Two ferritin subunits from disk abalone (Haliotis discus discus): Cloning, characterization and expression analysis

Fish & Shellfish Immunology 23 (2007) 624e635 www.elsevier.com/locate/fsi

Two ferritin subunits from disk abalone (Haliotis discus discus): Cloning, characterization and expression analysis Mahanama De Zoysa, Jehee Lee* Department of Marine Biotechnology, College of Ocean Science, Cheju National University, 66 Jejudaehakno, Ara-dong, Jeju 690-756, Republic of Korea Received 16 October 2006; revised 29 December 2006; accepted 11 January 2007 Available online 23 January 2007

Abstract Ferritin plays a key role in cellular iron metabolism, which includes iron storage and detoxification. From disk abalone, Haliotis discus discus, the cDNA that encodes the two ferritin subunits abalone ferritin subunit 1 (Abf1) and abalone ferritin subunit 2 (Abf2) were cloned. The complete cDNA coding sequences for Abf1 and Abf2 contained 621 and 549 bp, encoding for 207 and 183 amino acid residues, respectively. The H. discus discus Abf2 subunit contained a highly conserved motif for the ferroxidase center, which consists of seven residues of a typical vertebrate heavy-chain ferritin with a typical stemeloop structure. Abf2 mRNA contains a 27 bp iron-responsive element (IRE) in the 50 UTR position. This IRE exhibited 96% similarity with pearl and Pacific oyster and 67% similarity with human H type IREs. However, the Abf1 subunit had neither ferroxidase center residues nor the IRE motif sequence; instead, it contained iron-binding region signature 2 (IBRS) residues. Recombinant Abf1 and Abf2 proteins were purified and the respective sizes were about 24 and 21 kDa. Abf1 and Abf2 exhibited iron-chelating activity 44.2% and 22.0%, respectively, at protein concentration of 6 mg/ml. Analysis of tissue-specific expression by RT-PCR revealed that Abf1 and Abf2 ferritin mRNAs were expressed in various abalone tissues, such as gill, mantle, gonad, foot and digestive tract in a wide distribution profile, but Abf2 expression was more prominent than Abf1. Ó 2007 Elsevier Ltd. All rights reserved. Keywords: Abalone; cDNA expression; Ferritin; Hemocyte; Iron-responsive element

1. Introduction Iron has been considered an essential element for all living organisms, being critical in many biological functions, such as oxygen transport, electron transfer, DNA synthesis, and many enzymatic reactions. Moreover, iron is a constituent of metalloproteins like enzymes, electron transfer complexes, and oxygen carriers. On the other hand, an excess of free iron in living cells is potentially toxic, since it promotes serious reactions like oxidative injury [1]. Therefore, cells have evolved homeostatic mechanisms that regulate the transport, storage and mobilization of cellular iron to prevent any deleterious effects. Many proteins are involved in iron metabolism. Among them, ferritin plays the most important role in iron storage and detoxification [2]. Structurally, a ferritin molecule consists of a central microcrystalline, ferric-oxyhydroxy phosphate core that is capable of accommodating up to 4500 Fe (III) as an inorganic * Corresponding author. Tel.: þ82 64 754 3472; fax: þ82 64 756 3493. E-mail address: [email protected] (J. Lee). 1050-4648/$ - see front matter Ó 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2007.01.013

M. De Zoysa, J. Lee / Fish & Shellfish Immunology 23 (2007) 624e635

625

complex. This central core is surrounded by an outer protective protein shell, called apoferritin, which is a heteropolymer consisting of 24 subunits [3]. In vertebrate ferritins, there are two distinct polypeptide chain subunits: heavy (H) and light (L). The heavy and light chains are encoded by two distinct genes, which have molecular masses that vary from 18 to 28 kDa [4,5]. The H-subunit contains a ferroxidase center, and the L chain contains a site for nucleation with a mineral core. The expression of these two types of ferritin genes varies among different cell types, during cell differentiation and neoplastic transformation, as well as in response to certain environmental stimuli [6,7]. This variability in gene expression is achieved both at the transcriptional and post-transcriptional levels, thereby resulting in a family of H-rich and L-rich isoferritins [8]. Ferritin gene expression is induced or controlled by different types of molecule, including iron, heavy metals, cytokines [9,10], hormones [11,12] drugs, and cAMP [13]. Tissue ferritins are composed of variable proportions of H and L subunits. For example, the H-subunit is predominant in heart ferritin, whereas the L subunit predominates in liver ferritin. These subunits show distinct amino acids with different functions in metal regulation. Ferritin has been identified in a wide range of organisms, such as fungi, bacteria, plants, invertebrates and vertebrates, where it maintains a highly conserved conformation. Even though ferritin displays some common features in its sequences and structures, it differs from organism to organism in terms of size, cellular or sub-cellular distribution, and regulation pattern [1,14,15]. To date, few studies have been conducted examining mollusk ferritins. Those that have been assessed include the soma and yolk ferritins of snail (Lymnaea stagnalis), two heavy-chain ferritin subunits of the Pacific oyster (Crassostrea gigas), and ferritin from the pearl oyster (Pinctada fucata) [16e18]. However, molecular-level information and any understanding about the different roles based on the different tissues of ferritin are limited among invertebrate species. The abalone (Haliotis discus discus) belongs to the class Gastropoda. The family haliotidae is one of the most popular mollusks in worldwide aquaculture. In this study, we describe the full length of two ferritin cDNA subunits abalone ferritin 1 (Abf1) and abalone ferritin 2 (Abf2) from disk abalone (H. discus discus). The tissue-specific mRNA expression profiles of Abf1 and Abf2 were analyzed by RT-PCR. Both recombinant ferritin subunits were expressed successfully in Escherichia coli cells, and the respective ferritin proteins were purified, using the pMALÔ fusion protein purification system. Finally, the iron-chelating activity of the purified Abf1 and Abf2 proteins was measured. 2. Materials and methods 2.1. Abalone and tissue extraction Disk abalone (H. discus discus), having an average weight of 60e80 g, were obtained from the Fisheries Resources Research Institute (Jeju, Republic of Korea) and acclimatized to laboratory conditions for 2 weeks. They were maintained in flat-bottomed rectangular tanks, and supplied with natural seaweed as feeding material with fresh seawater at 20e23  C. Abalone gill, mantle, gonad, foot and digestive tract tissues were harvested, immediately snap-frozen with liquid nitrogen, and stored at e70  C. 2.2. Abalone hemocyte extraction Hemolymph was collected into a sterile syringe from the pericardial cavity of three healthy abalones separately. It was immediately centrifuged at 500 g for 5 min at 4  C. Hemolymph supernatant was removed and the hemocyte pellets were used for RNA extraction. 2.3. RNA extraction and cDNA synthesis The total RNA was extracted from different abalone tissues namely gill, mantle, gonad, foot, digestive tract and hemocytes using Tri ReagentÔ (Sigma, USA), following the manufacturer’s protocol. cDNA was synthesized from 5 mg of RNA using a Cloned AMV first-strand cDNA synthesis kit (Invitrogen, USA). Briefly, 5 mg RNA from each tissue type was incubated with 1 ml of 50 mM oligo (dT)18 and 2 ml 10 mM dNTP at 45  C for 5 min. Thereafter, 4 ml of 4 cDNA synthesis buffer, 1 ml of dithiothreitol (0.1 M-DDT), 1 ml of RNaseOUTÔ (40 U/ml) and 1 ml of

626

M. De Zoysa, J. Lee / Fish & Shellfish Immunology 23 (2007) 624e635

cloned AMV reverse transcriptase (15 U/ml) were added and incubated for 1 h at 45  C. The reaction was terminated by incubating at 85  C for 5 min; then the cDNA samples were stored at e20  C. 2.4. Cloning and sequencing of abalone ferritin Abf1 and Abf2 subunits Expressed sequence tags (EST), homologous to the two ferritin subunits, Abf1 and Abf2, were isolated from the cDNA library, which was developed by total RNA from abalone and a cDNA kit (CreatorÔ SMARTÔ, Clontech, USA). Plasmid DNA of Abf1 and Abf2 was isolated by using the AccuPrepÔ plasmid extraction kit (Bioneer Co., Korea). The sequencing reaction was performed using a terminator reaction kit, Big Dye, and an AB1 3700 sequencer (Macrogen, Korea). 2.5. Amplification of Abf1, Abf2 coding sequences and sub-cloning into a pMAL-c2x vector Two sets of primers (Abf1-1F, Abf1-1R) and (Abf2-2F, Abf-2R) (Table 1) were designed to amplify the 621 and 549 bp coding sequences of Abf1 and Abf2, respectively. These primers were designed with EcoRI and HindIII restriction sites, respectively, for both Abf1 and Abf2. Amplification of ferritin Abf1 and Abf2 was conducted in a total of 50 ml of reaction volume using 1 ml (10 ng/ml) of DNA template, 5 ml of Herculase buffer, 1 ml of 10 mM dNTP mix, 1 ml of both 20 pmol/ml primer and 0.5 ml (5 U/ml) of Herculase polymerase enzyme. PCR was performed in a TaKaRa thermos cycle (Bioneer Co., Korea) with a denaturing step at 94  C for 2 min, followed by 10 cycles of 94  C for 30 s, 50  C for 30 s, and 72  C for 40 s, and then 20 cycles with the same conditions, followed by 72  C for 5 min as the final extension. The PCR product was visualized on a 1% agarose gel with a marker to confirm amplification of the product after PCR. Then, the PCR products were digested with EcoRI and HindIII, after purification of the PCR product using an AccuprepÔ PCR purification kit (Bioneer Co., Korea). The products were gel-purified using 1% agarose gel and an AccuprepÔ gel purification kit (Bioneer Co., Korea). The expression vector pMAL-c2X was digested with the same respective restriction enzymes (EcoRI and HindIII), and the purified PCR products of Abf1 and Ab2 were ligated into the vector by incubating at 16  C for 16 h, in accordance with the manufacturer’s protocol (NEB, USA). The recombinant plasmids were then transformed into competent cells. Subsequently, the plasmids were extracted by using an AccuprepÔ plasmid extraction kit (Bioneer Co., Korea) and transformed into E. coli K12 (TB1) for protein expression. 2.6. Induction of Abf1 and Abf2 protein expression in E. coli K12 (TB1) system Recombinant ferritin protein expression was conducted using iso-propyl b-thio-galactopyranoside (IPTG) as an inducer in E. coli K12 (TB1) cells. Briefly, transformed E. coli K12 (TB1) cells were incubated in ampicillin (100 mg/ml) LB broth overnight. This culture was used to inoculate 10 ml of LB broth in 2% glucose-rich medium with ampicillin at 37  C for 90 min, shaken at 200 rpm. When cell density reached 0.6 at OD600, the culture was induced in 1 mM IPTG at 30  C for 3 h. E. coli K12 (TB1) uninduced culture was used as a negative control. Protein purification of the abalone ferritin Abf1 and Abf2 was done in accordance with pMALÔ c2X and pMALÔ fusion Table 1 A description of primers used in this study Name

Target

Orientation

Sequence

Abf1-1F Abf1-1R Abf2-2F Abf2-2R Abf1-3F Abf1-3R Abf2-4F Abf2-4R Ab actin-5F Ab actin-5R

ORF amplification ORF amplification ORF amplification ORF amplification RT-PCR amplification RT-PCR amplification RT-PCR amplification RT-PCR amplification Internal PCR control Internal PCR control

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

ATGAAGACGGTTCTACTCAGCTC CTAGTCGTGCAGGTCCTTGTC ATGGCCCAAACTCAACCC TCACGTGCGACTATGCCC TCCATAAGTATTTCCTGGCCGCGT TCGTGAAGCTCTTCAGTCTCGTCA TTTCAAGAAGGCATCCGAGGAGGA TCGTACATGTATTCACCCAGGCCA ATGCAGAAGGAGATCACAGCCCTT AGGCTAGGGTCTTATTTGGGCTGT

M. De Zoysa, J. Lee / Fish & Shellfish Immunology 23 (2007) 624e635

627

protein purification protocols (NEB, USA). IPTG-induced culture was centrifuged and the pellets were resuspended in column buffer and stored at 20  C overnight. The cells were thawed and sonicated to facilitate cell lysis, before being centrifuged at 9000 g at 4  C for 30 min to isolate soluble protein. The precipitated pellets were solubilized with column buffer, in order to compare the protein with supernatant. The resulting supernatant and pellets were subjected to 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) to determine their solubility status before protein purification. Abf1 and Abf2 supernatants were loaded separately onto an amylase resin column, and eluted with an elution buffer (20 mM TriseHCl, pH 7.4; 200 mM NaCl; 1 mM EDTA; 10 mM mercaptoethanol; and 10 mM maltose). Then, the purified proteins were collected and run on 10% SDS-PAGE with a low-molecular-weight marker (Bio-Rad). Gels were stained for the detection of protein, using 0.05% Coomassie blue R-250, followed by standard de-staining.

2.7. Analysis of sequences The Abf1 and Abf2 full-length sequences were analyzed and compared with other known ferritin sequences that are available in the NCBI database. Searches for sequence similarities with known genes were performed, using BLAST analysis. Identification of conserved regions and protein translations, and analysis of amino acids were performed using DNAssist, version 2.2. Multiple sequence alignments and phylogenetic analysis were performed on amino acid sequences of Abf1 and Abf2, versus known ferritins, using ClustalW and MEGA version 3.0 [19]. Signal peptide was predicted through a SignalP worldwide P server (http://www.cbs.dtu.dk/).

2.8. Tissue expression of ferritin subunits in disk abalone by RT-PCR RT-PCR was optimized to determine tissue-specific ferritin expression in different abalone tissues. To do this, synthesized cDNA from abalone gill, mantle, gonad, foot, digestive tract and hemocytes were used to amplify 318 and 344 bp fragments of Abf1 and Abf2, respectively. Two sets of primers (Abf1-3F, Abf1-3R) and (Abf2-4F, Abf2-4R) (Table 1) were used for amplification of the Abf1 and Abf2 fragments. Actin expression was assessed in all selected tissues as an internal PCR control. A set of primers, Ab actin-5F and Ab actin-5R, was designed based upon an abalone actin mRNA sequence, to amplify the 492 bp fragment (Table 1). All PCR reactions were carried out at the same time in a 25-ml reaction volume containing 1 ml of cDNA from each tissue, 2.5 ml of 10 TaKaRa Ex TaqÔ buffer, 2.0 ml of 2.5 mM dNTP mix, 1.0 ml of each primer (20 pmol/ml), and 0.125 ml (5 U/ml) of TaKaRa Ex TaqÔ DNA polymerase (TaKaRa, Japan). The PCR reaction was first optimized by performing different cycle numbers (n ¼ 27, 28 and 30) for Abf1, Abf2 as well as actin amplification. After analyzing the expression pattern in different cycles, PCR reaction with 28 cycles was used for RT-PCR amplification. The cycling protocol was one cycle of 94  C for 3 min, 28 cycles of 94  C for 30 s, 55  C for 30 s, 72  C for 30 s, and one cycle of 72  C for 5 min for the final extension. The PCR products were visualized on a 1.2% agarose gel stained with ethidium bromide. All samples were run in the same gel with a 100 bp molecular marker (TaKaRA, Japan). Three replicate abalones were used to obtain each tissue type in order to evaluate the consistency of expression.

2.9. Iron-chelating activity of the ferritin subunits in disk abalone The protein concentrations of the purified Abf1 and Abf2 were determined using the Bradford method [20] using bovine serum albumin as the standard. The iron-chelating ability of purified abalone ferritin was determined, in accordance with a previously-reported method [21]. Briefly, 1 ml (6 mg/ml) each of Abf1 and Abf2 were added separately to a solution of 20 ml of 2 mM FeCl2. The reaction was initiated by adding 40 ml of 5 mM ferrozine, and the mixture incubated for 10 min at room temperature, with shaking. After incubation, the absorbance of the solution was measured at 562 nm, using a spectrophotometer. Minimum three replicates were used to get the average absorbance value for each Abf1 and Abf2 iron-chelating activity. Chelating activity was calculated as a percentage using the equation [C  (S  B)]/C  100%, in which control (C, column buffer used to purify the recombinant Abf1 and Abf2), ferritin sample (S), blank (B) were used in this equation.

628

M. De Zoysa, J. Lee / Fish & Shellfish Immunology 23 (2007) 624e635

3. Results 3.1. Sequence analysis, comparison of the two ferritin subunits: Abf1 and Abf2 The nucleotide and the deduced amino acid sequences of Abf1 and Abf2 are shown in Figs. 1 and 2, respectively. The full-length cDNA of Abf1 and Abf2 were 795 and 901 bp, respectively. Abf1 exhibited a 621 bp open reading frame (ORF) coding for 207 amino acids; in contrast, Abf2 exhibited a shorter 549 bp ORF and coded for a 183 amino acid protein. The predicted molecular weights of the Abf1 and Abf2 ferritins were 24 and 21 kDa, respectively. Also, the isoelectric points (pI) of the two ferritin subunits were predicted to be 8.4 and 6.1, respectively. The sequence of Abf1 subunits is distinct from Abf2, as well as from most other mollusk ferritins, because of its longer C-terminus, which contributes to its larger protein size. Using the SignalP program, the N-terminus of the Abf1 subunit was found to have a signal peptide, representing a cleavage site at amino acid positions 20e21. There was no signal peptide in the Abf2 subunit sequence. The deduced amino acid sequence of the abalone Abf2 contained a putative iron-binding region signature (IBRS) 1 (61REHAEKLMKYQNTRGGR77) and IBRS 2 (124DAQMCDFLESEY LEEQVKAIK144) as determined by the PROSITE program (http://kr.expasy.org/prosite/). However, the Abf1 sequence showed only the IBRS 2 (158DPHVTHFLEDRFLETKVDVIK178). The highly conserved IRE domain (27 bp) sequence (109TCTTGCTGCGTCAGTGAACGTACGGGC83) was present in the 50 UTR of the abalone

Fig. 1. Full-length nucleotide and deduced amino acid sequences of disk abalone ferritin 1(Abf1) cDNA. This cDNA sequence has been deposited in GenBank under Accession No: DQ821493. The start (ATG) and stop (TAG) codons are underlined. The shaded box indicates the predicted signal peptide. Putative ferritin iron-binding region signature 2 (PROSITE program) is bold underlined, and the polyadenylation signal is double underlined. The poly-A tail is at the end with a dotted underline.

M. De Zoysa, J. Lee / Fish & Shellfish Immunology 23 (2007) 624e635

629

Fig. 2. Full-length nucleotide and deduced amino acid sequences of disk abalone ferritin 2 (Abf2) cDNA. This cDNA sequence has been deposited in GenBank under Accession No. DQ821494. The start (ATG) and stop (TAG) codons are underlined. The shaded box indicates the iron response element sequence (IRE) in the 50 UTR. Putative ferritin iron-binding region signatures (IBRS) 1 and 2 are bold underlined and italic underlined, respectively. The seven metal ligands in the ferroxidase center are shaded, and the putative N-glycosylation site (NQSL) is bold-dotted underlined. The polyadenylation signal is double underlined, and the poly-A tail is at the end with a dotted underline.

Abf2 subunit, but not in the Abf1 subunit. Seven amino acid residues, identified as metal ligands at the H-specific ferroxidase center in mammalian ferritins, are completely conserved in the Abf2 subunit: they are Glu25, Tyr32, Glu59, Glu60, His63, Glu105 and Gln139. Potential biomineralization residue Tyr27 was also observed, but only in the Abf2 subunit. Furthermore, Met24 and Gln33 residues were observed immediately adjacent to the Glu25 and Tyr32 residues, which are supposed to be associated with the iron-binding site at the ferroxidase center. Previous studies have revealed similar conserved residues in oyster ferritin and snail soma ferritin. A potential N-glycosylation site 109 NQS111 was observed in Abf2, but not in the Abf1 amino acid sequence; this site is found in most ferritin subunits. The abalone Abf2 subunit had three cysteine residues at C12, C128, C165, while Abf1 had only one cysteine residue at C13; but none of these were matched with the three cysteines at C90, C102 and C130 in the human ferritin heavy-chain subunit. Both Abf1 and Abf2 subunits exhibited a putative AATAAA polyadenylation signal, starting 37 and 36 nucleotides upstream of the poly-A tail, respectively. 3.2. An iron-responsive element (IRE) and a stemeloop structure (SLS) in the Abf2 subunit The 50 UTR of Abf2 cDNA contains a 27 bp, highly conserved IRE sequence 83 bp upstream of the start codon, ATG. Alignment of the Abf2 IRE sequence with known IREs showed the highest identity (96%) with pearl oyster,

630

M. De Zoysa, J. Lee / Fish & Shellfish Immunology 23 (2007) 624e635

Pacific oyster GF1, bullfrog, snail and chicken ferritin’s respective elements. Also, Abf2 shared 67% similarity with the human heavy-chain ferritin IRE sequence (Fig. 3A). This putative IRE can be folded into a typical stemeloop secondary structure (Fig. 3B), which perfectly matches all IRE characteristics, including its six nucleotide loop 50 -CA GUGA-30 , its proximal stem of five paired bases, followed by a bulged cysteine, and its six nucleotide bottom stem, as defined by Dandekar et al. and Klausner et al. [22,23]. Abf1 and Abf2 shared only 35% amino acid identity. Therefore, Abf1 and Abf2 appear to be two distinct ferritin subunits present in disk abalone. The low degree of identity between Abf1 and Abf2 was due to the long C-terminal sequence in the Abf1 subunit. Pair-wise alignment of the amino acid sequences showed that Abf1 has the highest degree of homology (38%) with Pacific white shrimp (Litopenaeus vannamei), while Abf2 has (76%) the highest homology to pearl oyster (Pinctada fucata) (Table 2). 3.3. Phylogenetic analysis Phylogenetic analysis was done by aligning amino acid sequences with ClustalW, and Neighbor-joining (NJ) tree with MEGA (3.0). Analysis revealed two well-defined, principle clusters of vertebrate and invertebrate ferritin (Fig. 4). Clearly isolated fish, amphibian, and mammalian ferritin sub-clusters were observed within the main vertebrate ferritin cluster. The new abalone ferritin subunits appeared to fit into two different sub-clusters within the invertebrate ferritin family. Abf2 exhibits the highest degree of sequence similarity with pearl oyster ferritin, while Abf1 appears to divert from the main mollusk ferritin cluster to move closer to mollusk Liolophura japonica and Pacific white shrimp. A

Abalone fern 2 (Abf2) Pinctada fern Oyster GF1 Oyster GF2 Rana fern Lymneas fern Chicken fern Human HF

:1 :1 :1 :1 :1 :1 :1 :1

TCTTGCTGCGTCAGTGAACGTACGGGC GCTTGCTGCGTCAGTGAACGTACGGGC TCTTGCTGCGTCAGTGAACGTACGGAC TTTTGCTGCGTCAGTGAACGTACGGAC TCTTGCTGCGTCAGTGAACGTACGGAC TCTTGCTGCGTCAGTGAACGTACGGAC TCTTGCTGCGTCAGTGAACGTACGGAC TCCTGCTTCAACAGTGCTTGGACGGAA **** ***** * ** *

27 27 27 27 27 27 27 27

B

Fig. 3. Alignments of IRE and stemeloop structure of abalone Abf2 with different species. (A) Alignment of the Abf2 IRE with selected ferritin IREs. Consensus residues are shaded and identical residues are in bold. Abalone ferritin 2 (Abf2); pearl oyster (Pinctada fucata) ferritin; Pacific oyster (Crassostrea gigas) GF1 and GF2; bullfrog (Rana catesbeiana) ferritin; great pond snail (Lymnaea stagnalis) soma ferritin; chicken (Gallus gallus) ferritin; and human (Homo sapiens) ferritin H. (B) A comparison of the IRE stemeloop structure of Abf2 and known ferritins GF1 (Crassostrea gigas), Pinctada fucata and Lymnea stagnalis. Typical CAGUGA loop structure residues and bulged cysteines are in bold.

M. De Zoysa, J. Lee / Fish & Shellfish Immunology 23 (2007) 624e635

631

Table 2 The homology percentage of disk abalone Abf1, Abf2 amino acid sequences with known ferritins

Abf1 Abf2

Abf2

P. fucata Fen

G. gigas GF1

G. gigas GF2

L. stagnalis SFen

L. vannamei Fen

Human FenH

Human FenL

35 e

28 76

33 71

36 71

30 70

38 55

38 55

36 46

3.4. Expression of abalone ferritins in E. coli K12 (TB1) cells To purify the recombinant ferritin, we transformed the two ferritin subunit clones into E. coli K12 (TB1) cells and induced protein expression with IPTG. Abalone Abf1 and Abf2 proteins were purified using the maltose binding pMALÔ c2X system, and purified protein was subjected to 10% SDS-PAGE to determine its purity status and to confirm the size of the ferritin subunits. As expected, Abf1 and Abf2 protein bands were noted at approximately 66.5 and 63.5 kDa, respectively. These results are in strong agreement with our two predicted sizes of 24 and 21 kDa, since the maltose binding fusion protein is 42.5 kDa (Fig. 5). Therefore, both Abf1 and Abf2 ferritin are well within the size range of ferritin subunits noted in other organisms (19e28 kDa).

86 100

House mouse FH Norway rat F Human FH

98

Catfish F

96

Vertebrate

Zebrafish F

96 41

Atlantic salmon F Rainbow trout F

59

Xenopus F

64 95

Bullfrog F Acari F

47

Octopus dofleni F Starfish F

21 97

Great pond snail SF 30 40 37

Pearl oyster F 65

Disk abalone (Abf2)

Invertebrate

Pacific oyster GF2 Pacific oyster GF1

21 100

Pacific oyster SF2 Pacific white shrimp F Liolophura japonica F Disk abalone (Abf1)

0.1 Fig. 4. Phylogenetic analysis of the disk abalone Abf1 and Abf2 subunits. The tree is based on an alignment corresponding to the full length of the ferritin amino acid sequences, using ClustalW and MEGA (3.0). The numbers of branches are bootstrap values for 1000 replicates. The GenBank accession numbers for the sequence designations are as follows: abalone (H. discus discus) Abf1 (DQ821493), Abf2 (DQ821494), Acari (Hyalomma asiaticum asiaticum) F (AAS66655), Atlantic salmon (Salmo salar) F (AAB34575), bullfrog (Rana catesbeiana) F (AAA49532), catfish (Ictalurus punctatus) F (AAY86949), great pond snail (Lymnaea stagnalis) SF (CAA40096), house mouse (Mus musculus) FH (AAH12314), human (Homo sapiens) FH (AAH66341), Liolophura japonica F (AB006447), Norway rat (Rattus norvegicus) F (NP_036980), Octopus dofleini F (AAD29639), Pacific oyster (Crassostrea gigas) GF1 (CAD91440), GF2 (AAP83794), SF (CAD92096), Pacific white shrimp (Litopenaeus vannamei) F (AAX55641), pearl oyster (Pinctada fucata) F, (AF547223), rainbow trout (Oncorhynchus mykiss) F (BAA13146), starfish (Asterias forbesii) F (AF001984), Xenopus tropicalis F (AAH61303), zebrafish (Danio rerio) F (NP_571660).

M. De Zoysa, J. Lee / Fish & Shellfish Immunology 23 (2007) 624e635

632

3.5. Analysis of tissue and hemocyte ferritin mRNA expression To identify preferential tissue-specific ferritin expression in vivo, ferritin mRNA expression was examined in different abalone tissues by RT-PCR. In this RT-PCR study, the 318 and 344-bp fragments of Abf1 and Abf2 were amplified with their respective primers, designed based upon the above two sequences. As an internal PCR control, an abalone actin (492 bp) fragment was amplified under the same PCR reaction conditions. Both Abf1 and Abf2 mRNA were expressed in all selected tissues namely gill, mantle, gonad, foot and digestive tract (Fig. 6AeC). Interestingly, Abf2 gill, mantle, gonad, foot and digestive tract tissues showed higher expression than Abf1 in all respective tissues. Although, both Abf1 and Abf2 gonad tissue showed lower expression but comparison with actin internal PCR control gonad expression could be assumed as similar to other organ expression level. RT-PCR expression results showed that Abf2 was expressed in abalone hemocytes as similar expression of Abf2 in other tissues (Fig. 6). In contrast, there was no Abf1 mRNA expression in hemocytes. 3.6. Iron-chelating activity of ferritin subunits in disk abalone The iron-chelating activities of Abf1 and Abf2 were determined based upon color reduction of the iron-ferrozine complex. Average values at 562 nm for control, Abf1 and Abf2 were 1.782, 0.993 and 1.39, respectively. Ironchelating activity of Abf1 and Abf2 was calculated as 44.2% and 22.0%, respectively, at the protein concentrations of 6 mg/ml.

4. Discussion In this study, we successfully isolated and sequenced the two ferritin subunits from disk abalone and determined the tissue expression profile. The two subunits could be categorized as genetically distinct; two different ferritin types based upon sequence characterization of homology with other known ferritins, tissue expression, and metal chelating activity. The Abf2 gene has significant similarities with H type ferritins, mainly because of the presence of a ferroxidase center, a Tyr 25 residue, and alignment identities with known ferritin H types. The amino acid residues responsible for the fixation, oxidation and incorporation of iron in the hydrous iron (III) oxide mineral core are completely conserved in abalone Abf2 at positions Glu25, Tyr32, Glu59, Glu60, His63, Glu105 and Gln139. Almost identical residues are conserved in the oyster ferritin H-subunit [17]. This H-specific ferroxidase center and Tyr27 are characteristic of vertebrate ferritin H-subunits, as well as of many other ferritins in a highly conserved manner [1]. Further, Tyr27 has been proposed as a prerequisite for the rapid biomineralization of iron in vertebrate H-ferritins [24]. Interestingly, the Tyr27 residue also was observed in the Abf2 subunit. A previously published study has shown that pearl oyster shares a high degree of identity with snail and H-chain mammalian ferritins [18]. Furthermore, abalone Abf2 has its highest degree of identity with pearl oyster (76%), and a greater degree of identity with human H-chains (55%) than human

A kDa M 250

B

Abf1 1

2

3

4

kDa 250

100 75

100

50

50

37

Abf2 M

1

2

3

4

75

37

25 25

Fig. 5. SDS-PAGE analysis of purified recombinant Abf1 and Abf2 proteins, using E. coli K12 (TB1) cells and the pMALÔ c2X system. (A) Subunit Abf1; (B) Subunit Abf2, M, Molecular marker (kDa); 1, uninduced cells (control); 2, induced supernatant; 3, pellets; 4, purified ferritin with fusion protein.

M. De Zoysa, J. Lee / Fish & Shellfish Immunology 23 (2007) 624e635

633

Fig. 6. Tissue-specific expression of ferritin mRNA in abalone Abf1 and Abf2 subunits by RT-PCR. Arrows indicate respective PCR products. (A) Abf1 (318 bp); (B) Abf2 (344 bp); and (C) actin (492 bp) was used as internal PCR control. Mk, 100 bp molecular marker; G, gill; M, mantle; R, gonad; F, foot; D, digestive tract and H, hemocytes.

L-chains (46%). All this evidence could support the categorization of Abf2 as an H type subunit; but further functional analysis is warranted before this determination can be made. In contrast, Abf1 does not contain any of the characteristic features belonging to H type ferritin, and it consistently exhibited lower degrees of identity with known L type ferritins also. In bullfrog (Rana catespiana) and salmon (Salmo salar), a third ferritin subunit has been reported, which has been termed the middle subunit (M). This unit was discovered to have a very different sequence than either H or L subunits [25,26]. Hence, the Abf1 subunit could be either an intermediate ferritin subunit (M) or an L type that is relatively exclusive to abalone. Again, all of these conjectures warrant further investigation. Most mollusk and echinoderm ferritins have amino acids numbering in the range of 170e180; for example, Pacific oyster 171; Octopus dofleini 172; Helix 172 and L. stagnalis 174 [27]. On the other hand, vertebrate ferritins generally have 170e185 amino acids [17]. Abalone Abf2 has 183 amino acids, which is consistent with most mollusks and vertebrates. However, a few mollusk species, like L. japonica (223 aa) and pearl oyster (206 aa), have an exceptionally high number of amino acids. Interestingly, so does disk abalone Abf1, with 207 amino acids. It has been suggested that the common ancestor of all ferritins may have been an H type that differentiated into H and L types during evolution [28]. A highly conserved IRE motif was identified 83 bp upstream of the predicted ATG translational start codon in the abalone Abf2 subunit. Although no IRE motif was found within the 22 bp 50 UTR of the other Abf1 subunit. The ferritin IREs are phylogenetically conserved in a cap-proximal position [29]. IREs have been identified in almost all known ferritin subunit mRNA, except for a few species like snail yolk ferritin and Schistosoma mansoni [16]. Abalone IRE can be folded into a stemeloop structure, which is considered to be the binding site for iron regulatory protein (IRP). Therefore, the presence of IRE in the 50 UTR of the Abf2 mRNA indicates that the expression of abalone ferritin is regulated at the translational level by iron. Cysteine residues play an integral role in the oxidation of ferritin, and are essential for the formation of ferritin aggregates. The H-subunit of human ferritin contains three cysteine residues, at positions 90, 102 and 130. But some deviation of these cysteine has been observed in rat ferritin, which contains arginine at position 90 [30]. Abalone Abf1 contains one cysteine residue, at position 13, while Abf2 contains three cysteine residues, at positions 12, 128, and 165. Therefore, abalone cysteine may have a functional role in the formation of ferritin aggregates, something which must be determined by side-directed mutagenesis. Abalone ferritins were expressed successfully in the E. coli K12 (TB1) and pMALÔ c2X systems. Both recombinant Abf1 and Abf2 fusion proteins were subjected to SDS-PAGE to determine protein size. As expected, the two proteins were 66.5 and 63.5 kDa, including the maltose binding fusion protein (42.5 kDa). Therefore, abalone Abf1 and Abf2 are 24 and 21 kDa, respectively, as predicted. These masses are within the range observed in other vertebrate and invertebrate ferritins, such as Pacific oyster, both Gf1 and Gf2 (20 kDa), pearl oyster (23.6 kDa), snail soma ferritin (20.1 kDa), yolk ferritin (25.4 kDa), and Pacific white shrimp (19.4 kDa) [31]. Both abalone ferritins failed to fulfill their maximum capacity of iron storage under natural conditions. The iron scavenging activity of purified Abf1 is higher than that of Abf2. This may be due to the initial storage of a certain amount of iron by both ferritins. Previous investigators have suggested that this condition exists, because the accumulation and release of iron in ferritin depends upon the number of iron atoms already present in the molecule, and on the

634

M. De Zoysa, J. Lee / Fish & Shellfish Immunology 23 (2007) 624e635

size of the surface area on the iron core [32]. In the future, we will be investigating in vitro iron incorporation of abalone ferritin subunits with respect to ferroxidase activity. Digestive tissue is believed to be a major site of metal accumulation, and such high expression of ferritin mRNA has been observed in the digestive tract of pearl oyster [18]. This is further supported by microanalysis and histochemical results indicating the cellular and sub-cellular distribution of iron in mollusks [33]. Therefore, we suggest that abalone digestive tissue also plays an important role in iron metabolism. The literature shows that ferritin is distributed to a different degree in different tissues dependent upon the species. For example, Pacific oyster (C. gigas) expresses ferritin in adductor muscle, mantle, heart, gill, digestive gland, stomach and hematocytes [17]. Similarly, Abf1 and Abf2 expression was common in gill, mantle, gonad, foot and digestive tract tissues. In contrast, only Abf2 was expressed in hemocytes, not the Abf1. An important point of Abf1 and Abf2 expression analysis is that Abf2 shows higher expression in all tissues than Abf1. It is well known that ferritin expression can be up-regulated not only by iron but also heavy metals such as Znþ2 and Cuþ2 [34]. Therefore, ferritin expression could vary depending on the type of stimulation and concentration. Furthermore, if there are different subunits present in the same species, those subunits may show different expression patterns based on their iron-chelating capacities or in different time frames of stimulation. For example, the major functional subunit may be expressed under normal conditions and others may be in silent mode or low level of expression. But with stimulation, expression of other minor subunits may increase to regulate the excessive iron. Furthermore, hemocytes may not need to express all different ferritin subunits compared to other organ tissues. Many reports have been published with respect to the tissue-specific function of ferritin, such as the mantle ferritin involved in shell formation in pearl oyster [18]. It has also been suggested that ferritin has other functions, including roles in invertebrate immune responses [35], protection against free radicals [36], cell proliferation [37], and high level accumulation of natural radionuclide 210Po [17,38,39]. Therefore, having two different ferritin subunits, as well as high levels of expression in certain important organs, gives us a high degree of confidence stating that abalone ferritin has other, unknown functions which warrant future investigation. In summary, we conclude that disk abalone contains two different ferritin subunits, which are genetically distinct from each other, but which may be derived from a common ancestor. The subunit Abf2 is most similar to the heavy chain of vertebrate ferritins. Whether light chain homology exists in abalone cannot be answered at this time, since the Abf1 subunit type does not exhibit clear sequence characteristics. Such homology might be identified in future studies. Since there are differences in the regulation, function and expression of the two ferritin subunits, further studies are necessary to aid in our understanding regarding the tissue-specific expression and other immune-related functions of the ferritin subunits in disk abalone. Acknowledgement This work was supported by the Marine and Extreme Genome Research Center Program, Ministry of Marine Affairs and Fisheries, Republic of Korea. Mahanama De Zoysa was supported by the Korea Research Foundation funded by the Korean Government (MOEHRD, Basic Research Promotion Fund, KRF-2005-211-F00021). References [1] Andrews SC, Arosio P, Bottke W, Briat JF, Von Darl M, Harrison PM, et al. Structure, function, and evolution of ferritins. J Inorg Biochem 1992;47:161e74. [2] Cario G, Rappocciolo E, Tacchini L, Schiaffonati L. Expression of the genes for the ferritin H and L subunits in rat liver and heart. Evidence for tissue-specific regulations at pre- and post translational levels. Biochem J 1991;275:813e6. [3] Theil EC. The iron-responsive elements (IRE) family of mRNA regulators. Regulation of iron transport and uptake compared in animals, plants, and microorganisms. In: Sigel A, Sigel H, editors. Iron transport and storage in plants, microorganism, and animals. Metal irons in biological systems, vol. 35. New York: Marcel Dekker, Inc.; 1998. p. 403e34. [4] Orino K, Eguchi K, Nakayama T, Yamamoto S, Watanabe K. Sequencing of cDNA clones that encode bovine ferritin H and L chains. Comp Biochem Physiol 118B 1997;3:667e73. [5] Laulhere JP, Lescure AM, Briat JF. Purification and characterization of ferritin from maize, pea, and soya bean seeds. Distribution in various pea organs. J Biol Chem 1988;263:10289e94. [6] Bevilacqua MA, Faniello MC, D’Agostino P, Quaresima B, Tiano MT, Pignata S, et al. Transcriptional activation of the H-ferritin gene in differentiated Caco-2 cells parallels a change in the activity of the nuclear factor Bdf. Biochem J 1995;311:769e73. [7] Bomford AB, Munro HN. Ferritin gene expression in health and malignancy. Pathobiology 1992;60:10e8.

M. De Zoysa, J. Lee / Fish & Shellfish Immunology 23 (2007) 624e635

635

[8] Ruggeri G, Iacobello C, Albertini A, Brocchi E, Levi S, Gabri E, et al. Studies of human isoferritns in tissues and body fluids. In: Albertini A, Arosio P, Chiancone E, Drysdale JW, editors. Ferritins and isoferritins as biochemical markers. Amsterdam: Elsevier; 1984. p. 67e78. [9] Aziz N, Munro HN. Iron regulates ferritin mRNA translation through a segment of its 5’ untranslation region. Proc Natl Acad Sci USA 1987;84:8478e82. [10] Torti SV, Kwak EL, Miller SC, Miller LL, Ringold GM, Myambo KB, et al. The molecular cloning and characterization of murine ferritin heavy chain, a tumor necrosis factor inducible gene. J Biol Chem 1988;263:12638e44. [11] Colucci-D’Amato LG, Ursini MV, Colletta G, Cirafici A, De Francisis V. Thyrotropin stimulates transcription from the ferritin heavy chain promoter. Biochem Biophys Res Commun 1989;165:506e11. [12] Yokomori N, Iwasa Y, Aida K, Inoue M, Tawata M, Onaya T. Transcriptional regulation of ferritin messenger ribonucleic acid levels by insulin in cultured rat glioma cells. Endocrinology 1991;128:1474e80. [13] Bevilacqua MA, Faniello MC, Russo T, Cimino F, Costanzo F. Transcriptional regulation of the human H-ferritin encoding gene (FERH) in G418-treated cells: role of the B-box-binding factor. Gene 1994;141:287e91. [14] Theil EC. Ferritin: structure, gene regulation and cellular function in animals, plants and microorganisms. Annu Rev Biochem 1987;56: 289e315. [15] Harrison PM, Arosio P. The ferritins: molecular properties, iron storage function and cellular regulation. Biochem Biophys Acta 1996;1275:161e203. [16] Von Darl M, Harrison PM, Bottke W. cDNA cloning and deduced amino acid sequence of two ferritins: Soma ferritin and yolk ferritin, from the snail Lymnaea stagnalis. L Eur J Biochem 1994;222:353e66. [17] Durand JP, Goudard F, Pieri J, Escoubas JM, Schreiber N, Cadoret JP. Crassostrea gigas ferritin: cDNA sequence analysis for two heavy chain type subunits and protein purification. Gene 2004;338:187e95. [18] Zhang Y, Meng Q, Jiang T, Wang H, Xie L, Zhang R. A novel ferritin subunit involved in shell formation from the pearl oyster (Pinctada fucata). Comp Biochem Physiol (B) 2003;135:43e54. [19] Kumar S, Tamura K, Nei M. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings Bioinform 2004;5:150e63. [20] Bradford MM. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 1976;72:248e51. [21] Decker EA, Welch B. Role of ferritin as a lipid oxidation catalyst in muscle foods. J Agric Food Chem 1990;38:674e7. [22] Dandekar T, Stripecke R, Gray NK, Goossen B, Constable A, Johanson HE, et al. Identification of a novel iron responsive element in murine and human erythroid gamma aminolevulinic acid synthase mRNA. EMBO J 1991;10:1903e9. [23] Klausner RD, Rouault TA, Harford JB. Regulating the fate of mRNA: the control of cellular iron metabolism. Cell 1993;72:19e28. [24] Waldo GS, Ling J, Sanders-Loehr J, Theil EC. Formation of an Fe(III)-tyrosinate complex during biomineralization of H-subunit ferritin. Science 1993;259:796e8. [25] Dickey LF, Sreedharan S, Theil EC, Didsbury JR, Wang YH, Kaufman RE. Differences in the regulation of messenger RNA for housekeeping and specialized-cell ferritin. A comparison of three distinct ferritin complementary DNAs, the corresponding subunits, and identification of the first processed in amphibia. J Biol Chem 1987;262:7901e7. [26] Andersen O, Dehli A, Standal H, Giskegjerde TA, Karstensen R, Rorvik KA. Two ferritin subunits of Atlantic salmon (Salmon salar): cloning of the liver cDNA and antibody preparation. Mol Mar Biol Biotechnol 1995;4:164e70. [27] Xie M, Hermann A, Richter K, Engel E, Kersch Baum HH. Nitric oxide up-regulates ferritin mRNA level in snail neurons. Eur J Neurosci 2001;13:1479e86. [28] Dietzel J, Hirzmann J, Preis D, Symmons P, Kunz W. Ferritins of Schistosoma mansoni: sequence comparison and expression in female and male worms. Mol Biochem Parasitol 1992;50:245e54. [29] Hentze MW, Kuhn LC. Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide and oxidative stress. Proc Natl Acad Sci USA 1996;93:8175e82. [30] Welch KD, Reilly CA, Aust SD. The role of cysteine residues in the oxidation of ferritin. Free Radic Biol Med 2002;33:399e408. [31] Hsieh SL, Chiu YC, Kuo CM. Molecular cloning and tissue distribution of ferritin in Pacific white shrimp (Litopenaeus vannamei). Fish Shellfish Immunol 2006;21:279e83. [32] Harrison PM, Hoy TG, Macara IG, Hoare RJ. Ferritin iron uptake and release. Structure function and relationships. Biochem J 1974;143:445e51. [33] Marigomez I, Soto M, Cajaraville MP, Angulo E, Giamberini L. Cellular and subcellular distribution of metals in mollusks. Microsc Res Tech 2002;56:358e92. [34] Zhang J, Li F, Wang Z, Zhang X, Zhou Q, Xiang J. Cloning, expression and identification of ferritin from Chinese shrimp, Fenneropenaeus chinensi. J Biotechnol 2006;125:173e84. [35] Beck G, Ellis TW, Habicht GS, Schluter SF, Marchalonis JJ. Evolution of the acute phase response: iron release by echinoderm (Asterias forbsei) coelomocytes, and cloning of an echinoderm ferritin molecule. Dev Comp Immunol 2002;26:11e26. [36] Orino K, Lehman L, Tsuji Y, Ayaki H, Torti SV, Torti FM. Ferritin and the response to oxidative stress. Biochem J 2001;357:241e7. [37] Le NT, Richardson DR. The role of iron in cell cycle progression and the proliferation of neoplastic cells. Biochim Biophys Acta 2002;1603:31e46. [38] Durand JP, Carvalho FP, Goudard F, Pieri J, Fowler SW, Cotret O. 210Po binding to metallothioneins and ferritin in the liver of teleost marine fish. Mar Ecol Prog Ser 1999;177:189e96. [39] Durand JP, Goudard F, Barbot C, Pieri J, Fowler SW, Cotret O. Ferritin and hemocyanin: 210Po molecular traps in marine fish oyster lobster. Mar Ecol Prog Ser 2002;233:199e205.