, Anal. Biochem. 30 (1969) 148–152. [19] G.S. Fan, P. Katrolia, H.Y. Jia, S.Q. Yang, Q.J. Yan, Z.Q. Jiang, Biotechnol. Lett. 34 (2012) 2043–2048. [20] G.L. Miller, Anal. Chem. 31 (1959) 426–428.
[21] T.M. Rose, E.R. Schultz, J.G. Henikoff, S. Pietrokovski, C.M. McCallum, S. Henikoff, Nucleic Acids Res. 26 (1998) 1628–1635. [22] D.E. Kim, D. Chivian, D. Baker, Nucleic Acids Res. 32 (2004) 526–531. [23] K. Rumbold, P. Biely, M. Mastihubova, M. Gudalj, G. Gubitz, K.H. Robra, Appl. Environ. Microbiol. 69 (2003) 5622–5626. [24] D.C. Smith, K.M. Bhat, T.M. Wood, World J. Microbiol. Biotechnol. 7 (1991) 475–484. [25] S. Hegde, G. Muralikrishna, World J. Microbiol. Biotechnol. 25 (2009) 1963–1969. [26] V.F. Crepin, C.B. Faulds, I.F. Connerton, Appl. Microbiol. Biotechnol. 63 (2004) 567–570. [27] E. Topakas, C. Vafiadi, H. Stamatis, P. Christakopoulos, Enzyme Microb. Technol. 36 (2005) 729–736. [28] D. Linke, R. Matthes, M. Nimtz, H. Zorn, M. Bunzel, R.G. Berger, Appl. Microbiol. Biotechnol. (2012), http://dx.doi.org/10.1007/s00253-012-4598-7. [29] M.T. Garcia-Conesa, V.F. Crepin, A.J. Goldson, G. Williamson, N.J. Cummings, I.F. Connerton, C.B. Faulds, P.A. Kroon, J. Biotechnol. 108 (2004) 227–241. [30] E.P. Knoshaug, M.J. Selig, J.O. Baker, S.R. Decker, M.E. Himmel, W.S. Adney, Appl. Biochem. Biotechnol. 146 (2008) 79–87. [31] K. Rashamuse, W. Sanyika, T. Ronneburg, D. Brady, Biochem. Mol. Biol. Rep. 45 (2012) 14–19. [32] S.B. Zhang, Z.L. Wu, Bioresour. Technol. 117 (2012) 140–147. [33] J.M. Berg, Cold Spring Harb. Symp. Quant. Biol. 52 (1987) 579–585. [34] P. Debeire, P. Khoune, J.M. Jeltsch, V. Phalip, Bioresour. Technol. 119 (2012) 425–428. [35] I. Benoit, D. Navarro, N. Marnet, N. Rakotomanomana, L. Lesage-Meessen, J.C. Sigoillot, M. Asther, M. Asther, Carbohydr. Res. 341 (2006) 1820–1827. [36] D.W.S. Wong, Appl. Biochem. Biotechnol. 133 (2006) 87–112. [37] R.A. Khudary, R. Venkatachalam, M. Katzer, S. Elleuche, G. Antranikian, Extremophiles 14 (2010) 273–285. [38] M. Levisson, L. Sun, S. Hendriks, P. Swinkels, T. Akveld, J.B. Bultema, A. Barendregt, R.H.H. van den Heuvel, B.W. Dijkstra, J. van der Oost, S.W.M. Kengen, J. Mol. Biol. 385 (2009) 949–962.