Calnexin functions in antibacterial immunity of Marsupenaeus japonicus

Developmental and Comparative Immunology 46 (2014) 356–363

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Calnexin functions in antibacterial immunity of Marsupenaeus japonicus Qing Zhang a, Xiu-Qing Wang b, Hai-Shan Jiang a, Wen-Ming Jia a, Xiao-Fan Zhao a, Jin-Xing Wang a,⇑ a MOE Key Laboratory of Plant Cell Engineering and Germplasm Innovation/Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, School of Life Sciences, Shandong University, Jinan, Shandong 250100, China b School of Clinical Laboratory of Medicine, Ningxia Medical University, Yinchuan, Ningxia 750004, China

a r t i c l e

i n f o

Article history: Received 22 January 2014 Revised 4 May 2014 Accepted 4 May 2014 Available online 21 May 2014 Keywords: Calnexin Marsupenaeus japonicus Phagocytosis Pattern recognition receptor Innate immunity

a b s t r a c t Calnexin (Cnx) is an endoplasmic reticulum membrane–bound lectin chaperone that comprises a dedicated maturation system with another lectin chaperone calreticulin (Crt). This maturation system is known as the Cnx/Crt cycle. The main functions of Cnx are Ca2+ storage, glycoprotein folding, and quality control of synthesis. Recent studies have shown that Cnx is important in phagocytosis and in optimizing dendritic cell immunity. However, the functions of Cnx in invertebrate innate immunity remain unclear. In this research, we characterized Cnx in the kuruma shrimp Marsupenaeus japonicus (designated as MjCnx) and detected its function in shrimp immunity. The expression of MjCnx was upregulated in several tissues challenged with Vibrio anguillarum. Recombinant MjCnx could bind to bacteria by binding polysaccharides. MjCnx protein existed in the cytoplasm and on the membrane of hemocytes and was upregulated by bacterial challenge. The recombinant MjCnx enhanced the clearance of V. anguillarum in vivo, and the clearance effects were impaired after silencing MjCnx with RNA interference assay. Recombinant MjCnx promoted phagocytosis efficiency of hemocytes. These results suggest that MjCnx functions as one of the pattern recognition receptors and has crucial functions in shrimp antibacterial immunity. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Chaperones comprising a large family of proteins have important functions in various physiological processes, such as cell survival promotion, protein aggregation prevention, stress response, signaling, transcription and differentiation (Frydman, 2001; Young et al., 2004). Recently, attention has turned to the roles of molecular chaperones in modulating immune functions, because they ensure the proper folding of immunological proteins and assist with antigen presentation and activation of immune cells (Wang et al., 2009a). Calnexin (Cnx) and calreticulin (Crt) are the most extensively studied glycoprotein-specific chaperones because of their functions in translocation, protein folding, and the quality control of newly synthesized polypeptides (Williams, 2006). Cnx is a lectin chaperone that is localized to the endoplasmic reticulum (ER) lumen; Cnx has a large lumenal domain, a transmembrane domain (TM), and a short cytosolic tail (Wada et al., 1991). Cnx and another lectin chaperone, Crt, are components of a dedicated maturation system known as Cnx/Crt cycle, which mainly functions in Ca2+ storage, promotion of correct folding, and oligomerization of many glycoproteins in the ER (Ellgaard

⇑ Corresponding author. Tel./fax: +86 531 88364620. E-mail address: [email protected] (J.-X. Wang). http://dx.doi.org/10.1016/j.dci.2014.05.009 0145-305X/Ó 2014 Elsevier Ltd. All rights reserved.

and Frickel, 2003; Rutkevich and Williams, 2010). Previous reports discussed the nonchaperone functions of Cnx and Crt. For example, Cnx and Crt purportedly have important functions in phagocytosis (Muller-Taubenberger et al., 2001). Phagocytosis is a phylogenetically conserved process that is critical not only for the removal of apoptotic bodies and dying tumor cells but also for the disposal of infected pathogens (Greenberg and Grinstein, 2002). Some studies reported that Crt has functions in plant antibacterial immunity (Qiu et al., 2012). Recent studies have revealed that Cnx is involved in apoptotic processes induced by ER stresses (Guerin et al., 2009). Cnx-deficient cells are resistant to apoptosis in mammalian cells (Zuppini et al., 2002). In fission yeast, Cnx overexpression causes apoptosis; Cnx regulates apoptosis induced by inositol starvation (Guerin et al., 2008, 2009). Studies on crustaceans found that Crt prevents apoptosis in crayfish after viral infection with gC1qR (Watthanasurorot et al., 2013) and that Crt may be related to the antiviral response in shrimp (Luana et al., 2007; Wang et al., 2007). Information on the function of Cnx in crustacean immunity is lacking (Wang and Wang, 2013). In this research, we initially identified a Cnx in the kuruma shrimp Marsupenaeus japonicus and analyzed its function in shrimp immunity. Results indicated that MjCnx may be a sensor of infected bacteria and may promote phagocytosis of hemocytes in shrimp. Our report contributes to the knowledge on Cnx function in invertebrate innate immunity.

Q. Zhang et al. / Developmental and Comparative Immunology 46 (2014) 356–363

357

2. Materials and methods

2.4. Sequence analyses

2.1. Biological materials, chemicals, and microorganisms

MjCnx was compared with other Cnx proteins by similarity analysis, which was performed using online BLASTX (http:// www.ncbi.nlm.nih.gov/). The signal peptide and putative domain were forecasted using online SMART program (http://smart.emblheidelberg.de/). GeneDoc software and MEGA 4.0 were used to perform the sequence alignment and to construct a phylogenetic tree, respectively. The phylogenetic tree was developed using the neighbor-joining method (Tamura et al., 2007).

Shrimp weighing approximately 12–15 g each were purchased from a seafood market in Jinan (Shandong, China) and cultured in tanks filled with aerated seawater. Lipopolysaccharide (LPS) from Escherichia coli serotype 055:B5, lipoteichoic acid (LTA) from Staphylococcus aureus, peptidoglycan (PGN) from Micrococcus luteus (designated as PGN (M)), and peptidoglycan (PGN) from S. aureus (designated as PGN (S)) were purchased from Sigma (St. Louis, MO, USA). Bacillus megaterium, Bacillus subtilis, Bacillus thuringiensis, Klebsiella pneumoniae, Pseudomonas aeruginosa, S. aureus, and E. coli were maintained in our laboratory. Vibrio anguillarum was provided by Professor Jianhai Xiang of the Institute of Oceanology, Chinese Academy of Sciences. 2.2. Immune challenge of shrimp, RNA extraction, and cDNA synthesis In immune challenge experiments, we injected V. anguillarum (approximately 3  107 CFU/shrimp) into the abdomen of each shrimp using a previously described method (Wang et al., 2009c). For hemocyte isolation, the hemolymph was obtained with a syringe containing 1 mL of anticoagulant buffer [0.45 M NaCl, 10 mM KCl, 10 mM ethylenediaminetetraacetic acid (EDTA), and 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, pH 7.45] from the ventral sinus of the shrimp. Total RNA from the hemocytes, heart, hepatopancreas, gills, stomach, and intestine of the shrimp were extracted using Unizol (Biostar, Shanghai, China) at 2, 6, 12, and 24 h postinfection. RNA from the tissues of phosphate-buffered saline (PBS; 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4, pH 7.4) challenged shrimp was isolated as control. RNA at 5 lg was used to synthesize firststrand cDNA with the RevertAid First-strand cDNA synthesis kit (Fermentas, Burlington, Canada) using a pair of primers SMART F and oligo anchor R (Table 1). 2.3. Cloning of MjCnx gene A specific primer MjCnx F (Table 1) was designed using a nucleotide sequence obtained by transcriptome sequencing of intestine in our laboratory and pairing with 30 anchor R primer (Table 1) to amplify the 30 end of MjCnx cDNA. Polymerase chain reaction (PCR) was performed as follows: 94 °C for 3 min; 35 cycles of 94 °C for 30 s, 54 °C for 45 s, and 72 °C for 1 min; and 72 °C for 10 min.

Table 1 Sequences of primers used in this research. Primer name

Sequence (50 –30 )

SMART F Oligo anchor R MjCnx F 30 anchor R RT F RT R Actin F Actin R EX F

TACGGCTGCGAGAAGACGACAGAAGGG GACCACGCGTATCGATGTCGACT16 (A/C/G) CTGGAAGTGGGAATGAAGCT GACCACGCGTATCGATGTCGAC TTCAAGGGCAAGTGGCG AACGCCCGCCTGTCC AGTAGCCGCCCTGGTTGTAGAC TTCTCCATGTCGTCCCAGT

EX R

TGAGTACTCGAG (XhoI) GACAACTATATTGTCGAA

TACTCAGAATTC (EcoRI) GCATATCTGATGGAAACA

RNAi F

TAATACGACTCACTATAGGGATAATGTTGCTGAAGCTTAC

RNAi R

TAATACGACTCACTATAGGGCTTTGTGTTGTTCTG GTTG

GFP RNAi F

TAATACGACTCACTATAGGTGGTCCCAATTCTCGTGGAAC

GFP RNAi R

TAATACGACTCACTATAGGCTTGAAGTTGACCTTGATGCC

The EcoRI, XhoI restriction sites and T7 promoters are underlined.

2.5. Semi-quantitative reverse transcription PCR (RT-PCR) and relative quantitative real-time PCR (qRT-PCR) The tissue distribution of MjCnx was determined by RT-PCR using specific primers RT F and RT R (Table 1). Actin F and Actin R (Table 1) were used to amplify b-actin as the internal control. PCR was performed as follows: 94 °C for 3 min; 28 cycles of 94 °C for 30 s, 58 °C for 45 s, and 72 °C for 30 s; and 72 °C for 10 min. qRT-PCR was performed to analyze the expression patterns of MjCnx after V. anguillarum challenge using the same primers used in RT-PCR. The amplification procedure was as follows: 95 °C for 10 min; 39 cycles of 95 °C for 20 s, 62 °C for 1 min, and 75 °C for 2 s; and a subsequent melt from 70 to 95 °C. Each experiment was repeated in triplicate. qRT-PCR data were calculated by 2DDCT (Livak and Schmittgen, 2001). The unpaired Student’s t-test was used to analyze the significant difference, and significant difference at P < 0.05 was accepted. 2.6. Recombinant expression and purification of MjCnx and preparation of antiserum Using the full-length cDNA sequence of MjCnx as basis, we designed a pair of primers EX F and EX R (Table 1) to amplify the fragment encoding for the Crt domain of MjCnx. The amplified fragment and the PGEX-4T-1 vector were digested with EcoRI and XhoI, and then ligated at 16 °C overnight. Subsequently, the recombinant plasmids were transformed into competent E. coli BL21 (DE3) cells. The expression of the recombinant MjCnx (rMjCnx) was induced by isopropyl b-D-1-thiogalactopyranoside. The soluble rMjCnx was purified using glutathione Sepharose 4B (Amersham Biosciences) according to the manufacturer’s instructions and analyzed by 12.5% SDS–PAGE. The glutathione S-transferase (GST) tag was also purified from the competent E. coli BL21 (DE3) cells with parent PGEX-4T-1 vectors as control protein. The purified rMjCnx was used to raise antiserum in New Zealand rabbits following a previously described method using (Shi et al., 2008). 2.7. Western blot V. anguillarum (approximately 3  107 CFU/shrimp) was injected into the abdomen of each shrimp. After 24 h, heart, hepatopancreatic, gills, stomach, and intestine from the challenged shrimp were collected and homogenized in a lysis buffer (150 mM NaCl, 1 mM Phenylmethanesulfonyl fluoride (PMSF), 3 mM EDTA, 50 mM Tris–HCl, pH 7.5) and then centrifuged at 12,000g for 10 min at 4 °C to collect the supernatant. Shrimp hemocytes isolated from the hemolymph were also homogenized. The proteins of hemocytes and other tissues from PBS-challenged and unchallenged shrimp were collected as the controls. Protein concentrations were measured using the Bradford method (Bradford, 1976). Approximately 200 lg of proteins from each sample from the three groups was analyzed by 12.5% SDS–PAGE according to the Laemmli method (Laemmli, 1970). Immunoblot analysis was conducted as previously described (Wang et al., 2009b). The

358

Q. Zhang et al. / Developmental and Comparative Immunology 46 (2014) 356–363

antiserum against MjCnx was used as the first antibody, and the antiserum against shrimp b-actin (prepared in our laboratory) was used as the loading control. 2.8. Immunocytochemistry The immunocytochemical experiments were performed as previously described (Liu et al., 2013). Shrimp were firstly challenged by V. anguillarum (approximately 3  107 CFU/shrimp or PBS. After 24 h, hemocytes from bacteria-, or PBS-challenged, or unchallenged (normal) shrimp, were isolated from the hemolymph and washed three times by PBS. The hemocytes were diluted in PBS until an appropriate concentration (approximately 4  105 cells/ mL) was reached and then placed on poly-L-lysine-coated glass slides. After standing for 30 min at room temperature, the cells were fixed in a 4% paraformaldehyde (PFA) solution for 5 min and then washed six times (1 min each) with PBS. The cells were permeated in 0.2% Triton X-100 in PBS for 10 min. After blocking with 2% bovine serum albumin in PBS (blocking buffer) for 1 h, the cells were incubated in the antiserum against MjCnx (1:100 diluted in blocking buffer) for 3 h at 37 °C and then washed six times (5 min each). Subsequently, the cells were incubated in the goat anti-rabbit IgG-Alexa Fluor 488 (Eugene, USA, diluted 1:1000 in blocking buffer) for 1 h at 37 °C. Cell nuclei were stained with 40 ,6-diamidino-2-phenylindole (DAPI; 1 mg/mL in PBS) for 10 min at room temperature. After mounting on 80% glycerol in PBS, the slides were observed under a fluorescence microscope (Olympus BX51, Japan). 2.9. Cell surface protein labeling To check whether MjCnx was located on the hemocyte surface, we firstly labelling the hemocytes surface with biotin-streptavidin system and then performed the Western blot. Shrimp were challenged with V. anguillarum with above mentioned method. After 24 h, the hemocytes of the bacteria-challenged and normal shrimp were isolated from the hemolymph respectively by centrifuging the hemolymph at 800g for 10 min. The obtained hemocytes (approximately 106) were washed by cold PBS and incubated with sulfo-NHS-LC-biotin (Pierce, American; 0.5 mg/ml in PBS) at 4 °C for 1 h, the hemocytes were washed by PBS for five times to remove the unreacted reagent. Then the hemocytes were lysed in RIPA buffer (50 mM Tris–HCl (pH 8.0), 150 mM NaCl, 1% NonidetP40, 1% Sodium deoxycholate, 0.1% SDS) for 30 min and then centrifuged at 12,000g for 10 min at 4 °C to collect the supernatant. Strepavidin-agarose beads (Pierce, American; 20 lL) were added in the supernatant with slight rotation at 4 °C for 1 h to immunoprecipitate the biotinylated cell-surface proteins. After washed by RIPA buffer for five times, the strepavidin-agarose beads were used in immunoblot analysis. The antiserum against MjCnx was used as the first antibody, and the antiserum against shrimp b-actin (prepared in our laboratory) was used as the negative control. 2.10. Microorganism binding assay Gram-positive bacteria (M. luteus, S. aureus, B. thuringiensis, B. subtilis, and B. megaterium) and Gram-negative bacteria (E. coli, V. anguillarum, K. pneumoniae, and P. aeruginosa) were used for the binding assay. The bacteria were cultured in LB medium (1% tryptone, 1% NaCl, and 0.5% yeast extract) overnight and then harvested by centrifugation at 6000g for 3 min. The pellet was washed using Tris-buffered saline (TBS; comprising 10 mM Tris–HCl and 150 mM NaCl, pH 7.5) and then resuspended in TBS to OD600 = 1.0. The purified rMjCnx (1 mg/mL, 20 lL) was mixed with a 1 mL solution containing the microorganisms (3  107 CFU/mL) by rotation for 1 h at room temperature. The microorganisms were collected by

centrifugation, washed four times with TBS, and then eluted with 7% SDS for 1 min. Microorganisms incubated in TBS were used as control. Microorganisms were collected by centrifugation and analyzed by 12.5% SDS–PAGE. Western blot analysis was performed using the specific antiserum against MjCnx. 2.11. Carbohydrate binding assay ELISA assays were performed as previously described to determine the binding ability of rMjCnx to different carbohydrates (Yu and Kanost, 2000). Wells of a microtiter plate were coated with 50 lL of LPS, LTA, PGN (M) or PGN (S) (80 lg/mL). Subsequently, 200 lL of BSA (1 mg/mL) in TBS was used to block the wells at 37 °C for 2 h. The purified rMjCnx or GST (control) was diluted in TBS containing 0.1 mg/mL BSA to different concentrations (0, 6.25, 12.5, 25, 50, 100, and 200 lg/mL) and then added into each well (100 lL). The microtiter plate was incubated at 37 °C for 3 h and then washed four times with TBS. The antiserum of MjCnx (1/200 dilution in TBS containing 0.1 mg/mL BSA) was added into the wells (100 lL/well) and then incubated at room temperature for 3 h. The plate was washed as described above, and peroxidase-conjugated goat anti-rabbit IgG (1/2000 dilution in TBS containing 0.1 mg/mL BSA, 100 lL/well) was added. After incubation at 37 °C for 1 h, color was developed in the wells by adding p-nitrophenyl phosphate (1 mg/mL in 10 mM diethanolamine and 0.5 mM MgCl2, 100 lL/well) and incubating at room temperature for 30 min. The absorbance of 405 nm was read by a plate reader (Bio Tek, USA). The binding assay was performed three times. 2.12. V. anguillarum clearance assay Bacterial clearance assays were performed as previously described (Wang et al., 2009c). Overnight-cultured V. anguillarum was washed and resuspended in PBS. V. anguillarum (approximately 4  108 CFU/mL, 500 lL) was incubated with rMjCnx (800 lg/mL, 500 lL) at 28 °C for 30 min with rotation. GST (800 lg/mL, 500 lL) as control was incubated with V. anguillarum. Two groups of mixtures (50 lL per shrimp) were injected into the shrimp. The hemolymph (approximately 500 lL) of three shrimps was collected at different postinjection times (5, 15, and 30 min). The samples (30 lL) were diluted in PBS, plated on 2216E agar (0.5% tryptone, 0.1% yeast extract, 2.4% seawater salt, 0.1% FeCl3, and 1.5% agar), and then incubated overnight at 37 °C. The number of bacteria in each plate was counted, and the number of bacteria in 1 mL hemolymph was calculated. The data were analyzed using an unpaired Student’s t-test, and the significant difference was accepted at P < 0.05. 2.13. V. anguillarum clearance assay after RNA interference The DNA fragment of MjCnx was amplified using a pair of primers (RNAi F and RNAi R; Table 1) for double-stranded RNA (dsRNA) synthesis. The amplified fragment was purified using phenol/chloroform, precipitated with ethanol, and then used as the template for dsRNA synthesis according to a previously described method (Wang et al., 2012a). The dsRNA of green fluorescent protein (GFP) gene was also synthesized as control (the primers for GFP amplification, GFP RNAi F and GFP RNAi R, are shown in Table 1). Approximately 10 lL of dsRNA (3 lg/lL) from MjCnx or GFP was injected into the abdomen of the shrimp. At 24 h postinjection, total RNA of the hemocytes from the two groups of shrimp was isolated and used to monitor the effects of RNAi by RT-PCR and qRT-PCR. The rest of the shrimp were used for clearance assay using the process described above with some modifications. In the modified clearance assay, 25 lL of processed V. anguillarum

Q. Zhang et al. / Developmental and Comparative Immunology 46 (2014) 356–363

(approximately 4  108 CFU/mL) that was not incubated with recombinant protein was injected into the shrimp. 2.14. Fluorescent labeling of V. anguillarum and phagocytosis assay Phagocytosis assays were performed using a previously described method with some modifications (Zong et al., 2008). V. anguillarum was killed by 75 °C water bath and then labeled with fluorescein isothiocyanate (FITC, Sigma, USA). After washing six times with 0.1 M NaHCO3, the bacteria were resuspended in PBS. Labeled V. anguillarum (approximately 1  109 CFU/mL, 500 lL) was incubated with rMjCnx (800 lg/mL, 500 lL) or control protein GST (800 lg/mL, 500 lL) at 28 °C for 1 h with slight rotation. The mixtures were centrifuged at 6000g for 3 min and then resuspended in PBS until an appropriate concentration (approximately 4  108 CFU/mL) was reached. The mixtures at 50 lL were injected into each shrimp. After 30 min, the hemocytes were isolated, washed three times by PBS, and then fixed in 1% PFA for 30 min. After washing twice with PBS, the cells were resuspended using 50 lL PBS and placed on poly-L-lysine-coated glass slides. The hemocytes were left to stand at room temperature for 30 min and then stained using DAPI (1 mg/mL in PBS) for 10 min. After washing six times with PBS (5 min each), hemocyte phagocytosis was observed under a fluorescence microscope (Olympus BX51, Japan). The number of hemocytes was counted at 400 magnification. Statistical analyses and calculations were conducted using the following formulas: Phagocytosis percentage = Number of cells phagocytosing bacteria/Number of cells examined and Phagocytosis index = Total number of bacteria phagocytosed/Number of cells phagocytosing bacteria. The assays were performed three times. The data were analyzed using t-test. 3. Results 3.1. MjCnx belongs to the Crt protein family A 1780 bp DNA fragment was obtained by intestine transcriptome sequencing, and online BLASTX search showed that this fragment was highly similar to Cnx from the shrimp Penaeus monodon (GenBank accession number: ADO00931). Hence, the protein was designated as MjCnx. The full-length cDNA sequence of MjCnx

359

was obtained by 30 RACE and comprised 2392 bp with a 113 bp 50 untranslated region (UTR), a 578 bp 30 UTR containing a typical polyadenylation signal (AATAAA), and an open reading frame of 1701 bp. MjCnx encodes 566 amino acids, including a signal peptide of 26 residues, a Crt domain, and a TM region predicted by SMART (Fig. S1). MjCnx is a lectin chaperone that belongs to the Crt superfamily. The BLASTP data showed that MjCnx was highly similar to Cnx proteins from other animals, including the shrimp Penaeus monodon (ADO00931.1, 93%), the leaf-cutting ant Acromyrmex echinatior (EGI60775.1, identity 58%), the yellow fever mosquito Aedes aegypti (XP_001647823.1, 59%), the carpenter ant Camponotus floridanus (EFN68342.1, 54%), the southern house mosquito Culex quinquefasciatus (XP_001850652.1, 58%), the fruit fly Drosophila melanogaster (CAA67846.1, 61%), human Homo sapiens (AAA21749.1, 59%), Brandt’s bat Myotis brandtii (EPQ06945.1, 61%), and the black flying fox Pteropus alecto (ELK03201.1, 59%). The multiple sequence alignment of MjCnx was performed using GenDoc (Fig. S2), and the results revealed that the Crt domains of Cnx proteins were highly conserved. A phylogenetic tree was constructed by MEGA 4.0 software to further determine the evolutionary relationships among these Cnx proteins (Fig. S3). The phylogenetic tree contained two large clusters. One cluster comprised Cnx proteins from insects (A. aegypti, C. quinquefasciatus, D. melanogaster, A. echinatior, and C. floridanus). The other cluster comprised the two types of Cnx proteins from shrimp (P. monodon and M. japonicus) and mammals (H. sapiens, M. brandtii, and P. alecto). MjCnx is clustered with mammal Cnxs. This suggested that MjCnx might have functions that were similar to those of Cnx proteins from mammals. 3.2. MjCnx exists in several tissues and responds to bacterial challenge at the RNA level RT-PCR was used to detect the tissue distribution of MjCnx. MjCnx had higher expression levels in hemocytes, hepatopancreas, and intestinal tissues than in heart, gill, and stomach tissues (Fig. 1A). Given that hemocytes and hepatopancreas are very important elements of the innate immune system of shrimp (Bachere et al., 2004; Gross et al., 2001), MjCnx might have functions in shrimp immunity.

Fig. 1. Distribution and expression profiles of MjCnx in shrimp after bacterial challenge. (A) Distribution of MjCnx in different tissues analyzed by RT-PCR and Western blot. (B–D) Expression patterns of MjCnx in hemocytes, hepatopancreas, and intestine after V. anguillarum or PBS injection as detected by qRT-PCR. b-actin was used as control. Asterisks indicate significant difference (⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001).

360

Q. Zhang et al. / Developmental and Comparative Immunology 46 (2014) 356–363

B. megaterium) and Gram-negative bacteria (E. coli, V. anguillarum, K. pneumoniae, and P. aeruginosa) were used in the binding assays. rMjCnx weakly bound to S. aureus and B. subtilis but strongly bound to the other seven microorganisms (Fig. 4A). Four types of polysaccharides (LPS, LTA, PGN (M) and PGN (S)) were used in ELISA assays to determine the microbial-associated molecular patterns of MjCnx binding. rMjCnx showed stronger binding affinity to PGN (M) than to LPS, LTA and PGN (S) (Fig. 4B). These results suggest that rMjCnx shows binding specificity to different microbe-associated molecular patterns (MAMPs) from different bacteria. Fig. 2. SDS–PAGE analysis of rMjCnx (A) and GST (B) expressed in E. coli. Lane 1, total protein obtained from E. coli without induction; lane 2, total protein obtained from E. coli induced by 0.5 mM IPTG; lane 3, recombinant protein purified by glutathione Sepharose 4B; and lane M, standard protein marker.

To further determine the relationship between MjCnx and shrimp immunity, we analyzed the expression patterns of MjCnx in hemocytes (Fig. 1B), hepatopancreatic (Fig. 1C), and intestinal tissues (Fig. 1D) after V. anguillarum and PBS challenge. As shown in the Fig. 4, compared with the PBS challenge, the transcriptional level of MjCnx was upregulated in hemocytes 12 h post bacterial injection. In the hepatopancreas, the transcriptional level of MjCnx increased at 24 h postinjection. In the intestine, the transcriptional level of MjCnx continuously increased from 12 to 24 h postinjection. These results suggested that the transcriptional level of MjCnx was upregulated by V. anguillarum challenge. 3.3. Recombinant expression and antiserum preparation Recombinant MjCnx was expressed in E. coli BL21 (DE3). The Crt domain of MjCnx has a predicted molecular mass of 43 kDa from the amino acid sequence. The rMjCnx contains a GST-tag at its N-terminal. The molecular mass of rMjCnx was 68 kDa according to the results of SDS–PAGE (Fig. 2A). This is consistent with the theoretical mass. The GST-tag molecular mass was approximately 25 kDa (Fig. 2B). The distribution of MjCnx in shrimp was detected using the antiserum against MjCnx by Western blot (Fig. 1A), with b-actin as the loading control. MjCnx was distributed in several tissues, including hemocytes, heart, hepatopancreas, gills, stomach, and intestine. This distribution was similar to the distribution patterns at the RNA level. 3.4. MjCnx protein is upregulated by bacterial challenge and exists in cytoplasm and on the membrane of hemocytes The subcellular localization and expression patterns of MjCnx in hemocytes were analyzed by immunocytochemial and Western blot assays. As shown in Fig. 3A, MjCnx was principally distributed in the cytoplasm of the hemocytes. The protein level of MjCnx significantly increased at 24 h after V. anguillarum injection compared with PBS injection (Fig. 3B). We know that MjCnx is an ER membrane-bound lectin. As the membrane system has the characteristic of fluidity, MjCnx may exist on the hemocytes surface to sense the invading microorganisms. We used biotin-streptavidin system to label and immuoprecipitate the shrimp hemocytes surface proteins and detected MjCnx in both normal and bacteria-challenged hemocytes surface proteins by Western blot (Fig. 3C). The result showed that MjCnx was detected on the cell surface of shrimp hemocytes. 3.5. MjCnx can bind microorganisms by binding to carbohydrates To detect the binding capabilities of MjCnx, Gram-positive bacteria (M. luteus, S. aureus, B. thuringiensis, B. subtilis, and

3.6. MjCnx enhances the clearance of V. anguillarum Given that rMjCnx can bind to the shrimp pathogen V. anguillarum, we further tested whether or not MjCnx affects the bacterial clearance rate in shrimp. V. anguillarum was cleared more rapidly in the hemolymph from the rMjCnx injection group compared with that from the GST control group at all postinjection times of the recombinant proteins (Fig. 5A). 3.7. Silencing MjCnx impairs the clearance of V. anguillarum in vivo To confirm the functions of MjCnx in bacterial clearance, we used RNAi to knock down MjCnx in the shrimp, which was used for the clearance assays. The expression of MjCnx significantly decreased 24 h after injection of dsMjCnx (Fig. 5B), and the clearance rate of V. anguillarum in the shrimp significantly decreased at all postinjection times (Fig. 5C). These findings indicated that MjCnx had an important function in the clearance of V. anguillarum. 3.8. MjCnx facilitates phagocytosis efficiency in hemocytes Phagocytosis assays were conducted to determine the mechanism of MjCnx in bacterial clearance. As shown in Fig. 6, higher phagocytosis percentage and phagocytosis index were obtained when the labeled bacteria were incubated with MjCnx than when the labeled bacteria were incubated with GST. This finding indicated that MjCnx increased phagocytosis efficiency. 4. Discussion In this study, Cnx from M. japonicus was identified and designated as MjCnx. MjCnx was principally distributed in hemocyte, hepatopancretic, and intestinal tissues and was significantly upregulated by V. anguillarum in hemocyte, gill, and intestinal tissues. Hemocytes and hepatopancreas have important functions in shrimp immunity (Bachere et al., 2004; Gross et al., 2001). These results indicated that MjCnx may have a function in shrimp antibacterial immunity. Cnx is a well-characterized transmembrane chaperone that is involved in the folding of newly synthesized glycoproteins and regulates the Ca2+ homeostasis in the ER lumen. This protein also participates in different physiological processes, such as signaling, apoptosis, and phagocytosis (Chevet et al., 2009; Guerin et al., 2009; Muller-Taubenberger et al., 2001; Wang et al., 2012b; Watthanasurorot et al., 2013). Phagocytosis is a highly conserved multi-step process that is involved in engulfing and destroying apoptotic bodies, dying tumor cells, and pathogens. Phagocytosis begins with particle recognition and adhesion of the particle to the phagocyte surface, followed by transmembrane signal transduction and restructuring of the cortical actin network in line with phagocytic cup formation (May and Machesky, 2001). Particle recognition, the first step of phagocytosis, is critical for particulate material removal. Cell surface receptors directly or indirectly bind

Q. Zhang et al. / Developmental and Comparative Immunology 46 (2014) 356–363

361

Fig. 3. Subcellular localization and expression profiles of MjCnx in shrimp hemocytes as analyzed by immunohistochemistry (A), Western blot (B) and protein biotin labeling and immunoprecipitation (C). (A) Distribution of MjCnx in normal, PBS-challenged and V. anguillarum-challenged hemocyte. The blue fluorescent indicates the nuclei of the hemocytes, and the green fluorescent shows the distribution of MjCnx. Scale is 20 lm. (B): MjCnx expression in normal, PBS-challenged and V. anguillarum-challenged hemocytes as analyzed by Western blot. b-actin was used as the loading control. N, normal shrimp; P, PBS-challenged shrimp; V, V. anguillarum-challenged shrimp. (C) MjCnx existed on the hemocytes surface. The hemocytes surface proteins were labeled by biotin and immunoprecipitated by streptavidin-agarose beads. The beads were analyzed by Western blot. b-actin was used as the negative control.

Fig. 4. Capacity of rMjCnx to bind to microorganisms and carbohydrates. (A) rMjCnx bound to bacteria as analyzed by Western blot using antiserum against MjCnx. (B) ELISA assay that detects the binding of rMjCnx to LPS, LTA, PGN from M. luteus (designated as PGN (M)) and PGN from S. aureus (designated as PGN (S)) using anti-MjCnx serum. The data shown are the mean ± SEM obtained from three individual experiments.

362

Q. Zhang et al. / Developmental and Comparative Immunology 46 (2014) 356–363

Fig. 5. MjCnx promoted the clearance of V. anguillarum in shrimp. (A) rMjCnx enhanced the clearance of V. anguillarum. Bacteria pre-incubated with rMjCnx or GST (as control) was used for the clearance assays. The number of bacterial colonies was counted, and the number of bacteria in 1 mL shrimp hemolymph was calculated. (B) Effects of RNAi on MjCnx in hemocytes. mRNA transcription levels of MjCnx obtained by RT-PCR at 24 h after injection of dsMjCnx or dsGFP are shown in the figure above the graph, and the results presented in the figure below were obtained using qRT-PCR. ⁄Indicates significant difference (P < 0.05) by Student’s t-test. (C) Clearance rate of V. anguillarum in shrimp was impaired by silencing MjCnx using RNAi. Two groups of shrimps were injected with dsMjCnx or dsGFP (control), and clearance assay was conducted at 24 h postinjection.

Cnx and Crt are involved in phagocytosis by modulating actin system activities; this function subsequently affects the outgrowth of phagocytic cups (Muller-Taubenberger et al., 2001). Therefore, the mechanism underlying phagocytosis enhancement by MjCnx in shrimp may be similar to the mechanism involved in cells of the amoeba D. discoideum (Muller-Taubenberger et al., 2001). Engulfment of invading microorganisms by phagocytosis is a critical component of the innate immune response. Pathogen recognition is the first step of phagocytosis. Three types of receptors that are related to phagocytosis have been identified in humans: pattern-recognition receptors (PRRs), opsonic receptors, and apoptotic corpse receptors (Flannagan et al., 2012). However, the known phagocytic receptors in invertebrates are few. In the present study, we found that MjCnx could strongly bind to Gramnegative bacteria and some Gram-positive bacteria. Further study revealed that MjCnx had higher affinity with PGN (M), LTA and LPS than PGN (S). The results suggested that MjCnx had binding specificity to different polysaccharides (known MAMPs) on the surface of bacteria. MjCnx is an ER membrane-bound lectin, it also exists on the surface of shrimp hemocytes. Therefore, MjCnx has the potential to sense the invading microorganisms by binding to different MAMPs and promote phagocytosis. Our results suggest that MjCnx is one of the PRRs involved in phagocytosis in shrimp. Fig. 6. rMjCnx enhanced the phagocytosis efficiency of hemocytes in shrimp. (A) FITC-labeled V. anguillarum pre-incubated with rMjCnx or GST (as control) was used in the phagocytosis assays. The results were observed using a fluorescent microscope. The blue fluorescent indicates the nuclei of the hemocytes, and the green fluorescent indicates the bacteria. Scale is 20 lm. (B–C) Phagocytosis percentage and phagocytosis index were calculated as described in the materials and methods section. ⁄Significant difference, P < 0.05.

to the particle; opsonins are the intermedium that links the cell surface receptors and particle, and indirectly enhances the phagocytosis efficiency (Groves et al., 2008). Surface-exposed Crt of dying cells was considered a (co)receptor for specific opsonins (Muller-Taubenberger et al., 2001). In this study, MjCnx showed the lectin activities of binding microorganisms and several polysaccharides. The clearance of V. anguillarum was enhanced by ‘‘overexpression’’ of rMjCnx and was impaired after silencing of MjCnx by RNAi. To investigate this mechanism, phagocytosis assay was performed. The results showed that MjCnx can promote hemocyte phagocytosis. Therefore, MjCnx may be involved in pathogen recognition or in other phagocytosis steps in shrimp. Phagocytosis is the mechanism of internalization used by different cells to engulf large particles, microorganisms, and cell debris (Flannagan et al., 2012). Phagocytosis is induced by cross-linking of receptors and intense F-actin polymerization, which generate the force that drives membrane extension. In Dictyostelium cells,

Acknowledgements This work was financially supported by the National Natural Science Foundation of China (No. 31130056), National Basic Research Program of China (973 Program, No. 2012CB114405), the Ph.D. Programs Foundation of the Ministry of Education of China (No. 20110131130003), and Provincial Natural Science Foundation of Shandong, China (No. ZR2011CM014). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.dci.2014.05.009. References Bachere, E., Gueguen, Y., Gonzalez, M., de Lorgeril, J., Garnier, J., Romestand, B., 2004. Insights into the anti-microbial defense of marine invertebrates: the penaeid shrimps and the oyster Crassostrea gigas. Immunol. Rev. 198, 149–168. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Chevet, E., Smirle, J., Cameron, P.H., Thomas, D.Y., Bergeron, J.J., 2009. Calnexin phosphorylation: linking cytoplasmic signalling to endoplasmic reticulum lumenal functions. Semin. Cell Dev. Biol. 21, 486–490. Ellgaard, L., Frickel, E.M., 2003. Calnexin, calreticulin, and ERp57: teammates in glycoprotein folding. Cell Biochem. Biophys. 39, 223–247.

Q. Zhang et al. / Developmental and Comparative Immunology 46 (2014) 356–363 Flannagan, R.S., Jaumouille, V., Grinstein, S., 2012. The cell biology of phagocytosis. Annu. Rev. Pathol. 7, 61–98. Frydman, J., 2001. Folding of newly translated proteins in vivo: the role of molecular chaperones. Annu. Rev. Biochem. 70, 603–647. Greenberg, S., Grinstein, S., 2002. Phagocytosis and innate immunity. Curr. Opin. Immunol. 14, 136–145. Gross, P.S., Bartlett, T.C., Browdy, C.L., Chapman, R.W., Warr, G.W., 2001. Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp, L. setiferus. Dev. Comp. Immunol. 25, 565–577. Groves, E., Dart, A.E., Covarelli, V., Caron, E., 2008. Molecular mechanisms of phagocytic uptake in mammalian cells. Cell. Mol. Life Sci. 65, 1957–1976. Guerin, R., Arseneault, G., Dumont, S., Rokeach, L.A., 2008. Calnexin is involved in apoptosis induced by endoplasmic reticulum stress in the fission yeast. Mol. Biol. Cell 19, 4404–4420. Guerin, R., Beauregard, P.B., Leroux, A., Rokeach, L.A., 2009. Calnexin regulates apoptosis induced by inositol starvation in fission yeast. PLoS ONE 4, e6244. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Liu, W., Zhang, F.X., Cai, M.J., Zhao, W.L., Li, X.R., Wang, J.X., Zhao, X.F., 2013. The hormone-dependent function of Hsp90 in the crosstalk between 20hydroxyecdysone and juvenile hormone signaling pathways in insects is determined by differential phosphorylation and protein interactions. Biochim. Biophys. Acta 1830, 5184–5192. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) method. Methods 25, 402–408. Luana, W., Li, F., Wang, B., Zhang, X., Liu, Y., Xiang, J., 2007. Molecular characteristics and expression analysis of calreticulin in Chinese shrimp Fenneropenaeus chinensis. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 147, 482–491. May, R.C., Machesky, L.M., 2001. Phagocytosis and the actin cytoskeleton. J. Cell Sci. 114, 1061–1077. Muller-Taubenberger, A., Lupas, A.N., Li, H., Ecke, M., Simmeth, E., Gerisch, G., 2001. Calreticulin and calnexin in the endoplasmic reticulum are important for phagocytosis. EMBO J. 20, 6772–6782. Qiu, Y., Xi, J., Du, L., Poovaiah, B.W., 2012. The function of calreticulin in plant immunity: new discoveries for an old protein. Plant Signal. Behav. 7, 907–910. Rutkevich, L.A., Williams, D.B., 2010. Participation of lectin chaperones and thiol oxidoreductases in protein folding within the endoplasmic reticulum. Curr. Opin. Cell Biol. 23, 157–166. Shi, X.Z., Zhao, X.F., Wang, J.X., 2008. Molecular cloning and expression analysis of chymotrypsin-like serine protease from the Chinese shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol. 25, 589–597.

363

Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Wada, I., Rindress, D., Cameron, P.H., Ou, W.J., Doherty 2nd, J.J., Louvard, D., Bell, A.W., Dignard, D., Thomas, D.Y., Bergeron, J.J., 1991. SSR alpha and associated calnexin are major calcium binding proteins of the endoplasmic reticulum membrane. J. Biol. Chem. 266, 19599–19610. Wang, B., Han, S., Lien, L., Chang, L.J., 2009a. Lentiviral calnexin-modified dendritic cells promote expansion of high-avidity effector T cells with central memory phenotype. Immunology 128 (1), 43–57. Wang, H.C., Leu, J.H., Kou, G.H., Wang, A.H., Lo, C.F., 2007. Protein expression profiling of the shrimp cellular response to white spot syndrome virus infection. Dev. Comp. Immunol. 31, 672–686. Wang, S., Chen, A.J., Shi, L.J., Zhao, X.F., Wang, J.X., 2012a. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response. PLoS ONE 7, e30057. Wang, S., Zhao, X.F., Wang, J.X., 2009b. Molecular cloning and characterization of the translationally controlled tumor protein from Fenneropenaeus chinensis. Mol. Biol. Rep. 36, 1683–1693. Wang, W.A., Groenendyk, J., Michalak, M., 2012b. Calreticulin signaling in health and disease. Int. J. Biochem. Cell Biol. 44, 842–846. Wang, X.W., Wang, J.X., 2013. Diversity and multiple functions of lectins in shrimp immunity. Dev. Comp. Immunol. 39 (1–2), 27–38. Wang, X.W., Zhang, X.W., Xu, W.T., Zhao, X.F., Wang, J.X., 2009c. A novel C-type lectin (FcLec4) facilitates the clearance of Vibrio anguillarum in vivo in Chinese white shrimp. Dev. Comp. Immunol. 33, 1039–1047. Watthanasurorot, A., Jiravanichpaisal, P., Soderhall, K., Soderhall, I., 2013. A calreticulin/gC1qR complex prevents cells from dying: a conserved mechanism from arthropods to humans. J. Mol. Cell. Biol. 5 (2), 120–131. Williams, D.B., 2006. Beyond lectins: the calnexin/calreticulin chaperone system of the endoplasmic reticulum. J. Cell Sci. 119, 615–623. Young, J.C., Agashe, V.R., Siegers, K., Hartl, F.U., 2004. Pathways of chaperonemediated protein folding in the cytosol. Nat. Rev. Mol. Cell Biol. 5, 781–791. Yu, X.Q., Kanost, M.R., 2000. Immulectin-2, a lipopolysaccharide-specific lectin from an insect, Manduca sexta, is induced in response to gram-negative bacteria. J. Biol. Chem. 275, 37373–37381. Zong, R., Wu, W., Xu, J., Zhang, X., 2008. Regulation of phagocytosis against bacterium by Rab GTPase in shrimp Marsupenaeus japonicus. Fish Shellfish Immunol. 25, 258–263. Zuppini, A., Groenendyk, J., Cormack, L.A., Shore, G., Opas, M., Bleackley, R.C., Michalak, M., 2002. Calnexin deficiency and endoplasmic reticulum stressinduced apoptosis. Biochemistry 41, 2850–2858.