- Email: [email protected]
Cas9-mediated off-target rate for MSTN gene knockout in bovines
Journal of Integrative Agriculture 2019, 18(12): 2835–2843 Available online at www.sciencedirect.com
ScienceDirect
RESEARCH ARTICLE
Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines ZHOU Zheng-wei*, CAO Guo-hua*, LI Zhe*, HAN Xue-jie, LI Chen, LU Zhen-yu, ZHAO Yu-hang, LI Xue-ling State Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.China
Abstract The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/ Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/ Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology. Keywords: CRISPR/Cas9, gRNA, targeting site, off-target rate
Received 19 October, 2018 Accepted 11 June, 2019 ZHOU Zheng-wei, E-mail: [email protected]; Correspondence LI Xue-ling, Tel: +86-471-3679807, E-mail: lixueling@hotmail. com * These authors contributed equally to this study. © 2019 CAAS. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/). doi:10.1016/S2095-3119(19)62744-9
1. Introduction The myostatin (MSTN) gene was first cloned from a mouse skeletal muscle cDNA library by Grobet’s team from the John Hopkins University School of Medicine in 1997 (Grobet et al. 1997; Aiello et al. 2018). It is a class of skeletal muscle specially-expressed glycoprotein, and
2836
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
it is also known as transforming growth factor-β (TGF-β) or growth-differentiation factor-8 (GDF-8) (Kambadur et al. 1997). Previous studies showed that the MSTN myokine can negatively regulate the growth of skeletal muscle. Loss of function and other mutation of this gene, or other mutation of this gene, is beneficial to the proliferation, quality improvement, and reduced fat rate of animal muscle tissue (Clop et al. 2006; Boman et al. 2009). Therefore, knockout of the MSTN gene in livestock is of great significance in production practice and breeding (Clop et al. 2006; Zhao et al. 2014; Proudfoot et al. 2015). The most commonly used modern gene editing technique is the CRISPR/Cas nuclease (clustered regular interspaced short-palindromic repeats/CRISPR-associated nucleases) (O’Geen et al. 2015). Compared with zinc finder nuclease (ZFN) and transcription activator-like effector nuclease (TALEN) technologies, CRISPR/Cas technology is simpler and more efficient (Li et al. 2011; Liu et al. 2013; Montague et al. 2014). Over the past decade, many studies (Jinek et al. 2012; Mali et al. 2013; Ni et al. 2014) have described the principles of CRISPR/Cas9 technology and used it to transform the genome of human and mouse cell lines, thus leading to the further development of this technology. In recent years, CRISPR/Cas9 technology has been successfully applied to genome-based editing in animals (Chang et al. 2013), plants (Zhou et al. 2016), and microorganisms (Jakočiūnas et al. 2015). However, the off-target effects of CRISPR/Cas9 have become well known. Studies (Fu et al. 2014) have shown that, during precise gene targeting, different lengths of gRNA-directed targeting will cause mismatches in number or location, and thus the length of gRNA is the main factor affecting the target and off-target effects of CRISPR/Cas9. The typical length of gRNA is 20 bp, which can form an RNA-DNA duplex by base pairing with the first 20 bp of the target site on the protospacer adjacent motif (PAM) sequence (Cong et al. 2013). If the sgRNA is truncated, the off-target effects of CRISPR/Cas9 is reduced. For example, if the sequence of sgRNA is reduced to 17–18 bp, the target specificity of gRNA is significantly improved (Liu et al. 2014; Xiao et al. 2014; Heo et al. 2015). Previously, we constructed the CRISPR/Cas9 plasmid containing 20 bp gRNA and its targeting rates at bovine MSTN site reached 74.29% (Liu et al. 2018), but the offtarget rates were not investigated. Based on the results of previous studies, we speculated that this 20-bp gRNA may have off-target problems, and truncated gRNA may have the ability to improve the precise gene editing efficiency. In this study, bovine MSTN was used as the target site, and the target and off-target rates were compared between CRISPR/ Cas9 vectors containing 20, 19, 18, 17 and 15 bp gRNA. Our
findings can help solve the off-target problems and improve the target efficiency in gene editing of domestic animals.
2. Materials and methods 2.1. Experimental design and treatments The bovine fetal fibroblasts (BFF) were used as gene editing materials, and CRISPR/Cas9 plasmid which was constructed with 20 bp gRNA was used as the control. The experimental group was the CRISPR/Cas9 vectors which contained the truncated 1, 2, 3 and 5 bp gRNA. These vectors were introduced into bovine fetal fibroblasts by electroporation, and the single cells were obtained by flow cytometry sorting. The experiment was repeated 3 times. The total single cell clones and the mutant cells were counted and the target and off-target rates were calculated.
2.2. Materials Primary fetal bovine fibroblasts were kept in the Research Center for Laboratory Animal Science of Inner Mongolia University (Hohhot, China), and other reagents included: DMEM high glucose medium, PS, 0.25% trypsin, OptiMEM (Gibco, Thermo Fisher, Waltham, MA, USA); fetal bovine serum FBS, bFGF, DPBS (BI), DMSO (SigmaAldrich, St. Louis, MO, USA); 1.5-mL centrifuge tube, 1.5-mL cell cryotube, 24-well plate, 48-well plate, 96-well plate (Corning, Corning, NY, USA); Endotoxin Plasmid Kit (QIAGEN, Venlo, Netherlands); Electrotransfer Instrument Nepa21, 2-mm electric shock cup (NEPA GENE, Ichikawa, Japan); 100-mm culture dish, 60-mm culture dish (Thermo Fisher, USA). Primer synthesis and sequencing were performed by the Beijing Genomics Company (BGI, Shenzhen, China).
2.3. Construction of CRISPR/Cas9 vector with truncated gRNA Based on the recognition of the approximately 20 nucleotide sequences upstream of the PAM by the CRISPR/Cas9 system, we targeted the MSTN gene of Luxi yellow cattle (NCBI: Chr. 2, NC_037329.1 (6278864-6285491)). A sequence of the second exon was designed with gRNA (5´-AGAACCAGGAGAAGATGGAC-3´, PAM sequence 5´-tgg-3´), and the oligonucleotide of the CRISPR/Cas9-B plasmid gRNA target site was synthesized. The glycoside chain was then ligated into the Cas9/gRNA vector and used to generate the final CRISPR/Cas9-B plasmid (Fig. 1). The CRISPR/Cas9-19 vector was modified from
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
the CRISPR/Cas9-B vector, with 1 bp truncated (5´-GAACCAGGAGAAGATGGAC-3´, PAM sequence of 5´-tgg-3´). First, we synthesized a single-stranded oligonucleotide strand of gRNA in CRISPR/Cas9-19 (5´-AAACACCGGAACCAGGAGAAGATGGAC-3´), and then mixed this single-stranded oligonucleotide and solution with water at a 1:1.5 ratio. The double-stranded oligonucleotide chain was then synthesized by a threestage reaction at 95°C for 3 min, 95°C to 25°C, and 16°C for 5 min. In a ratio of 1:2, the purchased Cas9/gRNA vector was mixed with the double-stranded oligonucleotide obtained above, and incubated at room temperature for 5 min. A total of 10 μL of the mixed product was added to 50 μL of Transl-T1, mixed and placed in an ice bath for 30 min, then heated at 42°C for 45 s, and placed again in the ice bath for 2 min. A total of 500 μL LB (Amp–) was added, and the mixture recovered for 1 h (200 r min–1, 37°C), and was finally plated. A single colony expansion was picked and cultured after 10–12 h growth. The plasmid DNA was extracted and sent to Huada Company (Shenzhen, China) for sequencing. Finally, the target vector with the correct sequence was transformed. The targeting vectors CRISPR/Cas9-18, CRISPR/Cas9-17, and CRISPR/Cas9-15 were obtained similarly. The sequences are shown in Table 1, and the primer for sequencing was 5´-TGAGCGTCGATTTTTGTGATGCTCGTCAG-3´.
2.4. Culture of bovine fetal fibroblasts The frozen primary bovine fetal fibroblasts were thawed in a constant temperature water bath at 37°C. After all icemelted, 1 mL high glucose medium (DMEM, 15% FBS, 1% PS, bFGF (10 ng mL–1 )) was added, mixed, and transferred to a 15-mL centrifuge tube with 4 mL high glucose medium, centrifuged at 1 500 r min–1 for 5 min, and the supernatant was discarded. The product was resuspended in 1 mL of liquid, transferred to a 100-mm culture dish with 8 mL high-sugar culture solution, and cultured in a 38.5°C, 5% CO2 incubator.
2.5. Establishment of a monoclonal cell line of bovine fetal fibroblasts The fibroblasts grown to 90% confluency were digested with 0.05% trypsin and centrifuged at 1 500 r min–1 for 5 min; the supernatant was discarded, and the product was uniformly mixed with 4 mL of opti-MEM, counted at 10 μL, and centrifuged at 1 500 r min–1 for 5 min. Cell size required to resuspend the required opti-MEM volume to a cell density of 1×107 was calculated; 90 μL of cells and 10 μL of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17, and CRISPR/Cas9-15 plasmids (1 000 ng μL–1) were mixed and added to a 2-mm electric
AMP pCAG
T7 promoter
gRNA u6 promoter
pCAG-T7-Cas9+gRNA 8 484 bp
SV40 NLS
SV40 ployA Nucleoplasmin NLS
Cas9
Fig. 1 Map of the CRISPR/Cas9 vector. Table 1 Oligonucleotide sequence for different vectors gRNA length (bp) 19 18 17 15
2837
Target (sense, 5´→3´) AAACACCGGAACCAGGAGAAGATGGAC AAACACCGAACCAGGAGAAGATGGAC AAACACCGACCAGGAGAAGATGGAC AAACACCGCAGGAGAAGATGGAC
Target (antisense, 5´→3´) CTCTAAAACGTCCATCTTCTCCTGGTTC CTCTAAAACGTCCATCTTCTCCTGGTT CTCTAAAACGTCCATCTTCTCCTGGT CTCTAAAACGTCCATCTTCTCCTG
2838
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
shock cup. These plasmids were transfected into the BFF with optimal electrotransfection conditions (150 V, 5 ms, 2 electric shocks). The transfected cells were transferred to a 60-mm dish. Then 3 mL of the high-sugar medium was added, mixed and incubated in an incubator at 38.5°C, 5% CO2 until the cells grew to 90% confluence. Single cells were sorted into 96-well plates with flow cytometry and incubated for 7 d; each colony was passaged to 24-well plates, cultured for 2 d, and divided in half. One portion was frozen in 90% FBS supplemented with 10% DMSO, and the other was used for DNA extraction.
the bovine genome that were similar to the gRNA targeting site (15 bp). Specific primers were designed for these off-target sites, and the genome of the monoclonal cell strain was obtained by transfecting the CRISPR/Cas9-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17, and CRISPR/Cas9-15 plasmids. PCR amplification was carried out for 35 cycles with denaturing at 95°C for 30 s, annealing for 30 s, extension at 72°C for 50 s, and a final extension at 72°C for 10 min, followed by electrophoresis on a 1% agarose gel at 110 V for 35 min. The primer sequence, the size of the target strip, and the annealing temperature of each point are as shown in Table 2. The positive samples
2.6. Genomic DNA extraction
of the obtained monoclonal cell lines were sent to BGI for
To extract the genomic DNA, the cells in 24-well plates were washed with phosphate-buffered saline and lysed in 200 μL of lysis buffer (100 mmol L–1 Tris pH 8.0, 200 mmol L–1 NaCl, 5 mmol L–1 EDTA pH 8.0, 0.2% sodium dodecyl sulfate, and 20 μg mL–1 proteinase K) at 38.5°C overnight. Lysed cells were then collected in a 1.5-mL centrifuge tube, and 200 μL (1:1) of chloroform was added, and an equal volume of isopropanol was extracted. Finally, the DNA pellet was washed twice with 400 μL 70% ethanol, dried, and then reconstituted with 50 μL of enzyme-free water.
sequencing. Finally, we counted the number of cell lines that were correctly sequenced and had mutations or were bimodal near the gRNA (Table 3). These were used to calculate the target and off-target rates. The calculation formula is as follows: Targeting efficiency=(Number of samples with sequencing target site mutations/Number of all sequenced samples)×100% Off-target rate=(Number of samples knocked off at the off-target site/Number of all sequenced samples)×100%
2.7. Detection of target sites and potential off-target sites
2.8. Data analysis
To detect the off-target conditions, the gRNA sequence of CRISPR/Cas9 in the bovine MSTN gene (5´-AGAACC AGGAGAAGATGGACTGG-3´) and its reverse complement sequence (5´-CCAGTCCATCTTCTCCTGGTTCT-3´) was Blast searched in NCBI to find potential off-target sites in
sequencing data. The chi-square test was used to analyze
The mutation status was analyzed according to the the difference in the targeting or off-targeting efficiency among five treatments (Liu H et al. 2017). We considered differences significant at P<0.05 and extremely significant at P<0.01.
Table 2 Primer sequences for different targeting sites Target site MSTN
Primer sequences (5´→3´) LH-F: GATTGATATGGAGGTCGTTCGTT LH-R: ACTAGAATCCACTGTGAAGACT 2F: ACACCCATGCACACACTCACAC 2R: AGCTTTGCGGCTCTAAGACCA 26F: AGATATTTGGCAAGAACCCAT 26R: CTGGCTTCCTTCATTTAGCAT 9F: GCAGGTCCTTTACTACCAA 9R: TCCTATCATATTATCCGCAGA
Off-MSTN-1 Off-MSTN-2 Off-MSTN-3
Annealing temperature (°C) 62
Product (bp) 800
60
506
60
819
58
662
Table 3 Summary of the sequencing results Target site MSTN Off-MSTN-1 Off-MSTN-2 Off-MSTN-3
Cas9-B 75 103 73 79
PCR band number Cas9-19 Cas9-18 Cas9-17 26 48 37 31 48 36 26 48 38 29 48 39
Cas9-15 54 56 31 56
Positive mutation/Sequenced PCR product Cas9B Cas9-19 Cas9-18 Cas9-17 Cas9-15 46/74 4/23 3/39 26/35 2/52 37/70 0/31 0/48 3/34 0/56 0/60 0/23 0/46 0/35 0/27 35/78 15/29 38/44 0/38 27/54
2839
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
3. Results
plasmid was significantly higher than others, and the partial
3.1. PCR detection of target and off-target sites
number of cell lines that were targeted at the Off-MSTN-3
The gRNA sequences used in the CRISPR/Cas9-B vector were analyzed by Blast alignment. Three potential off-target sites (Table 4) identified in preliminary experiments were located on Chr. 4, Chr. 10 and Chr. 1, and respectively identified as Off-MSTN-1, Off-MSTN-2 and Off-MSTN-3. 104, 32, 49, 48 and 56 monoclonal cell lines were obtained after CRISPR/Cas9-B, CRISPR/Cas9-19, CRISPR/Cas918, CRISPR/Cas9-17 and CRISPR/Cas9-15 plasmids were transfected into the laboratory-preserved bovine fetal fibroblasts. The PCR results at the four loci are shown in Fig. 2, and the number of cell lines obtained with the desired bands and correctly sequenced at each point was counted (Table 3). The final sequencing results were analyzed using DNAStar Software (DNAStar Inc., USA). At the MSTN targeting site, the number of positive target strains of the five plasmids was 46, 4, 3, 26 and 2, respectively. The positive rate of CRISPR/Cas9-B plasmid and CRISPR/Cas9-17
27, respectively. This indicates that the CRISPR/Cas9-17
sequencing results were compared as shown in Fig. 3. The off-target site by the various plasmids was 35, 15, 38, 0 and plasmid has a lower efficiency of action at the off-target site than the CRISPR/Cas9-B plasmid.
3.2. Analysis of target and off-target rates Genomic sequencing analysis showed that the transfection efficiencies of CRISPR/Cas9-B, CRISPR/Cas9-19, CRISPR/ Cas9-18, CRISPR/Cas9-17, and CRISPR/Cas9-15 at the MSTN targeting site were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively. The targeting efficiency of CRISPR/ Cas9-17 plasmid was higher than that of the CRISPR/ Cas9-B plasmid, but this difference was not significant (Fig. 4-A). Five plasmid transfections at the off-target site of the Off-MSTN-1 position indicated that the off-target rates of the CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 plasmids were significantly lower than
Table 4 Putative off-target loci Target site MSTN
Putative off-target site Off-MSTN-1 Off-MSTN-2 Off-MSTN-3
Putative off-target locus Chr. 4: 119535597–119535613 Chr. 10: 68448103–68448118 Chr. 1: 117369159–117369175
Sequence of putative off-target site (5´→3´) aaccaggagaagatgga ccaggagaagatggac aaccaggagaagatgga
Lowercase letters indicate the base pair that matched the sgRNA.
A
B
M 1 2 3 4 5 6 7 8 9 10 11 121314151617
800 bp
Cas9-B
Cas9-B
Cas9-19
Cas9-19
Cas9-18
Cas9-18
Cas9-17
Cas9-17
Cas9-15
Cas9-15
C Cas9-B
D
M 1 2 3 4 5 6 7 8 9 10 11 121314151617
819 bp
M 1 2 3 4 5 6 7 8 9 10 11 121314151617
Cas9-B
Cas9-19
Cas9-19
Cas9-18
Cas9-18
Cas9-17
Cas9-17
Cas9-15
Cas9-15
506 bp
M 1 2 3 4 5 6 7 8 9 10 11 121314151617
662 bp
Fig. 2 Partial electropherogram of the Cas9 vector constructed with different lengths of gRNA after targeting at the target site and three off-target sites. A, partial electrophoresis map of the MSTN target site. B–D, partial electropherogram for Off-MSTN-1, Off-MSTN-2 and Off-MSTN-3 off-target site, respectively.
2840
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
A
WT Cas9-B-2 Cas9-B-8 Cas9-B-20
Cas9-17-26 Cas9-17-27 Cas9-17-28
B
290
340
WT Cas9-19-4 Cas9-18-2 Cas9-15-1 Cas9-B-3 376 WT Cas9-19-4 Cas9-18-2 Cas9-15-1 Cas9-B-3
Fig. 3 DNA sequence alignment of wild type and mutant mutation site. A, sequence alignment of CRISPR/CAS9-B and CRISPR/ CAS9-17 at MSTN site mutation site. B, mutant base alignment of each vector at the Off-MSTN-3 site. Blue font in box indicates the gRNA sequence, red font with arrow indicates mutated base sites, underlined sequences are the PAM sequences.
that of the CRISPR/Cas9-B plasmid (P<0.01) (Fig. 4-B). No
2013; Pattanayak et al. 2013; Shen et al. 2014). However,
mutation was observed in the Off-MSTN-2 locus, indicating
the Cas9 protein can bind to some unintended sites with
that the 16-bp sequence shared between the off-target
up to five base differences from the target site, ultimately
site and the MSTN targeting site had no effect on the targeting efficiency. At the locus Off-MSTN-3, no insertions,
resulting in off-targeting effect during gene editing (Fu et al. 2013). As research into gene editing progresses, the issue
deletions, or mutations were observed within 10 bp after
of off-targeting has become a crucial topic in this field (Hsu
the gRNA for all of the sampled sequences transfected
et al. 2014).
with the five plasmids, but a deletion or mutation occurred
It has been proposed that the truncated gRNA sequence
at the 72 bp location after gRNA (Fig. 3-B). The calculated
with 17–18 bp could be beneficial in reducing the off-target
off-target rates were 44.87, 51.72, 86.36, 0, and 50.00%,
phenomenon and increasing the specificity of the target
respectively, of which only the CRISPR/Cas9-17 plasmid
site (Fu et al. 2013), which is consistent with the results of
had a significantly lower off-target rate than CRISPR/Cas9-B
our study. We successfully designed and constructed four
(P<0.01) (Fig. 4-C).
plasmids with truncated gRNA sequences of 1, 2, 3 and
4. Discussion
5 bp. The CRISPR/Cas9-17 plasmid constructed by truncating a 3-bp gRNA sequence showed a significant decrease in the efficiency at the three off-target sites.
CRISPR/Cas9 is the simplest and easiest of the new gene
There existed significant differences between the CRISPR/
editing strategies. Its rapidity and efficiency enable great
Cas9-17 and CRISPR/Cas9-B plasmids (P<0.01). At the
potential in gene editing (Hsu et al. 2014). Targeting of
target site of the MSTN gene, the targeting efficiency of
the Cas9 protein in the CRISPR/Cas9 system is closely
those two plasmids did not differ detectably, while the
related to the sequence guidance of gRNA (Hsu et al.
other three plasmids were less efficient at the MSTN site.
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
A NS
B
** **
60
**
** **
**
Off-target efficiency of Off-MSTN-1 site (%)
Targeting efficiency of MSTN sites (%)
80
**
2841
60 40 20 0
Cas9-B Cas9-19 Cas9-18 Cas9-17 Cas9-15 Plasmid
40
20
0
Cas9-B Cas9-19 Cas9-18 Cas9-17 Cas9-15 Plasmid
NS
C **
Off-target efficiency of Off-MSTN-3 site (%)
100
NS NS
80 60 40 20 0
Cas9-B Cas9-19 Cas9-18 Cas9-17 Cas9-15 Plasmid
This demonstrated that truncating the gRNA sequence to 17 nucleotides can effectively improve the specificity of targeting and reduce the off-target effects. This was possibly due to the unstable or difficult combination between the target sequence and the gRNA with truncation of 1, 2 and 5 bp, while the gRNA truncated by 3 bp may stably bind to the target site and weaken the binding ability to the off-target site (Mali et al. 2013; Ramakrishna et al. 2014; Feng et al. 2016). This provides a feasible solution for the application of CRISPR/Cas9 technology in large animal breeding (Wu et al. 2015; Zhou et al. 2015) and gene-based editing, and also brings greater opportunities for livestock breeding.
5. Conclusion The MSTN gene knockout monoclonal cell line was obtained by CRISPR/Cas9 technology, and CRISPR/Cas9 vectors of 19, 18, 17 and 15 bp gRNA were constructed by truncating the 20-bp gRNA sequence. Among these, the CRISPR/ Cas9-17 achieved the effect of reducing the off-target rate without affecting the gene targeting efficiency. Our results demonstrated that truncating the length of gRNA can greatly improve the off-target problems at bovine MSTN locus, which will guide the use of CRISPR/Cas9 technology in the
Fig. 4 Targeting efficiency of each target cell line obtained from different lengths of gRNA at different sites. A, analysis of targeting efficiency at MSTN target sites. B, analysis of targeting rate at off-target site Off-MSTN-1. C, analysis of targeting rate at off-target site Off-MSTN-3. **, P<0.01. NS, not significant.
field of cattle and sheep breeding by providing more effective gene editing strategies.
Acknowledgements We thank Dr. Zhao Yuhang for supplying the original carrier of CRISPR/Cas9B, and Drs. Wang Chen and Han Xuejie (all of them are from the Research Center for Laboratory Animal Science, Inner Mongolia University, China) for assistance with paper writing. This study was supported by the National Transgenic Project of China (2016ZX08010001-002 and 2016ZX08010005-001), the National Natural Science Foundation of China (81471001), and the Inner Mongolia Science and Technology Program, China (201502073).
References Aiello D, Patel K, Lasagna E. 2018. The myostatin gene: An overview of mechanisms of action and its relevance to livestock animals. Animal Genetics, 20, 12696. Boman I A, Klemetsdal G, Blichfeldt T, Nafstad O, Våge D I. 2009. A frameshift mutation in the coding region of the myostatin gene (MSTN) affects carcass conformation and fatness in Norwegian White sheep (Ovis aries). Animal Genetics, 40, 418–422.
2842
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong J W, Xi J J. 2013. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Research, 23, 465–472. Clop A, Marcq F, Takeda H, Pirottin D, Tordoir X, Bibé B, Bouix J, Caiment F, Elsen J M, Eychenne F, Larzul C, Laville E, Meish F, Milenkovic D, Tobin J, Charlier C, Georges M. 2006. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nature Genetics, 38, 813–818. Cong L, Ran F A, Cox D, Lin S, Barretto R, Haibb N, Hsu P D, Wu X, Jiang W, Marraffini L A, Zhang F. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819–823. Feng C, Yuan J, Wang R, Liu Y, Birchler J A, Han F. 2016. Efficient target genome modification in maize using CRISPR/Cas9 system. Journal of Genetics and Genomics, 43, 37–43. Fu Y, Foden J A, Khayter C, Maeder M L, Reyon D, Joung J K, Sander J D. 2013. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology, 31, 822–826. Fu Y, Sander J D, Reyon D, Reyon D, Cascio V M, Joung J K. 2014. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nature Biotechnology, 32, 279–284. Grobet L, Martin L J, Poncelet D, Pirottin D, Brouwers B, Riquet J, Schoeberlein A, Dunner S, Ménissier F, Massabanda J, Fries R, Hanset R, Georges M. 1997. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nature Genetics, 17, 71. Heo Y T, Quan X, Xu Y N, Baek S, Choi H, Kim N H, Kim J. 2015. CRISPR/Cas9 nuclease-mediated gene knock-in in bovineinduced pluripotent cells. Stem Cells and Development, 24, 393–402. Hsu P D, Lander E S, Zhang F. 2014. Development and applications of CRISPR-Cas9 for genome engineering. Cell, 157, 1262–1278. Hsu P D, Scott D A, Weinstein J A, Ran F A, Konermann S, Agarwala V, Li Y, Fine E J, Wu X, Shalem O, Cradick T J, Marraffini L A, Bao G, Zhang F. 2013. DNA targeting specificity of RNA-guided Cas9 nucleases. Nature Biotechnology, 31, 827–832. Jakočiūnas T, Bonde I, Herrgård M, Harrison S J, Kristensen M, Pedersen L E, Jensen M K, Keasling J D. 2015. Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae. Metabolic Engineering, 28, 213–222. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna J A, Charpentier E. 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337, 816–821. Kambadur R, Sharma M, Smith T P, Bass J J. 1997. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Research, 7, 910–916. Li T, Huang S, Jiang W Z, Wright D, Spalding M H, Weeks D P, Yang B. 2011. TAL nucleases (TALNs): Hybrid proteins composed of TAL effectors and FokI DNA-cleavage domain.
Nucleic Acids Research, 39, 359–372. Liu D, Wang Z, Xiao A, Zhang Y, Li W, Zu Y, Yao S, Lin S, Zhang B. 2014. Efficient gene targeting in zebrafish mediated by a zebrafish-codon-optimized cas9 and evaluation of off targeting effect. Journal of Genetics and Genomics, 41, 43–46. Liu H, Liu C, Zhao Y H, Han X J, Wang C, Zhou Z W. 2018. Comparing successful gene knock-in efficiencies of CRISPR/Cas9 with ZFNs and TALENs gene editing systems in bovine and dairy goat fetal fibroblasts. Journal of Integrative Agriculture, 17, 406-414. Liu X, Wang Y, Guo W, Chang B, Liu J, Guo Z, Quan F, Zhang Y. 2013. Zinc-finger nickase-mediated insertion of the lysostaphin gene into the β-casein locus in cloned cows. Nature Communications, 4, 2565. Mali P, Aach J, Stranges P B, Esvelt K M, Moosburner M, Kosuri S, Yang L, Church G M. 2013. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nature Biotechnology, 31, 833–838. Mali P, Yang L, Esvelt K M, Aach J, Guell M, Dicarlo J E, Norville J E, Church G M. 2013. RNA-guided human genome engineering via Cas9. Science, 339, 823–826. Montague T G, Cruz J M, Gagnon J A, Church G M, Valen E. 2014. CHOPCHOP: aCRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Research, 42, W401–W407. Ni W, Qiao J, Hu S, Zhao X, Regouski M, Yang M, Polejaeva I A, Chen C. 2014. Efficient gene knockout in goats using CRISPR/Cas9 system. PLoS ONE, 9, e106718. O’Geen H, Henry I M, Bhakta M S, Meckler J F, Segal D J. 2015. A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture. Nucleic Acids Research, 43, 3389–3404. Pattanayak V, Lin S, Guilinger J P, Ma E, Doudna J A, Liu D R. 2013. High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nature Biotechnology, 31, 839–843. Proudfoot C, Carlson D F, Huddart R, Long C R, Pryor J H, King T J, Lillico S G, Mileham A J, McLaren D G, Whitelaw C B, Fahrenkrug S C. 2015. Genome edited sheep and cattle. Transgenic Research, 24, 147–153. Ramakrishna S, Kwaku Dad A B, Beloor J, Gopalappa R, Lee S K, Kim H. 2014. Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA. Genome Research, 24, 1020–1027. Shen B, Zhang W, Zhang J, Zhou J, Wang J, Chen L, Wang L, Hodgkins A, Iyer V, Huang X, Skarnes W C. 2014. Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. Nature Methods, 11, 399–402. Wu H, Wang Y, Zhang Y, Yang M, Lv J, Liu J, Zhang Y. 2015. TALE nickase-mediated SP110 knockin endows cattle with increased resistance to tuberculosis. Proceedings of the National Academy of Sciences of the United States of America, 112, E1530–E1539. Xiao A, Cheng Z, Kong L, Zhu Z, Lin S, Gao G, Zhang B. 2014.
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
CasOT: A genome-wide Cas9/gRNA off-target searching tool. Bioinformatics, 30, 1180–1182. Zhao Y, Liang H, Liu M, Li X. 2014. The application of gene knock-out technologies in big domestic animals. Acta Veterinaria et Zootechnica Sinica, 45, 1–8. (in Chinese) Zhou H, He M, Li J, Chen L, Huang Z F, Zheng S Y, Zhu L Y, Ni E, Jiang D G, Zhao B R, Zhuang C X. 2016. Development of commercial Thermo-sensitive genic male sterile rice
2843
accelerates hybrid rice breeding using the CRISPR/Cas9mediated TMS5 editing system. Scientific Reports, 6, 37395–37406. Zhou X, Xin J, Fan N, Zou Q, Huang J, Ouyang Z, Zhao Y, Zhao B, Liu Z, Lai S, Yi X, Guo L, Esteban M A, Zeng Y, Yang H, Lai L. 2015. Generation of CRISPR/Cas9-mediated gene targeted pigs via somatic cell nuclear transfer. Cellular and Molecular Life Sciences, 72, 1175–1184.
Executive Editor-in-Chief LUO Xu-gang Managing editor ZHANG Juan
ScienceDirect
RESEARCH ARTICLE
Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines ZHOU Zheng-wei*, CAO Guo-hua*, LI Zhe*, HAN Xue-jie, LI Chen, LU Zhen-yu, ZHAO Yu-hang, LI Xue-ling State Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.China
Abstract The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/ Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/ Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology. Keywords: CRISPR/Cas9, gRNA, targeting site, off-target rate
Received 19 October, 2018 Accepted 11 June, 2019 ZHOU Zheng-wei, E-mail: [email protected]; Correspondence LI Xue-ling, Tel: +86-471-3679807, E-mail: lixueling@hotmail. com * These authors contributed equally to this study. © 2019 CAAS. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/). doi:10.1016/S2095-3119(19)62744-9
1. Introduction The myostatin (MSTN) gene was first cloned from a mouse skeletal muscle cDNA library by Grobet’s team from the John Hopkins University School of Medicine in 1997 (Grobet et al. 1997; Aiello et al. 2018). It is a class of skeletal muscle specially-expressed glycoprotein, and
2836
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
it is also known as transforming growth factor-β (TGF-β) or growth-differentiation factor-8 (GDF-8) (Kambadur et al. 1997). Previous studies showed that the MSTN myokine can negatively regulate the growth of skeletal muscle. Loss of function and other mutation of this gene, or other mutation of this gene, is beneficial to the proliferation, quality improvement, and reduced fat rate of animal muscle tissue (Clop et al. 2006; Boman et al. 2009). Therefore, knockout of the MSTN gene in livestock is of great significance in production practice and breeding (Clop et al. 2006; Zhao et al. 2014; Proudfoot et al. 2015). The most commonly used modern gene editing technique is the CRISPR/Cas nuclease (clustered regular interspaced short-palindromic repeats/CRISPR-associated nucleases) (O’Geen et al. 2015). Compared with zinc finder nuclease (ZFN) and transcription activator-like effector nuclease (TALEN) technologies, CRISPR/Cas technology is simpler and more efficient (Li et al. 2011; Liu et al. 2013; Montague et al. 2014). Over the past decade, many studies (Jinek et al. 2012; Mali et al. 2013; Ni et al. 2014) have described the principles of CRISPR/Cas9 technology and used it to transform the genome of human and mouse cell lines, thus leading to the further development of this technology. In recent years, CRISPR/Cas9 technology has been successfully applied to genome-based editing in animals (Chang et al. 2013), plants (Zhou et al. 2016), and microorganisms (Jakočiūnas et al. 2015). However, the off-target effects of CRISPR/Cas9 have become well known. Studies (Fu et al. 2014) have shown that, during precise gene targeting, different lengths of gRNA-directed targeting will cause mismatches in number or location, and thus the length of gRNA is the main factor affecting the target and off-target effects of CRISPR/Cas9. The typical length of gRNA is 20 bp, which can form an RNA-DNA duplex by base pairing with the first 20 bp of the target site on the protospacer adjacent motif (PAM) sequence (Cong et al. 2013). If the sgRNA is truncated, the off-target effects of CRISPR/Cas9 is reduced. For example, if the sequence of sgRNA is reduced to 17–18 bp, the target specificity of gRNA is significantly improved (Liu et al. 2014; Xiao et al. 2014; Heo et al. 2015). Previously, we constructed the CRISPR/Cas9 plasmid containing 20 bp gRNA and its targeting rates at bovine MSTN site reached 74.29% (Liu et al. 2018), but the offtarget rates were not investigated. Based on the results of previous studies, we speculated that this 20-bp gRNA may have off-target problems, and truncated gRNA may have the ability to improve the precise gene editing efficiency. In this study, bovine MSTN was used as the target site, and the target and off-target rates were compared between CRISPR/ Cas9 vectors containing 20, 19, 18, 17 and 15 bp gRNA. Our
findings can help solve the off-target problems and improve the target efficiency in gene editing of domestic animals.
2. Materials and methods 2.1. Experimental design and treatments The bovine fetal fibroblasts (BFF) were used as gene editing materials, and CRISPR/Cas9 plasmid which was constructed with 20 bp gRNA was used as the control. The experimental group was the CRISPR/Cas9 vectors which contained the truncated 1, 2, 3 and 5 bp gRNA. These vectors were introduced into bovine fetal fibroblasts by electroporation, and the single cells were obtained by flow cytometry sorting. The experiment was repeated 3 times. The total single cell clones and the mutant cells were counted and the target and off-target rates were calculated.
2.2. Materials Primary fetal bovine fibroblasts were kept in the Research Center for Laboratory Animal Science of Inner Mongolia University (Hohhot, China), and other reagents included: DMEM high glucose medium, PS, 0.25% trypsin, OptiMEM (Gibco, Thermo Fisher, Waltham, MA, USA); fetal bovine serum FBS, bFGF, DPBS (BI), DMSO (SigmaAldrich, St. Louis, MO, USA); 1.5-mL centrifuge tube, 1.5-mL cell cryotube, 24-well plate, 48-well plate, 96-well plate (Corning, Corning, NY, USA); Endotoxin Plasmid Kit (QIAGEN, Venlo, Netherlands); Electrotransfer Instrument Nepa21, 2-mm electric shock cup (NEPA GENE, Ichikawa, Japan); 100-mm culture dish, 60-mm culture dish (Thermo Fisher, USA). Primer synthesis and sequencing were performed by the Beijing Genomics Company (BGI, Shenzhen, China).
2.3. Construction of CRISPR/Cas9 vector with truncated gRNA Based on the recognition of the approximately 20 nucleotide sequences upstream of the PAM by the CRISPR/Cas9 system, we targeted the MSTN gene of Luxi yellow cattle (NCBI: Chr. 2, NC_037329.1 (6278864-6285491)). A sequence of the second exon was designed with gRNA (5´-AGAACCAGGAGAAGATGGAC-3´, PAM sequence 5´-tgg-3´), and the oligonucleotide of the CRISPR/Cas9-B plasmid gRNA target site was synthesized. The glycoside chain was then ligated into the Cas9/gRNA vector and used to generate the final CRISPR/Cas9-B plasmid (Fig. 1). The CRISPR/Cas9-19 vector was modified from
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
the CRISPR/Cas9-B vector, with 1 bp truncated (5´-GAACCAGGAGAAGATGGAC-3´, PAM sequence of 5´-tgg-3´). First, we synthesized a single-stranded oligonucleotide strand of gRNA in CRISPR/Cas9-19 (5´-AAACACCGGAACCAGGAGAAGATGGAC-3´), and then mixed this single-stranded oligonucleotide and solution with water at a 1:1.5 ratio. The double-stranded oligonucleotide chain was then synthesized by a threestage reaction at 95°C for 3 min, 95°C to 25°C, and 16°C for 5 min. In a ratio of 1:2, the purchased Cas9/gRNA vector was mixed with the double-stranded oligonucleotide obtained above, and incubated at room temperature for 5 min. A total of 10 μL of the mixed product was added to 50 μL of Transl-T1, mixed and placed in an ice bath for 30 min, then heated at 42°C for 45 s, and placed again in the ice bath for 2 min. A total of 500 μL LB (Amp–) was added, and the mixture recovered for 1 h (200 r min–1, 37°C), and was finally plated. A single colony expansion was picked and cultured after 10–12 h growth. The plasmid DNA was extracted and sent to Huada Company (Shenzhen, China) for sequencing. Finally, the target vector with the correct sequence was transformed. The targeting vectors CRISPR/Cas9-18, CRISPR/Cas9-17, and CRISPR/Cas9-15 were obtained similarly. The sequences are shown in Table 1, and the primer for sequencing was 5´-TGAGCGTCGATTTTTGTGATGCTCGTCAG-3´.
2.4. Culture of bovine fetal fibroblasts The frozen primary bovine fetal fibroblasts were thawed in a constant temperature water bath at 37°C. After all icemelted, 1 mL high glucose medium (DMEM, 15% FBS, 1% PS, bFGF (10 ng mL–1 )) was added, mixed, and transferred to a 15-mL centrifuge tube with 4 mL high glucose medium, centrifuged at 1 500 r min–1 for 5 min, and the supernatant was discarded. The product was resuspended in 1 mL of liquid, transferred to a 100-mm culture dish with 8 mL high-sugar culture solution, and cultured in a 38.5°C, 5% CO2 incubator.
2.5. Establishment of a monoclonal cell line of bovine fetal fibroblasts The fibroblasts grown to 90% confluency were digested with 0.05% trypsin and centrifuged at 1 500 r min–1 for 5 min; the supernatant was discarded, and the product was uniformly mixed with 4 mL of opti-MEM, counted at 10 μL, and centrifuged at 1 500 r min–1 for 5 min. Cell size required to resuspend the required opti-MEM volume to a cell density of 1×107 was calculated; 90 μL of cells and 10 μL of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17, and CRISPR/Cas9-15 plasmids (1 000 ng μL–1) were mixed and added to a 2-mm electric
AMP pCAG
T7 promoter
gRNA u6 promoter
pCAG-T7-Cas9+gRNA 8 484 bp
SV40 NLS
SV40 ployA Nucleoplasmin NLS
Cas9
Fig. 1 Map of the CRISPR/Cas9 vector. Table 1 Oligonucleotide sequence for different vectors gRNA length (bp) 19 18 17 15
2837
Target (sense, 5´→3´) AAACACCGGAACCAGGAGAAGATGGAC AAACACCGAACCAGGAGAAGATGGAC AAACACCGACCAGGAGAAGATGGAC AAACACCGCAGGAGAAGATGGAC
Target (antisense, 5´→3´) CTCTAAAACGTCCATCTTCTCCTGGTTC CTCTAAAACGTCCATCTTCTCCTGGTT CTCTAAAACGTCCATCTTCTCCTGGT CTCTAAAACGTCCATCTTCTCCTG
2838
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
shock cup. These plasmids were transfected into the BFF with optimal electrotransfection conditions (150 V, 5 ms, 2 electric shocks). The transfected cells were transferred to a 60-mm dish. Then 3 mL of the high-sugar medium was added, mixed and incubated in an incubator at 38.5°C, 5% CO2 until the cells grew to 90% confluence. Single cells were sorted into 96-well plates with flow cytometry and incubated for 7 d; each colony was passaged to 24-well plates, cultured for 2 d, and divided in half. One portion was frozen in 90% FBS supplemented with 10% DMSO, and the other was used for DNA extraction.
the bovine genome that were similar to the gRNA targeting site (15 bp). Specific primers were designed for these off-target sites, and the genome of the monoclonal cell strain was obtained by transfecting the CRISPR/Cas9-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17, and CRISPR/Cas9-15 plasmids. PCR amplification was carried out for 35 cycles with denaturing at 95°C for 30 s, annealing for 30 s, extension at 72°C for 50 s, and a final extension at 72°C for 10 min, followed by electrophoresis on a 1% agarose gel at 110 V for 35 min. The primer sequence, the size of the target strip, and the annealing temperature of each point are as shown in Table 2. The positive samples
2.6. Genomic DNA extraction
of the obtained monoclonal cell lines were sent to BGI for
To extract the genomic DNA, the cells in 24-well plates were washed with phosphate-buffered saline and lysed in 200 μL of lysis buffer (100 mmol L–1 Tris pH 8.0, 200 mmol L–1 NaCl, 5 mmol L–1 EDTA pH 8.0, 0.2% sodium dodecyl sulfate, and 20 μg mL–1 proteinase K) at 38.5°C overnight. Lysed cells were then collected in a 1.5-mL centrifuge tube, and 200 μL (1:1) of chloroform was added, and an equal volume of isopropanol was extracted. Finally, the DNA pellet was washed twice with 400 μL 70% ethanol, dried, and then reconstituted with 50 μL of enzyme-free water.
sequencing. Finally, we counted the number of cell lines that were correctly sequenced and had mutations or were bimodal near the gRNA (Table 3). These were used to calculate the target and off-target rates. The calculation formula is as follows: Targeting efficiency=(Number of samples with sequencing target site mutations/Number of all sequenced samples)×100% Off-target rate=(Number of samples knocked off at the off-target site/Number of all sequenced samples)×100%
2.7. Detection of target sites and potential off-target sites
2.8. Data analysis
To detect the off-target conditions, the gRNA sequence of CRISPR/Cas9 in the bovine MSTN gene (5´-AGAACC AGGAGAAGATGGACTGG-3´) and its reverse complement sequence (5´-CCAGTCCATCTTCTCCTGGTTCT-3´) was Blast searched in NCBI to find potential off-target sites in
sequencing data. The chi-square test was used to analyze
The mutation status was analyzed according to the the difference in the targeting or off-targeting efficiency among five treatments (Liu H et al. 2017). We considered differences significant at P<0.05 and extremely significant at P<0.01.
Table 2 Primer sequences for different targeting sites Target site MSTN
Primer sequences (5´→3´) LH-F: GATTGATATGGAGGTCGTTCGTT LH-R: ACTAGAATCCACTGTGAAGACT 2F: ACACCCATGCACACACTCACAC 2R: AGCTTTGCGGCTCTAAGACCA 26F: AGATATTTGGCAAGAACCCAT 26R: CTGGCTTCCTTCATTTAGCAT 9F: GCAGGTCCTTTACTACCAA 9R: TCCTATCATATTATCCGCAGA
Off-MSTN-1 Off-MSTN-2 Off-MSTN-3
Annealing temperature (°C) 62
Product (bp) 800
60
506
60
819
58
662
Table 3 Summary of the sequencing results Target site MSTN Off-MSTN-1 Off-MSTN-2 Off-MSTN-3
Cas9-B 75 103 73 79
PCR band number Cas9-19 Cas9-18 Cas9-17 26 48 37 31 48 36 26 48 38 29 48 39
Cas9-15 54 56 31 56
Positive mutation/Sequenced PCR product Cas9B Cas9-19 Cas9-18 Cas9-17 Cas9-15 46/74 4/23 3/39 26/35 2/52 37/70 0/31 0/48 3/34 0/56 0/60 0/23 0/46 0/35 0/27 35/78 15/29 38/44 0/38 27/54
2839
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
3. Results
plasmid was significantly higher than others, and the partial
3.1. PCR detection of target and off-target sites
number of cell lines that were targeted at the Off-MSTN-3
The gRNA sequences used in the CRISPR/Cas9-B vector were analyzed by Blast alignment. Three potential off-target sites (Table 4) identified in preliminary experiments were located on Chr. 4, Chr. 10 and Chr. 1, and respectively identified as Off-MSTN-1, Off-MSTN-2 and Off-MSTN-3. 104, 32, 49, 48 and 56 monoclonal cell lines were obtained after CRISPR/Cas9-B, CRISPR/Cas9-19, CRISPR/Cas918, CRISPR/Cas9-17 and CRISPR/Cas9-15 plasmids were transfected into the laboratory-preserved bovine fetal fibroblasts. The PCR results at the four loci are shown in Fig. 2, and the number of cell lines obtained with the desired bands and correctly sequenced at each point was counted (Table 3). The final sequencing results were analyzed using DNAStar Software (DNAStar Inc., USA). At the MSTN targeting site, the number of positive target strains of the five plasmids was 46, 4, 3, 26 and 2, respectively. The positive rate of CRISPR/Cas9-B plasmid and CRISPR/Cas9-17
27, respectively. This indicates that the CRISPR/Cas9-17
sequencing results were compared as shown in Fig. 3. The off-target site by the various plasmids was 35, 15, 38, 0 and plasmid has a lower efficiency of action at the off-target site than the CRISPR/Cas9-B plasmid.
3.2. Analysis of target and off-target rates Genomic sequencing analysis showed that the transfection efficiencies of CRISPR/Cas9-B, CRISPR/Cas9-19, CRISPR/ Cas9-18, CRISPR/Cas9-17, and CRISPR/Cas9-15 at the MSTN targeting site were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively. The targeting efficiency of CRISPR/ Cas9-17 plasmid was higher than that of the CRISPR/ Cas9-B plasmid, but this difference was not significant (Fig. 4-A). Five plasmid transfections at the off-target site of the Off-MSTN-1 position indicated that the off-target rates of the CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 plasmids were significantly lower than
Table 4 Putative off-target loci Target site MSTN
Putative off-target site Off-MSTN-1 Off-MSTN-2 Off-MSTN-3
Putative off-target locus Chr. 4: 119535597–119535613 Chr. 10: 68448103–68448118 Chr. 1: 117369159–117369175
Sequence of putative off-target site (5´→3´) aaccaggagaagatgga ccaggagaagatggac aaccaggagaagatgga
Lowercase letters indicate the base pair that matched the sgRNA.
A
B
M 1 2 3 4 5 6 7 8 9 10 11 121314151617
800 bp
Cas9-B
Cas9-B
Cas9-19
Cas9-19
Cas9-18
Cas9-18
Cas9-17
Cas9-17
Cas9-15
Cas9-15
C Cas9-B
D
M 1 2 3 4 5 6 7 8 9 10 11 121314151617
819 bp
M 1 2 3 4 5 6 7 8 9 10 11 121314151617
Cas9-B
Cas9-19
Cas9-19
Cas9-18
Cas9-18
Cas9-17
Cas9-17
Cas9-15
Cas9-15
506 bp
M 1 2 3 4 5 6 7 8 9 10 11 121314151617
662 bp
Fig. 2 Partial electropherogram of the Cas9 vector constructed with different lengths of gRNA after targeting at the target site and three off-target sites. A, partial electrophoresis map of the MSTN target site. B–D, partial electropherogram for Off-MSTN-1, Off-MSTN-2 and Off-MSTN-3 off-target site, respectively.
2840
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
A
WT Cas9-B-2 Cas9-B-8 Cas9-B-20
Cas9-17-26 Cas9-17-27 Cas9-17-28
B
290
340
WT Cas9-19-4 Cas9-18-2 Cas9-15-1 Cas9-B-3 376 WT Cas9-19-4 Cas9-18-2 Cas9-15-1 Cas9-B-3
Fig. 3 DNA sequence alignment of wild type and mutant mutation site. A, sequence alignment of CRISPR/CAS9-B and CRISPR/ CAS9-17 at MSTN site mutation site. B, mutant base alignment of each vector at the Off-MSTN-3 site. Blue font in box indicates the gRNA sequence, red font with arrow indicates mutated base sites, underlined sequences are the PAM sequences.
that of the CRISPR/Cas9-B plasmid (P<0.01) (Fig. 4-B). No
2013; Pattanayak et al. 2013; Shen et al. 2014). However,
mutation was observed in the Off-MSTN-2 locus, indicating
the Cas9 protein can bind to some unintended sites with
that the 16-bp sequence shared between the off-target
up to five base differences from the target site, ultimately
site and the MSTN targeting site had no effect on the targeting efficiency. At the locus Off-MSTN-3, no insertions,
resulting in off-targeting effect during gene editing (Fu et al. 2013). As research into gene editing progresses, the issue
deletions, or mutations were observed within 10 bp after
of off-targeting has become a crucial topic in this field (Hsu
the gRNA for all of the sampled sequences transfected
et al. 2014).
with the five plasmids, but a deletion or mutation occurred
It has been proposed that the truncated gRNA sequence
at the 72 bp location after gRNA (Fig. 3-B). The calculated
with 17–18 bp could be beneficial in reducing the off-target
off-target rates were 44.87, 51.72, 86.36, 0, and 50.00%,
phenomenon and increasing the specificity of the target
respectively, of which only the CRISPR/Cas9-17 plasmid
site (Fu et al. 2013), which is consistent with the results of
had a significantly lower off-target rate than CRISPR/Cas9-B
our study. We successfully designed and constructed four
(P<0.01) (Fig. 4-C).
plasmids with truncated gRNA sequences of 1, 2, 3 and
4. Discussion
5 bp. The CRISPR/Cas9-17 plasmid constructed by truncating a 3-bp gRNA sequence showed a significant decrease in the efficiency at the three off-target sites.
CRISPR/Cas9 is the simplest and easiest of the new gene
There existed significant differences between the CRISPR/
editing strategies. Its rapidity and efficiency enable great
Cas9-17 and CRISPR/Cas9-B plasmids (P<0.01). At the
potential in gene editing (Hsu et al. 2014). Targeting of
target site of the MSTN gene, the targeting efficiency of
the Cas9 protein in the CRISPR/Cas9 system is closely
those two plasmids did not differ detectably, while the
related to the sequence guidance of gRNA (Hsu et al.
other three plasmids were less efficient at the MSTN site.
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
A NS
B
** **
60
**
** **
**
Off-target efficiency of Off-MSTN-1 site (%)
Targeting efficiency of MSTN sites (%)
80
**
2841
60 40 20 0
Cas9-B Cas9-19 Cas9-18 Cas9-17 Cas9-15 Plasmid
40
20
0
Cas9-B Cas9-19 Cas9-18 Cas9-17 Cas9-15 Plasmid
NS
C **
Off-target efficiency of Off-MSTN-3 site (%)
100
NS NS
80 60 40 20 0
Cas9-B Cas9-19 Cas9-18 Cas9-17 Cas9-15 Plasmid
This demonstrated that truncating the gRNA sequence to 17 nucleotides can effectively improve the specificity of targeting and reduce the off-target effects. This was possibly due to the unstable or difficult combination between the target sequence and the gRNA with truncation of 1, 2 and 5 bp, while the gRNA truncated by 3 bp may stably bind to the target site and weaken the binding ability to the off-target site (Mali et al. 2013; Ramakrishna et al. 2014; Feng et al. 2016). This provides a feasible solution for the application of CRISPR/Cas9 technology in large animal breeding (Wu et al. 2015; Zhou et al. 2015) and gene-based editing, and also brings greater opportunities for livestock breeding.
5. Conclusion The MSTN gene knockout monoclonal cell line was obtained by CRISPR/Cas9 technology, and CRISPR/Cas9 vectors of 19, 18, 17 and 15 bp gRNA were constructed by truncating the 20-bp gRNA sequence. Among these, the CRISPR/ Cas9-17 achieved the effect of reducing the off-target rate without affecting the gene targeting efficiency. Our results demonstrated that truncating the length of gRNA can greatly improve the off-target problems at bovine MSTN locus, which will guide the use of CRISPR/Cas9 technology in the
Fig. 4 Targeting efficiency of each target cell line obtained from different lengths of gRNA at different sites. A, analysis of targeting efficiency at MSTN target sites. B, analysis of targeting rate at off-target site Off-MSTN-1. C, analysis of targeting rate at off-target site Off-MSTN-3. **, P<0.01. NS, not significant.
field of cattle and sheep breeding by providing more effective gene editing strategies.
Acknowledgements We thank Dr. Zhao Yuhang for supplying the original carrier of CRISPR/Cas9B, and Drs. Wang Chen and Han Xuejie (all of them are from the Research Center for Laboratory Animal Science, Inner Mongolia University, China) for assistance with paper writing. This study was supported by the National Transgenic Project of China (2016ZX08010001-002 and 2016ZX08010005-001), the National Natural Science Foundation of China (81471001), and the Inner Mongolia Science and Technology Program, China (201502073).
References Aiello D, Patel K, Lasagna E. 2018. The myostatin gene: An overview of mechanisms of action and its relevance to livestock animals. Animal Genetics, 20, 12696. Boman I A, Klemetsdal G, Blichfeldt T, Nafstad O, Våge D I. 2009. A frameshift mutation in the coding region of the myostatin gene (MSTN) affects carcass conformation and fatness in Norwegian White sheep (Ovis aries). Animal Genetics, 40, 418–422.
2842
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong J W, Xi J J. 2013. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Research, 23, 465–472. Clop A, Marcq F, Takeda H, Pirottin D, Tordoir X, Bibé B, Bouix J, Caiment F, Elsen J M, Eychenne F, Larzul C, Laville E, Meish F, Milenkovic D, Tobin J, Charlier C, Georges M. 2006. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nature Genetics, 38, 813–818. Cong L, Ran F A, Cox D, Lin S, Barretto R, Haibb N, Hsu P D, Wu X, Jiang W, Marraffini L A, Zhang F. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819–823. Feng C, Yuan J, Wang R, Liu Y, Birchler J A, Han F. 2016. Efficient target genome modification in maize using CRISPR/Cas9 system. Journal of Genetics and Genomics, 43, 37–43. Fu Y, Foden J A, Khayter C, Maeder M L, Reyon D, Joung J K, Sander J D. 2013. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology, 31, 822–826. Fu Y, Sander J D, Reyon D, Reyon D, Cascio V M, Joung J K. 2014. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nature Biotechnology, 32, 279–284. Grobet L, Martin L J, Poncelet D, Pirottin D, Brouwers B, Riquet J, Schoeberlein A, Dunner S, Ménissier F, Massabanda J, Fries R, Hanset R, Georges M. 1997. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nature Genetics, 17, 71. Heo Y T, Quan X, Xu Y N, Baek S, Choi H, Kim N H, Kim J. 2015. CRISPR/Cas9 nuclease-mediated gene knock-in in bovineinduced pluripotent cells. Stem Cells and Development, 24, 393–402. Hsu P D, Lander E S, Zhang F. 2014. Development and applications of CRISPR-Cas9 for genome engineering. Cell, 157, 1262–1278. Hsu P D, Scott D A, Weinstein J A, Ran F A, Konermann S, Agarwala V, Li Y, Fine E J, Wu X, Shalem O, Cradick T J, Marraffini L A, Bao G, Zhang F. 2013. DNA targeting specificity of RNA-guided Cas9 nucleases. Nature Biotechnology, 31, 827–832. Jakočiūnas T, Bonde I, Herrgård M, Harrison S J, Kristensen M, Pedersen L E, Jensen M K, Keasling J D. 2015. Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae. Metabolic Engineering, 28, 213–222. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna J A, Charpentier E. 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337, 816–821. Kambadur R, Sharma M, Smith T P, Bass J J. 1997. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Research, 7, 910–916. Li T, Huang S, Jiang W Z, Wright D, Spalding M H, Weeks D P, Yang B. 2011. TAL nucleases (TALNs): Hybrid proteins composed of TAL effectors and FokI DNA-cleavage domain.
Nucleic Acids Research, 39, 359–372. Liu D, Wang Z, Xiao A, Zhang Y, Li W, Zu Y, Yao S, Lin S, Zhang B. 2014. Efficient gene targeting in zebrafish mediated by a zebrafish-codon-optimized cas9 and evaluation of off targeting effect. Journal of Genetics and Genomics, 41, 43–46. Liu H, Liu C, Zhao Y H, Han X J, Wang C, Zhou Z W. 2018. Comparing successful gene knock-in efficiencies of CRISPR/Cas9 with ZFNs and TALENs gene editing systems in bovine and dairy goat fetal fibroblasts. Journal of Integrative Agriculture, 17, 406-414. Liu X, Wang Y, Guo W, Chang B, Liu J, Guo Z, Quan F, Zhang Y. 2013. Zinc-finger nickase-mediated insertion of the lysostaphin gene into the β-casein locus in cloned cows. Nature Communications, 4, 2565. Mali P, Aach J, Stranges P B, Esvelt K M, Moosburner M, Kosuri S, Yang L, Church G M. 2013. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nature Biotechnology, 31, 833–838. Mali P, Yang L, Esvelt K M, Aach J, Guell M, Dicarlo J E, Norville J E, Church G M. 2013. RNA-guided human genome engineering via Cas9. Science, 339, 823–826. Montague T G, Cruz J M, Gagnon J A, Church G M, Valen E. 2014. CHOPCHOP: aCRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Research, 42, W401–W407. Ni W, Qiao J, Hu S, Zhao X, Regouski M, Yang M, Polejaeva I A, Chen C. 2014. Efficient gene knockout in goats using CRISPR/Cas9 system. PLoS ONE, 9, e106718. O’Geen H, Henry I M, Bhakta M S, Meckler J F, Segal D J. 2015. A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture. Nucleic Acids Research, 43, 3389–3404. Pattanayak V, Lin S, Guilinger J P, Ma E, Doudna J A, Liu D R. 2013. High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nature Biotechnology, 31, 839–843. Proudfoot C, Carlson D F, Huddart R, Long C R, Pryor J H, King T J, Lillico S G, Mileham A J, McLaren D G, Whitelaw C B, Fahrenkrug S C. 2015. Genome edited sheep and cattle. Transgenic Research, 24, 147–153. Ramakrishna S, Kwaku Dad A B, Beloor J, Gopalappa R, Lee S K, Kim H. 2014. Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA. Genome Research, 24, 1020–1027. Shen B, Zhang W, Zhang J, Zhou J, Wang J, Chen L, Wang L, Hodgkins A, Iyer V, Huang X, Skarnes W C. 2014. Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. Nature Methods, 11, 399–402. Wu H, Wang Y, Zhang Y, Yang M, Lv J, Liu J, Zhang Y. 2015. TALE nickase-mediated SP110 knockin endows cattle with increased resistance to tuberculosis. Proceedings of the National Academy of Sciences of the United States of America, 112, E1530–E1539. Xiao A, Cheng Z, Kong L, Zhu Z, Lin S, Gao G, Zhang B. 2014.
ZHOU Zheng-wei et al. Journal of Integrative Agriculture 2019, 18(12): 2835–2843
CasOT: A genome-wide Cas9/gRNA off-target searching tool. Bioinformatics, 30, 1180–1182. Zhao Y, Liang H, Liu M, Li X. 2014. The application of gene knock-out technologies in big domestic animals. Acta Veterinaria et Zootechnica Sinica, 45, 1–8. (in Chinese) Zhou H, He M, Li J, Chen L, Huang Z F, Zheng S Y, Zhu L Y, Ni E, Jiang D G, Zhao B R, Zhuang C X. 2016. Development of commercial Thermo-sensitive genic male sterile rice
2843
accelerates hybrid rice breeding using the CRISPR/Cas9mediated TMS5 editing system. Scientific Reports, 6, 37395–37406. Zhou X, Xin J, Fan N, Zou Q, Huang J, Ouyang Z, Zhao Y, Zhao B, Liu Z, Lai S, Yi X, Guo L, Esteban M A, Zeng Y, Yang H, Lai L. 2015. Generation of CRISPR/Cas9-mediated gene targeted pigs via somatic cell nuclear transfer. Cellular and Molecular Life Sciences, 72, 1175–1184.
Executive Editor-in-Chief LUO Xu-gang Managing editor ZHANG Juan