- Email: [email protected]
Cloning, expression and biochemical characterization of a novel, moderately thermostable GDSL family esterase from Geobacillus thermodenitrificans T2
Journal of Bioscience and Bioengineering VOL. 115 No. 2, 133e137, 2013 www.elsevier.com/locate/jbiosc
Cloning, expression and biochemical characterization of a novel, moderately thermostable GDSL family esterase from Geobacillus thermodenitrificans T2 Zhenxing Yang, Yong Zhang, Tiantian Shen, Yi Xie, Yumin Mao, and Chaoneng Ji* State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433, People’s Republic of China Received 17 November 2011; accepted 24 August 2012 Available online 23 September 2012
A thermostable GDSL family esterase-encoding gene, EstL5, was directly obtained from the genomic DNA of Geobacillus thermodenitrificans T2. Recombinant hexahistidine-tagged EstL5 was overexpressed, purified, and its biochemical properties were partially characterized. EstL5 was observed to be active within the temperature range of 0e80 C, having maximal activity at 60 C. Unlike most other thermostable enzymes, EstL5 displayed 24% of its highest activity at 0 C. EstL5 exhibited a high level of activity within a pH range of 6.0e11.0, showing the highest activity at pH 8.0. EstL5 also retained 100% of its activity after a 12-h incubation at 55 C. Furthermore, this enzyme was observed to be strongly inhibited by 10% (w/v) SDS and 0.1 mM PMSF. Ó 2012, The Society for Biotechnology, Japan. All rights reserved. [Key words: Thermostable esterase; GDSL family; Cloning; Characterization; Geobacillus]
Esterases play important physiological and biotechnological roles in the synthesis or hydrolysis of ester-containing compounds. Esterases hydrolyze partially soluble fatty-acid esters with acyl chain lengths of less than 10 C atoms, whereas lipases display maximal activity toward water-insoluble long-chain triglycerides (1). Esterases have been used in food processing, beverages, perfume industries, chemical industries, agriculture and pharmaceutical industries for many years (2). Many esterases share the pentapeptide G S G motif, with serine located in the active site, but not all lipolytic enzymes have this motif. The GDSL motif has been identified as a new subfamily of hydrolytic/lipolytic enzymes with the active-site serine located near the N-terminus (3). Furthermore, a subgroup of this GDSL family was classified as the SGNH hydrolase family, with four conserved residues Ser, Gly, Asn and His in four conserved blocks I, II, III and V (4e6). Some GDSL family esterases are multifunctional. For example, Escherichia coli thioesterase I (TAP), containing the SGNH motif, possesses thioesterase, esterase, arylesterase, protease, and lysophospholipase activities (7). A flexible active-site environment for the SGNH family esterase may cause the weak substrate specificity observed. Previous studies revealed that conformational changes due to substrate binding were a unique feature of multifunctional SGNH esterases (8,9). In recent years, scientific and industrial uses of esterases from thermophiles have increased due to the functional and structural
stability of these proteins and their phylogenetic importance (10). Some thermostable esterases from Picrophilus torridus (11), Archaeoglobus fulgidus (12), Sulfolobus solfataricus (13), Pyrobaculum calidifontis (14), Alicyclobacillus acidocaldarius (15) and Fervidobacterium nodosum (16) have been characterized. However, these enzymes cannot satisfy all industrial demands, which require special properties, stimulating the discovery and characterization of novel esterases from thermophiles. Geobacillus is a genus of moderately thermophilic bacilli. Because of the significance of their structural and functional stability in extreme environments, these bacteria have been regarded as an important source of thermostable enzymes and have attracted industrial interest (17). To date, several thermostable enzymes such as thermostable L-arabinose isomerase (18), alkaline phosphatase (19), lipase (20), a-amylase and a-glucosidase (21) from Geobacillus spp. have been characterized. In this study, a novel esterase, EstL5, from Geobacillus thermodenitrificans T2 was cloned, purified and characterized. Sequence analysis revealed that this enzyme is a novel member of SGNH hydrolase family, exhibiting special catalytic properties, such as moderate thermostability and activity at low temperatures.
* Corresponding author. Room 109, 2nd Biology Building, Fudan University, Shanghai 200433, People’s Republic of China. Tel.: þ86 21 65648488; fax: þ86 21 65642502. E-mail address: [email protected] (C. Ji).
Sequence analysis of EstL5 The genomic library for sequencing of G. thermodenitrificans T2 was constructed by our lab (data of genome sequence is unpublished). Homology searches were performed using the BLAST program at the NCBI web server (http://www.ncbi.nlm.nih.gov/BLAST), and a novel putative
MATERIALS AND METHODS Oligonucleotides synthesis and DNA sequencing were performed by Sangon Corporation (Shanghai, China). Enzymes used in vector construction were purchased from New England Biolabs (Beverly, MA, USA). All the chemicals were purchased from Sigma (SigmaeAldrich, St. Louis, MO, USA) unless otherwise specified.
1389-1723/$ e see front matter Ó 2012, The Society for Biotechnology, Japan. All rights reserved. http://dx.doi.org/10.1016/j.jbiosc.2012.08.016
134
YANG ET AL.
esterase, EstL5, was identified. Multiple sequences alignments were performed by the GeneDoc programmer (http://www.psc.edu/biomed/genedoc). Cloning, expression, and purification of EstL5 Based on the sequencing results, the following two polymerase chain reaction (PCR) primers were designed 0 to amplify the EstL5 gene: forward primer (F), 5 -CTAGCTAGCTTAGTGGTGCAA GACCAGCTG-30 ; and reverse primer (R), 50 -CCGCTCGAGTCACTGGCGATCCTCCTCC-30 . The full-length coding sequence of EstL5 was amplified using the Pfu DNA polymerase with the F and R primers. The amplified fragments with the expected size were gel-purified and cloned into the Nhe I and Xho I sites of pET28b (Novagen, Merck KGaA, Darmstadt, Germany). The fidelity of inserting the fragment into pET vectors was confirmed by sequencing. E. coli BL21(DE3) harboring the constructed expression plasmids were grown in 1 L of Luria-Bertani (LB) medium containing kanamycin (100 mg L1) until an OD600 of 0.6e0.8 was reached. After induction with 0.5 mM IPTG for 10 h at 30 C, the cells were harvested by centrifugation. The cell pellet was resuspended in a standard buffer (40 mM Na2HPO4, 10 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) and disrupted by pressure (JN3000 Plus, JNBIO, Guangzhou, China) at 4 C. After incubation for 30 min at 55 C and centrifugation at 27,000 g for 30 min at 4 C, the supernatant of the lysate was passed through a pre-equilibrated Ni-NTA Superflow column (Qiagen, Hilden, Germany). After washing the column with standard buffer containing 10 mM imidazole and 50 mM imidazole to remove other proteins, the hexahistidine-tagged EstL5 was eluted with buffer containing 40 mM Na2HPO4, 10 mM NaH2PO4, 300 mM NaCl and 250 mM imidazole (pH 8.0). The phosphate buffer was subsequently replaced with 10 mM TriseHCl buffer (pH 8.0) and 100 mM NaCl by ultrafiltration (Amicon Ultra-15 column; Millipore, Billerica, MA, USA). The purity and concentration of the protein samples were analyzed by SDS-PAGE and Bradford assays (Pierce Co., Rockford, IL, USA), respectively. Mutagenesis Mutants Ser41Ala, Asp213Ala and His216Ala were generated by whole-plasmid PCR in 20-cycle reaction with steps at 95 C for 60 s, 55 C for 60 s, and 72 C for 9 min per cycle. The primers include: 50 -GGCGACGCGCTGACGCGGG GAACGGGCGATGA-30 and 50 -CGCGTCAGCGCGTCGCCTAAGGCGACAATGTC-30 ; 50 -GTA and 50 -CGGATGGAAATGC TAGCGCGCATTTCCATCCGAATAAGGAAGGGTACAAGC-30 GCGCTATACAAATAGTCGTTGACATGCAA -30 ; 50 -GTATAGCGATCATTTCGCGCCGAATAAGG AAGGGTACAAGC-30 and 50 -CGGCGCGAAATGATCGCTATACAAATAGTCGTTGACATGCAA-30 , respectively (modified codons underlined). After digestion with DpnI, the PCR product was transformed into E. coli BL21(DE3) for esterase gene expression. Enzyme assays The substrate specificity was determined using the following pNP (p-nitrophenly) esters: pNP acetate (pNP C2), pNP butyrate (pNP C4), pNP valerate (pNP C5), pNP caprylate (pNP C8), pNP decanoate (pNP C10), pNP laurate (pNP C12), pNP myristate (pNP C14) and pNP palmitate (pNP C16). The standard activity assay was carried out in 1 ml reaction mixture containing 25 mM Tris-HCl buffer (pH 8.0), 1 mM substrates and 0.3 mg enzyme at 60 C. After pre-incubation of substrate solutions at 60 C for 10 min, the reaction was initiated by the addition of the purified enzyme and the released p-nitrophenol was continuously monitored at 410 nm using a V-550 spectrophotometer (JASCO, Tokyo, Japan) with ECT-505s temperature conductor (JASCO). Measurements were corrected for nonspecific substrate hydrolysis in absence of the enzyme. The activity was determined by measuring the initial rate of hydrolysis of pNP ester. One unit of activity is defined as the amount of enzyme that releases 1 mmol of p-nitrophenol per minute. The molar extinction coefficient of p-nitrophenol is 15,000 M1 cm1 at 410 nm. Kinetic parameters were determined from data obtained by determining the initial rate of pNP butyrate hydrolysis.
J. BIOSCI. BIOENG., The effects of pH and temperature on esterase activity To determine the optimum pH, esterase activity was determined by measuring the amount of pnitrophenol formed from the pNP ester substrate within a pH range of 4.0e12.0 using various buffers (25 mM). All activity assays were performed at 60 C and terminated by the addition of an equal volume of 0.5 M NaOH. To determine the pH stability of the enzyme, the esterase was incubated for 1 h at 30 C in the following buffers (25 mM): acetic acid/sodium acetate (pH 4.0e5.5), potassium phosphate (pH 5.0e8.0), TriseHCl (pH 7.5e9.0) and glycine/NaCl/ NaOH (pH 9.0e13.0) without substrate. All of these activity assays were performed at 60 C. The optimum temperature was measured in assays incubated at temperatures ranging from 0 C to 80 C at pH 8.0 in 25 mM TriseHCl with 1 mM pNP butyrate as the substrate. Enzyme thermostability was also investigated by incubating the assays for various time intervals at different temperatures ranging from 0 to 80 C at pH 8.0. The effects of various compounds on esterase activity Various compounds (inhibitors, organic solvents and surfactants) were added to an enzyme solution (1 mg/ml) and incubated for 30 min at 30 C. Residual esterase activity was examined using a spectrophotometric assay with pNP butyrate as the substrate. Structural modeling Since there are no close structural homologs of EstL5, modeling was based on threading using the 3D-structural threading program Phyre2 (22). Several structural fits were found. The model was assessed using the PyMOL (www.pymol.org).
RESULTS Sequence analysis of EstL5 In the genome sequence of G. thermodenitrificans T2, a gene coding for a putative bacterial esterase, EstL5, composed of 241 amino acid residues was identified through a bioinformatic screening. These sequence data have been submitted to the GenBank databases under accession nos. EU623977 and ACD02023.1. A multiple amino acid sequence alignment of the conserved blocks was performed using the EstL5 sequence and a selection of SGNH family esterases (Fig. 1). The critical residues for enzyme activity, assigned by comparison with other SGNH proteins, include the oxyanion hole residues (Ser41, Gly79, and Asn111) and the catalytic triad (Ser41, Asp213, and His216), which appear in similar positions to those in other carboxylester hydrolases in this family (7,9). Therefore, EstL5 can be classified as a novel member of SGNH family hydrolases. Expression and purification of recombinant EstL5 The sequence encoding EstL5 was amplified by PCR and cloned into pET28b vector. Bacteria were transformed with the expression vector EstL5-pET28b and induced with IPTG to express the recombinant protein. The cytosolic fraction was collected and used to purify the recombinant protein. Recombinant EstL5 was completely eluted from the column with 250 mM imidazole (Fig. 2,
FIG. 1. Sequence alignment of EstL5 with the members of SGNH hydrolase family. These esterases include: Listeria innocua Clip11262 (accession no. NP_470091), lipase/acylhydrolase from Bacillus cereus (accession no. NP_981822), GDSL family lipolytic protein from Paenibacillus dendritiformis (accession no. ZP_09675168), acyl-CoA thioesterase from Clostridium acetobutylicum (accession no. NP_981822), RGAE, Rhamnogalacturonan acetylesterase (Swiss-Prot: Q00017.1). The four conserved sequence blocks found in all SGNH hydrolases are boxed and the consensus Ser, Gly, Asn and His residues (SGNH) are annotated with filled circles.
VOL. 115, 2013
BIOCHEMICAL CHARACTERIZATION OF NOVEL GDSL ESTERASE
lane 3). Approximately 36.7 mg of recombinant enzyme was obtained from a 1-L bacterial culture (Table 1). Substrate specificity The substrate specificity of EstL5 was determined at 60 C using pNP esters with acyl chains of different lengths (C2-C16) as substrates (Table 2). EstL5 only displayed hydrolase activity toward short-length acyl chain substrates. The specific activity of EstL5 toward pNP butyrate (C4) was approximately 4-fold higher than with pNP acetate (C2). However, no significant esterase activity was observed for substrates with chain lengths longer than C10. The catalytic activity of EstL5 with substrates that have short-chain acyl groups is characteristic of esterases. Physicochemical properties Purified recombinant EstL5 exhibited maximum activity at a temperature of 60 C at pH 8.0. The kinetic analysis shows that the Michaelis-Menten constant (Km) and the maximum velocity for the reaction (Vmax) are 1.007 mM and 8.05 107 M/s, respectively, under the reaction conditions described above. The catalytic efficiency (kcat/Km) of the enzyme for pNP butyrate was determined to be 79.94 mM1s1. Unlike most thermophilic enzymes, EstL5 retained 52% activity when the reaction was performed at 30 C and 24% esterase activity at 0 C (Fig. 3A). EstL5 displayed high activity at alkaline pH, with over 50% of its maximal activity occurring within the pH range of 7e9.5 (Fig. 3B). EstL5 can retain 100% of the esterase activity after incubation for 12 h at the temperature range from 0 C to 55 C. However, after incubation for 12 h at 60 C, only 55% of the esterase activity remained. EstL5 can be completely inactivated after incubating the enzyme for 40 min at 75 C or for 20 min at 80 C (Fig. 3C). EstL5 also exhibited high stability in buffers at various pH values. The enzyme retained over 50% of its activity after incubation in buffers within a pH range of 4e12 for 1 h (Fig. 3D). Effects of different reagents The effects of various compounds on EstL5 enzyme activity are shown in Table 3. CHAPS (3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonic
135
TABLE 1. Purification of recombinant EstL5 from E. coli cells.
Lysate supernatant Ni-chelation
Total protein (mg)a
Total activity (U)b
Specific activity (U/mg)
Yield (%)
Purification fold
1408.7 36.7
1730.7 1218.4
1.2 33.2
100 70.4
1 27.7
a The amount of total protein was determined by the Bradford assay (Pierce) using BSA as a standard. b The activity unit U is expressed as mmol/min with pNP butyrate as the substrate.
acid) and pyridine were observed to have a slight activating effect on EstL5. A significant decrease in enzyme activity was observed after incubation with Tween-80, Triton X-100, SDS, ethanol, 2-propanol, isooctane, PMSF or 99% DMSO. Structural modeling In order to obtain structural insights into EstL5, 3D-structural model has been build. Since there are no close structure homologs of EstL5, modeling was based on threading using the 3D-structural threading program Phyre2 (22). Unlike homology modeling, a certain sequence similarity between the query sequence and a template protein is not necessary. The 20 best structural alignments were provided by the server. The model of EstL5 showed a large domain with an a/b-hydrolase fold (Fig. 4A). The a/b-hydrolase fold consists of a five-central b-sheet and eight a-helixes. Sequence alignment indicated the residues Ser41, Asp213 and His216 as the probable catalytic triad. Comparing with E. coli thioesterase I, in the model of EstL5, Ser41, Asp213 and His216 were indeed located in close proximity, most likely representing the actual active site. To confirm the predictions of the catalytic triad, amino acid residues of the catalytic triad were substituted by site directed mutagenesis. Mutants Ser41Ala, Asp213Ala and His216Ala were generated by whole-plasmid PCR. None of the mutants had relative activity over 5%, which confirming the importance of these three residues for the activity of EstL5. DISCUSSION Several GDSL family members were identified and a subgroup of this family was further classified as SGNH hydrolases. Though current knowledge about the GDSL family is limited, GDSL hydrolases are commonly used for multiple functions in food, flavors, fragrances, cosmetics, textiles, and in the pharmaceutical and detergent industries (2,9). After sequence analysis, EstL5 was annotated as a putative SGNH hydrolase, a class II lipolytic enzyme in the GDSL family (23). Esterase activity assays demonstrated that EstL5 functions as an esterase with short-chain ester substrates. EstL5 displayed the highest activity toward pNP butyrate (C4). Furthermore, the substrate specificity of the enzyme was observed to differ from most thermophilic esterases. For example, the optimal substrate for FNE, an SGNH thermophilic esterase, is pNP acetate (C2) (16). Also, the thermophilic esterase from A. fulgidus (12) and P. calidifontis TABLE 2. Esterase activity toward p-nitrophenyl esters. Substrate p-nitrophenyl p-nitrophenyl p-nitrophenyl p-nitrophenyl p-nitrophenyl p-nitrophenyl p-nitrophenyl p-nitrophenyl
FIG. 2. Analysis of the expression and purification of recombinant EstL5 on 12% SDSPAGE. Lane M, molecular weight marker; lane 1, total protein of induced bacteria; lane 2, supernatant of induced bacteria lysate; and lane 3, purified recombinant EstL5.
acetate (C2) butyrate (C4) valerate (C5) caprylate (C8) caprate (C10) laurate (C12) myristate (C14) palmitate (C16)
RAa %
Specific activity (U/mg)
24.7 100 25.3 8.4 NDb ND ND ND
8.2 33.2 8.4 2.8 ND ND ND ND
a RA, Relative activity; the activity unit U is expressed as mmol/min with pNP butyrate as the substrate. b ND, not detectable.
136
YANG ET AL.
J. BIOSCI. BIOENG.,
FIG. 3. Physicochemical properties of EstL5. (A) Temperature profile of recombinant EstL5. The substrate mixture, containing 1 mM p-nitrophenyl butyrate, was prewarmed prior to the addition of enzyme. (B) The effect of pH on the enzyme activity of recombinant EstL5. The substrate mixture, containing different buffer, was prewarmed prior to the addition of enzyme. (C) The effect of temperature on the stability of recombinant EstL5. The thermostability of recombinant EstL5 was determined by preincubating the enzyme in pH 8.0 buffer at different temperatures 55 C, 60 C, 65 C, 70 C, 75 C and 80 C during various time intervals of up to 12 h. (D) The effect of pH value on the stability of recombinant EstL5. The pH stability of the enzyme was determined by preincubating the esterase in various buffers (100 mM) for 1 h at 30 C before standard assays. All these data were obtained from three independent experiments and corrected for autohydrolysis of the substrate. TABLE 3. The effects of various compounds on enzyme activity. Compounds CHAPS Tween-80 Triton X-100 SDS Methanol Ethanol Acetone 2-Propanol Isooctane EDTA DTT PMSF b-Mercaptoethanol Urea DMSO DMSO Pyridine Acetonitrile
Concentration
RAa %
10% (w/v) 10% (v/v) 10% (v/v) 10% (w/v) 99% (v/v) 99% (v/v) 99% (v/v) 99% (v/v) 99% (v/v) 10% (w/v) 10 mM 0.1 mM 10 mM 100 mM 50% (v/v) 99% (v/v) 99% (v/v) 99% (v/v)
125.55 41.85 53.35 3.08 92.68 26.53 96.94 36.12 34.37 99.2 103.2 18.5 98.7 91.1 87.7 48.7 121.1 98.2
a RA, Relative activity; the activity unit U is expressed as mmol/min with pNP butyrate as the substrate.
(14) showed maximum activity toward pNP caproate (C6). The thermophilic esterase from S. solfataricus (13) and P. torridus (11) also exhibited maximum activity toward pNP caprylate (C8) and pNP acetate (C2), respectively. Unlike EstA from Pseudoalteromonas sp. (24), we found no significant differences in the enzymic properties between recombined EstL5 and EstL5 without 6His-tag. However, the physiological function of EstL5 is not known, as is the case for most described esterases. The protein structure of thermostable enzymes is the key to understanding their thermostability. Stability and lack of flexibility lead to the inability of thermostable enzymes to function at low temperatures. For example, FNE, another thermostable SGNH esterase, exhibited only about 25% esterase activity at 30 C (16) and the esterase from A. fulgidus (12) exhibited only 20% of its highest activity at 30 C. Unlike these thermostable esterases, EstL5 retained 52% and 24% of full activity at 30 C and 0 C, respectively, which is rare among thermostable esterases. EstL5 possesses moderate thermostability and is active in a relatively wide range of temperatures. EstL5 consists of 17.1% acidic residues and 15.0% basic
FIG. 4. Structural analysis of EstL5. (A) Ribbon diagram shows the overall structure of the EstL5 model. The N- and C-terminus are labeled as N and C, respectively. (B) Ribbon diagrams of the superimposed polypeptide backbones of EstL5 (yellow) and E. coli thioesterase I (PDB ID 1IVN, pink). The proposed active-site residues Ser41, Asp213, and His216 of EstL5 are shown in stick representations. Carbon, nitrogen, and oxygen atoms are colored green, blue, and red, respectively. The catalytic trial residues (Ser10, Asp154, and His157) of E. coli thioesterase I are shown in stick representation and is colored pink. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
VOL. 115, 2013
BIOCHEMICAL CHARACTERIZATION OF NOVEL GDSL ESTERASE
residues while FNE consists of 14.2% acidic residues and 19.2% basic residues. The more acidic residues improved solvent interaction through additional surface charges giving rise to a more flexible enzyme (25,26). Moreover, the model of EstL5 revealed that all active-site residues involved in the reaction mechanisms are strictly conserved between homologous enzymes adapted to different temperatures. Thus, the molecular changes responsible for thermostability and cold adaptation of EstL5 have to be found elsewhere in the protein. The analysis of the 3D model structures of EstL5 can be found that a better accessibility of the active site to the substrate. This larger opening of the catalytic cleft has been demonstrated from the model structure of Antarctic fish elastase, and from the structures of cold-active citrate synthase (27). It is believed that the better accessibility certainly will lead to reduce the energy required for substrate accommodation and/or reaction product release in the case of macromolecular substrates (28). But up to now, there was little information from the counterparts of EstL5 for us to analyze the other features of cold-adapted enzyme, such as fewer intra or intersubunit salt-bridges, reduction in aromaticearomatic interactions, extended surface loops, lower hydrophobicity and weaker calcium-binding (29). EstL5 possesses moderate thermostability and is active in a relatively wide range of temperatures. The stability and flexibility of EstL5 suggest that this enzyme could potentially have industrial applications and scientific research value. ACKNOWLEDGMENTS This work is supported by the National Basic Research Program of China (973 Program, 2009CB825505 and 2007CB914304). References 1. Jaeger, K. E., Dijkstra, B. W., and Reetz, M. T.: Bacterial biocatalysts: molecular biology, three-dimensional structures, and biotechnological applications of lipases, Annu. Rev. Microbiol., 53, 315e351 (1999). 2. Panda, T. and Gowrishankar, B. S.: Production and applications of esterases, Appl. Microbiol. Biotechnol., 67, 160e169 (2005). 3. Upton, C. and Buckley, J. T.: A new family of lipolytic enzymes? Trends Biochem. Sci., 20, 178e179 (1995). 4. Dalrymple, B. P., Cybinski, D. H., Layton, I., McSweeney, C. S., Xue, G. P., Swadling, Y. J., and Lowry, J. B.: Three Neocallimastix patriciarum esterases associated with the degradation of complex polysaccharides are members of a new family of hydrolases, Microbiology, 143(Pt 8), 2605e2614 (1997). 5. Li, J., Derewenda, U., Dauter, Z., Smith, S., and Derewenda, Z. S.: Crystal structure of the Escherichia coli thioesterase II, a homolog of the human Nef binding enzyme, Nat. Struct. Biol., 7, 555e559 (2000). 6. Molgaard, A., Kauppinen, S., and Larsen, S.: Rhamnogalacturonan acetylesterase elucidates the structure and function of a new family of hydrolases, Structure, 8, 373e383 (2000). 7. Lo, Y. C., Lin, S. C., Shaw, J. F., and Liaw, Y. C.: Crystal structure of Escherichia coli thioesterase I/protease I/lysophospholipase L1: consensus sequence blocks constitute the catalytic center of SGNH-hydrolases through a conserved hydrogen bond network, J. Mol. Biol., 330, 539e551 (2003). 8. Koshland, D. E.: Application of a theory of enzyme specificity to protein synthesis, Proc. Natl. Acad. Sci. USA, 44, 98e104 (1958). 9. Akoh, C. C., Lee, G. C., Liaw, Y. C., Huang, T. H., and Shaw, J. F.: GDSL family of serine esterases/lipases, Prog. Lipid Res., 43, 534e552 (2004).
137
10. Park, Y. J., Choi, S. Y., and Lee, H. B.: A carboxylesterase from the thermoacidophilic archaeon Sulfolobus solfataricus P1; purification, characterization, and expression, Biochim. Biophys. Acta, 1760, 820e828 (2006). 11. Hess, M., Katzer, M., and Antranikian, G.: Extremely thermostable esterases from the thermoacidophilic euryarchaeon Picrophilus torridus, Extremophiles, 12, 351e364 (2008). 12. Manco, G., Giosue, E., D’Auria, S., Herman, P., Carrea, G., and Rossi, M.: Cloning, overexpression, and properties of a new thermophilic and thermostable esterase with sequence similarity to hormone-sensitive lipase subfamily from the archaeon Archaeoglobus fulgidus, Arch. Biochem. Biophys., 373, 182e192 (2000). 13. Morana, A., Di Prizito, N., Aurilia, V., Rossi, M., and Cannio, R.: A carboxylesterase from the hyperthermophilic archaeon Sulfolobus solfataricus: cloning of the gene, characterization of the protein, Gene, 283, 107e115 (2002). 14. Hotta, Y., Ezaki, S., Atomi, H., and Imanaka, T.: Extremely stable and versatile carboxylesterase from a hyperthermophilic archaeon, Appl. Environ. Microbiol., 68, 3925e3931 (2002). 15. Mandrich, L., Menchise, V., Alterio, V., De Simone, G., Pedone, C., Rossi, M., and Manco, G.: Functional and structural features of the oxyanion hole in a thermophilic esterase from Alicyclobacillus acidocaldarius, Proteins, 71, 1721e1731 (2008). 16. Yu, S., Zheng, B., Zhao, X., and Feng, Y.: Gene cloning and characterization of a novel thermophilic esterase from Fervidobacterium nodosum Rt17-B1, Acta Biochim. Biophys. Sin. (Shanghai), 42, 288e295 (2010). 17. McMullan, G., Christie, J. M., Rahman, T. J., Banat, I. M., Ternan, N. G., and Marchant, R.: Habitat, applications and genomics of the aerobic, thermophilic genus Geobacillus, Biochem. Soc. Trans., 32, 214e217 (2004). 18. Kim, H. J. and Oh, D. K.: Purification and characterization of an L-arabinose isomerase from an isolated strain of Geobacillus thermodenitrificans producing D-tagatose, J. Biotechnol., 120, 162e173 (2005). 19. Zhang, Y., Ji, C., Zhang, X., Yang, Z., Peng, J., Qiu, R., Xie, Y., and Mao, Y.: A moderately thermostable alkaline phosphatase from Geobacillus thermodenitrificans T2: cloning, expression and biochemical characterization, Appl. Biochem. Biotechnol., 151, 81e92 (2008). 20. Li, H. and Zhang, X.: Characterization of thermostable lipase from thermophilic Geobacillus sp. TW1, Protein Expr. Purif., 42, 153e159 (2005). 21. Ezeji, T. C. and Bahl, H.: Purification, characterization, and synergistic action of phytate-resistant alpha-amylase and alpha-glucosidase from Geobacillus thermodenitrificans HRO10, J. Biotechnol., 125, 27e38 (2006). 22. Kelley, L. A. and Sternberg, M. J.: Protein structure prediction on the Web: a case study using the Phyre server, Nat. Protoc., 4, 363e371 (2009). 23. Arpigny, J. L. and Jaeger, K. E.: Bacterial lipolytic enzymes: classification and properties, Biochem. J., 343(Pt 1), 177e183 (1999). 24. Dlugolecka, A., Cieslinski, H., Bruzdziak, P., Gottfried, K., Turkiewicz, M., and Kur, J.: Purification and biochemical characteristic of a cold-active recombinant esterase from Pseudoalteromonas sp. 643A under denaturing conditions, Pol. J. Microbiol., 58, 211e218 (2009). 25. Feller, G., Zekhnini, Z., Lamotte-Brasseur, J., and Gerday, C.: Enzymes from cold-adapted microorganisms. The class C beta-lactamase from the antarctic psychrophile Psychrobacter immobilis A5, Eur. J. Biochem., 244, 186e191 (1997). 26. Russell, R. J., Gerike, U., Danson, M. J., Hough, D. W., and Taylor, G. L.: Structural adaptations of the cold-active citrate synthase from an Antarctic bacterium, Structure, 6, 351e361 (1998). 27. D’Amico, S., Claverie, P., Collins, T., Georlette, D., Gratia, E., Hoyoux, A., Meuwis, M. A., Feller, G., and Gerday, C.: Molecular basis of cold adaptation, Philos. Trans. R. Soc. Lond. B Biol. Sci., 357, 917e925 (2002). 28. Merz, A., Yee, M. C., Szadkowski, H., Pappenberger, G., Crameri, A., Stemmer, W. P., Yanofsky, C., and Kirschner, K.: Improving the catalytic activity of a thermophilic enzyme at low temperatures, Biochemistry, 39, 880e889 (2000). 29. Arnorsdottir, J., Smaradottir, R. B., Magnusson, O. T., Thorbjarnardottir, S. H., Eggertsson, G., and Kristjansson, M. M.: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species, Eur. J. Biochem., 269, 5536e5546 (2002).
Cloning, expression and biochemical characterization of a novel, moderately thermostable GDSL family esterase from Geobacillus thermodenitrificans T2 Zhenxing Yang, Yong Zhang, Tiantian Shen, Yi Xie, Yumin Mao, and Chaoneng Ji* State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433, People’s Republic of China Received 17 November 2011; accepted 24 August 2012 Available online 23 September 2012
A thermostable GDSL family esterase-encoding gene, EstL5, was directly obtained from the genomic DNA of Geobacillus thermodenitrificans T2. Recombinant hexahistidine-tagged EstL5 was overexpressed, purified, and its biochemical properties were partially characterized. EstL5 was observed to be active within the temperature range of 0e80 C, having maximal activity at 60 C. Unlike most other thermostable enzymes, EstL5 displayed 24% of its highest activity at 0 C. EstL5 exhibited a high level of activity within a pH range of 6.0e11.0, showing the highest activity at pH 8.0. EstL5 also retained 100% of its activity after a 12-h incubation at 55 C. Furthermore, this enzyme was observed to be strongly inhibited by 10% (w/v) SDS and 0.1 mM PMSF. Ó 2012, The Society for Biotechnology, Japan. All rights reserved. [Key words: Thermostable esterase; GDSL family; Cloning; Characterization; Geobacillus]
Esterases play important physiological and biotechnological roles in the synthesis or hydrolysis of ester-containing compounds. Esterases hydrolyze partially soluble fatty-acid esters with acyl chain lengths of less than 10 C atoms, whereas lipases display maximal activity toward water-insoluble long-chain triglycerides (1). Esterases have been used in food processing, beverages, perfume industries, chemical industries, agriculture and pharmaceutical industries for many years (2). Many esterases share the pentapeptide G S G motif, with serine located in the active site, but not all lipolytic enzymes have this motif. The GDSL motif has been identified as a new subfamily of hydrolytic/lipolytic enzymes with the active-site serine located near the N-terminus (3). Furthermore, a subgroup of this GDSL family was classified as the SGNH hydrolase family, with four conserved residues Ser, Gly, Asn and His in four conserved blocks I, II, III and V (4e6). Some GDSL family esterases are multifunctional. For example, Escherichia coli thioesterase I (TAP), containing the SGNH motif, possesses thioesterase, esterase, arylesterase, protease, and lysophospholipase activities (7). A flexible active-site environment for the SGNH family esterase may cause the weak substrate specificity observed. Previous studies revealed that conformational changes due to substrate binding were a unique feature of multifunctional SGNH esterases (8,9). In recent years, scientific and industrial uses of esterases from thermophiles have increased due to the functional and structural
stability of these proteins and their phylogenetic importance (10). Some thermostable esterases from Picrophilus torridus (11), Archaeoglobus fulgidus (12), Sulfolobus solfataricus (13), Pyrobaculum calidifontis (14), Alicyclobacillus acidocaldarius (15) and Fervidobacterium nodosum (16) have been characterized. However, these enzymes cannot satisfy all industrial demands, which require special properties, stimulating the discovery and characterization of novel esterases from thermophiles. Geobacillus is a genus of moderately thermophilic bacilli. Because of the significance of their structural and functional stability in extreme environments, these bacteria have been regarded as an important source of thermostable enzymes and have attracted industrial interest (17). To date, several thermostable enzymes such as thermostable L-arabinose isomerase (18), alkaline phosphatase (19), lipase (20), a-amylase and a-glucosidase (21) from Geobacillus spp. have been characterized. In this study, a novel esterase, EstL5, from Geobacillus thermodenitrificans T2 was cloned, purified and characterized. Sequence analysis revealed that this enzyme is a novel member of SGNH hydrolase family, exhibiting special catalytic properties, such as moderate thermostability and activity at low temperatures.
* Corresponding author. Room 109, 2nd Biology Building, Fudan University, Shanghai 200433, People’s Republic of China. Tel.: þ86 21 65648488; fax: þ86 21 65642502. E-mail address: [email protected] (C. Ji).
Sequence analysis of EstL5 The genomic library for sequencing of G. thermodenitrificans T2 was constructed by our lab (data of genome sequence is unpublished). Homology searches were performed using the BLAST program at the NCBI web server (http://www.ncbi.nlm.nih.gov/BLAST), and a novel putative
MATERIALS AND METHODS Oligonucleotides synthesis and DNA sequencing were performed by Sangon Corporation (Shanghai, China). Enzymes used in vector construction were purchased from New England Biolabs (Beverly, MA, USA). All the chemicals were purchased from Sigma (SigmaeAldrich, St. Louis, MO, USA) unless otherwise specified.
1389-1723/$ e see front matter Ó 2012, The Society for Biotechnology, Japan. All rights reserved. http://dx.doi.org/10.1016/j.jbiosc.2012.08.016
134
YANG ET AL.
esterase, EstL5, was identified. Multiple sequences alignments were performed by the GeneDoc programmer (http://www.psc.edu/biomed/genedoc). Cloning, expression, and purification of EstL5 Based on the sequencing results, the following two polymerase chain reaction (PCR) primers were designed 0 to amplify the EstL5 gene: forward primer (F), 5 -CTAGCTAGCTTAGTGGTGCAA GACCAGCTG-30 ; and reverse primer (R), 50 -CCGCTCGAGTCACTGGCGATCCTCCTCC-30 . The full-length coding sequence of EstL5 was amplified using the Pfu DNA polymerase with the F and R primers. The amplified fragments with the expected size were gel-purified and cloned into the Nhe I and Xho I sites of pET28b (Novagen, Merck KGaA, Darmstadt, Germany). The fidelity of inserting the fragment into pET vectors was confirmed by sequencing. E. coli BL21(DE3) harboring the constructed expression plasmids were grown in 1 L of Luria-Bertani (LB) medium containing kanamycin (100 mg L1) until an OD600 of 0.6e0.8 was reached. After induction with 0.5 mM IPTG for 10 h at 30 C, the cells were harvested by centrifugation. The cell pellet was resuspended in a standard buffer (40 mM Na2HPO4, 10 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) and disrupted by pressure (JN3000 Plus, JNBIO, Guangzhou, China) at 4 C. After incubation for 30 min at 55 C and centrifugation at 27,000 g for 30 min at 4 C, the supernatant of the lysate was passed through a pre-equilibrated Ni-NTA Superflow column (Qiagen, Hilden, Germany). After washing the column with standard buffer containing 10 mM imidazole and 50 mM imidazole to remove other proteins, the hexahistidine-tagged EstL5 was eluted with buffer containing 40 mM Na2HPO4, 10 mM NaH2PO4, 300 mM NaCl and 250 mM imidazole (pH 8.0). The phosphate buffer was subsequently replaced with 10 mM TriseHCl buffer (pH 8.0) and 100 mM NaCl by ultrafiltration (Amicon Ultra-15 column; Millipore, Billerica, MA, USA). The purity and concentration of the protein samples were analyzed by SDS-PAGE and Bradford assays (Pierce Co., Rockford, IL, USA), respectively. Mutagenesis Mutants Ser41Ala, Asp213Ala and His216Ala were generated by whole-plasmid PCR in 20-cycle reaction with steps at 95 C for 60 s, 55 C for 60 s, and 72 C for 9 min per cycle. The primers include: 50 -GGCGACGCGCTGACGCGGG GAACGGGCGATGA-30 and 50 -CGCGTCAGCGCGTCGCCTAAGGCGACAATGTC-30 ; 50 -GTA and 50 -CGGATGGAAATGC TAGCGCGCATTTCCATCCGAATAAGGAAGGGTACAAGC-30 GCGCTATACAAATAGTCGTTGACATGCAA -30 ; 50 -GTATAGCGATCATTTCGCGCCGAATAAGG AAGGGTACAAGC-30 and 50 -CGGCGCGAAATGATCGCTATACAAATAGTCGTTGACATGCAA-30 , respectively (modified codons underlined). After digestion with DpnI, the PCR product was transformed into E. coli BL21(DE3) for esterase gene expression. Enzyme assays The substrate specificity was determined using the following pNP (p-nitrophenly) esters: pNP acetate (pNP C2), pNP butyrate (pNP C4), pNP valerate (pNP C5), pNP caprylate (pNP C8), pNP decanoate (pNP C10), pNP laurate (pNP C12), pNP myristate (pNP C14) and pNP palmitate (pNP C16). The standard activity assay was carried out in 1 ml reaction mixture containing 25 mM Tris-HCl buffer (pH 8.0), 1 mM substrates and 0.3 mg enzyme at 60 C. After pre-incubation of substrate solutions at 60 C for 10 min, the reaction was initiated by the addition of the purified enzyme and the released p-nitrophenol was continuously monitored at 410 nm using a V-550 spectrophotometer (JASCO, Tokyo, Japan) with ECT-505s temperature conductor (JASCO). Measurements were corrected for nonspecific substrate hydrolysis in absence of the enzyme. The activity was determined by measuring the initial rate of hydrolysis of pNP ester. One unit of activity is defined as the amount of enzyme that releases 1 mmol of p-nitrophenol per minute. The molar extinction coefficient of p-nitrophenol is 15,000 M1 cm1 at 410 nm. Kinetic parameters were determined from data obtained by determining the initial rate of pNP butyrate hydrolysis.
J. BIOSCI. BIOENG., The effects of pH and temperature on esterase activity To determine the optimum pH, esterase activity was determined by measuring the amount of pnitrophenol formed from the pNP ester substrate within a pH range of 4.0e12.0 using various buffers (25 mM). All activity assays were performed at 60 C and terminated by the addition of an equal volume of 0.5 M NaOH. To determine the pH stability of the enzyme, the esterase was incubated for 1 h at 30 C in the following buffers (25 mM): acetic acid/sodium acetate (pH 4.0e5.5), potassium phosphate (pH 5.0e8.0), TriseHCl (pH 7.5e9.0) and glycine/NaCl/ NaOH (pH 9.0e13.0) without substrate. All of these activity assays were performed at 60 C. The optimum temperature was measured in assays incubated at temperatures ranging from 0 C to 80 C at pH 8.0 in 25 mM TriseHCl with 1 mM pNP butyrate as the substrate. Enzyme thermostability was also investigated by incubating the assays for various time intervals at different temperatures ranging from 0 to 80 C at pH 8.0. The effects of various compounds on esterase activity Various compounds (inhibitors, organic solvents and surfactants) were added to an enzyme solution (1 mg/ml) and incubated for 30 min at 30 C. Residual esterase activity was examined using a spectrophotometric assay with pNP butyrate as the substrate. Structural modeling Since there are no close structural homologs of EstL5, modeling was based on threading using the 3D-structural threading program Phyre2 (22). Several structural fits were found. The model was assessed using the PyMOL (www.pymol.org).
RESULTS Sequence analysis of EstL5 In the genome sequence of G. thermodenitrificans T2, a gene coding for a putative bacterial esterase, EstL5, composed of 241 amino acid residues was identified through a bioinformatic screening. These sequence data have been submitted to the GenBank databases under accession nos. EU623977 and ACD02023.1. A multiple amino acid sequence alignment of the conserved blocks was performed using the EstL5 sequence and a selection of SGNH family esterases (Fig. 1). The critical residues for enzyme activity, assigned by comparison with other SGNH proteins, include the oxyanion hole residues (Ser41, Gly79, and Asn111) and the catalytic triad (Ser41, Asp213, and His216), which appear in similar positions to those in other carboxylester hydrolases in this family (7,9). Therefore, EstL5 can be classified as a novel member of SGNH family hydrolases. Expression and purification of recombinant EstL5 The sequence encoding EstL5 was amplified by PCR and cloned into pET28b vector. Bacteria were transformed with the expression vector EstL5-pET28b and induced with IPTG to express the recombinant protein. The cytosolic fraction was collected and used to purify the recombinant protein. Recombinant EstL5 was completely eluted from the column with 250 mM imidazole (Fig. 2,
FIG. 1. Sequence alignment of EstL5 with the members of SGNH hydrolase family. These esterases include: Listeria innocua Clip11262 (accession no. NP_470091), lipase/acylhydrolase from Bacillus cereus (accession no. NP_981822), GDSL family lipolytic protein from Paenibacillus dendritiformis (accession no. ZP_09675168), acyl-CoA thioesterase from Clostridium acetobutylicum (accession no. NP_981822), RGAE, Rhamnogalacturonan acetylesterase (Swiss-Prot: Q00017.1). The four conserved sequence blocks found in all SGNH hydrolases are boxed and the consensus Ser, Gly, Asn and His residues (SGNH) are annotated with filled circles.
VOL. 115, 2013
BIOCHEMICAL CHARACTERIZATION OF NOVEL GDSL ESTERASE
lane 3). Approximately 36.7 mg of recombinant enzyme was obtained from a 1-L bacterial culture (Table 1). Substrate specificity The substrate specificity of EstL5 was determined at 60 C using pNP esters with acyl chains of different lengths (C2-C16) as substrates (Table 2). EstL5 only displayed hydrolase activity toward short-length acyl chain substrates. The specific activity of EstL5 toward pNP butyrate (C4) was approximately 4-fold higher than with pNP acetate (C2). However, no significant esterase activity was observed for substrates with chain lengths longer than C10. The catalytic activity of EstL5 with substrates that have short-chain acyl groups is characteristic of esterases. Physicochemical properties Purified recombinant EstL5 exhibited maximum activity at a temperature of 60 C at pH 8.0. The kinetic analysis shows that the Michaelis-Menten constant (Km) and the maximum velocity for the reaction (Vmax) are 1.007 mM and 8.05 107 M/s, respectively, under the reaction conditions described above. The catalytic efficiency (kcat/Km) of the enzyme for pNP butyrate was determined to be 79.94 mM1s1. Unlike most thermophilic enzymes, EstL5 retained 52% activity when the reaction was performed at 30 C and 24% esterase activity at 0 C (Fig. 3A). EstL5 displayed high activity at alkaline pH, with over 50% of its maximal activity occurring within the pH range of 7e9.5 (Fig. 3B). EstL5 can retain 100% of the esterase activity after incubation for 12 h at the temperature range from 0 C to 55 C. However, after incubation for 12 h at 60 C, only 55% of the esterase activity remained. EstL5 can be completely inactivated after incubating the enzyme for 40 min at 75 C or for 20 min at 80 C (Fig. 3C). EstL5 also exhibited high stability in buffers at various pH values. The enzyme retained over 50% of its activity after incubation in buffers within a pH range of 4e12 for 1 h (Fig. 3D). Effects of different reagents The effects of various compounds on EstL5 enzyme activity are shown in Table 3. CHAPS (3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonic
135
TABLE 1. Purification of recombinant EstL5 from E. coli cells.
Lysate supernatant Ni-chelation
Total protein (mg)a
Total activity (U)b
Specific activity (U/mg)
Yield (%)
Purification fold
1408.7 36.7
1730.7 1218.4
1.2 33.2
100 70.4
1 27.7
a The amount of total protein was determined by the Bradford assay (Pierce) using BSA as a standard. b The activity unit U is expressed as mmol/min with pNP butyrate as the substrate.
acid) and pyridine were observed to have a slight activating effect on EstL5. A significant decrease in enzyme activity was observed after incubation with Tween-80, Triton X-100, SDS, ethanol, 2-propanol, isooctane, PMSF or 99% DMSO. Structural modeling In order to obtain structural insights into EstL5, 3D-structural model has been build. Since there are no close structure homologs of EstL5, modeling was based on threading using the 3D-structural threading program Phyre2 (22). Unlike homology modeling, a certain sequence similarity between the query sequence and a template protein is not necessary. The 20 best structural alignments were provided by the server. The model of EstL5 showed a large domain with an a/b-hydrolase fold (Fig. 4A). The a/b-hydrolase fold consists of a five-central b-sheet and eight a-helixes. Sequence alignment indicated the residues Ser41, Asp213 and His216 as the probable catalytic triad. Comparing with E. coli thioesterase I, in the model of EstL5, Ser41, Asp213 and His216 were indeed located in close proximity, most likely representing the actual active site. To confirm the predictions of the catalytic triad, amino acid residues of the catalytic triad were substituted by site directed mutagenesis. Mutants Ser41Ala, Asp213Ala and His216Ala were generated by whole-plasmid PCR. None of the mutants had relative activity over 5%, which confirming the importance of these three residues for the activity of EstL5. DISCUSSION Several GDSL family members were identified and a subgroup of this family was further classified as SGNH hydrolases. Though current knowledge about the GDSL family is limited, GDSL hydrolases are commonly used for multiple functions in food, flavors, fragrances, cosmetics, textiles, and in the pharmaceutical and detergent industries (2,9). After sequence analysis, EstL5 was annotated as a putative SGNH hydrolase, a class II lipolytic enzyme in the GDSL family (23). Esterase activity assays demonstrated that EstL5 functions as an esterase with short-chain ester substrates. EstL5 displayed the highest activity toward pNP butyrate (C4). Furthermore, the substrate specificity of the enzyme was observed to differ from most thermophilic esterases. For example, the optimal substrate for FNE, an SGNH thermophilic esterase, is pNP acetate (C2) (16). Also, the thermophilic esterase from A. fulgidus (12) and P. calidifontis TABLE 2. Esterase activity toward p-nitrophenyl esters. Substrate p-nitrophenyl p-nitrophenyl p-nitrophenyl p-nitrophenyl p-nitrophenyl p-nitrophenyl p-nitrophenyl p-nitrophenyl
FIG. 2. Analysis of the expression and purification of recombinant EstL5 on 12% SDSPAGE. Lane M, molecular weight marker; lane 1, total protein of induced bacteria; lane 2, supernatant of induced bacteria lysate; and lane 3, purified recombinant EstL5.
acetate (C2) butyrate (C4) valerate (C5) caprylate (C8) caprate (C10) laurate (C12) myristate (C14) palmitate (C16)
RAa %
Specific activity (U/mg)
24.7 100 25.3 8.4 NDb ND ND ND
8.2 33.2 8.4 2.8 ND ND ND ND
a RA, Relative activity; the activity unit U is expressed as mmol/min with pNP butyrate as the substrate. b ND, not detectable.
136
YANG ET AL.
J. BIOSCI. BIOENG.,
FIG. 3. Physicochemical properties of EstL5. (A) Temperature profile of recombinant EstL5. The substrate mixture, containing 1 mM p-nitrophenyl butyrate, was prewarmed prior to the addition of enzyme. (B) The effect of pH on the enzyme activity of recombinant EstL5. The substrate mixture, containing different buffer, was prewarmed prior to the addition of enzyme. (C) The effect of temperature on the stability of recombinant EstL5. The thermostability of recombinant EstL5 was determined by preincubating the enzyme in pH 8.0 buffer at different temperatures 55 C, 60 C, 65 C, 70 C, 75 C and 80 C during various time intervals of up to 12 h. (D) The effect of pH value on the stability of recombinant EstL5. The pH stability of the enzyme was determined by preincubating the esterase in various buffers (100 mM) for 1 h at 30 C before standard assays. All these data were obtained from three independent experiments and corrected for autohydrolysis of the substrate. TABLE 3. The effects of various compounds on enzyme activity. Compounds CHAPS Tween-80 Triton X-100 SDS Methanol Ethanol Acetone 2-Propanol Isooctane EDTA DTT PMSF b-Mercaptoethanol Urea DMSO DMSO Pyridine Acetonitrile
Concentration
RAa %
10% (w/v) 10% (v/v) 10% (v/v) 10% (w/v) 99% (v/v) 99% (v/v) 99% (v/v) 99% (v/v) 99% (v/v) 10% (w/v) 10 mM 0.1 mM 10 mM 100 mM 50% (v/v) 99% (v/v) 99% (v/v) 99% (v/v)
125.55 41.85 53.35 3.08 92.68 26.53 96.94 36.12 34.37 99.2 103.2 18.5 98.7 91.1 87.7 48.7 121.1 98.2
a RA, Relative activity; the activity unit U is expressed as mmol/min with pNP butyrate as the substrate.
(14) showed maximum activity toward pNP caproate (C6). The thermophilic esterase from S. solfataricus (13) and P. torridus (11) also exhibited maximum activity toward pNP caprylate (C8) and pNP acetate (C2), respectively. Unlike EstA from Pseudoalteromonas sp. (24), we found no significant differences in the enzymic properties between recombined EstL5 and EstL5 without 6His-tag. However, the physiological function of EstL5 is not known, as is the case for most described esterases. The protein structure of thermostable enzymes is the key to understanding their thermostability. Stability and lack of flexibility lead to the inability of thermostable enzymes to function at low temperatures. For example, FNE, another thermostable SGNH esterase, exhibited only about 25% esterase activity at 30 C (16) and the esterase from A. fulgidus (12) exhibited only 20% of its highest activity at 30 C. Unlike these thermostable esterases, EstL5 retained 52% and 24% of full activity at 30 C and 0 C, respectively, which is rare among thermostable esterases. EstL5 possesses moderate thermostability and is active in a relatively wide range of temperatures. EstL5 consists of 17.1% acidic residues and 15.0% basic
FIG. 4. Structural analysis of EstL5. (A) Ribbon diagram shows the overall structure of the EstL5 model. The N- and C-terminus are labeled as N and C, respectively. (B) Ribbon diagrams of the superimposed polypeptide backbones of EstL5 (yellow) and E. coli thioesterase I (PDB ID 1IVN, pink). The proposed active-site residues Ser41, Asp213, and His216 of EstL5 are shown in stick representations. Carbon, nitrogen, and oxygen atoms are colored green, blue, and red, respectively. The catalytic trial residues (Ser10, Asp154, and His157) of E. coli thioesterase I are shown in stick representation and is colored pink. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
VOL. 115, 2013
BIOCHEMICAL CHARACTERIZATION OF NOVEL GDSL ESTERASE
residues while FNE consists of 14.2% acidic residues and 19.2% basic residues. The more acidic residues improved solvent interaction through additional surface charges giving rise to a more flexible enzyme (25,26). Moreover, the model of EstL5 revealed that all active-site residues involved in the reaction mechanisms are strictly conserved between homologous enzymes adapted to different temperatures. Thus, the molecular changes responsible for thermostability and cold adaptation of EstL5 have to be found elsewhere in the protein. The analysis of the 3D model structures of EstL5 can be found that a better accessibility of the active site to the substrate. This larger opening of the catalytic cleft has been demonstrated from the model structure of Antarctic fish elastase, and from the structures of cold-active citrate synthase (27). It is believed that the better accessibility certainly will lead to reduce the energy required for substrate accommodation and/or reaction product release in the case of macromolecular substrates (28). But up to now, there was little information from the counterparts of EstL5 for us to analyze the other features of cold-adapted enzyme, such as fewer intra or intersubunit salt-bridges, reduction in aromaticearomatic interactions, extended surface loops, lower hydrophobicity and weaker calcium-binding (29). EstL5 possesses moderate thermostability and is active in a relatively wide range of temperatures. The stability and flexibility of EstL5 suggest that this enzyme could potentially have industrial applications and scientific research value. ACKNOWLEDGMENTS This work is supported by the National Basic Research Program of China (973 Program, 2009CB825505 and 2007CB914304). References 1. Jaeger, K. E., Dijkstra, B. W., and Reetz, M. T.: Bacterial biocatalysts: molecular biology, three-dimensional structures, and biotechnological applications of lipases, Annu. Rev. Microbiol., 53, 315e351 (1999). 2. Panda, T. and Gowrishankar, B. S.: Production and applications of esterases, Appl. Microbiol. Biotechnol., 67, 160e169 (2005). 3. Upton, C. and Buckley, J. T.: A new family of lipolytic enzymes? Trends Biochem. Sci., 20, 178e179 (1995). 4. Dalrymple, B. P., Cybinski, D. H., Layton, I., McSweeney, C. S., Xue, G. P., Swadling, Y. J., and Lowry, J. B.: Three Neocallimastix patriciarum esterases associated with the degradation of complex polysaccharides are members of a new family of hydrolases, Microbiology, 143(Pt 8), 2605e2614 (1997). 5. Li, J., Derewenda, U., Dauter, Z., Smith, S., and Derewenda, Z. S.: Crystal structure of the Escherichia coli thioesterase II, a homolog of the human Nef binding enzyme, Nat. Struct. Biol., 7, 555e559 (2000). 6. Molgaard, A., Kauppinen, S., and Larsen, S.: Rhamnogalacturonan acetylesterase elucidates the structure and function of a new family of hydrolases, Structure, 8, 373e383 (2000). 7. Lo, Y. C., Lin, S. C., Shaw, J. F., and Liaw, Y. C.: Crystal structure of Escherichia coli thioesterase I/protease I/lysophospholipase L1: consensus sequence blocks constitute the catalytic center of SGNH-hydrolases through a conserved hydrogen bond network, J. Mol. Biol., 330, 539e551 (2003). 8. Koshland, D. E.: Application of a theory of enzyme specificity to protein synthesis, Proc. Natl. Acad. Sci. USA, 44, 98e104 (1958). 9. Akoh, C. C., Lee, G. C., Liaw, Y. C., Huang, T. H., and Shaw, J. F.: GDSL family of serine esterases/lipases, Prog. Lipid Res., 43, 534e552 (2004).
137
10. Park, Y. J., Choi, S. Y., and Lee, H. B.: A carboxylesterase from the thermoacidophilic archaeon Sulfolobus solfataricus P1; purification, characterization, and expression, Biochim. Biophys. Acta, 1760, 820e828 (2006). 11. Hess, M., Katzer, M., and Antranikian, G.: Extremely thermostable esterases from the thermoacidophilic euryarchaeon Picrophilus torridus, Extremophiles, 12, 351e364 (2008). 12. Manco, G., Giosue, E., D’Auria, S., Herman, P., Carrea, G., and Rossi, M.: Cloning, overexpression, and properties of a new thermophilic and thermostable esterase with sequence similarity to hormone-sensitive lipase subfamily from the archaeon Archaeoglobus fulgidus, Arch. Biochem. Biophys., 373, 182e192 (2000). 13. Morana, A., Di Prizito, N., Aurilia, V., Rossi, M., and Cannio, R.: A carboxylesterase from the hyperthermophilic archaeon Sulfolobus solfataricus: cloning of the gene, characterization of the protein, Gene, 283, 107e115 (2002). 14. Hotta, Y., Ezaki, S., Atomi, H., and Imanaka, T.: Extremely stable and versatile carboxylesterase from a hyperthermophilic archaeon, Appl. Environ. Microbiol., 68, 3925e3931 (2002). 15. Mandrich, L., Menchise, V., Alterio, V., De Simone, G., Pedone, C., Rossi, M., and Manco, G.: Functional and structural features of the oxyanion hole in a thermophilic esterase from Alicyclobacillus acidocaldarius, Proteins, 71, 1721e1731 (2008). 16. Yu, S., Zheng, B., Zhao, X., and Feng, Y.: Gene cloning and characterization of a novel thermophilic esterase from Fervidobacterium nodosum Rt17-B1, Acta Biochim. Biophys. Sin. (Shanghai), 42, 288e295 (2010). 17. McMullan, G., Christie, J. M., Rahman, T. J., Banat, I. M., Ternan, N. G., and Marchant, R.: Habitat, applications and genomics of the aerobic, thermophilic genus Geobacillus, Biochem. Soc. Trans., 32, 214e217 (2004). 18. Kim, H. J. and Oh, D. K.: Purification and characterization of an L-arabinose isomerase from an isolated strain of Geobacillus thermodenitrificans producing D-tagatose, J. Biotechnol., 120, 162e173 (2005). 19. Zhang, Y., Ji, C., Zhang, X., Yang, Z., Peng, J., Qiu, R., Xie, Y., and Mao, Y.: A moderately thermostable alkaline phosphatase from Geobacillus thermodenitrificans T2: cloning, expression and biochemical characterization, Appl. Biochem. Biotechnol., 151, 81e92 (2008). 20. Li, H. and Zhang, X.: Characterization of thermostable lipase from thermophilic Geobacillus sp. TW1, Protein Expr. Purif., 42, 153e159 (2005). 21. Ezeji, T. C. and Bahl, H.: Purification, characterization, and synergistic action of phytate-resistant alpha-amylase and alpha-glucosidase from Geobacillus thermodenitrificans HRO10, J. Biotechnol., 125, 27e38 (2006). 22. Kelley, L. A. and Sternberg, M. J.: Protein structure prediction on the Web: a case study using the Phyre server, Nat. Protoc., 4, 363e371 (2009). 23. Arpigny, J. L. and Jaeger, K. E.: Bacterial lipolytic enzymes: classification and properties, Biochem. J., 343(Pt 1), 177e183 (1999). 24. Dlugolecka, A., Cieslinski, H., Bruzdziak, P., Gottfried, K., Turkiewicz, M., and Kur, J.: Purification and biochemical characteristic of a cold-active recombinant esterase from Pseudoalteromonas sp. 643A under denaturing conditions, Pol. J. Microbiol., 58, 211e218 (2009). 25. Feller, G., Zekhnini, Z., Lamotte-Brasseur, J., and Gerday, C.: Enzymes from cold-adapted microorganisms. The class C beta-lactamase from the antarctic psychrophile Psychrobacter immobilis A5, Eur. J. Biochem., 244, 186e191 (1997). 26. Russell, R. J., Gerike, U., Danson, M. J., Hough, D. W., and Taylor, G. L.: Structural adaptations of the cold-active citrate synthase from an Antarctic bacterium, Structure, 6, 351e361 (1998). 27. D’Amico, S., Claverie, P., Collins, T., Georlette, D., Gratia, E., Hoyoux, A., Meuwis, M. A., Feller, G., and Gerday, C.: Molecular basis of cold adaptation, Philos. Trans. R. Soc. Lond. B Biol. Sci., 357, 917e925 (2002). 28. Merz, A., Yee, M. C., Szadkowski, H., Pappenberger, G., Crameri, A., Stemmer, W. P., Yanofsky, C., and Kirschner, K.: Improving the catalytic activity of a thermophilic enzyme at low temperatures, Biochemistry, 39, 880e889 (2000). 29. Arnorsdottir, J., Smaradottir, R. B., Magnusson, O. T., Thorbjarnardottir, S. H., Eggertsson, G., and Kristjansson, M. M.: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species, Eur. J. Biochem., 269, 5536e5546 (2002).