Characterization and expression analysis of a GnRH-like peptide in the Pacific abalone, Haliotis discus hannai

Journal Pre-proof Characterization and expression analysis of a GnRH-like peptide in the Pacific abalone, Haliotis discus hannai

Md. Rajib Sharker, Soo Cheol Kim, Kanij Rukshana Sumi, Zahid Parvez Sukhan, Young Chang Sohn, Won Kyo Lee, Kang Hee Kho PII:

S2352-2151(19)30019-4

DOI:

https://doi.org/10.1016/j.aggene.2019.100099

Reference:

AGGENE 100099

To appear in: Received date:

13 August 2019

Revised date:

8 October 2019

Accepted date:

25 October 2019

Please cite this article as: M.R. Sharker, S.C. Kim, K.R. Sumi, et al., Characterization and expression analysis of a GnRH-like peptide in the Pacific abalone, Haliotis discus hannai, (2018), https://doi.org/10.1016/j.aggene.2019.100099

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2018 Published by Elsevier.

Journal Pre-proof

Characterization and expression analysis of a GnRH-like peptide in the Pacific abalone, Haliotis discus hannai Md. Rajib Sharker1 , Soo Cheol Kim1 , Kanij Rukshana Sumi2 , Zahid Parvez Sukhan1 Young Chang Sohn3 , Won Kyo Lee1 and Kang Hee Kho1* 1. Department of Fisheries Science, College of Fisheries and Ocean Sciences, Chonnam National University, 50 Daehak-ro, Yeosu, Jeonnam, 59626, Republic of Korea. 2. Department of Aquaculture, Patuakhali Science and Technology University, Dumki,

of

Patuakhali-8602, Bangladesh

ro

3. Department of Marine Molecular Biosciences, Gangneung-Wonju National University,7

-p

Jukheon-gil, Gangneung, Gangwon 25457, Republic of Korea

Jo

ur

na

lP

re

*Correspondence: [email protected]; Tel.: +82-61-659-7168; Fax: +82-61-659-7169

Journal Pre-proof ABSTRACT Gonadotropin- releasing hormone (GnRH) is a key neuropeptide of vertebrates, involved in gonadal maturation and primarily regulated by the hypothalamic-pituitary- gonadal axis. The full length GnRH-like cDNA isolated from the cerebral ganglion of Haliotis discus hannai, encodes a deduced protein of 216 amino acids with a theoretical molecular mass of 23.36 kDa and an isoelectric point of 7.72. The GnRH transcript comprises a putative signal peptide, a GnRH

of

dodecapeptide, a proteolytic processing site, and a GnRH associated peptide (GAP).

ro

Comparative structural analysis revealed that the cloned sequence shares relatively high

-p

homology with other molluscan species and a lower degree of amino acid identity with GnRH of

re

piscine vertebrates. Phylogenetic comparison with other known GnRH genes revealed that the

lP

GnRH-like mRNA of H. discus hannai is most closely related to the marine gastropod, Haliotis laevigata. Three-dimensional homology structure of H. discus hannai GnRH and GAP exhibited

na

a helix- loop-helix structure. Quantitative PCR assay demonstrated wide expression of GnRH in

ur

all ganglia, among them cerebral ganglion exhibited the highest expression level. Significantly higher expression was observed in cerebral ganglion and gonadal tissues at higher effective

Jo

accumulative temperature (1000 °C). In situ hybridization showed that the GnRH expressing neurosecretory cells distributed throughout the cortex of the cerebral ganglion. These results suggest that GnRH synthesized from the cerebral ganglia may be involved in gonadal maturation and regulating the secretion of other reproductive hormones. Keywords: Pacific abalone, Haliotis discus hannai, GnRH mRNA, cerebral ganglion, In situ hybridization

Journal Pre-proof 1. Introduction Gonadotropin- releasing hormone (GnRH) is a peptidergic hypophysiotropic hormone that plays a central role in the control of reproduction, also known to act as a neuromodulator in vertebrates (Tsutsui et al., 1998). The GnRH precursor protein consists of a signal peptide, a GnRH bioactive peptide, and a GnRH associated peptide (GAP) (Tsai et al., 2008). Neurosecretory cells of the brain hypothalamus synthesize GnRH, which reaches to the gonadotrophic cells either

of

indirectly via the portal system (Tetrapods) or directly via axon endings (Teleost) (Dubois et al.,

ro

2002). GnRH isoforms are classified into 5 major groups, on the basis of developmental origin,

-p

function, distribution, and phylogenetic analysis: GnRH-I, GnRH-II, GnRH-III, GnRH-IV, and

re

GnRH-V (Silver et al., 2004; Sower et al., 2004). This short-chain polypeptide hormone is conserved in both vertebrate and invertebrate species and plays a pivotal role in the initiation and

lP

maintenance of reproductive function (Adams et al., 2003; Gorbman et al., 2003). GnRH- like

na

molecules have been found to induce ovarian cell proliferation and spawning in Pacific white shrimp (Tinikul et al., 2014). Moreover, oocyte maturation and mass spawning in a scleractinian

ur

coral is influenced under the tight control of GnRH (Twan et al., 2006). GnRH is crucial for the

Jo

early development of gametogenesis and germ cell proliferation in bivalve mollusks (Lubet and Mathieu, 1982). This molecule is responsible for the production to steroid hormones by the follicle and spermatozoa in Octopus vulgaris (Kanda et al., 2006). It also acts as a neuromodulator in autonomic functions of the brain, feeding, memory, and movement of the Octopus (Iwakoshi- Ukena et al., 2004; Kanda et al., 2006). An exclusive expression of rp-GnRH mRNA at the gonadal early developmental stage indicated that this peptide plays a role at the beginning of sexual maturation of the clam, Ruditapes philippinarum (Song et al., 2015). Former studies using in vivo administration of py-GnRH suggested that this neuropeptide plays a role in

Journal Pre-proof stimulating spermatogonial proliferation and can cause an inhibitory effect of the oocyte growth in the Yesso scallop (Nagasawa et al., 2015). In abalone (Hatiotis asinina), GnRH peptide seems to be the strongest inducer for the female germ cell proliferation (Nuurai et al., 2015). It has been also reported that this neuropeptide may be synthesized locally in the male and female gonads and act as a paracrine switch of gonadal maturation in H. asinina (Nuurai et al., 2010 and 2014).

of

The abalone is one of the most valuable marine gastropods and is widely distributed

ro

throughout temperate and tropical coastal regions (Estates et al., 2005). Of the Haliotis, H. discus

-p

hannai has drawn increasing attention in the fishery and aquaculture industry of Korea, Japan,

re

China, and Taiwan. H. discus hannai is deemed to be high valued seafood due to its content in health beneficial bioactive molecules, in addition to its basic nutritional value (Suleria et al.,

lP

2015). Many research groups have relied on the genomic and proteomic approaches, linkage map

na

development, construction of bacterial artificial chromosome (BAC) libraries, and whole genome sequence to unravel the mechanisms underlying the growth, development, reproduction, and

ur

molecular adaptation of the Haliotis genus (Palmer et al., 2013; Mendoza-Porras et al., 2014;

Jo

Jiang et al., 2016; Nam et al., 2017).

Several studies have reported isolation and expression of GnRH in various tissues of protostomian and ascidian species (Zhang et al., 2000; Di Cristo et al. 2002; Iwakoshi- Ukena et al., 2004; Tsai et al., 2003; Di Fiore et al., 2000). A few studies have been conducted on GnRH in H. discus hannai and other closely related species (Nuurai et al., 2010 and 2015; Amano et al., 2010; Kim et al., 2017). To date, the characterization and expression of GnRH in H. discus hannai by means of in situ hybridization is lacking. The present study focused on the molecular

Journal Pre-proof identification, characterization and expression of GnRH- like peptide in H. discus hannai using in situ hybridization. 2. Materials and Methods 2.1. Experimental animals and tissue collection Two- year-old adult female abalone (H. discus hannai) with a shell length of 10.5 cm and a total body weight of 148.2 g were obtained from Jindo Island (South Korea) and transferred to

of

the laboratory in the Department of Fisheries Science, Chonnam National University. The

ro

abalone was euthanized by immersion using MS-222 (ethyl 3-aminobenzoate methane sulfonate)

-p

to harvest the cerebral ganglion, pleuropedal ganglion, branchial ganglion, testis, ovary, mantle,

re

and adductor muscle. The samples were frozen in liquid N 2 and stored at -80 °C for subsequent research.

lP

The cerebral ganglion was washed in phosphate buffered saline (PBS; pH 7.4) and

na

immersion fixed in 4% paraformaldehyde (PFA) overnight to prepare the cryosection. Next, the fixed tissues were washed three times with PBS for 1 min to eliminate the residual 4% PFA. The

ur

tissues were then submerged in 30% sucrose and kept at 4 °C overnight. Subsequently, frozen

Jo

section compound (FSC 222, Leica Biosystems, Wetzlar, Germany) was used to embed the tissues, which were kept at room temperature for 1 h. The embedded tissues were stored at −20 °C for subsequent use. A cryostat device (CM 3050; LEICA, Wetzlar, Germany) was employed to section the frozen tissue at 10 µm per section. Thin sections were placed on electrostatically charged slides (SuperFrost Plus; VWR International, Radnor, PA, USA), allowed to air-dry for 30 min and then stored at −20 °C until use.

Journal Pre-proof 2.2. RNA extraction for molecular cloning Total RNA from all tissues of Pacific abalone was extracted using an RNeasy mini kit (Qiagen, Hilden, Germany) and treated with RNase-free DNase (Promega, Madison, WI, USA) to eliminate any genomic DNA contamination. Quality and quantity of total RNA were evaluated by electrophoresis and spectrophotometry (NanoDrop ® NP 1000 spectrophotometer). The Superscript® III First-Strand synthesis kit (Invitrogen, Carlsbad, CA, USA) was employed for

ro

2.3. Identification and cloning of GnRH gene

of

cDNA synthesis. All steps were conducted as per the manufacturer’s instructions.

-p

Molecular cloning was performed by using reverse transcription (RT) primers (forward: 5′-

re

CCGTACTATCCAGTCAAG -3′ and reverse: 5′- CTCAGCGTCCACTGTATC -3′) which were

lP

designed based on the conserved GnRH nucleotide sequences of Haliotis asinina (GenBank accession no. KP719130.1) and H. laevigata (GenBank accession no. KP719129.1). RT

na

polymerase chain reactions (PCR) were conducted using Phusion® High-Fidelity DNA

ur

Polymerase (Biolabs Inc., New England). PCR was executed by using 1 μL of cDNA template from cerebral ganglion tissue in reaction mixtures containing 1 μL (20 pmol) of each forward

Jo

and reverse primer, 8 μL of Master Mix, and sterile distilled water (dH2 O) in a total volume of 20 μL. The RT-PCR assay consisted of 35 cycles including pre- incubation: 95 °C for 5 min, denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 2 min with a final dissociation step at 72 °C for 5 min. The gel extraction kit (Promega) was used to purify the PCR products, which are then ligated into the pTOP Blunt V2 vector (Enzynomics, Daejeon, Korea) and transformed into competent E. coli DH5α cells (Enzynomics). The plasmids of positive clones were purified using a plasmid mini kit (Qiagen) and sequenced by the Macrogen Online Sequencing System (Macrogen, Seoul, Korea). On the basis of the partial sequence 5′-

Journal Pre-proof and 3′- rapid amplification of cDNA ends (RACE) PCR was performed to obtain the full- length sequence by using the SMARTer® RACE 5′/3′ Kit (Clontech Laboratories, Inc., USA) according to the manufacturer’s instructions. The 5′- and 3′-RACE cDNA was synthesized from 1 μg of total RNA from the cerebral ganglion tissue of abalone, in accordance with the kit protocol. 5 ′and 3′-RACE PCRs were executed using gene-specific primer sequences (GSPs), as follows; antisense primer: 5′- GATTACGCCAAGCTTACTGTGTCAGGCTCTGTGAAGTCCATGT -

of

3′, sense primer: 5′- GATTACGCCAAGCTTACATGGACTTCACAGAGCCTGACACAGT-3′,

ro

including a 15-bp overlap with the 5′-end of the GSP sequence, a universal primer mix (UPM):

-p

5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3′, and SeqAmp

re

DNA Polymerase in a total volume of 50 µl. Touchdown PCR was employed with 35 cycles for 3′-RACE and 40 cycles for 5′-RACE PCR, according to the kit protocol. Purification of the

lP

RACE PCR products was conducted by the NucleoSpin Gel and PCR Clean-Up kit. Next, the

na

products were ligated into the linearized pRACE vector, transformed into Stellar Competent Cells and then sequenced as previously described. Finally, the sequenced RACE products were

Jo

2.4. Sequence analysis

ur

assembled with SeqMan Pro (DNA STAR Inc., Madison, WI, USA).

In silico analysis of the GnRH neuropeptide was conducted using multiple online software tools to detect its identity to other GnRH homologues. The protein homology of GnRH clone was

analyzed

using

Basic

Local

Alignment

Search

Tool

(BLASTP)

(http://www.ncbi.nlm.nih.gov/BLAST/). SignalP 4.1 (www.cbs.dtu.dk/services/SignalP/) was employed to infer the N-terminal signal peptide, and the bonding state of cysteines in the protein was

predicted

by

CYSPRED

(Fariselli

et

al.,

1999).

ProtParam

(http://expasy.org/tools/protparam.html) and Protcomp (http://linux1. softberry.com/berry.phtml)

Journal Pre-proof were used to determine the primary structures and subcellular localization of proteins. Multiple alignments of the deduced amino acid sequences o f GnRH were carried out using Clustal Omega (Sievers et al., 2011). Editing and visualization of the peptide sequence alignment were conducted using Jalview, version 2.10.0 (www.jalview.org) (Waterhouse et al., 2009). The Multiple Em for Motif Elicitation (MEME) software (Version 4.11.0) (http://memesuite.org/tools/meme) was used to identify the conserved motifs in the GnRH peptide sequences

of

(Bailey et al., 2006).

ro

2.5. Phylogenetic analysis

-p

GnRH peptide sequences from protostome and deuterostome invertebrates and from

re

vertebrates were used to construct the phylogenetic trees. The GnRH peptide sequence of H.

lP

discus hannai was aligned with other GnRH sequences using Clustal Omega (Sievers et al., 2011). The MEGA software (version 7.24) with a maximum likelihood method was applied to

na

form the phylogenetic trees (Tamura et al., 2013). The numbers reported on the branches indicate

ur

the significance of the nodes based on a bootstrap analysis conducted on 1000 replicates. The GenBank accession numbers of the sequences used to construct the phylogenetic trees are

Jo

reported in the legend of Fig. 4.

2.6. Template identification and three-dimensional protein structure The three-dimensional protein structure of GnRH- like transcript was performed using the ITASSER server, an automated protein- modeling server from the Zhang Lab at the University of Michigan (Yang et al., 2015). GAP sequences were considered between the tribasic site for cleavage after the GnRH sequence and the stop codon of the ORF. A refined model of the predicted three-dimensional (3D) structure was visualized using Chimera software (Pettersen et al., 2004). The protein quality predictor (ProQ: http://www.sbc.su.se/~bjornw/ProQ/ProQ.html),

Journal Pre-proof and ERRAT (Colovos et al., 1993) tools were used to evaluate the stereo-chemical quality of the predicted model. 2.7 Quantitative PCR expression analysis The 2× qPCRBIO SyGreen Mix Lo-Rox kit (PCR Biosystems Ltd.,London, UK) was used to perform the quantitative real- time PCR (qPCR) assay. Gene-specific primers (forward: 5′-

primers

(forward:

of

ATCGCTGCCAGAACGGAGTG -3′ and reverse: 5′-CCACTGTTACTGCTACTACTG-3′), and 5′-

TGTCCGTTTCACCAACAAGG-3′

and

reverse:

5′-

ro

AGATGGAATCAAGTTTCAATT -3′) from ribosomal protein L-5 gene (RPL-5, JX002679.1)

-p

of H. discus hannai were used for qPCR expression analysis. The ribosomal protein L-5 gene

re

was chosen as internal control based on its expression stability. The 20 μL reaction mixtures

lP

containing 1 μL of cDNA template, 1 μL (10 pmol) of each forward and reverse primer, 10 μL of SyGreen Mix, and 7 μL of dH2 O. Three replicate reactions per sample were prepared. The PCR

na

amplification conditions were as follows: pre-incubation at 95 °C for 5 min, followed by 40

ur

cycles of three-step amplification at 95 °C for 5 min, 60 °C for 30 s, and 72 °C for 1 min. The melting temperature was used as a default setting. At the end of each cycle, a fluorescence

Jo

reading was recorded for quantification. A LightCycler® 96 System (Roche, Germany) was used for amplification and data analysis. The relative gene expressio n was determined on the basis of the cycle threshold 2−ΔΔct method, with the RPL-5 gene as an internal reference (Livak et al. 2001). 2.8. Expression analysis of GnRH like peptide at effective accumulated temperature (EAT) The healthy adult abalones were collected from the hatchery and kept in the rearing tanks with filtered sea water at 9.5 °C for one month. Afterwards, the temperature was gradually increased and reared at 10.5 °C and 13.5 °C during the following two months. The abalones were

Journal Pre-proof then conditioned at 18 °C for nineteen days and sixty seven days for obtaining the effective accumulated temperature (EAT) at 500°C and 1000 °C, respectively. 1 μL of cDNA template from neural ganglia and gonad at different EAT were used to conduct qPCR assay as described above. 2.9. In Situ Hybridization (ISH)

of

The expression and distribution of GnRH- like mRNA were detected using in situ hybridization after generation of sense and antisense riboprobe based on the protocol prescribed

ro

for DIG Kit (Roche, Mannheim, Germany). The sense and anti-sense probes were prepared using

-p

SP6 RNA polymerases and T7 RNA polymerases, respectively. The PCR product was ligated

re

with pGEM- T Easy vector and sequencing of plasmid DNA was conducted for the identification

lP

and orientation of the probe. Afterwards, the purified PCR product was resuspended in 5 μL of RNase-free H2 O. A probe-labeling assay was performed for in vitro transcription using T7 RNA

na

polymerase (New England BioLabs, MO251S, UK) and SP6 RNA polymerases with

ur

digoxigenin (DIG) RNA labeling mix according to the spectrophotometric (NanoDrop® NP1000 spectrophotometer, Thermo Fisher Scientific) measurement of the digest concentration.

Jo

Pre-hybridization of cerebral ganglion tissue sections was conducted with hybridization buffer (5 ml deionized formamide, 2.5 ml of 20 x saline sodium citrate, 100 μL of 0.1% Tween-20, 92 μL of 1 M citric acid (pH 6.0), and DEPC-H2 O in a total volume of 20 ml) and yeast total RNA (50 μL) for 2 h followed by hybridization with the RNA probe at 65 °C overnight. Subsequently, the hybridized tissue sections were sequentially rinsed for 10 min at 65 °C with 75% hybridization mix plus 25% 2× SSC, 50% hybridization mix plus 50% 2× SSC, 25% hybridization mix plus 75% 2× SSC. Next, sections were washed twice with 0.2× SSC for 30 min, followed by sequential washes of 5 min at room temperature with 75% 0.2× SSC plus 25% PBS with Tween-

Journal Pre-proof 20, 50% 0.2× SSC plus 50% PBST, 25% 0.2× SSC plus 75% PBST and PBST for 5 min at room temperature. To detect the hybridization signal, tissue sections were incubated at room temperature for 1 h with blocking solution (10% calf serum in PBST) and overnight at 4°C with alkaline phosphatase-conjugated anti-digoxigenin-Ap, Fab fragments antibody (diluted 1:500 in blocking solution [Roche]). After six times washes in PBST (15 min/wash), the tissue sections were rinsed

of

thrice in alkaline Tris buffer (5 min/wash) at room temperature and finally treated with labelling

ro

mix to observe the color. The sections were placed in a dark and humid chamber for 5 h in order

-p

to contrast the color. The slides were washed with PBST and fixed in 4% PFA for 1 h after

re

getting the desired color.

lP

2.10 Nuclear fast red counterstain

Counterstaining of the hybridized ISH slides was performed with Nuclear Fast Red (Sigma-

na

Aldrich, USA). Slides were rinsed in distilled water. The sections were then treated with Nuclear

ur

Fast Red solution for 5 min followed by washing in water for 5 min and dehydrated in ascending series of ethanol, dipped in Histo-Clear (National diagnostics, USA) and coverslipped using

Jo

permount mounting medium. 2.11. Statistical analysis

Data were analyzed statistically and presented as mean ± standard error using one-way analysis of variance (ANOVA) followed by Tukey’s test to assess the differences in relative mRNA expression in the different tissues. GraphPad Prism 5.0 was employed to conduct statistical analysis and differences P < 0.05 were regarded as statistically significant.

Journal Pre-proof 3

Results

3.1 cDNA cloning and sequence analysis of Pacific abalone prepro-GnRH A total of 1072-bp cDNA transcript of GnRH was obtained from the cerebral ganglion, including a 122-bp 5′-untranslated region (UTR) and a 299-bp 3′-UTR with a consensus canonical polyadenylation signal (AATAAA) located 14-bp upstream of the poly-A tail. The open reading frame encoded a putative protein of 216 amino acids with a theoretical molecular

of

weight of 23.36 kDa and an isoelectric point of 7.72 (Fig. 1). The sequence data have been

ro

submitted to the GenBank database under the accession number MK089558. The coding region

-p

comprised a predicted signal peptide (22 amino acids) and a cleavage site between the Ala22 and

re

Gln23 . In silico analysis indicated that the protein might be an extracellular secretory protein. The following architecture of a cloned GnRH has been postulated: a signal peptide, the GnRH

lP

dodecapeptide with an N-terminal Gln (Q) and C-terminal Gly (G), followed by a cleavage site

na

and a GnRH associated peptide (GAP). The predicted amino acid sequences flanking the tribasic (KKR) motif which act as a proteolytic processing site of the prohormone precursor to the

ur

functional peptide. The glycine (Gly) residue of GnRH might be enzymatically processed into

Jo

the active amidated peptide. The cysteine residues (Cys-39 and Cys-106) in the GAP region are likely to form disulfide bond based on similarity with other GnRH peptide sequences. Among the molluscan and vertebrate GnRHs, the cloned GnRH was 78/83%, 60/61%, 38/52%, and 38/54% identical/similar to H. laevigata, Aplysia californica, O. vulgaris, Mizuhopecten yessoensis, respectively and, to a lesser extent, with bivalve (Crassostrea gigas) and piscine vertebrate (Petromyzon marinus) homologs. Motifs are differently distributed in protostomian invertebrate and vertebrate GnRH, with lengths ranging between 6 and 43 amino acids. A total of five motifs were recognized in the

Journal Pre-proof characterized GnRH of H. discus hannai (Fig. 2). Notably, motif 2 is well-conserved among the representative chordate and molluscan family members. Motif 3 in H. discus hannai exhibit similarity with different groups of mollusks whereas motif 5 is only identical to the motif of A. californica. 3.2. Comparison of the putative GnRH peptide residues among cloned GnRH and GnRH from vertebrates and various molluscans

of

In the cloned GnRH dodecapeptide, 3 residues were highly conserved with vertebrates and

ro

other molluscans. In molluscan species, an insertion of two amino acids was observed near the

-p

N-terminal end. In the comparison between human GnRH-I and the cloned GnRH like peptide,

re

characteristic aromatic residue Trp/Phe-5 substitutions were observed; at position 7 and 9, the serotonin precursor tyrosine (Tyr) and the branched-chain amino acid leucine (Leu) is replaced

lP

by asparagine (Asn) and tryptophan (Trp), respectively (Fig. 3A). The residues at positions 10

na

and 11 are polymorphic among vertebrates and several molluscan species. Lower amino acid conservation was observed in the GAP region of C-terminal portion among H. discus hannai, A.

ur

californica and D. reticulatum (Fig. 3B).

Jo

3.3.Phylogenetic analysis

A phylogenetic tree was constructed to delineate the possible evolutionary connection between the GnRH peptide sequences, revealing five distinct groups: GnRH-I, GnRH-II, GnRHIII, GnRH-IV, and GnRH-V (Fig. 4). H. discus hannai GnRH is contained in the molluscan clade and more closely related with H. laevigata GnRH. According to the results, this GnRH was classified as a member of the GnRH-V family. Bombyx mori serine protease was used as an outgroup.

Journal Pre-proof 3.4 Prediction of GnRH and GnRH associated peptide (GAP) three-dimensional structure The three-dimensional structure of GnRH and GnRH associated peptide (GAP) were predicted using the amino acid residues of cloned GnRH (Fig. 5). For GAP residues, a 3D structure revealed multiple alpha helices, which is separated by a loop (helix- loop-helix structure). The number of amino acids involved in the N-terminal and C-terminal alpha helices was 15 and 12 amino acid, respectively. The validation results for GnRH and GAP residues

of

revealed the following: LG score of 3.410 and 3.298 (value >2 = a very good model). The

ro

ERRAT overall quality score was 92.71% and 89.47% for the predicted GnRH and GAP model.

-p

These results confirmed the stereo-chemical quality of this 3D structure as an optimized model.

re

3.5 Expression of GnRH-like mRNA in H. discus hannai

lP

Quantitative PCR assay was carried out to measure the relative mRNA level in neural ganglion (Cerebral, pleuropedal, and branchial), adductor muscle, mantle, and gonads (testis and

na

ovary) by using gene-specific and internal reference primers. The relative mRNA expression

ur

level in different examined tissues were significantly different (p  0.05), among the highest expression was observed in the cerebral ganglion (Fig. 6).

Jo

3.6 Effects of effective accumulative temperature (EAT) on GnRH mRNA expression in neural ganglia and gonad

The expression pattern of GnRH-like mRNA in neural ganglia and gonad was investigated by qPCR at different effective accumulative temperature (EAT). The results showed that cerebral ganglion and gonadal tissues (Testis and Ovary) exhibited significantly higher expression at 1000 °C (Fig. 7). There were no significant differences was observed in pleuropedal and branchial ganglion at different EAT.

Journal Pre-proof 3.7 In situ hybridization In situ hybridization was conducted to investigate the expression and distribution of GnRHlike peptides in cerebral ganglion. Positive mRNA expressing hybridization signals were exhibited in the neurosecretory cells within the cortex of the cerebral ganglion (Purple color), (Fig. 8A,B,C,D). Positive signals were not detected in the negative control section, which lacked the GnRH mRNA anti-sense probe (Fig. 8E). Fast red counterstaining confirmed that the positive

of

signal was likely localized in the neurosecretory cells of the cortex region (Fig. 8F).

ro

4. Discussion

-p

This study reports the molecular cloning and characterization of the GnRH- like peptide from

re

the abalone species, H. discus hannai. Like other GnRH neuropeptides, the cloned GnRH possess a typical architecture, comprising a signal peptide, a dodecapeptide GnRH sequence, and

lP

a downstream processing site followed by a GnRH associated peptide (GAP) (Fig. 1). Different

na

GnRH isoforms exist in vertebrates consisting of 10 amino acids (Okubo et al., 2008). However a variable extra dipeptide insertion was previously reported at the N-terminal end of a variety of

ur

molluscan family members (Sakai et al., 2017). Due to the lack of this feature, the vertebrate

Jo

GnRH precursor exhibits weak or no activity on Oct-GnRH receptors (Kanda et al., 2006). Consequently, this extra dipeptide is considered as a structural requisite for physiological activity and receptor binding (Song et al., 2015). The dibasic amino acids in the cloned GnRH between the N-terminal pyroglutamate and the histidine residues are a common feature of most other known mollusks (Fig. 3A). Although low similarity was visualized in the GnRH-associated peptide region, the presence of homologous cysteine residues suggests that they are required to stabilize the tertiary structure of the secreted peptide (Nuurai et al., 2015). The GAP region could be functional in mollusks and is likely to possess an accessory role in the lower selective

Journal Pre-proof pressure during evolution. (Bigot et al., 2012). Similar to other mollusks GnRH a well- conserved cleavage site was observed at the C-terminal amino acid (Minakata et al., 2016). Bigot et al. (2012) reported two forms of GnRH in Crassostrea gigas (Cg-GnRH-G, a precursor dodecapeptide with the C-terminal -Pro-Gly- motif and Cg-GnRH-a, the mature amidated peptide). Sequence alignment of mature GnRHs revealed that the amino acids are tightly conserved among the known molluscan members (Fig. 3A). Oct-GnRH displays similarity to the

of

vertebrate GnRH at both the N- and C-terminal ends as well as in the dibasic cleavage site

ro

downstream of Gly12 (Iwakoshi et al., 2002), while the Haliotis discus hannai GnRH- like

-p

peptide differs in the C-terminal region due to the change of the Pro11 residue to Ala11 . The –Pro-

re

Gly- motif in C-terminal region is crucial for the release of gonadotropins in vertebrates (Minakata et al., 2016). Additionally, the presence of a tribasic cleavage site and a unique

lP

amidated glycine residue makes the identified GnRH peptide shorter than the previously

na

characterized protostomian Oct-GnRH. The GnRH peptide of cloned sequence is strongly similar to Ap-GnRH active peptide (Zhang et al., 2008). However, only one amino acid is substituted

Jo

al., 2017).

ur

(histidine is replaced by tyrosine) from previously reported GnRH of H. discus hannai (Kim et

Motif analysis showed that motif 2 represents a common or characteristic feature for all GnRH transcripts. A highly homologous motif is detected in A. californica owing to the similar residue in the GAP region (Fig. 2). GnRHs orthologs of mollusks and representative species of vertebrate were used to construct a phylogenetic tree and illustrate the possible evolutionary relationships between the GnRH- like molecules in chordates and non-chordates. The GnRH peptide of H. discus hannai formed a cluster with other gastropod mollusks and was categorized a non-chordate GnRH (Fig. 4).

Journal Pre-proof Consequently, this transcript is allocated to the GnRH-V group, as previously described for the GnRHs of mollusks and other non-chordates (Zhang et al., 2008). Three-dimensional protein structures of GAP variants were previously reported for different mammalian and non- mammalian vertebrate groups (Pérez Sirkin et al., 2017). In the present study, the 3D structure of GnRH and GAP residues were analyzed for the first time in invertebrates (Fig. 5). The predicted 3D structure of GAP revealed a helix- loop-helix structure in

of

concordance with the previous reports (Pérez Sirkin et al., 2017). The evaluation results of

ro

GnRH and GAP 3D structure demonstrated the structural conservation of the GnRH transcript,

-p

and the amino acid residues were in a favorable position.

re

The expression pattern of GnRH transcript of H. discus hannai was evaluated by qPCR in several representative tissues. The highest level of expression was detected in the cerebral

lP

ganglion (Fig. 6). In contrast, GnRH-I and GnRH-II are primarily expressed in the central

na

nervous system and peripheral tissues in human and other piscine vertebrates (Metallinou et al., 2007; Nabissi et al., 2000). The GnRH mRNA was mainly expressed in the central nervous

ur

system (CNS) of Uroteuthis edulis, whereas Oct-GnRH mRNA is distributed in CNS and other

Jo

peripheral organs such as heart, oviduct, and oviductal gland (Iwakoshi- Ukena et al., 2004). Notably, Ap-GnRH transcripts were also found in the CNS, ovotestis, and atrial gland (Zhang et al., 2000). On the other hand, GnRH transcripts were highly and exclusively expressed in the visceral ganglia of the Pacific oyster, C. gigas (Bigot et al., 2012). To date, the GnRH mRNA expression in tissues at different EAT has been totally unknown. In the present study, significantly higher expression was found in cerebral ganglia and gonadal tissues (testis and ovary) at higher EAT (Fig. 7). The results indicated that the maturation rate and quantity of gametes rises with increasing EAT.

Journal Pre-proof Nuurai et al. (2010, 2014) reported that GnRH- like peptide expressing neurosecretory cell was distributed in the cerebral ganglion of H. asinina. Biochemical and immunohistochemical analysis of H. discus hannai revealed the presence of a GnRH-like immunoreactive substance in the peripheral region of the cerebral ganglion (Amano et al., 2010). To date, no reports based on in situ hybridization in abalone species have been published. In the present study, the existence of a GnRH- like peptide is detected in the neurosecretory cells of the cerebral ganglia and its

of

distribution is characterized using in situ hybridization (Fig. 8 A,B,C,D).

ro

5. Conclusion

-p

GnRH, a neuropeptide hormone has been associated to reproductive regulation in mollusks.

re

In the present study, a GnRH- like neuropeptide from Pacific abalone was cloned and found to substantially similar to those of other molluscan GnRH. qPCR analysis and in situ hybridization

lP

of neural ganglia and gonad indicated that the ganglia might be the principal site for the synthesis

na

and secretion of GnRH or produced locally in the gonad of abalone and plays a role in the gonadal maturation. Exploration of the physiological roles of abalone GnRH in the maintenance

Jo

future research.

ur

of gonadal maturation and gamete production is an urgent need and will be the main objective of

Acknowledge ments: This research was a part of the project titled ' Development of technology for abalone aquaculture using sperm cryopreservation (Grant No. 2018-2129)' funded by the Ministry of Oceans and Fisheries, Korea. Conflicts of interest: The authors have no conflicts of interest.

Journal Pre-proof References Adams, B.A., Tello, J.A., Erchegyi, J., Warby, C., Hong, D.J., Akinsanya, K.O., 2003. Six novel gonadotropin-releasing hormones are encoded as triplets on each of two genes in the protochordate, Ciona intestinalis. J. Endocrinol. 144, 1907–1919. Amano, M., Moriyama, S., Okubo, K., Amiya, N., Takahashi, A., Oka, Y., 2010. Biochemical and immunohistochemical analyses of a GnRH- like peptide in the neural ganglia of the

of

Pacific abalone Haliotis discus hannai (gastropoda). Zool. Sci. 27, 656–661.

ro

Bailey, T.L., Williams, N., Misleh, C., Li, W.W., 2006. MEME: Discovering and analyzing

-p

DNA and protein sequence motifs. Nucleic Acids Res. 34, 369–373.

re

Bigot, L., Zatylny- Gaudin, C., Rodet, F., Bernay, B., Boudry, P., Favrel, P., 2012. Characterization of GnRH-related peptides from the Pacific oyster Crassostrea gigas.

lP

Peptides 34, 303–310.

na

Colovos, C., Yeates, T.O., 1993. Verification of protein structures: patterns of nonbonded atomic interactions. Protein Sci. 9:1511–1519.

ur

Di Cristo, C., Paolucci, M., Iglesias, J., Sanchez, J., Di Cosmo, A. 2002. Presence of two

Jo

neuropeptides in the fusiform ganglion and reproductive ducts of Octopus vulgaris: FMRFamide and gonadotropin-releasing hormone (GnRH). J. Exp. Zool. 292, 267–276. Di Fiore, M.M., Rastogi, R.K., Ceciliani, F., Messi, E., Botte, V., Botte, L., Pinelli, C., D'Aniello, B., D'Aniello, A., 2000. Mammalian and chicken I forms of gonadotropinreleasing hormone in the gonads of a protochordate, Ciona intestinalis. Proc. Natl. Acad. Sci. 97, 2343–2348.

Dubois, E.A., Zandbergen, M.A., Peute, J., Goos, H.J., 2002. Evolutionary development of three gonadotropin-releasing hormone (GnRH) systems in vertebrates. Brain Res. Bull. 57, 413–418.

Journal Pre-proof Estes, J.A., Lindberg, D.R., Wray, C., 2005. Evolution of large body size in abalones (Haliotis): patterns and implications. Paleobiology 31, 591–606. Fariselli, P., Riccobelli, P., Casadio, R., 1999. Role of evolutionary information in predicting the disulfide bonding state of cysteines in proteins. Proteins 36, 340–346. Gorbman, A., Sower, S.A., 2003. Evolution of the role of GnRH in animal (Metazoan) biology. Gen. Comp. Endocrinol. 134: 207–213.

of

Iwakoshi, E., Takuwa-Kuroda, K., Fujisawa, Y., Hisada, M., Ukena, K.T., Tsutsui, K., Minakata,

ro

H., 2002. Isolation and characterization of a GnRH- like peptide from Octopus vulgaris.

-p

Biochem. Biophys. Res. Commun. 29, 1187–1193.

re

Iwakoshi- Ukena, E., Ukena, K., Takuwa-Kuroda, K., Kanda, A., Tsutsui, K., Minakata, H., 2004. Expression and distribution of octopus gonadotropin-releasing hormone in the

lP

central nervous system and peripheral organs of the octopus (Octopus vulgaris) by in situ

na

hybridization and immunohistochemistry. J. Comp. Neurol. 477, 310–323. Jiang, L., You, W., Zhang, X., Xu, J., Jiang, Y., Wang, K., Zhao, Z., Chen, B., Zhao, Y.,

ur

Mahboob, S., 2016. Construction of the BAC library of small abalone (Haliotis

56.

Jo

diversicolor) for gene screening and genome characterization. Mar. Biotechnol. 18, 49–

Kanda, A., Takahashi, T., Satake, H., Minakata, H., 2006. Molecular and functional characterization of a novel gonadotropin-releasing- hormone receptor isolated from the common octopus (Octopus vulgaris). Biochem. J. 395, 125–135. Kim, T.H., Kim, M.A., Kim, K.S., Kim, J.W., Lim, H.K., Lee, J.S., Sohn, Y.C., 2017. Characterization and spatiotemporal expression of gonadotropin- releasing hormone in the

Journal Pre-proof Pacific abalone, Haliotis discus hannai. Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 209, 1-9. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2−ΔΔct method. Methods 25, 402–408. Lubet, P., Mathieu, M., 1982. The action of internal factors on gametogenesis in pelecypod mollusks. Malacologia 22 (1–2), 131–136.

of

Mendoza-Porras, O., Botwright, N.A., McWilliam, S.M., Cook, M.T., Harris, J.O., Wijffels, G.,

-p

reproduction. J. Proteom. 108, 337–353.

ro

Colgrave, M.L., 2014. Exploiting genomic data to identify proteins involved in abalone

re

Metallinou, C., Asimakopoulos, B., Schröer, A., Nikolettos, N., 2007. Gonadotropin-releasing hormone in the ovary. Reprod. Sci. 14, 737–749.

lP

Minakata, H., Tsutsui, K., 2016. Oct-GnRH, the first protostomian gonadotropin-releasing

na

hormone- like peptide and a critical mini-review of the presence of vertebrate sex steroids in mollusks. Gen. Comp. Endocrinol. 227, 109–114.

ur

Nagasawa, K., Oouchi, H., Itoh, N., Takahashi, K.G., Osada, M. 2015. In Vivo Administration of

Jo

Scallop GnRH-Like Peptide Influences on Gonad Development in the Yesso Scallop, Patinopecten yessoensis. PLoS ONE 10(6), e0129571. Nabissi, M., Soverchia, L., Polzonetti-Magni, A.M., Habibi, H.,R., 2000 Differential splicing of three gonadotropin-releasing hormone transcripts in the ovary of seabream (Sparus aurata). Biol. Reprod. 62, 1329–1334. Nam, B.H., Kwak, W., Kim, Y.O., Kim, D.G., Kong, H.J., Kim, W.J., Kang, J.H., Park, J.Y., An, C.M., Moon, J.Y., Park, C.J., Yu, J.W., Yoon, J., Seo, M., Kim, K., Kim, D.K., Lee, S., Sung. S., Lee, C., Shin, Y., Jung, M., Kang, B.C., Shin, G.H., Ka, S., Caetano-Anolles,

Journal Pre-proof K., Cho, S., Kim, H. 2017. Genome sequence of pacific abalone (Haliotis discus hannai): the first draft genome in family Haliotidae. Gigascience 6:1-8. Nuurai, P., Cummins, S.F., Botwright, N.A., Sobhon, P., 2015. Characterization of an abalone gonadotropin-releasing hormone and its effect on ovarian cell proliferation. Aquaculture, 450: 116-122. Nuurai, P., Primphon, J., Seangcharoen, T., Tinikul, Y., Wanichanon, C., Sobhon, P., 2014.

ro

Haliotis asinina. Microsc. Res. Tech. 77, 110–119.

of

Immunohistochemical detection of GnRH- like peptides in the neural ganglia and testis of

-p

Nuurai, P., Poljaroen, J., Tinikul, Y., Cummins, S., Sretarugsa, P., Hanna, P., Wanichanon, C.,

re

Sobhon, P., 2010. The existence of gonadotropin-releasing hormone- like peptides in the neural ganglia and ovary of the abalone, Haliotis asinina L. Acta Histochem. 112, 557–

lP

566.

na

Okubo, K., Nagahama, Y. 2008. Structural and functional evolution of gonadotropin-releasing hormone in vertebrates. Acta Physiol. 193, 3–15.

ur

Osada, M., Treen, N., 2013. Molluscan GnRH associated with reproduction. Gen. Comp.

Jo

Endocrinol. 181, 254–258.

Palmer, M. R., McDowall, M.H., Stewart, L., Ouaddi, A., MacCoss, M.J., Swanson, W.J. 2013. Mass spectrometry and next- generation sequencing reveal an abundant and rapidly evolving abalone sperm protein. Mol. Reprod. Dev. 80, 460–465. Pérez Sirkin, D. I., Lafont, A. G., Kamech, N., Somoza, G. M., Vissio, P. G., and Dufour, S. 2017. Conservation of three-dimensional helix- loop-helix structure through the vertebrate lineage reopens the cold case of gonadotropin- releasing hormone-associated peptide. Front. Endocrinol. 8:207.

Journal Pre-proof Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M., Meng, E.C., Ferrin, T.E., 2004. UCSF Chimera--a visualization system for exploratory research and analysis.. J. Comput. Chem. 25:1605-1612. Roch, G.J., Tello, J.A., Sherwood, N.M., 2014. At the transition from invertebrates to vertebrates, a novel GnRH-like peptide emerges in amphioxus. Mol. Biol. Evol. 31 : 765– 778.

of

Sakai, T., Shiraishi, A., Kawada, T., Matsubara, S., Aoyama, M., Satake, H., 2017. Invertebrate

ro

gonadotropin-releasing hormone-related peptides and their receptors: An Update. Front.

-p

Endocrinol. 8: 1–8.

re

Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez, R., McWilliam, H., Remmert, M., Söding, J. 2011. Fast, scalable generation of high-quality protein multiple

lP

sequence alignments using Clustal Omega. Mol. Syst. Biol. 7, 1-6.

na

Silver, M.R., Kawauchi, H., Nozaki, M., Sower, S.A., 2004. Cloning and analysis of the lamprey GnRH-III cDNA from eight species of lamprey representing the three families of

ur

Petromyzoniformes. Gen. Comp. Endocrinol. 139, 85–94.

Jo

Song, Y., Miao, J., Yuefeng, Cai, Y., Pan, L., 2015. Molecular cloning, characterization, and expression analysis of a gonadotropin-releasing hormone- like cDNA in the clam, Ruditapes philippinarum. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 189: 47-54. Sower, S.A., Nucci, N.V., Silver, M.R., 2004. Family of Gonadotropin-releasing hormone. Martini, L., (Eds.), Encyclopedia of Endocrine Diseases, 2 nd ed., Elsevier, pp 306–317. Suleria, H.A., Masci, P.P., Gobe, G.C, Osborne, S.A., 2015. Therapeutic potential of abalone and status of bioactive molecules: A comprehensive review. Crit. Rev. Food Sci. Nutr. 57 : 1742–1748.

Journal Pre-proof Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013 MEGA6: Molecular evolutionary genetics analysis Version 6.0. Mol. Biol. Evol. 30: 2725–2729. Tinikul, Y., Poljaroen, J., Tinikul, R., Anuracpreeda, P., Chotwiwatthanakun, C., Senin, N., Poomtong, T, Hanna, P.J., Sobhon, P. 2014. Effects of gonadotropin-releasing hormones and dopamine on ovarian maturation in the Pacific white shrimp, Litopenaeus vannamei, and their presence in the ovary during ovarian development. Aquaculture 420–421: 79–

of

88.

ro

Tsai, P.S., 2006. Gonadotropin-releasing hormone in invertebrates: structure, function, and

-p

evolution. Gen. Comp. Endocrinol. 148, 48–53.

re

Tsai, P.S., Maldonado, T.A., Lunden, J.B., 2003. Localization of gonadotropin-releasing hormone in the central nervous system and a peripheral chemosensory organ of Aplysia

lP

californica. Gen. Comp. Endocrinol. 130: 20–28.

na

Tsai, P.S., Zhang, L., 2008. The emergence and loss of gonadotropin-releasing hormone in protostomes: orthology, phylogeny, structure, and function. Biol. Reprod. 79: 798–805.

ur

Tsutsui, H., Yamamoto, N., Ito, H., Oka, Y., 1998. GnRH- immunoreactive neuronal system in

Jo

the presumptive ancestral chordate, Ciona intestinalis (Ascidian). Gen. Comp. Endocrinol. 112: 426–432. Twan, W.H., Hwang, J.S., Lee, Y.H., Jeng, S.R., Yueh, W.S., Tung, Y.H. 2006. The presence and ancestral role of gonadotropin-releasing hormone in the reproduction of scleractinian coral, Euphyllia ancora. Endocrinol. 147: 397–406. Waterhouse, A.M, Procter, J.B., Martin, D.M.A., Clamp, M, Barton, G.J., 2009. Bioinformatics Jalview Version 2-a multiple sequence alignment editor and analysis workbench. 25 : 1189-1191.

Journal Pre-proof Yang, J., Yan, R., Roy, A., Xu, D., Poisson, J., Zhang, Y. 2015. The I-TASSER Suite: protein structure and function prediction. Nat. Methods 12, 7–8. Zhang, L., Tello, J.A., Zhang, W., Tsai, P.S., 2008. Molecular cloning, expression pattern and immunocytochemical localization of a gonadotropin-releasing hormone like molecule in the gastropod mollusk, Aplysia californica. Gen. Comp. Endocrinol. 156: 201–209. Zhang, L., Wayne, N.L., Sherwood, N.M., Postigo, H.R., Tsai, P.S. 2000. Biological and

of

immunological characterization of multiple GnRH in an opisthobranch mollusk, Aplysia

Jo

ur

na

lP

re

-p

ro

californica. Gen. Comp. Endocrinol. 188: 77–89. https://doi.org/10.1006/gcen.2000.7457

Journal Pre-proof Figure legends Figure 1. The nucleotide and deduced amino acid sequences of prepro-GnRH in Haliotis discus hannai. The sequence containing the GnRH dodecapeptide is highlighted in light grey, and the GnRH associated peptide (GAP) is underlined (dashed line). The N-terminal signal peptide is underlined (solid line). The initiation, stop codon (asterisks), and the consensus polyadenylation signal sequences are marked in boldface. A potential proteolytic processing site is boxed by an

of

open rectangle. Two cysteine residues (Cys-39, Cys-106) in the gap region, forming a disulfide

ro

bond, are circled.

-p

Figure 2. A schematic diagram of the motifs detected in GnRH of H. discus hannai and other

re

invertebrates and vertebrates. Distinct motifs are denoted by different colors. Figure 3. (A) Comparisons of mature GnRH peptide sequences in protostomes and

lP

deuterostomes. Identical amino acid residues, based on the Homo sapiens GnRH-I, are shaded in

na

blue, similar residues are labeled in gray. The GenBank accession numbers of the peptide precursors were: Gallus gallus GnRH-I (AEZ51860.1) and GnRH-II (AEZ51860.1), H. sapiens (EAW63591.1)

and

GnRH-II

ur

GnRH-I

(AAI15401),

Strongylocentrotus

purpuratus

Jo

(XP_800179.1), H. discuss hannai (the present study, GenBank accession No. AZL93822.1), L. gigantea (FC 805607 and FC 796606), H. laevigata (AKR13997.1), H. asinina (AKR13998.1), A. californica (ABW82703.1), O. vulgaris (BAB86782.1), C. gigas (ADZ17180.1), M. yessoensis (BAH47639.1). (B) Alignment of the GnRH associated peptide (GAP) of H. discus hannai with the deduced sequence of the gastropod mollusk, Aplysia and Deroceras GnRH precursor. Identity, high and low amino acid conservations are denoted by (*), (:), and (.) respectively.

Journal Pre-proof Figure 4. Phylogenetic tree, based on the amino acid residues of GnRH, constructed by the neighbor joining method after clustalW alignment. Numbers at the nodes indicate the bootstrap probability. The 0.2 scale bar indicates the amino acid substitutions per site. The GenBank accession number of the sequences used to construct the phylogenetic tree are as follows: Micropogonias undulatus (AAQ16502.2), Haplochromis burtoni (AAC27717.1), Mugil cephalus (AAQ83270.1), Oncorhynchus kisutch (XP_020349613.1), Mordacia moradex

unicuspis

australis (AAQ77371.2), (AAQ77373.1),

G.

gallus

Lampetra

appendix

(CAA49246.1),

(AAQ77374.1),

Tupaia

belangeri

ro

Ichthyomyzon

Geotria

of

(AAQ77371.2),

-p

(AAB16837.1), Mus musculus (AAI16900.1), H. sapiens (NP_001191482.1), Oryzias latipes

re

(BAC06425.1), Coregonus clupeaformis (AAP57220.1), Cyprinus carpio (AAM77660.1), H. discus hannai (AZL93822.1), H. laevigata (AKR13997.1), A. californica (NP_001036826.1), M.

lP

yessoensis (BAH09303), O. vulgaris (BAB 86782.1), U. edulis (BAH 09303.1) Bombyx mori

Figure 5.

na

(NP_ 001036826.1).

Three-dimensional homology structures of H. discus hannai (A) GnRH and

ur

(B).GnRH associated peptide (GAP). The N- and C- termini are marked with blue arrows. The

Jo

figure was generated using I-TASSER and the domains between the N- and C- termini are predicted from the secondary structure. Figure 6. Differential GnRH mRNA expression (means ± SD, N = 3) in abalone tissues as determined by qPCR analysis. Data were compared with the value of the branchial ganglion, which was assigned a relative value of 1. Different letters are used to indicate the significant differences (p < 0.05). Figure 7. Quantitative PCR analysis of GnRH mRNA expression in neural ganglia and gonad at different effective accumulative temperature. Asterisks indicate significant difference (p < 0.05).

Journal Pre-proof Figure 8. Distribution of GnRH mRNA hybridization signal in the cerebral ganglion of H. discus hannai. (A) Neurosecretory cell expressing the GnRH mRNA (Arrows) in the cortex region hybridized with the GnRH riboprobe; (B) Medium magnification of A; (C) High magnification showing hybridized mRNA in neurosecretory cells; (D) Medium magnification showing hybridization signal in the other area of cortex region; (E) Hybridized with the GnRH sense probe, showing no hybridization signal; (F) Fast red counterstaining of section C exhibiting

of

hybridized neurosecretory cells. Co, Cortex; Me, Medullae NS, Neurosecretory cells. Scale bars

Jo

ur

na

lP

re

-p

ro

100 µm.

Jo

ur

na

lP

re

-p

ro

of

Journal Pre-proof

Figure 1

Journal Pre-proof

Jo

ur

na

lP

re

-p

ro

of

Figure 2

Figure 3

Jo

ur

na

lP

re

-p

ro

of

Journal Pre-proof

Jo

ur

na

lP

re

-p

ro

of

Journal Pre-proof

Figure 4

ur Jo

Figure 5

na

lP

re

-p

ro

of

Journal Pre-proof

re

-p

ro

of

Journal Pre-proof

Jo

ur

na

lP

Figure 6

of

Journal Pre-proof

Jo

ur

na

lP

re

-p

ro

Figure 7

Jo

ur

na

lP

re

-p

ro

of

Journal Pre-proof

Figure 8

Journal Pre-proof

Jo

ur

na

lP

re

-p

ro

of

cDNA, complementary DNA; GnRH, gonadotropin-releasing hormone; GAP, GnRH associated peptide; qPCR, quantitative polymerase chain reaction; RACE, rapid amplification of cDNA ends; RT-PCR, reverse transcription-polymerase chain reaction.

Journal Pre-proof Research Highlights 

A 1072-bp GnRH cDNA sequence was obtained from the cerebral ganglion of H. discus hannai encoding a deduced protein of 216 amino acids.



Molecular phylogenetic analysis revealed that H. discus hannai GnRH is a member of the GnRH-V family.

ur

na

lP

re

-p

ro

quantitative PCR and in situ hybridization results.

of

The cloned GnRH transcript is highly expressed in cerebral ganglion by means of

Jo

