Carbon nanotubes significantly enhance the biological activity of CpG ODN in chickens

International Journal of Pharmaceutics 561 (2019) 135–147

Contents lists available at ScienceDirect

International Journal of Pharmaceutics journal homepage: www.elsevier.com/locate/ijpharm

Carbon nanotubes significantly enhance the biological activity of CpG ODN in chickens Jason Tomporowskia, Jamille M. Heera, Brenda Allana, Susantha Gomisb, Palok Aicha,c,

T

⁎

a

Vaccine and Infectious Disease Organization-International Vaccine Centre (VIDO-InterVac), 120 Veterinary Road, University of Saskatchewan, Saskatoon S7N 5E3, SK, Canada b Department of Veterinary Pathology, Western College of Veterinary Medicine, 52 Campus Drive, University of Saskatchewan, Saskatoon S7N 5B4, SK, Canada c School of Biological Sciences, National Institute of Science Education and Research (NISER), HBNI, P.O. - Bhimpur-Padanpur, Jatni, 752050 Khurda, Odisha, India

A R T I C LE I N FO

A B S T R A C T

Keywords: CpG ODN Nano conjugation Macrophage priming Pathogen clearance Chicken

Synthetic unmethylated cytidine-phosphate-guanosine oligodeoxynucleotides (CpG ODN) is an effective immune stimulant in chicken. To be effective CpG dosage requirement is high. High dosage increases cost of treatment and introduces toxicity. A delivery system using multi-walled carbon nanotubes (MWCNT) is utilized in this study to aid in lowering the effective dose of the immune stimulant. CpG ODNs were attached non-covalently in different ways to multi-walled carbon nanotubes (MWCNT). We assessed and selected an appropriate linking method of CpG ODN with MWCNT followed by cellular uptake studies to establish that MWCNT-conjugated CpG ODNs were delivered better than free CpG ODNs into the cell. It was observed that MWCNT-conjugated CpG ODNs were equally effective in priming the cells in vitro at 1000-fold less concentration than free CpG ODN. In vivo studies revealed that a significantly lower dose of CpG ODN, when given subcutaneously, was enough to protect chickens from a lethal challenge of bacteria. The mechanism of immune stimulation was examined by in vivo cell recruitment and in vitro cytokine production studies. MWCNT-conjugated CpG ODNs are significantly more efficacious and less toxic than free CpG ODN to qualify as a potential immune stimulant.

1. Introduction

(Zhang et al., 2017). In the current study, we wanted a nanoparticle that has larger size and higher hydrophobicity with lower toxicity when used subcutaneously. Based on this criteria, we selected multi-walled carbon nanotubes for the current study over other types of nanoparticles (Meng et al., 2010). In general, there are two main forms of carbon nanotubes, the single-walled form, with a single cylindrical graphene sheet and the multi-walled form which is made of several concentric graphene sheets spaced approximately 0.34 nm apart (Bianco et al., 2005). In this study, we have used the multi-walled form of carbon nanotube over other commonly used form single-walled carbon nanotube (SWCNT), because it has been reported that SWCNT is more toxic to macrophages than MWCNT (Zeinabad et al., 2016). Since, the current study used macrophages to screen various types of CpG ODN coupled to CNTs, we selected MWCNT for subsequent analysis. The problem that exists with carbon nanotubes in that they have poor solubility in almost all types of solvents. However, this problem can be overcome with the covalent or non-covalent functionalization of the carbon nanotubes which not only makes them more soluble but also allows effective attachment of a wide

Nanoparticles that can be attached to other molecules are very useful as nano-vectors to deliver their cargo to target cells. These nanovectors have the ability to pass through biological barriers and localize in target tissue (Sakamoto et al., 2007). There are a wide variety of nanoparticles being studied for use as drug delivery vehicles. Lipidbased molecules have been used to carry drugs, however, they have the problem of not being able to enter the cell to deliver their drug directly (Riehemann et al., 2009). Natural polymers, such as proteins or polysaccharides, have also been used as delivery vehicles as they are internalized and rapidly degraded allowing release of their cargo drug or gene. However, their use has yielded some severe side effects (Riehemann et al., 2009). Another promising candidate for a nanoparticle drug delivery system is carbon nanotubes which can be attached to a wide variety of proteins and nucleic acids (Bianco et al., 2005; Lacerda et al., 2006). There is no single kind of nanoparticle that is the best for any therapeutic applications. The selection of a nanoparticle for a particular use depends on the objective of the work

⁎ Corresponding author at: School of Biological Sciences, National Institute of Science Education and Research (NISER), HBNI, P.O.- Bhimpur-Padanpur, Jatni, 752050 Khurda, Odisha, India. E-mail address: [email protected] (P. Aich).

https://doi.org/10.1016/j.ijpharm.2019.02.040 Received 17 December 2018; Received in revised form 4 February 2019; Accepted 25 February 2019 Available online 28 February 2019 0378-5173/ © 2019 Elsevier B.V. All rights reserved.

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

free CpG ODN. We further examined the protective ability of the molecules against a lethal challenge of Salmonella typhimurium and correlated the immune response with the recruitment of immune cells to the site of injection of the treatments. We also examined the mechanism of improved immune stimulation by examining key innate immune gene stimulation with free and MWCNT linked CpG ODN. These studies indicated that conjugation of CpG ODN to MWCNT through adsorption with a linker molecule improves the biological activity of CpG ODN in vivo at a dose that is significantly lower.

variety of proteins and other molecules to their surface (Bianco et al., 2005; Pastorin, 2009). It has been demonstrated that functionalized carbon nanotubes are taken up by cells and are less harmful nanovectors (Pastorin, 2009). Toxicity studies done on carbon nanotubes differ in their results. Studies have claimed that high doses of carbon nanotubes can be detrimental to the host’s health (Poland et al., 2008) but other studies have indicated no toxicity of these molecules and that they are cleared from the system quickly (Singh et al., 2006). The paradox in establishing the fact of toxicity regarding carbon nanotubes is perhaps because of manufacturing protocol to keep the controversy unresolved. Preliminary studies from current laboratory could not establish the toxicity of 1 µm MWCNTs used in this study when administered intra-peritoneally in mice. The promise of improved delivery to target cells and enhancement of the activity of immune stimulating molecules leading to protection against disease makes the use of nanoparticles as drug delivery vehicles an exciting possibility. It is reported that SWNT are more toxic to macrophages than MWCNT (Zeinabad et al., 2016), which helped us to select MWCNT for the current study. We have used CpG ODN molecules to conjugate with MWCNT. It is the unmethylated CpG dinucleotides flanked by sequences to the 5′ and 3′ end that make up the CpG motif responsible for immune stimulation (Krieg, 2006). Both bacteria and vertebrates possess CpG nucleotides in their DNA but only bacterial DNA contains unmethylated CpG nucleotides flanked by specific nucleotides (Mutwiri et al., 2003). Structurally CpG ODNs are single-stranded oligonucleotides (ssODN) of about twenty-four base pairs in length containing palindromic GC-rich sequences that can be synthesized with a nuclease-resistant phosphorothioate backbone to increase their half life (Ishii and Akira, 2006). CpG ODN is recognized in most vertebrates by Toll-like receptor 9 (TLR9) located in innate immune cells and some adaptive immune cells Chickens respond to treatment with CpG ODN, however there is no evidence of a TLR 9 orthologue in avian species (Boyd et al., 2007; He et al., 2006). Recently, it has been suggested that the avian TLR 21 may function as the receptor for CpG ODN. Using both in vitro and in vivo studies, a strong stimulation of the immune response by CpG ODN treatment in chickens has been observed (Brownlie et al., 2009). Several in vitro studies have been conducted using the chicken macrophage cell HD11 where it has been demonstrated that treatment with CpG ODN led to greatly increased nitric oxide production by the macrophage cells and aided in the intracellular killing of Salmonella enteriditis which is observed when macrophages are activated (He et al., 2003; Xie et al., 2003). In one study it was observed that birds treated with 50 or 10 µg of CpG ODN were effectively protected from a lethal challenge of the extracellular bacteria Escherichia coli which can cause cellulitis and colibacillosis (Gomis et al., 2003; Taghavi et al., 2008). Treatment with CpG ODN has been effective in providing a protective response in chickens against a wide variety of infectious disease both intracellular and extracellular. The cost and toxicity associated with higher dose of CpG ODN prompted us to explore the potential of CpG-conjugated MWCNT for treatment in chicken. There is a wide variety of chemistries available to link carbon nanotubes to nucleic acids such as CpG ODN involving direct adsorption with or without a linker, electrostatic linkers and others (Chicharro et al., 2007; Lei et al., 2008; Shim et al., 2002; Yang et al., 2008). In this study, we selected all three chemistries involving non-covalent interactions (adsorption with or without linker and electrostatic interactions) to conjugate CpG with. Non-covalent linking was selected to easily detach CpG ODN in vivo to exert its activity which via covalent conjugation might have been compromised. To determine the effective chemistry and screen for the best MWCNT-conjugated CpG, we compared (a) chicken lymphocyte proliferation and (b) innate immune gene expression in chicken macrophages following treatment with three types of MWCNT-CpG (1:1) ODN conjugates and free CpG ODN. After selection of the best conjugate of MWCNT-CpG ODN for further use, we determined the increase in cellular uptake of the conjugated over the

2. Materials and methods 2.1. Cell cultures 2.1.1. Splenic lymphocytes Chickens were euthanized at the age of 2–4 weeks with halothane. The spleens were removed aseptically and placed in 10 mLs of Hank’s Balanced Salt Solution (HBSS) (Sigma-Aldrich, Canada). Spleens were macerated and passed through a 70 µM mesh strainer (BD Biosciences, USA) with a syringe plunger to obtain a single-cell suspension. Lymphocytes were washed through the mesh with 10 mLs of HBSS. Single-cell lymphocyte solution was kept on ice for 5 min and tissue that settled on the bottom of the tube was removed. The lymphocyte solution was then overlaid onto 15 mLs of Histopaque -1077 density gradient medium (Sigma-Aldrich, Canada). The density gradient was then centrifuged at 700g for 20 min at room temperature. Lymphocytes at the interface were then collected and washed three times with HBSS. Lymphocytes were then suspended in complete Dulbecco Modified Eagles Medium (DMEM, Sigma Aldrich, Canada) with 2 mM L-glutamine (Sigma-Aldrich, Canada), 1 mM sodium pyruvate (Sigma-Aldrich, Canada), 10% Fetal Bovine Serum (FBS) (Lonza Walkersville, Inc. USA), 100 U/mL penicillin (Invitrogen, Canada), 100 µg/mL streptomycin (Invitrogen, Canada), and 2 × 10−6 M 2-mercaptoethanol (SigmaAldrich, Canada). Viable cells were counted using the trypan blue dye exclusion assay (Miyamoto et al., 2002). 2.1.2. Chicken macrophage cell line HD11 The avian MC29 virus-transformed chicken macrophage cell (HD11) were obtained from Reno Pontarollo (Genome Prairie, Canada). Cells were cultured in 75 cm flasks (Corning CellBIND Surface, USA) at 37 °C in a 5% CO2 incubator. Cells were maintained in RPMI 1640 media (Invitrogen, USA) with 10% FBS (Lonza Walkerville.Inc, USA) and 50 µg/mL of gentamicin (Sigma, USA). Viable cells were counted using the trypan blue dye exclusion assay. 2.2. Linkages of carbon nanotube to CpG ODN 2.2.1. Linking via adsorption 2.2.1.1. Adsorption chemistry with a linker (MWCNT-PySE-CpG ODN) (MWCNT-1-CpG). MWCNTs were purchased from Cheap Tubes Inc. (USA) and were used without any further purification. MWCNTs at 5 mg/mL were suspended in N, N-Dimethylformamide (DMF) (SigmaAldrich, Canada). Separately 1-pyrenebutanoic acid, succinimidyl ester (PySE) (Invitrogen, Canada) was also suspended in DMF at a concentration of 5 mg/mL. The MWCNT suspension was then mixed with the PySE suspension in DMF at a 1:2 ratio with a final concentration of 1 mg/mL MWCNT and 2 mg/mL PySE. This reaction mixture was then incubated in the dark at room temperature for 4 h. Under these conditions, PySE is absorbed on the hydrophobic surface of MWCNT (Chen et al., 2001). CpG ODN was then added to the MWCNTPySE solution at a 1:1 ratio. The reaction was continued overnight at room temperature in the dark. In the aqueous environment, the succinimidyl ester group is hydrolyzed and single-stranded CpG ODN is thought to be non-covalently absorbed on the aromatic surface of MWCNT-PySE (Kam et al., 2005). 136

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

the spleen of chickens as described elsewhere. Lymphocytes were plated in a flat bottom 96 well plate at a concentration of 2.5 × 104 cells/well. The cells were treated with various concentrations of the three MWCNT-CpG ODN conjugates or free CpG ODN ranging from 5 µg/mL to 0.005 µg/mL. Untreated cells were used as a negative control. The positive control cells were treated with 5 µg/mL of Concanavalin A (Con A). Each treatment was done in triplicate. After treatment, cells were incubated for 48 h at in a 5% CO2 incubator at 41 °C. Proliferation was measured using the Quick cell proliferation kit II (BioVision, USA). Proliferation was measured by the ability of viable cells to cleave the tetrazolium salt WST. After the incubation time, cells were treated with 10 µL WST per well and incubated another 4 h. The optical density absorbance at an optical density of 440 nm was then measured. Fold change of cells was calculated by comparing the A440 of treated cells to the A440 of media treated control cells.

2.2.1.2. Direct adsorption chemistry (MWCNT-CpG ODN) (MWCNT-2CpG). CpG ODN was mixed with MWCNT at a 1:1 ratio at a final concentration of 1 mg/mL in PBS (20 mM, pH 7.2, made in house) and shaken gently overnight in the dark at room temperature. 2.2.1.3. Linking via electrostatic interactions (MWCNT-PEI-CpG ODN) (MWCNT-3-CpG). The MWCNT-COCL was made by dispersing 10 mg of the MWCNT-COOH, (Cheap Tubes Inc. (USA)), in 500 µL of N, NDimethylformamide (DMF, Sigma-Aldrich, Canada). The 5 mg/mL sample was sonicated using a pulse sonicator 1/3″ probe from Betatck Inc, for 5 min at 5 s intervals with sonication pulses for 2 s. A 250 µL volume of Thionyl Chloride (SOCl2, Sigma-Aldrich, Canada) was slowly mixed with an equal volume of Dichloromethane (DCM, SigmaAldrich, Canada). The mixture was then added to the sonicated MWCNT-COOH in DMF drop by drop and allowed to reflux on a heat block for 1hr at 65 °C. The tube was vortexed occasionally during the hour. After that time, 250 µL of the solution was put into eppendorf tubes. The excess SOCl2, DCM, and DMF were removed using a Savant SC11OA SPEEDVAC ® (Thermo Scientific, USA) for 30 min. The final products contain a concentrated amount of 2.5 mg of MWCNT-COCl in each tube. The conjugation of branched Polyethyleneimine (PEI) to MWCNTCOCl was done by mixing 5 µL of PEI, which was dissolved in 1-Methyl2-pyrrolidinone, (NMP, Sigma-Aldrich, Canada) at 10 mg/mL, to each 2.5 mg of MWCNT-COCl followed by the addition of 225 µL of NMP per tube. The mixture, now at 0.21 mg/mL of PEI and 11 mg/mL of MWCNT-COCl, was pulse sonicated for 5 min at 5 s intervals with sonication pulses for 2 s, then put on a shaker in the dark at room temperature overnight. The next day an additional 10 µL of PEI was added and sonicated as above then placed in the dark for 2 hrs with gentle shaking. Another aliquot of 10 µL of PEI was added to the mixture and sonicated again for 5 min at 5 s intervals. The resulting reaction, now two tubes of 1 mg/mL of PEI and 11 mg/mL of MWCNT-COCl in 250 µL of NMP solution was again put on the shaker overnight at room temperature in the dark. The next day each tube was dried of excess NMP and PEI using Savant SC11OA SPEEDVAC ® (Thermo Scientific, USA) to concentrate the MWCNT-COCl-PEI as our final product. PBS was added to each tube to produce a final product that contained 0.5 mg/mL of PEI and 5.5 mg/ mL of MWCNT-COCl. CpG ODN was added to MWCNT-PEI at a 1:1 ratio and shaken gently overnight in the dark at room temperature.

2.6. Comparative cellular uptake 2.6.1. Labeling of CpG ODN and MWCNT-CpG ODN To make the conjugate with a label for confocal use, CpG ODN 2007 was purchased with Cy3 dye (Integrated DNA Technologies, USA) attached. Ethanol precipitation was performed to purify the oligonucleotide by removing any free dye. MWCNT-PySE was conjugated to the labeled CpG ODN using the same techniques as described previously. Dialysis was performed as described previously with PBS being changed until no visible dye was left in the dialysis solution over a 2–3 day period. The optical density was measured for the purified labeled MWCNT-PySE-CpG ODN conjugate using a NANODROP ® spectrophotometer (Nanodrop Technologies LLC, USA at an absorbance of 260 nm while the Cy3 concentration (µM) was calculated using the Beer-Lambert law (A = ε/c.l) using the absorbance at 550 nm.

To purify the MWCNT-CpG ODN dialysis was performed. Excess reagents (PySE, PEI and CpG ODN) were removed by dialysis for 24 h at 4 °C in PBS (20 mM, pH 7.2) using a SLIDE-A-LYZER ® Dialysis Cassette (extra strength) with a 10 kDA molecular weight cutoff (Pierce Biotechnology, USA), The PBS dialysis solution was changed three times to remove free CpG ODN, PysE or PEI from the dialysis solution. The final concentration of the MWCNT-CpG ODN conjugate was determined by measuring the nucleic acid concentration of the MWCNTCpG ODN remaining in the dialysis cassette using a NANODROP ® spectrophotometer ND-1000 (Nanodrop Technologies LLC, USA) at an absorbance of 260 nm.

2.6.2. Confocal microscopy A 24 well cell culture plate (Corning Incorporated, USA) was seeded with 1.0 × 106 cells/ well of HD11 cells along with the appropriate media and treatment to total of 500 µL per well. Treatments included Cy3 alone (Amersham Biosciences, UK), CpG ODN-Cy3 and MWNTPySE-CpG ODN-Cy3 at a final concentration of 3 µM of Cy3 for each treatment. A time course was performed at the time points of 15, 60, 120, 240 min. All cells were also treated with Hoechst 33342, (Invitrogen, USA) for one hour to visualize the cell nucleolus. Cells were observed live using glass bottom culture dishes (MatTek Corp. Ashland, MA, USA) on a Leica 1-photon confocal microscope (DMI 6000 B inverted, TCS SP5, Germany). A live cell chamber was attached to the motorized scanning stage. A diode laser was used for Hoechst (excitation 405 nm) and the HeNe 543 nm laser was used for Cy3 (excitation 550 nm). The conventional fluorescence filters were; Analyzer, Dapi, Green, and Red. The objective used was the 40×/1.25–0.75 oil (Leica Plan NEOFlUAR ®). The tunable dichroic mirrors used for all lasers were AOBS. The detector consists of the following; two channel, all cooled PMTs, all spectral and transmitted light detectors. The computer software used was HP ® xw6400 workstation Intel Xeon ® CPU, 4 GB RAM, Dual hard- drives, CD/DVD burners, MS WINDOWS XP ® Professional SP2 and LEICA ® LAS AF 1.8.2.

2.4. CpG ODN

2.7. Measurement of nitric oxide

The CpG-ODN 2007 which is 22 bases in length with the sequence of tcgtcgttgtcgttttgtcgtt was used. The cg sequences are the CpG dinucleotides which stimulate an immune response (Mena et al., 2003).

In vitro nitrite production was measured using a nitric oxide assay kit (Biomedical Research Service, USA). Nitrite represents the levels of nitric oxide (NO) as it is the more stable metabolite (He et al., 2003). Chicken macrophage cells (HD11) were cultured in a 96 well round bottom plate (VWR, Canada) to a concentration of 5.0 × 105 cells/well overnight. Cells were treated with a 10-fold dose titration from 100 µg/ mL to 0.001 µg/mL of MWCNT-COOH, CpG ODN or MWCNT-PySE-CpG ODN and then were incubated at 41 °C for 1, 3 or 7 days in a 5% CO2

2.3. Dialysis of MWCNT-CpG ODN

2.5. Cellular proliferation To observe the ability of MWCNT-CpG ODN and CpG ODN to stimulate a proliferative B cell response lymphocytes were isolated from 137

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

Typhimurium challenge for clinical signs. Daily clinical scores for individual birds were recorded as follows: 0 = normal; 1 = hesitate to move and tire quickly; 2 = unable to stand or forage for food and subsequently euthanatized; 3 = dead. Mortality was counted each day. Dead or euthanized birds were necropsied immediately. Gross lesions such as pericarditis, perihepatitis, airsacculitis, and polyserositis were recorded. Bacterial swabs were taken from the air sacs and cultured on BHI agar plates.

incubator. Negative control cells were treated with RPMI 1640 with Gentamicin reagent solution and 10% Fetal Bovine Serum (FBS). Positive control cells were treated with 1ug/mL of LPS (Sigma-Aldrich, Canada) which stimulates NO production in HD11 cells (Crippen et al., 2003). After incubation cells were trypsinized to detach from the plates and pelleted by centrifugation at 400g for 4 min and 100 µL of each well was removed and placed in a new flat bottom 96 well plate. Nitrite standards were prepared from fresh sodium nitrite and 100 µL of nitric oxide assay solution was added to each well. The standard solution and assay solution were provided -as part of the Nitric Oxide Assay Kit (Biomedical Research Service Center, USA). The absorbance of the samples was read at an optical density of 540 nm using a BENCHMARK TM microplate reader (Bio-Rad Laboratories, USA) and the concentrations of nitrite were calculated based on the standard curve generated from the nitrite standards. The nitrite content in cell-free medium was subtracted from the values obtained with cells. All treatments were done in triplicate.

2.10. In vivo cell recruitment One day old leghorn chickens were placed into 7 groups (12 per group) with 4 subgroups (Day 1, Day2, Day3 and Day 7 after injection) (n = 3 per subgroup). The birds were treated SQ with PBS (negative control), MWCNT (10 µg), CpG ODN (10, 1 or 0.1 µg) or MWCNT-1-CpG ODN (1 or 0.1 µg). Three birds per group were euthanized on day 1, 2, 3, and 7 after treatment and the injection site was removed with a 10 mm punch biopsy and fixed in 10% neutral buffered formalin, embedded in paraffin, sectioned at 5-µm thickness and stained with hematoxylin and eosin. A histological score from 0 to 4 (cell infiltration 1+ = mild, 2+ = moderate, 3+ = moderate-severe, 4+ = severe) was assigned.

2.8. Endocytosis and endosomal maturation HD11 cells were seeded in a 96 well plate (VWR, Canada) at 2 × 105 cells/well and grown overnight (18 h) at 37 °C in CO2 incubator. The cells were pelleted and the media was replaced with fresh media containing various concentrations of monodansylcadaverine (MDC, 0–200 µg/mL) (Sigma-Aldrich, Canada) or chloroquine (0–50 µg/mL) (Sigma-Aldrich, Canada). The cells were then pre-incubated for 1 h in the presence of the inhibitors at 37 °C in CO2 incubator. Cells were then treated with CpG ODN 2007 (1 µg/mL), MWCNT-PySE-CpG ODN (1 µg/mL) or LPS (1 µg/mL) using a total volume of 200 µL/well. The treated cells were then incubated for an additional 24 h (Crippen et al., 2003) at 37 °C in CO2 incubator. Nitrite levels were measured as described previously. All treatments were done in triplicate.

2.11. Innate immune gene expression The HD11 cell line (1 × 106 cells/well) in 6 well plate was treated with various doses of CpG ODN or MWCNT-PySE-CpG ODN for 4 h or 24 h at 37 °C in a 5% CO2 incubator. Cells were also treated with a RPMI 1640 media control as well as a negative control of 5 µg/mL of MWCNT. RNA was isolated using an RNA easy isolation kit (Qiagen, USA) following the manufactures’ protocol. The cDNA was then transcribed from isolated RNA using an iScript CDNA synthesis kit (Bio- Rad, USA) following manufacturer’s protocol. The cDNA was used to test the expression profile of select innate immune genes by use of quantitative real-time polymerase chain reaction (qRT-PCR) as described before (Aich et al., 2007). Expression of select innate immune genes is expressed as fold change values which is the amount of expression in treated cells compared to gene expression in media treated control cells. An average of triplicate measurements was presented and all fold changes were normalized against GAPDH as a housekeeping gene.

2.9. Protection of chickens against Salmonella infection 2.9.1. Salmonella Typhimurium culture and protection study A field isolate of Salmonella Typhimurium from a 25-wk-old broiler chicken was used as the challenge strain. Bacteria for use as the challenge were cultured on Brain Heart Infusion (BHI) Agar for 18–24 h at 37 C from a frozen stock culture. Two to three colonies of bacteria from the agar plate were added to 200 ml of BHI broth (Miller, BDH, Poole, United Kingdom) in a 1-l Erlenmeyer flask. The culture was grown at 37 C for 16–18 h with shaking at 200 rpm. The cultures were further diluted in cold BHI broth to the concentration of bacteria required in the challenge experiments. Birds were challenged with either 1 × 106, 1 × 107, or 1 × 108 cfu of Salmonella Typhimurium in a 250 µL volume, subcutaneously in the neck. Serial dilutions of the challenge were cultured on BHI plates, in duplicate for 18–24 h at 37C to validate the challenge dose. All procedures with animals were done according to the protocol approved by the University of Saskatchewan, Committee on Animal Care. Day-old leghorn chickens hatched from Specific Pathogen Free Eggs were identified individually by neck tags (Swiftack Poultry Tags, Heartland Animal Health Inc., MO). Day-old chickens were randomly divided into groups of 25 and housed in the Animal Care housing facilities, Vaccine and Infectious Disease Organization, University of Saskatchewan. Water and commercial broiler ration were provided ad libitum. Air from each room was exhausted through a HEPA filter and replaced with non-recirculated intake air at a rate of 18 changes/h. Airpressure differentials and strict sanitation were maintained in this isolation facility. Photoperiods of 24 h per day for the first 3 days and 8 h per day for the remaining 7 days were established. Room temperature was maintained at 30–32 C for the first week and 28–30 C for the second week. Birds were observed twice daily for 10 days following Salmonella

3. Results 3.1. Selection of linkage of CpG ODN to MWCNT To select which of the chemistries to use to link CpG ODN to MWCNTs the ability of three types of MWCNT-CpG ODN to stimulate immune responses was compared. Two methods used adsorption of CpG ODN onto the surface of the MWCNT, either with a linker (PySE), designated as MWCNT-1-CpG ODN, or directly, designated as MWCNT-2CpG ODN. The third chemistry used an electrostatic linker, PEI, and is designated as MWCNT-3-CpG ODN. In all conjugates MWCNT and CpG ODN ratios were 1:1. The first measurement of the immune stimulating capabilities of the conjugates was the ability to stimulate lymphocyte proliferation. Chicken lymphocytes, isolated from chicken spleens, were treated with the three MWCNT-CpG ODNs, free CpG ODN, or free MWCNT. Cells were also treated with Con A (5 µg/mL) as a positive control as this mitogen stimulates lymphocyte proliferation. Untreated cells were used as a negative control in order to determine the proliferation of the treated cells. Proliferation was measured 48 h posttreatment. It was observed that the stimulating ability of CpG ODN was dose-dependent and decreased as the dose decreased. This was also observed with MWCNT-2-CpG ODN and MWCNT-3-CpG ODN treatments. In contrast treatment with MWCNT-1-CpG ODN was able to stimulate proliferation with doses as low as 0.005 µg/mL. A dose titration of cellular proliferation was done at 0.005, 0.05, 0.5 and 5 µg/ 138

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

3.2. Uptake of free and linked CpG ODN A comparative cellular uptake assay was performed with the chicken macrophage cell line HD11 to observe the uptake of both CpG ODN and MWCNT-1-CpG ODN by innate immune cells. A time course study was conducted to see if MWCNT-1-CpG ODN can enter the cells more rapidly than unformulated CpG ODN. After 30 min uptake of both CpG ODN and MWCNT-1-CpG ODN was observed and localization at the cell membrane was seen At one hour post treatment both molecules begin to localize within the macrophage cytoplasm and after two hours the localization of both CpG ODN and MWCNT-1-CpG ODN was focused on certain areas within the cytoplasm and the intensity of the fluorescence increased. Four hours post treatment the localization remained in the cytoplasm for both molecules but the intensity of fluorescence had increased indicating further uptake of the molecules over time (Fig. 3C–F). It also appears that the cells receiving the MWCNT-CpG ODN show greater fluorescence than the cells receiving CpG ODN treatment indicating more MWCNT-1-CpG ODN is being taken up by the cells or remaining in the cell longer. Cells treated with the Cy3 dye alone did not show localization within the cell and the dye remained localized at the membrane even four hours post-treatment (Fig. 3A and B). To ensure that MWCNT-CpG ODN was reaching the same intracellular target as free CpG ODN and to determine if there was a different mechanism of cellular uptake between the two molecules an inhibition study was conducted using HD11 cells. CpG ODN is known to stimulate nitrite production in the chicken macrophage line. We observed that MWCNT linked CpG ODN stimulated the same level of nitrite production in these cells (Fig. S1). To examine the role of cellular uptake on macrophage activation for both free and MWCNT linked CpG ODN inhibitors of clathrin-mediated endocytosis and endosomal maturation were used to pre-treat the cells before treatment with the two molecules. LPS was used as a negative control as its target receptor is TLR4 which is located on the cell surface. It was observed that when clathrin-mediated endocytosis was inhibited with MDS there was a significant reduction in nitrite production for cells treated either with free or MWCNT linked CpG ODN (Fig. 4A). It was observed that inhibition of endosomal maturation with chloroquine also resulted in a significant reduction in nitrite production in macrophages treated with either free or MWCNT linked CpG ODN (Fig. 4B).

Fig. 1. Comparative Cellular Proliferation. Splenocytes isolated from chickens (n = 8) were treated with differently conjugated CpG ODNs. Control cells were treated with Con A (positive control, 5 µg/mL). Cells were treated for 48 h. Proliferative response is graphed as the fold change in cell number compared to media treated cells. The median of the mean of three replicates for each bird is shown in the graph. MWCNT-1-CpG ODN generates a significant proliferative response compared to a,b, and c. p < 0.0001.

mL concentrations of free and MWCNT-linked CpG-ODN. For free CpG ODN no proliferation was detected below 5 µg/mL while for MWCNT-1CpG ODN at 0.005 µg/mL proliferation was comparable to that of 5 µg/ mL CON A. Increased proliferation compared to the media treated control occurred in cells receiving either 5 µg/mL of free CpG ODN any of the three linked MWCNT-CpG ODNs at 0.005 µg/mL and 5 µg/mL of MWCNT or Con A (Fig. 1). Cells treated with CNT-1-CpG ODN significantly stimulate lymphocyte proliferation compared to MWCNT, CpG ODN, MWCNT-2-CpG ODN and MWCNT-3-CpG ODN treated cells. The level of proliferation of MWCNT-1-CpG ODN treated cells is comparable to the Con A treated cells. Treatment with MWCNT alone did not stimulate a significant proliferative response in cells even at high doses. To further examine the three chemistries used to link CpG ODN to MWCNT gene expression in the chicken macrophage cell HD11 treated with various doses of the three MWCNT-CpG ODN, CpG ODN or MWCNT was examined to see if there was a significant difference in the immune stimulation of innate immune cells between the three conjugates. At 4 h post stimulation, there was an increase in key innate immune genes such as TLR7, TLR15, MyD88 and NFkB1 that showed the same level of up-regulation for treatment all three conjugates. However, other innate immune genes showed higher expression with treatment with MWCNT-1-CpG ODN compared to treatment with MWCNT-2-CpG ODN and MWCNT-3-CpG ODN (Fig. 2A–D). These results indicated that MWCNT-1-CpG ODN generates an improved innate gene response and generated improved lymphocyte proliferation compared to free CpG ODN, MWCNT-2-CpG ODN, and MWCNT-3-CpG ODN. We, therefore, concluded that MWCNT-1-CpG ODN is the best chemistry to link CpG ODN to MWCNT and this chemistry was used for all further studies.

3.3. In vivo protection study Having established in vitro that MWCNT-CpG ODN was taken up by target cells and showed improved immune stimulating capabilities compared to free CpG ODN we investigated the immune stimulating ability of MWCNT-CpG ODN in vivo. A protection study was performed to determine the in vivo effect MWCNT-CpG ODN has on the immune system in a young chicken model. Various doses of MWCNT-CpG ODN or CpG ODN were injected into one-day old leghorn chickens before they were challenged with a dose of Salmonella Typhimurium know to cause significant septicemia and mortality. The level of protection provided by MWCNT was the same as the level of protection provided by the PBS control. In contrast, the MWCNT-CpG in doses greater than 0.1 µg provided protection (Fig. 5). The linked CpG ODN did not lose any ability to protect the chickens as high concentrations of MWCNTCpG ODN and CpG ODN are just as effective at protecting the chickens (Fig. S2). However, at the lower concentration of 0.1 µg per injection, MWCNT-CpG ODN was significantly more effective (P < 0.05) at protecting chickens against a lethal bacterial dose compared to the same concentration of CpG ODN alone (Graphical abstract, Fig. 5). 3.4. In vivo cellular recruitment An in vivo study was done in chickens to determine the amount of cellular recruitment that occurs to the site of injection with various 139

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

Fig. 2. Relative fold changes in select innate immune gene expression. Fold changes of select innate immune genes in HD 11 cell following treatment for 4 h with various agents with respect to untreated media control. (A) TLR7 (B) TLR15 (C) MyD88 (D) NFκ-B1. Presented as a bar diagram with ± 1SD as error bars. Fig. 3. Confocal microscopy visualization of uptake of MWCNT-linked CpG ODN by HD11 cells. Uptake of free and MWCNT-linked CpG ODN after 4 h treatments with (B) Cy3, (D) CpG-Cy3, and (F) MWCNT-CpG-Cy3. Zoomed in sections of various uptake for (A) Cy3, (C) CpG-Cy3, and (F) MWCNTCpG-Cy3 are shown. Blue regions in the spectra indicate Hoechst 33342 stained nucleolus and Red region indicates Cy3 labeled CpG ODN. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

severe cellular recruitment and inflammation after 1 day which remained until day 7. At day 2 the higher CpG ODN concentrations (10 µg and 1 µg) showed extreme inflammation with tissue-damaging myositis and cellulitis. This was not observed with the MWCNT-CpG ODN conjugates. At a concentration of 1 µg both CpG ODN and MWCNT-CpG ODN were able to generate similar levels of cell recruitment which did not peak until day 2 (Fig. 7A). At day 1 and day 2 there was more cellular recruitment to the injection site for the 0.1 µg MWCNT-CpG ODN treated chickens than the 0.1 µg CpG ODN treated chickens. By day 3 MWCNT-CpG ODN treated chicken cellular recruitment to the

doses of CpG ODN and MWCNT-CpG ODN as well as negative controls PBS and MWCNT. The severity of the cell recruitment was scored on a scale from 0 to 4 where 4 is the largest amount of cell recruitment to the injection site. A representative picture of each level is found in Fig. 6. The majority of the cells recruited to the site of injection were mononuclear cells such as lymphocytes and macrophages. The amount of cell recruitment was measured over a time course of 1, 2, 3 and 7 days posttreatment of CpG ODN and MWCNT-CpG ODN at a concentration of 1 µg and 0.1 µg per dose. A summary of recruitment in all groups is given in Table S1. Higher concentrations of CpG ODN (10 µg) showed 140

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

stimulating the most gene expression (Fig. 8C). The expression of IL-8 is also significantly higher for cells treated with MWCNT-CpG ODN compared to cells treated with CpG ODN with the highest response being generated with 0.5 µg/mL treatment with MWCNT-CpG ODN (Fig. 8D). 4. Discussion 4.1. Selection of linkage of CpG ODN to MWCNT In order to select the chemistry that provided the strongest immune response at the lowest dose, we compared the lymphocyte proliferative response after exposure of cells to each of the three chemistry linkages. The proliferation of B cells in response to proper stimuli is a sign of the generation of an immune response (Miyamoto et al., 2002). It has been shown in other species that CpG ODN is able to stimulate a proliferative B cell response with treatment (Booth et al., 2007). Here, we isolated lymphocytes from chicken spleens where a mix of B lymphocytes, T lymphocytes and other mononuclear cells present (Neelima et al., 2003). After 48 h, the proliferative responses were measured and it was found that the cells treated with CpG ODN, MWCNT-2-CpG ODN, and MWCNT-3-CpG ODN showed significant proliferation (p < 0.05) at treatment doses of 5 µg/mL. When the treatment dose of MWCNTCOOH was lowered ten-fold the proliferative response dropped dramatically to levels comparable to the negative control cells treated with media. It has been demonstrated that low concentrations of free CpG ODN is not able to elicit a strong immune response and it is believed that this is due to the instability of the molecule (Dar et al., 2009). However, it was observed that treatment with MWCNT-1-CpG ODN gave a high proliferative result at 5 µg/mL which remained constant even to 0.005 µg/mL (Fig. 1). Therefore, we believe that this chemistry would appear to be the most suited of those tested for improving the biological activity of CpG ODN. The use of PySE as a linker may be most effective due to the pi stacking interactions which lead to a stable and strong non-covalent interaction without disrupting the structure of CpG ODN (Yang et al., 2008). We also examined the up-regulation of some important innate immune genes in HD11 chicken macrophage cells treated with a dose titration of the three MWCNT-CpG ODN linkages. It was observed that certain genes were expressed at higher levels with treatment with MWCNT-1-CpG ODN compared to cells treated with MWCNT-2-CpG ODN, MWCNT-3-CpG ODN and free CpG ODN (Fig. 2). The genes, TLR7, TLR15, MyD88, and NF-kB, expressed are vital to immune responses generated by CpG ODN. MyD88 is an important adapter protein that is recruited to toll-like receptors when they come in contact with their ligands. MyD88 interacts with other proteins such as IRAK and TRAF6 which forms a complex that results in the up-regulation of innate immune cytokines (Krieg, 2006). NF-κB is an important transcription factor which can be stimulated by mitogens such as LPS and CpG ODN (Crippen et al., 2003). Once active, NF-κB translocates into the nucleus where it is involved in the transcription of innate immune cytokines. The up-regulation of TLR7 and TLR15 may indicate how CpG ODN is recognized in chicken cells as avian species lack TLR9, which mammals use to recognize CpG ODN. TLR7 is also located within the endosome as is TLR9 and it may be possible that it functions like TLR9 in avian species. It has also recently been discovered that chickens who have been infected with Salmonella have an upregulation of TLR15 (Higgs et al., 2006) as well as TLR21, has been indicated as the receptor for CpG ODN in chicken (Brownlie et al., 2009). It may be possible that TLR15 and TLR 21 are involved in CpG ODN recognition in the avian species or working in tandem with TLR7. The observations here show that CpG ODN bound to MWCNT with the use of PySE as a non-covalent linker is able to stimulate these innate immune genes at a lower concentration than free CpG ODN or any other linking chemistry attempted in this study. This may be to due to a stronger stacking interaction between MWCNT and CpG ODN due to the Pyrene in PySE.

Fig. 4. Inhibition of nitric oxide production. Inhibition of nitrite production in HD 11 cells pretreated with different concentrations of inhibitors (A) MDS, (B) Chloroquine, following 24 h treatment with either 1 µg/mL of CpG ODN, or MWCNT-CpG or LPS. Mean values of three biological replicates with 1-SD are plotted.

injection site drops to the same level as the CpG ODN treated chicken then further drops by day 7 (Fig. 7B). 3.5. Select innate immune gene activation Since immune cells produce important cytokines in response to activation by molecules such as CpG ODN it may be lower doses of MWCNT-CpG ODN are able to more effectively activate cells to produce immune stimulating cytokines than unformulated CpG ODN. Innate immune genes including IL-6, IL-12, IL-8, IL-1b, IL-6 and IL-12, that are expressed by activated macrophages and act as inflammatory cytokines to stimulate T cells. To observe the effect of CpG ODN and MWCNT-CpG ODN on the expression of these cytokines by HD11 cells the level of expression was measured using qRT-PCR. Cells were treated with various doses of either CpG ODN or MWCNT-CpG ODN for 24 h. Expression of all four genes was increased at 0.05 µg/mL MWCNT-CpG ODN treatment compared to the same concentration of CpG ODN treatment (Fig. 8). There is a significant increase in IL-6, IL-12, IL-8 and IL-1b gene expression by CpG ODN and MWCNT-CpG ODN treated cells. The expression of IL-6 and IL-12 were not as high as the other two cytokines but there was an increased expression with CpG ODN and MWCNT-CpG ODN treatment. There is also a significant difference (P < 0.05) in the fold change of these cytokines with the treatment of 0.05 µg/mL of MWCNT-CpG ODN compared to cells treated with the same dose of free CpG ODN (Fig. 8A and B). The expression of IL-1b in cells treated with free CpG ODN remains similar for all doses however for cells treated with MWCNT-CpG ODN there is an increase in IL-1b expression as the dose lower. There is also significantly higher expression in cells treated with a lower dose of MWCNT-CpG ODN compared to cells treated with CpG ODN with a concentration of 0.05 µg/mL of MWCNT-CpG ODN 141

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

Fig. 5. Survival of chickens following treatment with different formulations of CpG ODN and challenge with Salmonella Typhimurium. Groups of birds (n = 25) were treated with 10 µg CpG ODN, 10 µg of MWCNT-CpG, 0.1 µg of MWCNT CpG ODN, 0.1 µg CpG ODN, 5 µg MWCNT (positive control) or PBS (negative control) by subcutaneous injection at 1 day of age. (A) The survival of birds was followed on day 7 following challenge at 5 days (day 0) of age with 1 × 108 colony-forming units of Salmonella Typhimurium and (B) role of 10 µg, 1 µg and 0.1 µg of MWCNT-CpG or CpG ODNs and 5 µg MWCNT (positive control) or PBS (negative control) by subcutaneous injection at 1 day of age following challenge at 5 –days of age with 1 × 105, 1 × 106, 1 × 107, and 1 × 108 colony-forming units of Salmonella Typhimurium. Outcome of treatment in terms of survivability with MWCNT CpG was significantly higher than outcome of treatment with CpG ODN at any concentrations, as shown in the figure with asterisk.

Fig. 6. Representative images of the severity of cell recruitment to injection site clockwise from top left (control), top right (mild/moderate), bottom right (moderatesevere), and to bottom left (severe) with scoring: 1 = mild; 2 = moderate; 3 = moderate-severe; 4 = severe.

142

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

observation rules out any differential cellular uptake as a reason for the increased immune response. Previous studies have indicated that CpG ODN requires at least 4 h to stimulate an immune response (Utaisincharoen et al., 2002; Xu et al., 2003). It was seen in our study that uptake begins almost immediately but it takes time for both free and MWCNT-linked CpG ODN to begin to localize in the cytoplasm. Localization was observed around 1 h post-treatment and by 2 h there is complete localization in the cytoplasm. By 4 h there is more concentrated localization in specific areas of the cytoplasm, presumably in the endosome where the target receptor is located (Fig. 3C–F). After 4 h there does appear that there is more MWCNT-linked CpG ODN localized within the cell compared to that of free CpG ODN. This could explain the increased immune response as there would be more CpG ODN to stimulate a stronger immune response. If there is an increase in MWCNT-linked CpG ODN in the cell over time it may be due to increased uptake or perhaps MWCNT is providing protection from degradation for CpG ODN, therefore there is more CpG ODN present to stimulate an immune response. Free CpG ODN is typically degraded by 3′ exonucleases fairly rapidly (Noll et al., 2005). It may be that by linking MWCNT to CpG ODN the exonuclease ability to degrade the CpG ODN molecule is impaired. We concluded from this study is that CpG ODN linked to MWCNT is able to be taken up by target cells as rapidly as free CpG ODN and that the linkage does not impede CpG ODNs uptake. Further studies were also conducted to determine how MWCNT-CpG ODN is taken up by the cells compared to the uptake of free CpG ODN. The addition of an inhibitor of clathrin-dependent endocytosis resulted in a dramatic decrease in the ability of both free and MWCNT-linked CpG ODN to stimulate nitric oxide production (Fig. 4A). The need of receptor-mediated endocytosis for CpG ODN to stimulate HD11 cells had been observed in other studies (Crippen et al., 2003). This study also indicated that MWCNT-linked CpG ODN also required clathrinmediated uptake into the cell and is not free to pass through the cellular membrane. MWCNT have been shown to be able to pass through cellular membranes on their own but it was clear that endocytosis was required for MWCNT-linked CpG ODN to enter into the cell. This may be due to the size or the charge of the CpG ODN (Bianco et al., 2005). It is known that the target receptor for CpG ODN in mammals is TLR 9 located in the endosome (Krieg, 2006). No TLR 9 orthologue has been found in avian species but they still respond to CpG ODN (Boyd et al., 2007; He et al., 2006). Recent work (Bartgel and Hapfelmeier, 2003) suggests that the chicken TLR 21 may be the avian receptor for CpG ODN. Previous studies have indicated that inhibition of endosomal maturation with an inhibitor like chloroquine prevents CpG ODN from stimulating macrophages to produce NO (Crippen et al., 2003). By using chloroquine we observed that MWCNT-linked CpG ODN also requires an endosomally located receptor to stimulate NO production in HD11 cells as there was a dramatic reduction in NO production by inhibiting endosome maturation for both free and MWCNT-linked CpG ODN (Fig. 4B). This study indicates that linking CpG ODN to MWCNT does not structurally alter CpG ODN as it is still recognized by an endosomally located receptor.

Fig. 7. Cell recruitment. Two-week old chicks were injected with various doses of either CpG ODN, MWCNT-CpG ODN or controls PBS and MWCNT. Subgroups were euthanized and biopsies were taken from the injection site and examined for cell recruitment. Subgroups = 1,2,3 and 7 days post-treatment. Scoring: 1 = mild; 2 = moderate; 3 = moderate-severe; 4 = severe. A) 1 µg of MWCNTCpG ODN or CpG ODN B) 0.1 µg MWCNT-CpG ODN or CpG ODN. ** indicates significant difference p < 0.01.

4.3. In vivo protection study

4.2. Uptake of free and linked CpG ODN

For a treatment to be acceptable to the poultry industry the cost must be as low as possible per bird. Therefore, the formulation that results in a decrease in the amount of material necessary to provide immune stimulation and protection from challenge is useful characteristic. Previous studies have indicated that free CpG ODN is able to provide protection against septicaemia caused by bacteria such as Salmonella Typhimurium and Eschericia coli (Gomis et al., 2003). In this study, we treated day old leghorn chickens with CpG ODN or MWCNTCpG ODN to see if there was improved protection at lower doses of the formulated CpG OLDN. It was observed that at doses of 10 and 1 µg both free and MWCNT linked CpG ODN were able to provide an

In order to reach intracellular receptors to trigger an immune CpG ODN is taken up by the target cells. Therefore, it was important to confirm that MWCNT-linked CpG ODN was taken up by target innate immune cells. The current results revealed that MWCNT-linked CpG ODN is able to stimulate a stronger immune response compared to the free form of CpG ODN. It was hypothesized that this increased immune stimulating ability may be due to quicker cellular uptake allowing a quicker response and more CpG ODN to enter the cell before it is degraded in the system. However, our uptake study revealed that cells rapidly take up both free and MWCNT-linked CpG ODN. This 143

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

Fig. 8. Fold Changes of select innate immune genes. Fold change values for transcriptional expression of (A) IL-6 (B) IL-12 (C) IL-1b and (D) IL-8 in HD-11 cells following 24 h treatment with different doses of free and MWCNT-linked CpG ODN with respect to media treated cells are shown. Fold changes for CNT treated cells are also shown as negative control. Mean values from three biological replicates with 1-SD are plotted. Bars with similar letters indicate a statistically significant difference. Small letters in each panel denote statistically significant difference (p < 0.05) between conditions with same letters.

(Uwiera et al., 2001). Cell recruitment to the site of injection is important as the immune cells converge on the CpG ODN and are stimulated to produce an immune response that prepares them for an encounter with a potential microbial pathogen. In this study with chickens our observations agreed with those previously published. We observed that the majority of the cells recruited to the site of injection were mononuclear cells including lymphocytes and macrophages. Some early recruitment of heterophils was also observed but the majority of the cells were mononuclear cells later in the observation period. Free MWCNT at 10 µg did not recruit any cells or cause any inflammation. This indicates that in vivo this dose is likely not toxic to the chicken or the chicken’s tissue and cells. It observed that at higher doses of CpG ODN there was significant cell recruitment early which was sustained until day 7 (Fig. 7A). This was not observed with the dose of 0.1 µg of CpG ODN (Fig. 7B). The cell recruitment of MWCNT-CpG ODN began more slowly but by day 2 significant cell recruitment was observed 1 µg and 0.1 µg (Fig. 7). After this time point, the degree of cell recruitment decreases in chickens treated with MWCNT-CpG ODN. It was observed that the doses of CpG ODN and MWCNT-CpG ODN that provided protection against a lethal challenge of bacteria had significant cell recruitment at day 2. Also, the treatment of 0.1 µg of CpG ODN only had moderate cell recruitment on day 2 and did not provide protection after

effective protective response against a lethal challenge of bacteria (Fig. S2). However, a difference between the two treatments was observed at a dose of 0.1 µg. At this concentration, MWCNT-CpG ODN provided a protective response comparable to a treatment of 10 µg of MWCNT-CpG ODN or CpG while 0.1 µg of free CpG ODN did not provide protection and the rate of survival was similar to the control birds treated with PBS (Graphical abstract, Fig. 5). MWCNT by itself also did not provide a protective immune response therefore the protection provided by MWCNT-CpG ODN is due to the CpG ODN linked to the carbon nanotube. These observations indicate that MWCNT-CpG ODN is more effective than CpG ODN at lower doses at providing protection in chickens against costly losses to bacterial infections.

4.4. In vivo cell recruitment To investigate the mechanism of the improved protection by MWCNT-CpG ODN compared to free CpG ODN we examined at cell recruitment to injection sites in vivo. It has been demonstrated in other studies that CpG ODN recruits immune cells to the site of injection (Mutwiri et al., 2004; Uwiera et al., 2001). The cells recruited to the site of injection after 24 h were both heterophils and mononuclear cells but by 72 h after injection mononuclear cells were the predominant type 144

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

infections. Further studies need to be done on the stability of the MWCNT-CpG ODN molecule to see if this response to lower doses is due to stability of CpG ODN or another reason. In general, nanomedicines or nanoparticle derived therapeutics are used mainly for cancer therapy. The current study is perhaps one of the very few studies using carbon nanotubes to activate immunity to finght infection. CNTs have been shown to have potential to treat and prevent infection (Gottardi and Douradinha, 2013; Rosen and Elman, 2009). It has been shown that carbon nanotubes and other nanoparticles, such as those which are made of silver or clustered nanoparticles, have potentials to be effective in treating various types of cancers (Li et al., 2016; Ong et al., 2013; Son et al., 2016). It has been argued that MWCNTs have better prospect in treating infectious diseases (Gottardi and Douradinha, 2013). Current study, perhaps for the first time, revealed the efficacy of non-covalently linked MWCNT to protect chickens against salmonella infection at a very low dose. Because of subcutaneous nature of the treatment and non-covalent mode of conjugation no toxicity is expected or seen.

a bacterial challenge. This suggests that in order to have a strong protective immune response generated by CpG ODN in chickens there need be significant cell recruitment to the site of injection on or before day 2 post initial treatment. Extent of the recruitment on day 1 and past day 2 seems not to matter for the ability to protect against lethal bacterial infections at least in the case of MWCNT-CpG ODN. The lower dose of MWCNT-CpG ODN may be able to recruit cells more effectively than free CpG ODN perhaps to the stability provided in vivo by the MWCNT 4.5. Select innate immune gene activation To further examine the mechanism of improved immune response to lower doses of MWCNT-CpG ODN compared to free CpG ODN the production of select innate immune cytokines produced by HD11 cells treated was examined. It has been demonstrated that key pro-inflammatory cytokines produced by stimulated innate immune cells are important to controlling certain types of infections (Blanks, 2007; Krieg, 2006). We observed that the same cytokines were being produced by free and MWCNT-linked CpG ODN but that there were significantly more pro-inflammatory cytokines being stimulated with a lower dose of MWCNT-linked CpG ODN compared to free CpG ODN of the same dose. It has been observed in this study that the biological function of CpG ODN has not been altered by linking the molecules to MWCNT. An important part of the biological activity of CpG ODN is to stimulate proinflammatory cytokines such as interleukins. We observed that both free and MWCNT-linked CpG ODN were able to stimulate key inflammatory cytokines at about the same increased level at higher concentrations for IL-6, IL-1b and IL-12 using qRT-PCR (Fig. 8). However, it was observed that the production of these cytokines and IL-8 are dramatically increased with a lower dose of MWCNT-linked CpG ODN compared to the same dose of free CpG ODN (Fig. 8D). This may explain part of the increased protective immune responses observed. IL-6 is a key pro-inflammatory cytokine produced by macrophages and dendritic cells to help fight against infections (Heinrich et al., 2003). IL-12 is also typically produced by activated dendritic cells and macrophages. It plays an important role in the differentiation of naive T cells and can stimulate IFN-γ and TNF-α by natural killer cells (Kalinski et al., 1997). IL-1b is an important cytokine in inflammatory responses such as bacterial infection and is also responsible for immune cell proliferation and differentiation as well as nitric oxide production in macrophages (Bencsath et al., 2003). IL-1b also stimulates the production of IL-8. Therefore, the increase in IL-1b observed correlates with the increase in IL-8. IL-8 has the ability to specifically activate neutrophil granulocytes. IL-8 causes a transient increase in cytosolic calcium levels in neutrophils to aid in release of enzymes from granules which helps destroy invading pathogens (Krieger et al., 1992). IL-8 also acts as a chemotactic cytokine which attracts other immune cells to the site of infection (Smith et al., 1991). These cytokines act as a first defense against infections as well as they recruit and activate adaptive immune cells to better fight infections. It is unclear why MWCNT-linked CpG ODN is able to stimulate more cytokine production in the HD11 cells at lower doses. It may be that MWCNT provides protection from degradation that allows more time for CpG ODN to stimulate these cytokines. The presence of more of these cytokines in vivo would stimulate a stronger longer lasting response that could result in effective clearance of intracellular pathogens (Patel et al., 2008). From the gene expression study there is a clear time course of innate immune activation. After 4 h there is an improved up-regulation of early innate genes such as tolllike receptors, adaptor proteins and transcription factors. After 24 h the downstream products of these early genes are also up-regulated at higher levels with lower doses of MWCNT-CpG ODN compared to the same dose of CpG ODN. Compared with the cell recruitment it would seem that the lower dose of MWCNT-CpG ODN is able to recruit immune cells to the site of injection and after 24 h there is significant upregulation of key cytokines that prepares the host to fight potential

5. Conclusions Several chemistries are available to link molecules such as CpG ODN to carbon nanotubes. However, we found that adsorption through the use of a linker that uses non-covalent interactions provides the strongest interaction allowing an improved immune response to CpG ODN at lower doses compared to other chemistries attempted and free CpG ODN itself. This was demonstrated in vitro using two types of chicken cells, splenic lymphocytes and macrophages. Both these cell types are crucial for generating a strong immune response. The ability to use lower doses of CpG ODN when linked to MWCNT may be due to the carbon nanotube providing protection against rapid degradation of the CpG ODN molecule. We observed that there was no alteration in the ability of the MWCNT linked CpG ODN to enter the cell but there appears to be more of the bound CpG ODN in the cell compared to free CpG ODN with the passage of time. Perhaps this is due to the stability provided by MWCNT. Further studies need to be conducted in vitro and in vivo to compare the degradation of the free versus MWCNT bound CpG ODN. We also found that this improved immune stimulation at lower doses of MWCNT-CpG ODN remains in vivo. We found that our in vitro observations correlated with our observations in vivo. We found that at a significantly lower dose, MWCNT-CpG ODN was better at providing a protective immune response compared to the same dose of free CpG ODN in chickens. To try to better understand why this occurred an in vivo cell recruitment study was conducted. It was found that for CpG ODN to provide protection it is critical for high levels of immune cell recruitment to the site of treatment injection to occur on day two post treatment. This was one day before challenge. This was observed in all the treatment doses that provided adequate protection against a lethal bacterial protection including the dose of 0.1 µg of MWCNT-CpG ODN but not in the same dose of free CpG ODN which did not provide protection in chickens. This indicates that the lower dose of MWCNT-CpG ODN is able to attract immune cells and provide a protective immune response not seen at the same dose of free CpG ODN. This study also indicates that MWCNT alone does not cause any type of immune response or inflammation which could have negative effects towards the host. In most studies, we used MWCNT-COOH alone with and without the addition of PySE and found no difference in immune stimulation between the two different forms. Studies still need to be conducted on the toxicity of carbon nanotubes but from these studies the doses used here did not cause any harm towards the host or tissue. The study established the efficacy of a noncovalently conjugated CpG with MWCNT in treating bacterial infection. Declarations

• Ethics approval and consent to participate: This work was approved 145

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

• • • • • •

by the University of Saskatchewan’s Animal Research Ethics Board and adhered to the Canadian Council on Animal Care guidelines for humane animal use. Consent for publication: Not applicable. Availability of data and material: All data generated or analyzed during this study are included in this published article [and its supplementary information files]. However, if there is further query that can be addressed to the corresponding author. Competing interests: Authors declare that there is no financial or non-financial competing interests for this report. Funding: Funding to support part of the work was approved by the Saskatchewan Chicken Industry Development Fund (SCIDF) to Palok Aich, PhD. Authors’ contributions: JT and JH executed most of the experiments and analyzed data. BA and SG assisted in the chicken experiment. SG analyzed the histology analysis. PA conceptualized, supervised and finalized he manuscript. Authors acknowledge the facility and infrastructure provided by VIDO-Intervac and NISER to execute and publish the work. This work is published as VIDO-InterVac manuscript #849.

D.J., Babiuk, L.A., O'Farrelly, C., 2006. Induction of a novel chicken Toll-like receptor following Salmonella enterica serovar Typhimurium infection. Infect. Immun. 74, 1692–1698. Ishii, K.J., Akira, S., 2006. Innate immune recognition of, and regulation by, DNA. Trends Immunol. 27, 525–532. Kalinski, P., Hilkens, C.M., Snijders, A., Snijdewint, F.G., Kapsenberg, M.L., 1997. IL-12deficient dendritic cells, generated in the presence of prostaglandin E2, promote type 2 cytokine production in maturing human naive T helper cells. J. Immunol. 159, 28–35. Kam, N.W., O'Connell, M., Wisdom, J.A., Dai, H., 2005. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proc. Natl. Acad. Sci. USA 102, 11600–11605. Krieg, A.M., 2006. Therapeutic potential of Toll-like receptor 9 activation. Nat. Rev. Drug Discov. 5, 471–484. Krieger, M., Brunner, T., Bischoff, S.C., von Tscharner, V., Walz, A., Moser, B., Baggiolini, M., Dahinden, C.A., 1992. Activation of human basophils through the IL-8 receptor. J. Immunol. 149, 2662–2667. Lacerda, L., Bianco, A., Prato, M., Kostarelos, K., 2006. Carbon nanotubes as nanomedicines: from toxicology to pharmacology. Adv. Drug. Deliv. Rev. 58, 1460–1470. Lei, Z.L., Wei, X.Y., Zhang, L., Bi, S.X., 2008. Preparation and characterization of carbon nanotubes-polymer/CdSe hybrid nanocomposites through combining electrostatic adsorption and ATRP technique. Colloids Surf. a-Physicochem. Eng. Aspects 324, 131–136. Li, H.J., Du, J.Z., Du, X.J., Xu, C.F., Sun, C.Y., Wang, H.X., Cao, Z.T., Yang, X.Z., Zhu, Y.H., Nie, S., Wang, J., 2016. Stimuli-responsive clustered nanoparticles for improved tumor penetration and therapeutic efficacy. Proc. Natl. Acad. Sci. USA 113, 4164–4169. Mena, A., Nichani, A.K., Popowych, Y., Ioannou, X.P., Godson, D.L., Mutwiri, G.K., Hecker, R., Babiuk, L.A., Griebel, P., 2003. Bovine and ovine blood mononuclear leukocytes differ markedly in innate immune responses induced by Class A and Class B CpG-oligodeoxynucleotide. Oligonucleotides 13, 245–259. Meng, J., Yang, M., Jia, F., Kong, H., Zhang, W., Wang, C., Xing, J., Xie, S., Xu, H., 2010. Subcutaneous injection of water-soluble multi-walled carbon nanotubes in tumorbearing mice boosts the host immune activity. Nanotechnology 21, 145104. Miyamoto, T., Min, W., Lillehoj, H.S., 2002. Lymphocyte proliferation response during Eimeria tenella infection assessed by a new, reliable, nonradioactive colorimetric assay. Avian. Dis. 46, 10–16. Mutwiri, G., Pontarollo, R., Babiuk, S., Griebel, P., van Drunen Littel-van den Hurk, S., Mena, A., Tsang, C., Alcon, V., Nichani, A., Ioannou, X., Gomis, S., Townsend, H., Hecker, R., Potter, A., Babiuk, L.A., 2003. Biological activity of immunostimulatory CpG DNA motifs in domestic animals. Vet. Immunol. Immunopathol. 91, 89–103. Mutwiri, G.K., Nichani, A.K., Babiuk, S., Babiuk, L.A., 2004. Strategies for enhancing the immunostimulatory effects of CpG oligodeoxynucleotides. J. Controlled Rel. 97, 1–17. Neelima, S., Ram, G.C., Kataria, J.M., Goswami, T.K., 2003. Avian reovirus induces an inhibitory effect on lymphoproliferation in chickens. Vet. Res. Commun. 27, 73–85. Noll, B.O., McCluskie, M.J., Sniatala, T., Lohner, A., Yuill, S., Krieg, A.M., Schetter, C., Davis, H.L., Uhlmann, E., 2005. Biodistribution and metabolism of immunostimulatory oligodeoxynucleotide CPG 7909 in mouse and rat tissues following subcutaneous administration. Biochem. Pharmacol. 69, 981–991. Ong, C., Lim, J.Z., Ng, C.T., Li, J.J., Yung, L.Y., Bay, B.H., 2013. Silver nanoparticles in cancer: therapeutic efficacy and toxicity. Curr. Med. Chem. 20, 772–781. Pastorin, G., 2009. Crucial functionalizations of carbon nanotubes for improved drug delivery: a valuable option? Pharm. Res. 26, 746–769. Patel, B.A., Gomis, S., Dar, A., Willson, P.J., Babiuk, L.A., Potter, A., Mutwiri, G., Tikoo, S.K., 2008. Oligodeoxynucleotides containing CpG motifs (CpG-ODN) predominantly induce Th1-type immune response in neonatal chicks. Dev. Comp. Immunol. 32, 1041–1049. Poland, C.A., Duffin, R., Kinloch, I., Maynard, A., Wallace, W.A., Seaton, A., Stone, V., Brown, S., Macnee, W., Donaldson, K., 2008. Carbon nanotubes introduced into the abdominal cavity of mice show asbestos-like pathogenicity in a pilot study. Nat. Nanotechnol. 3, 423–428. Riehemann, K., Schneider, S.W., Luger, T.A., Godin, B., Ferrari, M., Fuchs, H., 2009. Nanomedicine–challenge and perspectives. Angew. Chem. Int. Ed. Engl. 48, 872–897. Rosen, Y., Elman, N.M., 2009. Carbon nanotubes in drug delivery: focus on infectious diseases. Expert Opin. Drug. Deliv. 6, 517–530. Sakamoto, J., Annapragada, A., Decuzzi, P., Ferrari, M., 2007. Antibiological barrier nanovector technology for cancer applications. Expert Opin. Drug. Deliv. 4, 359–369. Shim, M., Kam, N.W.S., Chen, R.J., Li, Y.M., Dai, H.J., 2002. Functionalization of carbon nanotubes for biocompatibility and biomolecular recognition. Nano Letters 2, 285–288. Singh, R., Pantarotto, D., Lacerda, L., Pastorin, G., Klumpp, C., Prato, M., Bianco, A., Kostarelos, K., 2006. Tissue biodistribution and blood clearance rates of intravenously administered carbon nanotube radiotracers. Proc. Natl. Acad. Sci. USA 103, 3357–3362. Smith, W.B., Gamble, J.R., Clark-Lewis, I., Vadas, M.A., 1991. Interleukin-8 induces neutrophil transendothelial migration. Immunology 72, 65–72. Son, K.H., Hong, J.H., Lee, J.W., 2016. Carbon nanotubes as cancer therapeutic carriers and mediators. Int. J. Nanomed. 11, 5163–5185. Taghavi, A., Allan, B., Mutwiri, G., Van Kessel, A., Willson, P., Babiuk, L., Potter, A., Gomis, S., 2008. Protection of neonatal broiler chicks against Salmonella Typhimurium septicemia by DNA containing CpG motifs. Avian Dis. 52, 398–406. Utaisincharoen, P., Anuntagool, N., Chaisuriya, P., Pichyangkul, S., Sirisinha, S., 2002. CpG ODN activates NO and iNOS production in mouse macrophage cell line (RAW 264.7). Clin. Exp. Immunol. 128, 467–473. Uwiera, R.R., Gerdts, V., Pontarollo, R.A., Babiuk, L.A., Middleton, D.M., Griebel, P.J.,

Appendix A. Supplementary material Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ijpharm.2019.02.040. References Aich, P., Wilson, H.L., Kaushik, R.S., Potter, A.A., Babiuk, L.A., Griebel, P., 2007. Comparative analysis of innate immune responses following infection of newborn calves with bovine rotavirus and bovine coronavirus. J. Gen. Virol. 88, 2749–2761. Bartgel, M., Hapfelmeier, S., 2003. Pretreatment of mice with streptomycin provides a Salmonella enterica serovar typhimurium colitis model that allows analysis of both pathogen and host. Infect. Immun. 71 SRC - GoogleScholar. Bencsath, M., Blaskovits, A., Borvendeg, J., 2003. Biomolecular cytokine therapy. Pathol. Oncol. Res. 9, 24–29. Bianco, A., Hoebeke, J., Kostarelos, K., Prato, M., Partidos, C.D., 2005. Carbon nanotubes: on the road to deliver. Curr. Drug. Deliv. 2, 253–259. Blanks, D.A., 2007. Immunostimulatory sequences in immunotherapy. Curr. Opin. Otolaryngol. Head Neck Surg. 15, 281–285. Booth, J.S., Nichani, A.K., Benjamin, P., Dar, A., Krieg, A.M., Babiuk, L.A., Mutwiri, G.K., 2007. Innate immune responses induced by classes of CpG oligodeoxynucleotides in ovine lymph node and blood mononuclear cells. Vet. Immunol. Immunopathol. 115, 24–34. Boyd, A., Philbin, V.J., Smith, A.L., 2007. Conserved and distinct aspects of the avian Tolllike receptor (TLR) system: implications for transmission and control of bird-borne zoonoses. Biochem. Soc. Trans. 35, 1504–1507. Brownlie, R., Zhu, J., Allan, B., Mutwiri, G.K., Babiuk, L.A., Potter, A., Griebel, P., 2009. Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG oligodeoxynucleotides. Mol. Immunol. 46, 3163–3170. Chen, R.J., Zhang, Y., Wang, D., Dai, H., 2001. Noncovalent sidewall functionalization of single-walled carbon nanotubes for protein immobilization. J. Am. Chem. Soc. 123, 3838–3839. Chicharro, M., Arribas, A.S., Moreno, M., Bermejo, E., Zapardiel, A., 2007. Comparative study of multi walled carbon nanotubes-based electrodes in micellar media and their application to micellar electrokinetic capillary chromatography. Talanta 74, 376–386. Crippen, T.L., Sheffield, C.L., He, H., Lowry, V.K., Kogut, M.H., 2003. Differential nitric oxide production by chicken immune cells. Dev. Comp. Immunol. 27, 603–610. Dar, A., Allan, B., Gomis, S., Potter, A., Mutwiri, G., 2009. Immunotherapeutic Potential of CpG Oligonucleotides in Chickens. J. Poultry Sci. 46, 69–80. Gomis, S., Babiuk, L., Godson, D.L., Allan, B., Thrush, T., Townsend, H., Willson, P., Waters, E., Hecker, R., Potter, A., 2003. Protection of chickens against Escherichia coli infections by DNA containing CpG motifs. Infect Immun 71, 857–863. Gottardi, R., Douradinha, B., 2013. Carbon nanotubes as a novel tool for vaccination against infectious diseases and cancer. J. Nanobiotechnol. 11, 30. He, H., Crippen, T.L., Farnell, M.B., Kogut, M.H., 2003. Identification of CpG oligodeoxynucleotide motifs that stimulate nitric oxide and cytokine production in avian macrophage and peripheral blood mononuclear cells. Dev. Comp. Immunol. 27, 621–627. He, H., Genovese, K.J., Nisbet, D.J., Kogut, M.H., 2006. Profile of Toll-like receptor expressions and induction of nitric oxide synthesis by Toll-like receptor agonists in chicken monocytes. Mol. Immunol. 43, 783–789. Heinrich, P.C., Behrmann, I., Haan, S., Hermanns, H.M., Muller-Newen, G., Schaper, F., 2003. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem. J. 374, 1–20. Higgs, R., Cormican, P., Cahalane, S., Allan, B., Lloyd, A.T., Meade, K., James, T., Lynn,

146

International Journal of Pharmaceutics 561 (2019) 135–147

J. Tomporowski, et al.

electrocatalysis of hemoglobin on 1-pyrenebutanoic acid succinimidyl ester/multiwalled carbon nanotube and Au nanoparticle modified electrode. Electroanalysis 20, 2134–2140. Zeinabad, H.A., Zarrabian, A., Saboury, A.A., Alizadeh, A.M., Falahati, M., 2016. Interaction of single and multi wall carbon nanotubes with the biological systems: tau protein and PC12 cells as targets. Sci. Rep. 6, 26508. Zhang, J., Tang, H., Liu, Z., Chen, B., 2017. Effects of major parameters of nanoparticles on their physical and chemical properties and recent application of nanodrug delivery system in targeted chemotherapy. Int. J. Nanomed. 12, 8483–8493.

2001. Plasmid DNA induces increased lymphocyte trafficking: a specific role for CpG motifs. Cell Immunol. 214, 155–164. Xie, H., Raybourne, R.B., Babu, U.S., Lillehoj, H.S., Heckert, R.A., 2003. CpG-induced immunomodulation and intracellular bacterial killing in a chicken macrophage cell line. Dev. Comp. Immunol. 27, 823–834. Xu, H., An, H., Yu, Y., Zhang, M., Qi, R., Cao, X., 2003. Ras participates in CpG oligodeoxynucleotide signaling through association with toll-like receptor 9 and promotion of interleukin-1 receptor-associated kinase/tumor necrosis factor receptor-associated factor 6 complex formation in macrophages. J. Biol. Chem. 278, 36334–36340. Yang, J., Pang, F.Y., Zhang, R.Y., Xu, Y., He, P.A., Fang, Y.Z., 2008. Electrochemistry and

147